|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00501

1 Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1
3PS, UK
2 Polgen Division, Cyclacel, Babraham Bioincubator 405, Babraham Institute,
Babraham, Cambridgeshire CB2 4AT, UK
3 Department of Genetics, University of Cambridge, Downing Street, Cambridge,
CB2 3EH, UK
4 Department of Biological Sciences, The Open University, Walton Hall, Milton
Keynes, MK7 6AA, UK
* Present address: Skirball Institute, Developmental Genetics Program, New York
University Medical Center, 540 First Avenue, NY 10016, USA
Author for correspondence
(myles.axton{at}zoo.ox.ac.uk)
Accepted 14 March 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila melanogaster, Mitosis, DNA replication, Fertilization, Oogenesis, Protein phosphatase 1
| INTRODUCTION |
|---|
|
|
|---|
At fertilization, Cdks and their activators are present in excess in the
Drosophila embryo as a result of maternal provisioning. From mitotic
cycle 8, global Cyclin A and B levels oscillate, generating fluctuations in
Cdk1 activity (Edgar et al.,
1994
). However, prior to cycle 8 the global levels of Cyclin A and
B appear not to oscillate and global Cdk1 levels and activity, as measured by
histone H1 kinase levels and tyrosine phosphorylation status, are constant
(Edgar et al., 1994
). Recent
evidence suggests that Cyclin degradation and Cdk activity oscillation are
localised (Su et al., 1998
;
Huang and Raff, 1999
), which
may explain how syncytial nuclei are able to exit mitosis despite the presence
of high Cyclin levels and Cdk1 activity in the rest of the embryo.
plu, png and gnu are three genes required maternally to
inhibit DNA replication in the unfertilised egg and to couple S phase and
mitosis in the subsequent embryonic cleavage cycles
(Freeman et al., 1986
;
Freeman and Glover, 1987
;
Shamanski and Orr-Weaver,
1991
; Axton et al.,
1994
; Elfring et al.,
1997
; Fenger et al.,
2000
). Regardless of embryonic genotype, oocytes, eggs and embryos
derived from plu, png or gnu homozygous females will be
referred to here as plu, png or gnu oocytes, eggs or
embryos.
Pan gu and Plu co-immunoprecipitate from egg and embryo extracts suggesting
they act in a complex. However, the level of Plu is reduced in null
png mutants (Elfring et al.,
1997
) leaving open the possibility that Plu is a downstream
effector of Pan gu. The levels of the mitotic Cyclins A and B and Cdk1 kinase
activity are decreased in embryonic extracts mutant for png, gnu or
plu (Fenger et al.,
2000
) providing a link between the giant nuclei phenotype with
known cell cycle regulators. In addition, a genetic screen for png
genetic interactors identified enhancement by cyclin B. Experimental
restoration of Cyclin B levels in a png background was able to
restore polar body chromosome condensation, though the zygotic nuclei
eventually became polyploid (Lee et al.,
2001
). Thus Cyclin B is a critical, but probably not the sole,
target of png, plu and gnu action. Here we describe the
cloning of the gnu gene. We also describe an analysis of the
gnu over-replication phenotype and investigate gnu function
using epitope-tagged constructs.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DASH (Stratagene). The cosmids were in
NotBamNot CosPer vector (Tamkun et al.,
1992
P-element induced male recombination
gnu was mapped by P-element induced male recombination
(Chen et al., 1998
) relative to
Trls2325 (a P-element insertion verified by inverse PCR).
The gnu stock ru gnu kniri th pp
es / TM3 Sb has visible flanking markers ru and
kni[ri]. The source of transposase was Delta2-3 CyO. Six
independent recombinant chromosomes were recovered and all indicated that
gnu is proximal relative to Trls2325.
Transgenes
A 3.5 kb XbaI fragment from phage clone 23.13.3 was transferred
into the XbaI site of pCaSpeR4
(Sambrook et al., 1989
). This
comprised the complete ORF of CG5272, with 1.6 kb of 5' and 0.9 kb
3' sequence and the CG5258 (NHP2) coding region including the
stop codon but lacking the 3' UTR. This construct, inserted
(Spradling, 1986
) on the
second chromosome (F1I) and an independent insertion (M2A) restored fertility
to homozygous gnu females such that they produced fertile adult
progeny. The premature stop codon and SpeI site were introduced by
site-directed mutagenesis using the QuikChangeTM (Stratagene)
strategy with the primers CTGAGGCAGGAGGAATACTAGTTGAAAAGTGCGCG and
CGCGCACTTTTCAACTAGTATTCCTCCTGCCTCAG. The mutated fragment was cloned into
EcoRI/XbaI-cut pCaSpeR4. This construct inserted on the
second chromosome (stock GS3A) and independent insertion (GS2B) did not rescue
the sterility of homozygous gnu females. The eggs laid by such
females failed to undergo any normal cleavage cycles and all developed giant
nuclei.
Production of GFP-taggedgnuconstructs
The 3.5 kb XbaI fragment in pBluescript SK was treated to remove
the downstream CG5258 (NHP2) gene and destroy a vector BamHI
site, by PmeI/BamHI digestion, end filling and re-ligation.
A gnu 3' BamHI site was created by site-directed
mutagenesis with the primers GCCAAGCAATTCTTCGGATCCTATATCCTGTAGG and
CCTACAGGATATAGGATCCGAAGAATTGCTTGGC. Enhanced GFP
(Cormack et al., 1996
) was
amplified using the restriction site-tagged primers
CGGGATCCAAAGGAGAAGAACTTTTCACTG and CGGGATCCTATTTGTATAGTTCATCCATGC and inserted
into the new gnu 3' BamHI site. The entire insert was
amplified by PCR using the restriction enzyme-tagged primers
GCTCTAGAGCTCAGCTGTTTCTTAGCC and GGAATTCAAGCATACTAGCGTGCCGC and the product was
inserted into EcoRI/XbaI-digested pCaSpeR4 to create a
genomic gnu-GFP construct. This construct, inserted on the second
chromosome, restored fertility to homozygous gnu females (GG4c). Eggs
laid by such females hatched and produced fertile adults. The rescue was
complete since no giant nuclei were observed in unfertilised eggs or
fertilised embryos from homozygous gnu females with the
construct.
For Gnu-GFP mis-expression, a UASp gnu-GFP construct was produced
by PCR using the restriction-tagged primers
AAGGAAAAAAGCGGCCGCATTATTTGTAAAATTACCG and GCTCTAGAGGATCCTATTTGTATAGTTC and the
genomic gnu-GFP construct as a template. The fragment was subcloned
into NotI/XbaI-cut pSK. The fragment was excised and
inserted into NotI/XbaI-cut UASp
(Rørth, 1998
). The
inserts of all transformation constructs were sequenced in their entirety and
no coding changes were found.
Embryo and ovary fixation, staining and microscopy
Protocols were from Sullivan et al.
(Sullivan et al., 2000
).
Pictures were taken using an Eclipse 800 microscope (Nikon) with a MRC
Radiance Plus laser scanning confocal system (Biorad) and LaserSharp software
(Biorad) or a Nikon Optiphot attached to the BioRad MRC600 confocal microscope
head. A Kahlman-averaging filter was used to reduce background. Our
observations of GFP fluorescence are significant, since they were compared
with identically-fixed oocytes and embryos not containing the gnu-GFP
transgene and imaged with identical confocal settings.
DNA was stained with propidium iodide, primary antibodies used were YL1/2
rat IgG anti-alpha tubulin 1 µg/µl (Serotec Ltd) used at 1:500 dilution;
T47 mouse monoclonal anti-lamin (Frasch et
al., 1986
), rabbit polyclonal against Drosophila PCNA
antigen (Ng et al., 1990
)
1:500; mouse monoclonal anti-bromodeoxyuridine (BrdU: Becton Dickinson).
Secondary antibodies (Jackson) used were fluorescein (FITC)-conjugated
AffiniPure F(ab')2 fragment donkey anti-rat IgG (H+L) minimal
cross reaction diluted to 1:400, the equivalent FITC anti-rabbit was used for
PCNA, FITC anti-mouse for lamin and BrdU. For
Fig. 1D, embryos were treated
with 0.5 mg/ml BrdU in Schneider's Drosophila medium for 5
minutes.
|
| RESULTS |
|---|
|
|
|---|
processivity factor, PCNA (Yamaguchi et
al., 1991When BrdU incorporation was used to detect DNA replication in gnu embryos, some, but not all, of the giant nuclei incorporated BrdU (Fig. 1C,D). Taken together, the results from these cell cycle markers suggest that some nuclei were in S phase whilst others in the same embryo were not and that DNA replication in gnu embryos is cyclic or of limited duration.
It was previously reported that, in gnu eggs and embryos, the
nuclei neither condense chromosomes nor divide but the centrosomes replicate
and organise asters apparently normally
(Freeman and Glover, 1987
). We
examined microtubule asters in gnu eggs and embryos by staining with
an antibody against tubulin. We found that asters were indeed initiated in
gnu embryos in a regular array throughout the embryos, but that, in
unfertilised eggs, the tubulin coated the giant nuclei and no asters were
observed (Fig. 1E,F).
Gnu is a small novel protein
gnu lies between the distal breakpoint of Df(3L)fzD21 at
70E5-6 and the distal breakpoint of Df(3L)BrdR15 at 71A1-2.
Microdissected clones of polytene chromosome DNA
(Saunders, 1990
) from the
region were used as starting points to construct a genomic walk. By sequencing
the ends of the inserts of phage and cosmid clones, we anchored the walk to
the sequence of the Drosophila genome
(Adams et al., 2000
).
gnu was mapped proximal to Trl by P-element-induced male
recombination, placing gnu within a region of 131 kb and 10 predicted
genes between Trl and the distal breakpoint of Df(3L)BrdR15.
Sequencing genes from the gnu chromosome in this region revealed a C
to T mutation in gene CG5272 resulting in a premature stop codon
(Fig. 2). This mutation was not
present on other lines (fs(3)131-19 and fs(3)135-17,
Tübingen stock centre) made in the same mutagenesis screen as
gnu (data not shown).
|
cDNAs GM10421 and LD12084, corresponding to ESTs in the BDGP database (http://www.fruitfly.org) that matched CG5272 were sequenced, confirming that gnu is a small gene with a single intron encoding a 240 amino acid protein with a predicted molecular mass of 27 kDa (Fig. 2). The premature stop codon in gnu mutants would produce a truncated protein lacking the C-terminal 94 residues. The deduced Gnu sequence was used to search the protein databases. No close matches were found, therefore Gnu is a novel protein.
Gnu is specific for early development
Rabbit anti-Gnu antiserum Rb86, raised against a synthetic peptide
comprising aa117-131 is specific for Gnu and for Gnu-GFP but does not
recognise a truncated product of the gnu mutant
(Fig. 3A). The expression
profile of a functional Gnu-GFP fusion protein under the control of the
gnu promoter was examined by immunoblotting and detection with a
monoclonal antibody against GFP. Gnu-GFP was expressed in ovaries and 0- to
3-hour embryos (Fig. 3A,B) and
in unfertilised eggs, but not in larval tissues or in adult testes (not
shown). The epitope-tagged protein had very similar expression to native Gnu
detected with an anti-peptide antiserum, but had a somewhat longer half-life
in cleavage embryos. We did not detect Gnu in embryos more than 1 hour after
egg deposition (Fig. 3B), in
larvae or in adult testes (not shown). The mobility of Gnu and of Gnu-GFP from
ovaries was slower than from unfertilised eggs or embryos suggesting Gnu is
post-translationally modified. The mobility of the embryonic isoform matched
the predicted size of the fusion protein (54 kDa). GFP mobility in extracts
from ovaries and embryos from a ubiquitin-driven GFP line were
identical (data not shown), therefore it is only the Gnu moiety of Gnu-GFP
that is modified.
|
To determine the developmental time-point at which Gnu dephosphorylation
occurs, we crossed the genomic gnu-GFP transgene into mutant
backgrounds that cause the oocyte to arrest development during meiosis
[cortex and grauzone
(Page and Orr-Weaver, 1996
)],
or immediately following meiosis but prior to the first zygotic mitosis
[deadhead (Pellicena-Palle et
al., 1997
)]. Gnu-GFP mobility in ovaries and eggs in these mutant
backgrounds was indistinguishable from wild-type
(Fig. 3D) indicating that Gnu
is dephosphorylated before meiotic arrest induced by cortex and
grauzone, most likely at egg activation.
Gnu accumulates in oocytes of stage 11 egg chambers and is
cytoplasmic in eggs and embryos
In ovaries, Gnu-GFP was first observed in fixed oocytes of stage 11 egg
chambers (Fig. 4A). In
subsequent stages it accumulated in the oocyte but was not observed in nurse
cells (Fig. 4B). In eggs,
Gnu-GFP was cytoplasmic and showed no association with the replicatively
inactive polar body chromosomes (Fig.
4C,D). In syncytial embryos Gnu-GFP was again cytoplasmic at all
stages of the cell cycle. Although the nuclear envelope stains somewhat more
distinctly, Gnu is neither strongly localised within, nor excluded from
zygotic nuclei (Fig. 4E,F).
|
Gnu mis-expression in the ovarian germline results in sterility
We mis-expressed Gnu-GFP in Drosophila ovaries using the UAS-GAL4
system (Rørth, 1998
;
Brand and Perrimon, 1993
).
Females containing the maternal alpha4tubulin>GAL4:VP16 driver and
UASp gnu-GFP (see Materials and Methods) were sterile and did not lay
eggs. Staining of their ovaries revealed Gnu-GFP was expressed from stage 5
onwards (Fig. 5A). Egg chambers
up to stages 8-10 had wild-type morphology. However subsequent stages were
characterised by large amounts of irregularly localised, often fragmented,
chromatin resulting from the degeneration of nurse cell nuclei. No stage 14
egg chambers could be distinguished. Suprisingly, given that Gnu-GFP,
expressed from its own promoter, was unlocalised in embryos, mis-expressed
Gnu-GFP was exclusively nuclear in nurse cells
(Fig. 5D-F).
|
We compared the mobility of ectopic Gnu-GFP from ovaries to that of Gnu-GFP from ovaries expressing the genomic construct. Mis-expressed Gnu-GFP from ovaries was identical to the dephosphorylated embryonic form (Fig. 5G). Thus nurse cells do not phosphorylate Gnu, suggesting that the Gnu kinase activity is restricted to the oocyte.
To test whether the sterility associated with Gnu mis-expression was a consequence of Gnu alone, we mis-expressed Gnu in ovaries in a png mutant background. Females homozygous for png1058 and containing the maternal alpha4tubulin>GAL4:VP16 and UASp gnu-GFP constructs laid eggs (Table 1). Staining of their ovaries revealed they were morphologically normal with no abnormal egg chambers or fragmented DNA (Fig. 5C). The egg laying rates for such females were similar to wild type (Table 1) indicating that the restoration of ovarian function was complete. The eggs did not hatch but, when stained for chromatin, exhibited a giant nuclei phenotype identical to that in Fig. 4G-I, typical of png embryos. The earliest mis-expression and amount of Gnu-GFP fluorescence in a png background was the same as in a wild-type background indicating that the restoration of ovary function is not caused by an effect of png on Gnu-GFP mis-expression levels or timing. The effect of a homozygous null plu mutation in combination with Gnu-GFP mis-expression was indistinguishable from that of the null png mutation (Table 1).
|
|
| DISCUSSION |
|---|
|
|
|---|
Gnu phosphorylation
We deduce from its mobility shift on immunoblots that Gnu is phosphorylated
before it is needed in oocytes, is dephosphorylated upon egg activation, and
that this phosphorylation is independent of Pan gu protein kinase activity. A
specific inhibitor of PP1, I-2, stabilised phosphorylated Gnu in vitro,
implicating PP1 as the relevant phosphatase. Drosophila contains four
PP1 genes of which PP1 87B provides 80% of total PP1 activity
(Dombrádi et al., 1989
)
and is required for mitotic progression
(Axton et al., 1990
), though
none have previously been ascribed a role in egg activation or
fertilisation.
PP1 87B and PP2A28D mutations genetically suppress a weak
png allele (Lee et al.,
2001
) However, these data are not consistent with our finding that
PP1 activates Gnu. If unphosphorylated embryonic Gnu is the active form and
Gnu and Pan gu act in the same pathway, then reducing the dose of the
activating phosphatase should enhance a png phenotype. It may be that
these phosphatases oppose png action directly by dephosphorylating
the Pan gu substrate (Lee et al.,
2001
) or that they are the cell cycle regulators targeted by Gnu,
Plu and PnP as discussed below.
Gain-of-function phenotype
Gnu mis-expression using the UAS-Gal4 system
(Rørth, 1998
) in
Drosophila ovaries resulted in sterility due to an inability to lay
eggs. Dissection of the ovaries revealed that early oogenesis was unaffected.
Gnu was expressed in egg chambers from stage 5 onwards and was localised
solely to the nurse cell nuclei. No normal egg chambers could be discerned at
stage 10 or later when gross aberrations in the organisation of the actin
cytoskeleton resulted in failure to transfer nurse cell cytoplasm into the
oocyte. Gnu mobility from such ovaries was identical to the dephosphorylated
form suggesting that the protein kinase that phosphorylates Gnu is not present
or active in the nurse cells.
Since gnu, plu and png mutations have the same phenotype, we were previously unable to determine whether the gene products act in series or in parallel. Here we have used the dominant ovarian phenotype resulting from Gnu mis-expression to investigate the epistasis of gnu, png and plu. Loss of png or plu function blocked the ovarian phenotype caused by Gnu mis-expression. This result implies that ectopic Gnu destroys egg chambers only through Pan gu and Plu. It is therefore likely that wild-type Gnu function in the egg and embryo also requires Pan gu. Although Gnu-GFP is more obviously excluded from the larger png giant nuclei (Fig. 4H) than from zygotic nuclei (Fig. 4E) we do not favour the explanation that Gnu requires Pan gu for nuclear localisation. Firstly, Gnu-GFP is not specifically nuclear in wild-type embryos (Fig. 4E) and secondly, in a png null ovary, ectopic Gnu-GFP is able to concentrate in the polyploid nurse cell nuclei (Fig. 6C). The remaining possibilities are that Gnu acts upstream of Pan gu and Plu or that it acts in a complex with Pan gu and Plu.
We have mis-expressed Gnu in polytene salivary glands and ovarian follicle
cells (data not shown). In both cases Gnu was exclusively nuclear, but its
expression had no obvious effect on tissue morphology. However, not all nurse
cell nuclei in an egg chamber contained Gnu-GFP, suggesting that that the
presence of Gnu-GFP reflects the transcriptional activity of the nucleus or
depends upon its cell cycle status. Why is Gnu nuclear in polytene cells and
cytoplasmic in the diploid syncytial blastoderm and larval neuroblasts (data
not shown)? Gnu contains no obvious nuclear import sequence, suggesting that
Gnu binds a factor that is cytoplasmic in eggs and embryos (including those
with giant nuclei; Fig. 4H),
and nuclear in polytene tissues. Polytene and diploid tissues have different
Cyclin profiles. Embryos are replete with maternal Cyclins A, B and E whereas
polytene tissues have no Cyclin A or B
(Lehner and O'Farrell, 1989
;
Lehner and O'Farrell, 1990
;
Richardson et al., 1993
) and
Cyclin E is expressed periodically in nurse cell nuclei and constantly in the
germinal vesicle (Lilly and Spradling,
1996
). Our observations fit the Cyclin E pattern, ectopic Gnu was
not present in all nurse or follicle cell nuclei and was concentrated in
germinal vesicles.
Downstream targets of giant nuclei genes
The DNA replication in gnu embryos resembles the endoreduplication
observed in Drosophila ovarian nurse cells and larval salivary glands
and this raises the question of how the normal mechanisms that license DNA
replication once per cell cycle are subverted in gnu embryos. In
yeast, Cdk1 activity, modulated by Cyclin levels, is responsible for resetting
replication origins (Hayles et al.,
1994
) raising the possibility that over-replication in
gnu embryos may result from inappropriate Cdk1 activity. Indeed, in
gnu, plu or png embryos, levels of Cyclin A and B proteins
and Cdk1 activity are reduced (Fenger et
al., 2000
). Restored Cyclin B levels can suppress a weak
png mutation (Lee et al.,
2001
).
Several features of early Drosophila embryogenesis may have
necessitated the evolution of these specialised regulators of the cell cycle.
Firstly, distinct cell cycle fates befall the polar body and zygotic nuclei
within a common cytoplasm. Secondly, many cell cycle regulators are in excess,
so that the first 13 cycles are rapid and lack G1 or G2
phases, but S and M phases must alternate accurately. Finally, correct cell
cycle regulation is achieved by a small subset of the available cell cycle
control proteins (e.g. Cyclins A and B)
(Edgar et al., 1994
). In this
context, Gnu, Plu and Pan gu act coordinately to ensure that the cell cycle
oscillations experienced by the nuclei are temporally and locally apt.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A.
Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A.,
Galle, R. F. et al. (2000). The genome sequence of
Drosophila melanogaster. Science
287,2185
-2195.
Axton, J. M., Dombrádi, V., Cohen, P. T. W. and Glover,
D. M. (1990). One of the Protein Phosphatase-1 isoenzymes in
Drosophila is essential for mitosis. Cell
63, 33-46.[CrossRef][Medline]
Axton, J. M., Shamanski, F., Young, L., Henderson, D., Boyd, J.
and Orr-Weaver, T. (1994). The inhibitor of DNA replication
encoded by the Drosophila gene plutonium is a small, ankyrin
repeat protein. EMBO J.
13,462
-470.[Medline]
Bennett, D., Szöór, B. and Alphey, L.
(1999). The chaperone-like properties of mammalian inhibitor-2
are conserved in a Drosophila homologue.
Biochemistry 38,16276
-16282.[CrossRef][Medline]
Brand, A. H. and Perrimon, N. (1993). Targeted
gene expression as a means of altering cell fates and generating dominant
phenotypes. Development
118,401
-415.[Abstract]
Chen, B., Chu, T., Harms, E., Gergen, J. and Strickland, S.
(1998). Mapping of Drosophila mutations using
site-specific male recombination. Genetics
149,157
-163.
Cooley, L. Verheyen, E. and Ayers, K. (1992).
chickadee encodes a Profilin required for intercellular cytoplasm
transport during Drosophila oogenesis. Cell
69,173
-184.[CrossRef][Medline]
Cormack, B. P., Valdivia, R. H. and Falkow, S.
(1996). FACS-optimized mutants of the green fluorescent protein
GFP. Gene 173,33
-38.[CrossRef][Medline]
Dombrádi, V., Axton, J. M., Glover, D. M. and Cohen, P.
T. W. (1989). Cloning and chromosomal localization of
Drosophila cDNA encoding the catalytic subunit of protein
phosphatase-1-alpha: high conservation between mammalian and insect sequences.
Eur. J. Biochem. 183,603
-610.[Medline]
Edgar, B., Sprenger, F., Duronio, R., Leopold, P. and O'Farrell,
P. (1994). Distinct molecular mechanisms regulate cell-cycle
timing at successive stages of Drosophila embryogenesis.
Genes Dev. 8,440
-452.
Elfring, L., Axton, J., Fenger, D., Page, A., Carminati, J. and
Orr-Weaver, T. (1997). Drosophila Plutonium protein
is a specialized cell cycle regulator required at the onset of embryogenesis.
Mol. Biol. Cell 8,583
-593.[Abstract]
Fenger, D. D., Carminati, J. L., Burney-Sigman, D. L.,
Kashevsky, H., Dines, J. L., Elfring, L. K., Orr-Weaver, T. L
(2000). PAN GU: a protein kinase that inhibits S phase and
promotes mitosis in early Drosophila development.
Development 127,4763
-4774.[Abstract]
Frasch, M., Glover, D. M. and Saumweber, H.
(1986). Nuclear antigens follow different pathways into daughter
nuclei during mitosis in early Drosophila embryos. J. Cell
Sci. 82,155
-172.[Abstract]
Freeman, M. and Glover, D. (1987). The
gnu mutation of Drosophila causes inappropriate DNA
synthesis in unfertilized and fertilized eggs. Genes
Dev. 1,924
-930.
Freeman, M., Nüsslein-Volhard, C. and Glover, D.
(1986). The dissociation of nuclear and centrosomal division in
gnu, a mutation causing giant nuclei in Drosophila.Cell 46,457
-468.[CrossRef][Medline]
Hayles, J. Fisher, D., Woollard, A. and Nurse, P.
(1994). Temporal order of S-phase and mitosis in fission yeast is
determined by the state of the p34cdc2 mitotic B-cyclin complex.
Cell 78,813
-822.[CrossRef][Medline]
Heifetz, Y., Yu, J. and Wolfner, M. F. (2001).
Ovulation triggers activation of Drosophila oocytes. Dev.
Biol. 234,416
-424.[CrossRef][Medline]
Huang, J. and Raff, J. (1999). The
disappearance of cyclin B at the end of mitosis is regulated spatially in
Drosophila cells. EMBO J.
18,2184
-2195.[CrossRef][Medline]
Jang, J. K., Messina, L., Erdman, M. B., Arbel, T. and Hawley,
R. S. (1995). Induction of metaphase arrest in
Drosophila oocytes by chiasmabased kinetochore tension.
Science 268,1917
-1919.
Lee, L. A., Elfring, L. K., Bosco, G. and Orr-Weaver, T. L.
(2001). A genetic screen for suppressors and enhancers of the
Drosophila PAN GU cell cycle kinase identifies cyclin B as a target.
Genetics 158,1545
-1556.
Lehner, C. F. and O'Farrell, P. H. (1989).
Expression and function of Drosophila cyclin-A during embryonic-cell
cycle progression. Cell
56,957
-968.[CrossRef][Medline]
Lehner, C. F. and O'Farrell, P. H. (1990).The
roles of Drosophila cyclin-A and cyclin-B in mitotic control.
Cell 61,535
-547.[CrossRef][Medline]
Lilly, M. A. and Spradling, A. C. (1996).The
Drosophila endocycle is controlled by cyclin E and lacks a checkpoint
ensuring S-phase completion. Genes Dev.
10,2514
-2526.
Lindsley, D. L. and Zimm, G. G. (1992). The
Genome of Drosophila melanogaster. London: Academic Press.
Mackintosh, C. and Mackintosh, R. W. (1994).
Inhibitors of protein kinases and phosphatases. Trends Biochem.
Sci. 19,444
-448.[CrossRef][Medline]
Ng, L., Prelich, G., Anderson, C. W., Stillman, B. and Fisher,
P. A. (1990) Drosophila proliferating cell nuclear
antigen structural and functional homology with its mammalian
counterpart. J. Biol. Chem.
265,11948
-11954.
Page, A. and Orr-Weaver, T. (1996). The
Drosophila genes grauzone and cortex are necessary
for proper female meiosis. J. Cell Sci.
109,1707
-1715.[Abstract]
Pellicena-Palle, A., Stitzinger, S. M. and Salz, H. K.
(1997). The function of the Drosophila thioredoxin
homologue encoded by the deadhead gene is redox-dependent and blocks the
initiation of development but not DNA synthesis. Mech.
Dev. 62,61
-65.[CrossRef][Medline]
Richardson, H., O'Keefe, L., Reed, S. and Saint, R.
(1993). A Drosophila G1-specific cyclinE homolog
exhibits different modes of expression during embryogenesis.
Development 119,673
-690.
Roberts, D. B. and Standen, G. N. (1998). In
Drosophila: A Practical Approach, 2nd edition
(ed. D. B. Roberts), pp. 1-54. Oxford: IRL
Press.
Rørth, P. (1998). Ga14 in the
Drosophila female germline. Mech. Dev.
78,113
-118.[CrossRef][Medline]
Sagata, N. (1996). Meiotic metaphase arrest in
animal oocytes its mechanisms and biological significance.
Trends Cell Biol. 6,22
-28.[CrossRef][Medline]
Sambrook, J, Fritsch, E. F. and Maniatis, T.
(1989). DNA Cloning, Laboratory Manual.
Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Saunders, R. D. C. (1990). Short cuts for
genomic walking chromosome microdissection and the polymerase
chain-reaction. BioEssays
12,245
-248.[CrossRef][Medline]
Shamanski, F. and Orr-Weaver, T. (1991). The
Drosophila plutonium and pan gu genes regulate entry into
S-phase at fertilization. Cell
66,1289
-1300.[CrossRef][Medline]
Siden-Kiamos, I., Saunders, R. D. C., Spanos, L., Majerus,T.,
Treanear, J., Savakis, C., Louis, C., Glover, D. M., Ashburner, M. and
Kafatos, F. C. (1990). Towards a physical map of the
Drosophila melanogaster genome: mapping of cosmid clones within
defined genomic divisions. Nucleic Acids Res.
18,6261
-6270.
Spradling, A. C. (1986). P-element-mediated
transformation. In Drosophila, A Practical Approach
(ed. D. B. Roberts), pp. 175-197. Oxford: IRL
Press.
Su, T., Sprenger, F., DiGregorio, P., Campbell, S. and
O'Farrell, P. (1998). Exit from mitosis in
Drosophila syncytial embryos requires proteolysis and cyclin
degradation and is associated with localized dephosphorylation.
Genes Dev. 12,1495
-1503.
Sullivan, W., Ashburner, M. and Hawley, R. S.
(2000). Drosophila Protocols. Cold Spring
Harbor, NY: Cold Spring Harbor Laboratory Press.
Tamkun, J. W., Deuring, R., Scott, M. P., Kissinger, M.,
Pattatucci, A. M., Kaufman, T. C., Kennison, J. A. (1992).
Brahma a regulator of Drosophila homeotic genes structurally
related to the yeast transcriptional activator Snf2 Sw12.
Cell 68,561
-572.[CrossRef][Medline]
Yamaguchi, M., Hirose, F., Nishida, Y. and Matsukage, A.
(1991). Repression of the Drosophila proliferating-cell
nuclear antigen gene promoter by Zerknullt protein. Mol. Cell.
Biol. 11,4909
-4917.
This article has been cited by other articles:
![]() |
L. Vardy, J. A. Pesin, and T. L. Orr-Weaver Regulation of Cyclin A protein in meiosis and early embryogenesis PNAS, February 10, 2009; 106(6): 1838 - 1843. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Rickmyre, S. DasGupta, D. L.-Y. Ooi, J. Keel, E. Lee, M. W. Kirschner, S. Waddell, and L. A. Lee The Drosophila homolog of MCPH1, a human microcephaly gene, is required for genomic stability in the early embryo J. Cell Sci., October 15, 2007; 120(20): 3565 - 3577. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-H. Zhang, J. M. Axton, J. Drinjakovic, L. Lorenz, H. White-Cooper, and A. D. Renault Spatial and temporal control of mitotic cyclins by the Gnu regulator of embryonic mitosis in Drosophila J. Cell Sci., July 15, 2004; 117(16): 3571 - 3578. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Lee, D. Van Hoewyk, and T. L. Orr-Weaver The Drosophila cell cycle kinase PAN GU forms an active complex with PLUTONIUM and GNU to regulate embryonic divisions Genes & Dev., December 1, 2003; 17(23): 2979 - 2991. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||