|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00517
Department of Molecular, Cellular and Developmental Biology, University of Michigan, Ann Arbor, MI 48109, USA
* Author for correspondence (e-mail: rolf{at}umich.edu)
Accepted 31 March 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, Heart, Cardiogenesis, Mesoderm, pannier, u-shaped, tinman, dpp, Gata factors
| INTRODUCTION |
|---|
|
|
|---|
There are striking molecular and developmental similarities between
vertebrate and Drosophila heart development
(Bodmer, 1995
;
Bodmer and Venkatesh, 1998
;
Bodmer and Frasch, 1999
).
Developmentally, both vertebrate and Drosophila hearts are formed
from bilaterally symmetrical rows of mesodermal cells, which will eventually
migrate to the midline, where they will fuse to form a linear heart tube. More
importantly, tin and dpp, two factors that determine the
initial formation of the Drosophila heart, also have vertebrate
counterparts (Nkx2.5 and Bmp2/4, respectively) with a similar function in
cardiogenesis (Harvey, 1996
;
Schultheiss et al., 1997
). In
contrast to Drosophila, canonical Wnt signaling in vertebrates needs
to be prevented for promoting heart formation in the anterior lateral plate
mesoderm (Schneider and Mercola,
2001
; Marvin et al.,
2001
). However, the non-canonical Wnt pathway is required for
heart formation in vertebrates (Pandur et
al., 2002
).
Six Gata transcription factors have been identified in vertebrates,
characterized by two conserved DNA-binding zinc fingers
(Evans and Felsenfeld, 1989
;
Tsai et al., 1989
;
Yamamoto et al., 1990
).
Gata1, Gata2 and Gata3 are largely expressed in hematopoietic stem cells
(reviewed by Orkin, 1998
), and
Gata4, Gata5 and Gata6 are expressed in several mesoderm- and endoderm-derived
tissues, including the developing heart
(Arceci et al., 1993
;
Kelley et al., 1993
;
Heikinheimo et al., 1994
;
Laverriere et al., 1994
;
Jiang and Evans, 1996
;
Morrisey et al., 1996
), where
they are thought to regulate cardiac-specific genes
(Grepin et al., 1994
;
Ip et al., 1994
;
Durocher et al., 1997
;
Murphy et al., 1997
) (reviewed
by Molkentin, 2000
). Gata4 is
already expressed in the early cardiac crescent of the lateral plate mesoderm,
and in mice deficient for Gata4, these heart primordia fail to migrate towards
the midline where they normally fuse into the primitive heart tube
(Molkentin et al., 1997
;
Kuo et al., 1997
). Owing to
these ventral closure defects, it has been difficult to discriminate between a
direct role for Gata4 in heart formation and an indirect involvement via its
function in ventral morphogenesis. Furthermore, Gata4, Gata5 and Gata6 may act
in part redundantly, which may further occlude their cardiogenic potential.
Consistent with the direct involvement of Gata4 in heart development is the
congenital heart disease phenotype observed in individuals heterozygous for
deletions of chromosome 8p23.1 region, which includes the GATA4 gene
(Pehlivan et al., 1999
;
Bhatia et al., 1999
).
In vitro, Gata4 interacts with a wide array of proteins, including the
Tinman homolog Nkx2.5, the bHLH protein Hand and the multiple zinc-finger
protein Fog2 (Durocher et al.,
1997
; Sepulveda et al.,
1998
; Lee et al.,
1998
; Lu et al.,
1999
; Sepulveda et al.,
2002
; Svensson et al.,
1999
; Tevosian et al.,
1999
; Dai et al.,
2002
). Fog2 apparently modulates Gata-mediated transcriptional
regulation not only as a repressor, but also as an activator, depending on the
promoter and on cell type (Lu et al.,
1999
). Fog2 is co-expressed with Gata4 in embryonic and adult
cardiomyocytes, and Fog2-deficient mice exhibit severe developmental heart
defects, suggesting a direct cardiogenic requirement
(Tevosian et al., 2000
;
Svensson et al., 2000
).
Moreover, these heart defects are rescued by cardiac-specific transgenic
expression of Fog2, providing strong evidence for a cardiac autonomous
function (Tevosian et al.,
2000
).
The three Gata factors found in Drosophila (pannier,
serpent and grain) also play important developmental roles
(Abel et al., 1993
;
Ramain et al., 1993
;
Winick et al., 1993
;
Lin et al., 1995
;
Heitzler et al., 1996
;
Rehorn et al., 1996
;
Sam et al., 1996
;
Riechmann et al., 1998
;
Gajewski et al., 1999
;
Brown and Castelli-Gair Hombria,
2000
; Calleja et al.,
2000
; Herranz and Morata,
2001
). serpent is required for endodermal gut
development, mesodermal fat body formation and hematopoiesis. grain
is involved in filzkorper and head skeleton morphogenesis. pannier
(pnr) is best known for its requirement during embryonic and adult
dorsal closure, and for dorsomedial patterning. The Drosophila
counterpart of Fog2, U-shaped (Ush), can physically interact with Pnr, and (as
with Gata4 and Fog2) this interaction is mediated by the N-terminal zinc
finger of Pnr, which is thought to antagonize the role of Pnr as a
transcriptional activator (Haenlin et al.,
1997
; Cubadda et al.,
1997
). At blastoderm, pnr and ush are expressed
in response to the dorsal morphogen encoded by dpp
(Winick et al., 1993
;
Jazwinska et al., 1999
;
Ashe et al., 2000
), and are
thought to be part of the process that subdivides the dorsal ectoderm
(Herranz and Morata,
2001
).
It has been proposed that pnr promotes myocardial as opposed to
pericardial cell fates within the cardiac mesoderm
(Gajewski et al., 1999
;
Gajewski et al., 2001
) and
that ush antagonizes this function
(Fossett et al., 2000
;
Fossett et al., 2001
). Recent
lineage studies, however, have indicated that some heart progenitors give rise
to mixed myocardial/pericardial progeny, but others do not
(Park et al., 1998
;
Ward and Skeath, 2000
;
Han and Bodmer, 2003
;
Alvarez et al., 2003
), raising
the question of how pnr functions in different heart progenitor
populations. We have re-examined the cardiogenic role of these two genes. We
find that pnr is required for formation of all
tin-expressing cardiac progenitors, and loss of pnr function
results in loss of both myocardial and pericardial cell populations. By
contrast, loss of ush function did not affect the initial expression
of tin in the cardiac mesoderm, but is required for its maintenance
of expression as well as for the correct differentiation of both myocardial
and pericardial cells. Moreover, specific aspects of early cardiac
differentiation were preferentially affected: most of the seven-up
(svp)-expressing cells were absent in both mutants, more
ladybird (lbe)-expressing cells were absent in pnr
than in ush mutants, and the heart cells expressing
even-skipped (eve) were only moderately affected in
pnr and virtually not at all in ush mutants. Overexpression
of pnr in the entire mesoderm produces ectopic tin
expression, which is strongly antagonized by co-overexpression of
ush, suggesting a dual role for ush: one that is necessary
for cardiogenesis and another that counteracts pnr function. The
heart phenotype of either mutant is rescued by mesoderm-specific expression of
wild-type pnr or ush cDNA, respectively; and mesodermal
expression of a dominant-negative form of pnr (pnrEnR)
mimics the heart defects of pnr mutants when expressed in the
mesoderm. Interestingly, dorsal ectodermal dpp expression fades after
germband retraction in pnr mutants and cardiac differentiation is
also compromised when pnrEnR is overexpressed in the ectoderm.
Moreover, mesoderm-specific expression of brinker (brk), a
repressor of dpp target genes
(Jazwinska et al., 1999
;
Zhang et al., 2001
), has a
similar phenotype as pnr mutants or mesodermal pnrEnR
expression, suggesting that pnr may be mediating, at least in part,
the cardiogenic dpp signal in the mesoderm. Thus, we propose a dual
role for pnr in heart development: (1) pnr functions as a
mesodermal target and mediator of the ectodermally derived dpp signal
by acting in concert with tinman; and (2) pnr is also
required in the ectoderm for maintaining dorsal stripe dpp
expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
All crosses were performed at 29°C. Combinations of transgene insertions were generated using standard genetic crosses. Oregon-R was used as the wild-type reference strain.
Dominant-negative Pannier
The dominant-negative pnr (UAS-pnrEnR) was constructed
according to the strategy described by Fu et al.
(Fu et al., 1998
). Basically
the construct contains the repressor domain from engrailed (EnR,
amino acid 2-298) (Jaynes and O'Farrell,
1991
; Smith and Jaynes,
1996
; Tolkunova et al.,
1998
) and the two N-terminal zinc-finger domains from pnr
(amino acid 153-293) (Ramain et al.,
1993
). The pnr zinc-finger domains were PCR amplified
from the full-length pnr cDNA (5' primer,
CATCTCGAGATGCAGTTCTACTCGCCAAACGCC; 3'primer,
GCTCTAGACTACCTCCAAAGTGGAGCCTGTTC) and inserted into XhoI-
and XbaI-digested pUAST vector already containing the EnR domain
(Fu et al., 1998
;
Han et al., 2002
). Transgenic
flies were generated as previously described
(Brand and Perrimon,
1993
).
Immunohistochemistry and in situ hybridization
Immunohistochemistry and in situ hybridization were performed as described
(Wu et al., 1995
), except
that Cy3- or FITC-conjugated secondary antibodies (The Jackson Laboratory)
were used for fluorescent confocal microscopy. Fluorescent in situ double
labeling was performed as described (Knirr
et al., 1999
). For Lbe staining the TSA Plus Fluorescence System
was used (Perkin Elmer). Embryos were mounted in VectaShield (Vector
Laboratories). Fluorescent embryo staining was analyzed by using a Zeiss
LSM510 confocal microscope. Primary antibodies were used at the following
dilutions: rabbit anti-Eve, 1:300 (Frasch
et al., 1987
); mouse anti-PC 1:10
(Yarnitzky and Volk, 1995
);
mouse anti-Lbe 1:40 (Jagla et al.,
1997
); and rabbit anti-Mef2 1:2000
(Lilly et al., 1995
).
Biotinlylated secondary antibodies (Vector Laboratories) were used at 1:200.
The following RNA probes were used: the dpp probe was generated from
the 2.9 kb dpp E55 fragment
(Padgett et al., 1987
), the
tin probe from a 1.7 kb insert
(Bodmer et al., 1990
), the
svp probe from a 3.1 kb insert
(Mlodzik et al., 1990
), the
pnr probe from a 1.6 kb fragment
(Ramain et al., 1993
) and the
Hand probe from a 0.5 kb insert
(Moore et al., 2000
).
For expression analysis, 25-50 embryos were used as a sample size. Embryos were placed in categories based on expression: +, less than 1/4 staining or expression when compared with wild type; ++, 1/4 to 1/2; +++, 1/2 to 3/4; ++++, 3/4. When ZKr-Gal4 was used, only the segments T3-A3 were assayed.
| RESULTS |
|---|
|
|
|---|
|
|
By stage 16, dorsal closure is complete and the linear heart tube has
assembled beneath the dorsal midline. A general marker for pericardial cells
shows a severe reduction in these cells in both mutants
(Fig.
2Y1-Y4). As pnr and ush
mutants fail to undergo dorsal closure, we wanted to determine if this process
was a prerequisite for cardiac cell-type specification, by perhaps causing
heart defects indirectly. As a test of this hypothesis, we examined another
dorsal closure mutant, raw (Byars
et al., 1999
), in which we observe pericardial cell staining that
is normal or in excess along the dorsal mesoderm
(Fig. 2Z). This increase in
cardiac differentiation is probably due to an excess in dpp
signaling. Thus, a dorsal open phenotype in itself is insufficient to
compromise cardiac differentiation.
pnr can activate but not efficiently maintain ectopic
tin expression
Analysis of pnr and ush mutants suggests that both genes
functions are required for heart formation. In order to explore their
functional relationship in heart development further, we performed
overexpression studies. When pnr is expressed throughout the
mesoderm, tin expression is no longer confined to the heart
precursors by late stage 11, but is expanded laterally throughout the
mesoderm, suggesting that pnr is sufficient to ectopically initiate
tin expression within the mesoderm
(Fig. 3A,B). This is in
contrast to mesodermal overexpression of tin, which does not seem to
cause significant initiation of cardiogenesis without spatially intersecting
with dpp (and wg) signaling
(Lockwood and Bodmer, 2002
).
Much of this lateral expansion of tin driven by ectopic pnr
does not persist beyond stage 13, where ectopic tin is reduced to
small ventrolateral cell clusters (Fig.
3H). These results suggest that pnr can activate early
ectopic expression of tin, but by itself is insufficient to maintain
it at significant levels.
|
Previous data suggest that Ush exerts its inhibitory activity by binding to
the N-terminal zinc finger of Pnr, an interaction that is blocked in the
allele pnrD4, which has an amino acid substitution in this domain and
thereby abolishes Ush binding to Pnr
(Haenlin et al., 1997
). When
we overexpressed this gain-of-function allele of pnr in the mesoderm,
we also observed ectopic induction of ventrolateral tin expression in
late stage 11 embryos (Fig.
3E), as with overexpression of the wild-type form of pnr
(Fig. 3B). At later stages,
however, ectopic tin levels increase dramatically in the
ventrolateral mesoderm and exceed those of wild-type pnr mesodermal
overexpression (Fig. 3H,K).
Unlike co-overexpression of wild-type pnr and ush, using
pnrD4 in conjunction with ush does not cause a
ush-like phenotype but rather one like pnrD4, which produces
ectopic tin expression (Fig.
3L), suggesting that ush is unable to inhibit the gain of
function of this pnr allele. Taken together, these data are
consistent with a dual function of ush: (1) a positive role in
maintaining tin expression within the cardiogenic region and (2) a
negative role in limiting the level and spatial distribution of pnr
activity (see Fig. 1D for
normal patterns of expression).
To determine if pnr cooperated with tin in heart
formation, we examined other markers of cardiac-specific differentiation.
Similar to the presence of ectopic tin
(Fig. 3H), ectopic expression
of Hand, a general heart marker
(Fig. 3M)
(Kolsch and Paululat, 2002
),
is also observed ventrolaterally when pnr is induced throughout the
mesoderm (Fig. 3N).
Interestingly, more ectopic Hand expression is induced by
co-overexpressing pnr as well as tin
(Fig. 3O), similar to the
extent of ectopic tin with pan-mesodermal pnrD4
(Fig. 3K). This indicates that
pnr and tin act synergistically in their ability to induce
heart formation (overexpression of tin alone does not cause ectopic
heart induction) (see Lockwood and Bodmer,
2002
), and that the presence of `activated' PnrD4 is sufficient to
sustain heart formation.
pnr and ush are required within the mesoderm and
ectoderm for heart development
It is well established that both ectodermal and mesodermal patterning
information is required for heart development
(Bodmer, 1993
;
Azpiazu and Frasch, 1993
;
Frasch, 1995
;
Wu et al., 1995
;
Park et al., 1996
;
Azpiazu et al., 1996
;
Lockwood and Bodmer, 2002
). As
pnr and ush are expressed in both of these germlayers
(Fig. 1)
(Winick et al., 1993
;
Heitzler et al., 1996
;
Calleja et al., 2000
;
Gajewski et al., 1999
; Fosset
et al., 2000; Herranz and Morata,
2001
), it is possible they are required for heart development in
either or both germlayers. We already showed that mesodermal overexpression of
pnr and ush alters tin expression, demonstrating
that these two genes can influence heart development within the mesoderm. In
order to test for a specific germlayer requirement directly, we overexpressed
these genes in the respective mutant background either in the mesoderm or the
ectoderm (see Materials and Methods). We then assayed for restoration (i.e.
rescue) of tin expression within the heart-forming mesoderm of these
rescue embryos. When pnr or ush is rescued in the mesoderm
specifically, 57% and 52% of the embryos, respectively, show cardiac-specific
tin expression that is restored close to wild-type levels
(Fig. 4A-C). The ubiquitous
da-Gal4 driver confers similar levels of rescue
(Fig. 4A), which suggests that
forced mesodermal expression of these genes is sufficient to initiate proper
heart formation. However, this interpretation does not exclude the possibility
that ectodermal pnr and ush expression is also a contributor
to heart-specific tin expression. Ectoderm-specific rescue of
pnr, using ZKr-Gal4 (Frasch,
1995
) (see Materials and Methods), restores a considerable amount
of tin expression in a small but significant number of pnr
mutant embryos (Fig. 4A,D),
suggesting that pnr activity in the ectoderm can also contribute to
cardiogenesis. Because the level of ectodermal rescue is low, we cannot rule
out that this ectodermal driver also allows low levels of mesodermal
expression, which may be sufficient to achieve considerable rescue.
Nevertheless, these results are consistent with the hypothesis that
pnr and ush are mediators of an ectodermal cardiogenic
signal within both germlayers.
|
Maintaining dpp expression in the dorsal ectoderm requires
pnr and ush
As previously described, the expression patterns of pnr and
ush are initially broadly induced by dpp in the dorsal
ectoderm (Winick et al., 1993
;
Ashe et al., 2000
). Later,
these expression patterns are further refined but continue to overlap
spatially with ectodermal dpp (as well as wg) expression,
but their genetic relationship at later stages is not known. The maintenance
of dpp expression in a thin dorsal ectodermal stripe
(Fig. 5A) is thought to be
essential for controlling dorsal morphogenesis and closure by regulating a
number of target genes (Winick et al.,
1993
; Heitzler et al.,
1996
; Calleja et al.,
2000
; Herranz and Morata,
2001
). As pnr also exhibits an ectodermal requirement for
heart development, we hypothesized that pnr may be needed for
maintaining late dpp expression
(Herranz and Morata, 2001
),
which in turn contributes to the progression of cardiogenesis
(Lockwood and Bodmer, 2002
). A
late role for dpp in maintaining cardiogenesis has been difficult to
ascertain, because the stage 11 dorsal stripe expression could not be
abolished easily or selectively. When we examined dpp expression in
pnr and ush mutant embryos, we find that dorsal ectodermal
stripe expression of dpp is present at stage 11, but is progressively
reduced after germband retraction (Fig.
5). This finding is consistent with the idea that ectodermal
pnr/ush function acts via maintenance of dpp in a dorsal
stripe overlaying the forming heart. Thus, pnr/ush is likely to play
a crucial role in a crossregulatory network of the cardiogenic function of
dpp: first by mediating the early Dpp signal within the mesoderm and
later by maintaining ectodermal dpp expression.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Even though tin expression is dramatically reduced in early and late stage pnr and ush mutants, respectively, cardiac subtype-specific gene expression is not affected equally. In stage 13 embryos, eve-, lbe- and svp-expressing cells were more affected in pnr than in ush mutants, presumably because the reduction in cardiac tin expression occurs earlier in pnr than in ush mutants. The largest difference in susceptibility to pnr relative to ush was observed with lbe expression. Of the three cardiac cell type-specific markers, Eve is the least sensitive to pnr loss-of-function. We speculate that this difference may be due to direct versus indirect (via tin) regulation of the relevant enhancers by pnr.
Ectopic ventrolateral tin expression is observed when pnr
is overexpressed in the mesoderm. This expansion in tin expression is
reminiscent to what is observed when dpp is expressed throughout the
mesoderm (Lockwood and Bodmer,
2002
). This raises the question of whether pnr directly
regulates tin expression, or indirectly through dpp (or
both). As shown previously, global overexpression of pnr causes
ectopic dpp expression in the ectoderm
(Herranz and Morata, 2001
).
However, we find that pan-mesodermal overexpression of pnr does not
cause an expansion of dpp expression in the mesoderm or the ectoderm
(data not shown). This suggests that pnr must be able to activate the
expression of tin either by itself or with some other factors,
excluding dpp, in this overexpression assay. This does exclude the
possibility that normally pnr and ectodermal Dpp signaling could act
in parallel to activate tin expression in the heart primordial (see
below). The ability of pnr to activate tin is likely to be
direct, as a heart-specific enhancer of tin
(Venkatesh et al., 2000
)
contains several consensus Gata sites (M. Liu and R.B., unpublished). As shown
by transcription assays (Gajewski et al.,
2001
), pnr is also a likely direct target of
tin, suggesting that they both contribute to maintaining each other's
expression. Both tin and pnr have been shown to be targets
of Dpp signaling at stage 9/10 (Xu et
al., 1998
; Ashe et al.,
2000
). We propose that dpp is necessary again at stage 11
to activate and maintain pnr and tin expression in the
cardiogenic region of the mesoderm (Fig.
7). First, pnr is activated with the help of early stage
11 tin, which is expressed broadly throughout the dorsal mesoderm,
and dpp, which is expressed in a narrow dorsal ectodermal stripe.
Then, at mid-stage 11, tin is restricted to the cardiogenic region
with the help of mesodermal pnr as well as continuous ectodermal Dpp
signaling. Once both are activated in the cardiogenic mesoderm, they are
likely to contribute to the maintenance of each other's expression, probably
aided again, but only moderately, by ectodermal Dpp signaling. This
interpretation is consistent with mesodermal versus ectodermal expression of
dominant-negative pnrEnR (Fig.
4) and the dpp target repressor encoded by brk
(Fig. 6). They are both equally
effective in reducing cardiac-specific tin when expressed in the
mesoderm, but ectodermal repression is more effective when dorsal-stripe
dpp at stage 11 is also affected (as in the case of
ZKr-Gal4>UAS-brk shown in Fig.
6G, but not with ZKr-Gal4>UAS-pnrEnR, data not
shown).
Mesodermal overexpression of ush and co-overexpression with pnr results in a decrease in the amount of cardiac-specific tin expression, suggesting that ush may not only be required along with pnr for heart development, but also play an inhibitory role. To test this hypothesis further, we overexpressed pnrD4, an allele that abolishes Ush binding to Pnr, and found not only ectopic tin expression at early stages of cardiogenesis, but also undiminished and even increased levels of expression at later stages. A similar phenotype was observed when both pnrD4 and ush were expressed throughout the mesoderm, suggesting that ush plays an anti-cardiogenic role by antagonizing the activity of wild-type Pnr, but not that of PnrD4. It would be interesting to see if pan-mesodermal overexpression of wild-type pnr in a ush mutant background results in ectopic tin expression similar to pnrD4, or if a minimal amount of ush activity is required to maintain normal and ectopic tin expression even with forced pnr expression. Interestingly, overexpression of both pnr and tin together in the mesoderm also causes a pnrD4-like phenotype, as assayed with Hand expression, suggesting that pnr and tin collaborate during initiation and subsequent differentiation of the heart progenitors.
Although in vitro the Ush-related FOG factors are primarily known for their
role as transcriptional repressors
(Svensson et al., 1999
;
Tevosian et al., 1999
), they
apparently can also function as co-activators: Fog2 can synergistically
activate or repress the transcriptional activity of Gata4, depending on the
(cardiac) promoter and cell line used (Lu
et al., 1999
), and FOG-1 can cooperate with Gata1 to transactivate
NF-E2, an erythroid cell-specific promoter
(Tsang et al., 1998
).
Moreover, the ventricular hypoplasia and other heart defects observed in
Fog2-deficient mice suggest a deficit rather than an excess in heart
development (Tevosian et al.,
2000
; Svensson et al.,
2000
). In addition, mice with an equivalent mutation to PnrD4
knocked into the Gata4 locus, thus eliminating binding to Fog2, exhibit in
many ways a similar phenotype to Fog2-deficient mice
(Crispino et al., 2001
). These
data are consistent with the idea that Fog2 is normally involved in promoting
rather than antagonizing cardiogenesis, similar to what we have found with our
genetic studies during Drosophila heart development.
The dual role of Ush suggests that the amount of Ush may be crucial for whether it exerts its function as a an activator or repressor, perhaps by binding to different sets of co-factors in a concentration-dependent manner. Alternatively, the mode of transcriptional regulation by Ush could be stage-dependent: at stage 11, Pnr and Ush cooperate as transcriptional activators in initiating cardiac-specific tin expression and heart development, but later Ush becomes a repressor to limit the transcriptional activation of tin by Pnr
pnr and ush are initially broadly expressed in the dorsal
ectoderm of the early embryo, but by germband retraction the ectodermal
expression of pnr is confined to a narrow stripe of cells along the
border of the amnioserosa, which overlaps with the thin dorsal dpp
stripe (Fig. 1D). The early
ectodermal expression of ush is restricted to the presumptive
amnioserosa, and by germband extension, ush also overlaps with the
dorsalmost region of the ectoderm (Fossett
et al., 2000
; Herranz and
Morata, 2001
). These patterns of expression suggest that
pnr and ush may be acting in both germ layers. Our genetic
data, including germ layer-specific expression of wild-type and
dominant-negative pnr constructs, as well as germ layer-specific
rescue experiments suggest strongly that pnr and ush
function is not only needed in the mesoderm, but also in the ectoderm for
heart formation (see model in Fig.
7). The ectodermal requirement for pnr and ush
in heart development is probably achieved via the maintenance of dpp
expression, as dorsal stripe dpp expression diminishes in
pnr and ush mutants and ectodermal interference with
pnr, ush and/or dpp-signaling function compromises the
normal progression of heart development.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abel, T., Michelson, A. M. and Maniatis, T.
(1993). A Drosophila GATA family member that binds to Adh
regulatory sequences is expressed in the developing fat body.
Development 119,623
-633.
Alvarez, A. D., Shi, W. S., Wilson, B. A. and Skeath, J. B.
(2003). pannier and pointedP2 act sequentially
to regulate Drosophila development.
Development 130,3015
-3026.
Arceci, R. J., King, A. A., Simon, M. C., Orkin, S. H. and
Wilson, D. B. (1993). Mouse GATA-4: a retinoic acid-inducible
GATA-binding transcription factor expressed in endodermally derived tissues
and heart. Mol. Cell. Biol.
13,2235
-2246.
Ashe, H. L., Mannervick, M. and Levine, M.
(2000). Dpp signaling thresholds in the dorsal ectoderm of the
Drosophila embryo. Development
127,3305
-3312.[Abstract]
Azpiazu, N. and Frasch, M. (1993). Tinman and
bagpipe: two homeobox genes that determine cell fates in the dorsal mesoderm
of Drosophila. Genes Dev.
7,1325
-1340.
Azpiazu, N., Lawrence, P. A., Vincent, J. P. and Frasch, M.
(1996). Segmentation and specification of the Drosophila
mesoderm. Genes Dev. 10,3183
-3194.
Bhatia, S. N., Suri, V., Bundy, A. and Krauss, C. M.
(1999). Prenatal detection and mapping of a distal 8p deletion
associated with congenital heart disease. Prenat.
Diagn. 19,863
-867.[CrossRef][Medline]
Bodmer, R., Jan, L. Y. and Jan, Y. N. (1990). A
new homeobox-containing gene, msh-2, is transiently expressed early during
mesoderm formation of Drosophila. Development
110,661
-669.
Bodmer, R. (1993). The gene tinman is required
for specification of the heart and visceral muscles in Drosophila.
Development 118,719
-729.[Abstract]
Bodmer, R. (1995). Heart development in
Drosophila and its relationship to vertebrate systems. Trends
Cardiovasc. Med. 5,21
-27.[CrossRef]
Bodmer, R. and Venkatesh, T. V. (1998). Heart
development in Drosophila and vertebrates: conservation of molecular
mechanisms. Dev. Genet.
22,181
-186.[CrossRef][Medline]
Bodmer, R. and Frasch, M. (1999). Genetic
determination of Drosophila heart development. In Heart
Development (ed. N. Rosenthal and R. Harvey), pp.65
-90. San Diego, London, New York: Academic
Press.
Brand, A. H. and Perrimon, N. (1993). Targeted
gene expression as a means of altering cell fates and generating dominant
phenotypes. Development
118,401
-415.[Abstract]
Brown, S. and Castelli-Gair Hombria, J. (2000).
Drosophila grain encodes a GATA transcription factor required for cell
rearrangement during morphogenesis. Development
127,4867
-4876.[Abstract]
Byars, C. L., Bates, K. L. and Letsou, A.
(1999). The dorsal-open group gene raw is required for restricted
DJNK signaling during closure. Development
126,4913
-4923.[Abstract]
Calleja, M., Herranz, H., Estella, C., Casal, J., Lawrence, P.,
Simpson, P. and Morata, G. (2000). Generation of
medial and lateral dorsal body domains by the pannier gene of Drosophila.
Development 127,3971
-3980.[Abstract]
Chartier, A., Zaffran, S., Astier, M., Semeriva, M. and
Gratecos, D. (2002). Pericardin, a Drosophila type IV
collagen-like protein is involved in the morphogenesis and maintenance of the
heart epithelium during dorsal ectoderm closure.
Development 129,3241
-3253.
Crispino, J. D., Lodish, M. B., Thurberg, B. L., Litovsky, S.
H., Collins, T., Molkentin, J. D. and Orkin, S. H.
(2001). Proper coronary vascular development and heart
morphogenesis depend on interaction of GATA-4 with FOG cofactors.
Genes Dev. 15,839
-844.
Cubadda, Y., Heitzler, P., Ray, R. P., Bourouis, M., Ramain, P.,
Gelbart, W., Simpson, P. and Haenlin, M. (1997).
U-shaped encodes a zinc finger protein that regulates the proneural genes
achaete and scute during the formation of bristles in Drosophila.
Genes Dev. 11,3083
-3095.
Dai, Y. S., Cserjesi, P., Markham, B. E. and Molkentin, J.
D. (2002). The transcription factors GATA4 and dHAND
physically interact to synergistically activate cardiac gene expression
through a p300-dependent mechanism. J. Biol. Chem.
277,24390
-24398.
Durocher, D., Charron, F., Warren, R., Schwartz, R. J. and
Nemer, M. (1997). The cardiac transcription factors Nkx2-5
and GATA-4 are mutual cofactors. EMBO J.
16,5687
-5696.[CrossRef][Medline]
Evans, T. and Felsenfeld. G. (1989). The
erythroid-specific transcription factor Eryf1: a new finger protein.
Cell 58,877
-885.[CrossRef][Medline]
Frasch, M. (1995). Induction of visceral and
cardiac mesoderm by ectodermal Dpp in early Drosophila embryo.
Nature 374,464
-467.[CrossRef][Medline]
Frasch, M., Hoey, T., Rushlow, C., Doyle, H. and Levine, M.
(1987). Characterization and localization of the even-skipped
protein of Drosophila. EMBO J.
6, 749-759.[Medline]
Fossett, N., Zhang, Q., Gajewski, K., Choi, C., Kim, Y. and
Schulz, R. A. (2000). The multitype zinc-finger protein
U-shaped functions in heart cell specification in the Drosophila embryo.
Proc. Natl. Acad. Sci. USA
97,7348
-7353.
Fossett, N., Tevosian, S. G., Gajewski, K., Zhang, Q., Orkin, S.
H. and Schulz, R. A. (2001). The Friend of GATA
proteins U-shaped, FOG-1, and FOG-2 function as negative regulators of blood,
heart, and eye development in Drosophila. Proc. Natl. Acad. Sci.
USA 98,7342
-7347.
Fu, Y., Yan, W., Mohun, T. J. and Evans, S. M.
(1998). Vertebrate tinman homologues XNkx2-3 and XNkx2-5 are
required for heart formation in a functionally redundant manner.
Development 124,4439
-4449.
Gajewski, K., Fossett, N., Molkentin, J. D. and Schulz, R.
A. (1999). The zinc finger proteins Pannier and GATA4
function as cardiogenic factors in Drosophila.
Development 126,5679
-5688.[Abstract]
Gajewski, K., Zhang, Q., Choi, C. Y., Fossett, N., Dang, A.,
Kim, Y. H., Kim, Y. and Schulz, R. A. (2001). Pannier
is a Transcriptional Target and Partner of Tinman during Drosophila
Cardiogenesis. Dev. Biol.
233,425
-436.[CrossRef][Medline]
Gisselbrecht, S., Skeath, J. B., Doe, C. Q. and Michelson, A.
M. (1996). heartless encodes a fibroblast growth
factor receptor (DFR1/DFGF-R2) involved in the directional migration of early
mesodermal cells in the Drosophila embryo. Genes Dev.
10,3003
-3017.
Greig, S. and Akam, M. (1993). Homeotic genes
autonomously specify one aspect of pattern in the Drosophila mesoderm.
Nature 362,630
-632.[CrossRef][Medline]
Grepin, C., Dagnino, L., Robitaille, L., Haberstroh, L.,
Antakly, T. and Nemer, M. (1994). A hormone-encoding
gene identifies a pathway for cardiac but not skeletal muscle gene
transcription. Mol. Cell. Biol.
14,3115
-3129.
Haenlin, M., Cubadda, Y., Blondeau, F., Heitzler, P., Lutz, Y.,
Simpson, P. and Ramain, P. (1997). Transcriptional activity
of Pannier is regulated negatively by heterodimerization of the GATA
DNA-binding domain with a cofactor encoded by the u-shaped gene in Drosophila.
Genes Dev. 11,3096
-3108.
Han, Z., Fujioka, M., Su, M., Liu, M., Jaynes, J. B. and Bodmer,
R. (2002). Transcriptional integration of competence
modulated by mutual repression generates cell-type specificity within the
cardiogenic mesoderm. Dev Biol.
252,225
-240.[CrossRef][Medline]
Han, Z. and Bodmer, R. (2003). Myogenic cells
fates are antagonized by Notch only in asymmetric lineages of the Drosophila
heart, with or without cell division. Development
130,3039
-3051.
Harvey, R. P. (1996). NK-2 homeobox genes and
heart development. Dev. Biol.
178,203
-216.[CrossRef][Medline]
Heikinheimo, M., Scandrett, J. M. and Wilson, D. B.
(1994). Localization of transcription factor GATA-4 to regions of
the mouse embryo involved in cardiac development. Dev.
Biol. 164,361
-373.[CrossRef][Medline]
Heitzler, P., Haenlin, M., Ramain, P., Calleja, M. and Simpson,
P. (1996). A genetic analysis of pannier, a gene necessary
for viability of dorsal tissues and bristle positioning in Drosophila.
Genetics 143,1271
-1286.[Abstract]
Herranz, H. and Morata, G. (2001). The
functions of pannier during Drosophila embryogenesis.
Development 128,4837
-4846.
Ip, H. S., Wilson, D. B., Heikinheimo, M., Tang, Z., Ting, C.
N., Simon, M. C., Leiden, J. M. and Parmacek, M. S.
(1994). The GATA-4 transcription factor transactivates the
cardiac muscle-specific troponin C promoter-enhancer in nonmuscle cells.
Mol. Cell. Biol. 14,7517
-7526.
Jagla, K., Frasch, M., Jagla, T., Dretzen, G., Bellard, R. and
Bellard, M. (1997). Ladybird, a new component of the
cardiogenic pathway in Drosohila required for diversification of heart
precursors. Development
124,3471
-3479.[Abstract]
Jaynes, J. B. and O'Farrel, P. H. (1991).
Active repression of transcription by the engrailed homeodomain protein.
EMBO J. 10,1427
-1433.[Medline]
Jazwinska, A., Rushlow, C. and Roth, S. (1999).
The role of brinker in mediating the graded response to Dpp in early
Drosophila embryos. Development
126,3323
-3334.[Abstract]
Jiang, Y. and Evans, T. (1996). The Xenopus
GATA-4/5/6 genes are associated with cardiac specification and can regulate
cardiac-specific transcription during embryogenesis. Dev.
Biol. 174,258
-270.[CrossRef][Medline]
Kelley, C., Blumberg, H., Zon, L. I. and Evans, T.
(1993). GATA-4 is a novel transcription factor expressed in
endocardium of the developing heart. Development
118,817
-827.[Abstract]
Kirkpatrick, H., Johnson, K. and Laughon, A.
(2001). Repression of dpp targets by binding of brinker to mad
sites. J. Biol. Chem.
276,18216
-18222.
Knirr, S., Azpiazu, N. and Frasch, M. (1999).
The role of the NK-homeobox gene slouch (S59) in somatic muscle patterning.
Development 126,4525
-4535.[Abstract]
Kolsch, V. and Paululat, A. (2002) The highly
conserved cardiogenic bHLH factor Hand is specifically expressed in circular
visceral muscle progenitor cells and in all cell types of the dorsal vessel
during Drosophila embryogenesis. Dev. Genes Evol.
212,473
-485.[CrossRef][Medline]
Kuo, C. T., Morrisey, E. E., Anandappa, R., Sigrist, K., Lu, M.
M., Parmacek, M. S., Soudais, C. and Leiden, J. M.
(1997). GATA4 transcription factor is required for ventral
morphogenesis and heart tube formation. Genes Dev.
11,1048
-1060.
Laverriere, A. C., MacNeill, C., Mueller, C., Poelmann, R. E.,
Burch, J. B. and Evans, T. (1994). GATA-4/5/6, a subfamily of
three transcription factors transcribed in developing heart and gut.
J. Biol. Chem. 269,23177
-23184.
Lee, H. H. and Frasch, M. (2000). Wingless
effects mesoderm patterning and ectoderm segmentation events via induction of
its downstream target sloppy paired. Development
127,5497
-5508.[Abstract]
Lee, Y., Shioi, T., Kasahara, H., Jobe, S. M., Wiese, R. J.,
Markham, B. E. and Izumo, S. (1998). The cardiac
tissue-restricted homeobox protein Csx/Nkx2.5 physically associates with the
zinc finger protein GATA4 and cooperatively activates atrial natriuretic
factor gene expression. Mol. Cell. Biol.
18,3120
-3129.
Lilly, B., Zhao, B., Ranganayakulu, G., Paterson, B. M., Schulz,
R. A., Olson, E. N. (1995). Requirement of MADS domain
transcription factor D-MEF2 for muscle formation in Drosophila.
Science 267,688
-693.
Lin, W. H., Huang, L. H., Yeh, J. Y., Hoheisel, J., Lehrach, H.,
Sun, Y. H. and Tsai, S. F. (1995). Expression of a Drosophila
GATA transcription factor in multiple tissues in the developing embryos.
Identification of homozygous lethal mutants with P-element insertion at the
promoter region. J. Biol. Chem.
270,25150
-25158.
Lo, P. C., Skeath, J. B., Gajewski, K., Schulz, R. A. and
Frasch, M. (2002). Homeotic genes autonomously specify the
anteroposterior subdivision of the Drosophila dorsal vessel into aorta and
heart. Dev. Biol. 251,307
-319.[CrossRef][Medline]
Lockwood, W. and Bodmer, R. (2002). Patterns of
wingless, decapentaplegic and tinman positions the Drosophila heart.
Mech. Dev. 114,13
-26.[CrossRef][Medline]
Lu, J. R., McKinsey, T. A., Xu, H., Wang, D. Z., Richardson, J.
A. and Olsen, E. N. (1999). FOG-2, a heart- and
brain-enriched cofactor for GATA transcription factors. Mol. Cell.
Biol. 19,4495
-4502.
Marvin, M. J., di Rocco, G., Gardiner, A., Bush, S. M. and
Lassar, A. B. (2001). Inhibition of Wnt activity induces
heart formation from posterior mesoderm. Genes Dev.
15,316
-347.
Mlodzik, M., Hiromi, Y., Weber, U., Goodman, C. S. and Rubin, G.
M. (1990). The Drosophila seven-up gene, a member of the
steroid receptor gene superfamily, controls photoreceptor cell fates.
Cell 60,211
-224.[CrossRef][Medline]
Molkentin, J. D., Lin, Q., Duncan, S. A. and Olsen, E. N.
(1997). Requirement of the transcription factor GATA4 for heart
tube formation and ventral morphogenesis. Genes Dev.
11,1061
-1072.
Molkentin, J. D. (2000). The zinc
finger-containing transcription factors GATA-4,-5,-6. J. Biol.
Chem. 275,38949
-38952.
Moore, A. W., Barbel, S., Jan, L. Y. and Jan, Y. N.
(2000). A genomewide survey of basic helix-loop-helix factors in
Drosophila. Proc. Natl. Acad. Sci. USA
97,10436
-10441.
Morrisey, E. E., Ip, H. S., Lu, M. M. and Parmacek, M. S.
(1996). GATA-6: a zinc finger transcription factor that is
expressed in multiple cell lineages derived from lateral mesoderm.
Dev. Biol. 177,309
-322.[CrossRef][Medline]
Murphy, A. M., Thompson, W. R., Peng, L. F. and Jones, L.,
2nd (1997). Regulation of the rat cardiac troponin I gene by
the transcription factor GATA-4. Biochem. J.
322,393
-401.[Medline]
Orkin, S. H. (1998). Embryonic stem cells and
transgenic mice in the study of hematopoiesis. Int. J. Dev.
Biol. 42,827
-934.
Padgett, R. W., St. Johnston, R. D. and Gelbart, W. M.
(1987). A transcript from a Drosophila pattern gene predicts a
protein homologous to the transforming growth factor-beta family.
Nature 325,81
-84.[CrossRef][Medline]
Pandur, P., Lasche, M., Eisenberg, L. M. and Kuhl, M.
(2002). Wnt-11 activation of a non-canonical Wnt signaling
pathway is required for cardiogenesis. Nature
481,636
-641.
Park, M., Wu, X., Golden, K., Axelrod, J. and Bodmer, R.
(1996). The Wingless signaling pathway is directly involved in
Drosophila development. Dev. Biol.
177,104
-116.[CrossRef][Medline]
Park, M., Yaich, L. E. and Bodmer, R. (1998).
Mesodermal cell fate decisions in Drosophila are under the control of the
lineage genes numb, Notch, and sanpodo. Mech. Dev.
75,117
-126.[CrossRef][Medline]
Pehlivan, T., Pober, B. R., Brueckner, M., Garrett, S., Slaugh,
R., van Rheeden, R., Wilson, D. B., Watson, M. S. and Hing, A. V.
(1999). GATA4 haploinsufficiency in patients with interstitial
deletion of chromosome region 8p23.1 and congenital heart disease.
Am. J. Med. Genet. 83,201
-206.[CrossRef][Medline]
Ponzielli, R., Astier, M., Chartier, A., Gallet, A., Therond, P.
and Semeriva, M. (2002). Heart tube patterning in
Drosophila requires integration of axial and segmental information provided by
the Bithorax Complex genes and hedgehog signaling.
Development 129,4509
-4521.
Ramain, P., Heitzler, P., Haenlin, M. and Simpson, P.
(1993). pannier, a negative regulator of achaete and scute in
Drosophila, encodes a zinc finger protein with homology to the vertebrate
transcription factor GATA-1. Development
119,1277
-1291.[Abstract]
Ranganayakulu, G., Elliott, D. A., Harvey, R. P. and Olsen, E.
N. (1998). Divergent roles for NK-2 class homeobox genes in
cardiogenesis in flies and mice. Development
113, 35-54.
Rehorn, K. P., Thelen, H., Michelson, A. M. and Reuter, R.
(1996). A molecular aspect of hematopoiesis and endoderm
development common to vertebrates and Drosophila.
Development 122,4023
-4031.[Abstract]
Riechmann, V., Irion, U., Wilson, R., Grosskortenhaus, R. and
Leptin, M. (1997). Control of cell fates and segmentation in
the Drosophila mesoderm. Development
124,2915
-2922.[Abstract]
Riechmann, V., Rehorn, K. P., Reuter, R. and Leptin, M.
(1998). The genetic control of the distinction between fat body
and gonadal mesoderm in Drosophila. Development
125,713
-723.[Abstract]
Rizki, T. M. (1978). The circulatory system and
associated cells and tissues. In The Genetics and Biology of
Drosophila (ed. M. Ashburner and T. R. F. Wright), pp.397
-452. London, New York: Academic Press
Rushlow, C., Colosimo, P. F., Lin, M. C., Xu, M. and Kirov,
N. (2001). Transcriptional regulation of the Drosophila gene
zen by competing Smad and Brinker inputs. Genes Dev.
15,340
-351.
Saller, E. and Bienz, M. (2001). Direct
competition between Brinker and Drosophila Mad in Dpp target gene
transcription. EMBO J.
2, 298-305.[CrossRef]
Sam, S., Leise, W. and Hoshizaki, D. K. (1996).
The serpent gene is necessary for progression through the early stages of
fat-body development. Mech. Dev.
60,197
-205.[CrossRef][Medline]
Sato, M. and Saigo, K. (2000). Involvement of
pannier and u-shaped in regulation of Decapentaplegic-dependent wingless
expression in developing Drosophila notum. Mech. Dev.
93,127
-138.[CrossRef][Medline]
Schneider, V. A. and Mercola, M. (2001). Wnt
antagonism initiates cardiogenesis in Xenopus laevis. Genes
Dev. 15,304
-315.
Schultheiss, T. M., Burch, J. B. and Lassar, A. B.
(1997). A role for bone morphogenetic proteins in the induction
of cardiac myogenesis. Genes Dev.
11,451
-462.
Sepulveda, J. L., Belaguli, N., Nigam, V., Chen, C., Nemer, M.
and Schwartz, R. J. (1998). GATA-4 and Nkx-2.5
coactivate Nkx-2 DNA binding targets: role for regulating early cardiac gene
expression. Mol. Cell. Biol.
18,3405
-3415.
Sepulveda, J. L., Vlahopoulos, S., Iyer, D., Belaguli, N. and
Schwartz, R. J. (2002). Combinatorial expression of
GATA4, Nkx2-5, and serum response factor directs early cardiac gene activity.
J. Biol. Chem. 277,25775
-25782.
Sivasankaran, R., Vigano, M. A., Muller, B., Affolter, M. and
Basler, K. (2000). Direct transcriptional control of the Dpp
target omb by the DNA binding protein Brinker. EMBO J.
19,6162
-6172.[CrossRef][Medline]
Smith, S. T. and Jaynes, J. B. (1996). A
conserved region of engrailed, shared among all en-, gsc-, Nk1-, Nk2- and
msh-class homeoproteins, mediates active transcriptional repression in vivo.
Development 122,3141
-3150.[Abstract]
Svensson, E. C., Huggins, G. S., Dardik, F. B., Polk, C. E. and
Leiden, J. M. (1999). A functionally conserved
N-terminal domain of the Friend of GATA-2 (FOG-2) protein represses
GATA-4-Dependent transcription. J. Biol. Chem.
275,20762
-20769.
Svensson, E. C., Huggins, G. S., Lin, H., Clendenin, C., Jiang,
F., Tufts, R., Dardik, F. B. and Leiden, J. M. (2000).
A syndrome of tricuspid atresia in mice with a targeted mutation of the gene
encoding Fog-2. Nat. Genet.
25,353
-356.[CrossRef][Medline]
Tevosian, S. G., Deconinck, A. E., Cantor, A. B., Rieff, H. I.,
Fujiwara, Y., Corfas, G. and Orkin, S. H. (1999).
FOG-2: A novel GATA-family cofactor related to multitype zinc-finger proteins
Friend of GATA-1 and U-shaped. Proc. Natl. Acad. Sci.
USA 96,950
-955.
Tevosian, S. G., Deconinck, A. E., Tanaka, M., Schinke, M.,
Litovsky, S. H., Izumo, S., Fujiwara, Y. and Orkin, S. H.
(2000). FOG-2, a cofactor for GATA transcription factors, is
essential for heart morphogenesis and development of coronary vessels from
epicardium. Cell 101,729
-739.[CrossRef][Medline]
Tolkunova, E. N., Fujioka, M., Kobayashi, M., Deka, D. and
Jaynes, J. B. (1998). Two distinct types of repression domain
in engrailed: one interacts with the groucho corepressor and is preferentially
active on integrated target genes. Mol. Cell. Biol.
18,2804
-2814.
Tomoyasu, Y., Ueno, N. and Nakamura, M. (2000).
The Decapentaplegic morphogen gradient regulates the notal wingless expression
through induction of pannier and u-shaped in Drosophila. Mech.
Dev. 96,37
-49.[CrossRef][Medline]
Tsai, S. F., Martin, D. I., Zon, L. I., D'Andrea, A. D., Wong,
G. G. and Orkin, S. H. (1989). Cloning of cDNA for the
major DNA-binding protein of the erythroid lineage through expression in
mammalian cells. Nature
339,446
-451.[CrossRef][Medline]
Tsang, A. P., Fujiwara, Y., Hom, D. B. and Orkin, S. H.
(1998). Failure of megakaryopoiesis and arrested erythropoiesis
in mice lacking the GATA-1 transcriptional cofactor FOG. Genes
Dev. 12,1176
-1188.
Venkatesh, T. V., Park, M., Ocorr, K., Nemaceck, J., Golden, K.,
Wemple, M. and Bodmer, R. (2000). Cardiac enhancer
activity of the homeobox gene tinman depends on CREB consensus binding sites
in Drosophila. Genesis
26, 55-66.[CrossRef][Medline]
Ward, E. J. and Skeath, J. B. (2000).
Characterization of a novel subset of cardiac cells and their progenitors in
the Drosophila embryo. Development
127,4959
-4969.[Abstract]
Winick, J., Abel, T., Leonard, M. W., Michelson, A. M., Chardon,
I. L., Holmgren, R. A., Maniatis, T. and Engel, J. D.
(1993). A GATA family transcription factor is expressed along the
embryonic dorsoventral axis in Drosophila melanogaster.
Development 199,1055
-1065.
Wodarz, A., Hinz, U., Engelbert, M. and Knust, E.
(1995). Expression of crumbs confers apical character on plasma
membrane domains of ectodermal epithelia of Drosophila.
Cell 82,67
-76.[CrossRef][Medline]
Wu, X., Golden, K. and Bodmer, R. (1995). Heart
development in Drosophila requires the segment polarity gene wingless.Dev. Biol. 169,619
-628.[CrossRef][Medline]
Xu, X, Yin, Z., Hudson, J. B., Ferguson, E. L. and Frasch,
M. (1998). Smad proteins act in combination with synergistic
and antagonistic regulators to target Dpp responses to the Drosophila
mesoderm. Genes Dev. 12,2354
-2370.
Yamamoto, M., Ko, L. J., Leonard, M. W., Beug, H., Orkin, S. H.
and Engel, J. D. (1990). Activity and tissue-specific
expression of the transcription factor NF-E1 multigene family.
Genes Dev. 4,1650
-1652.
Yarnitzky, T. and Volk, T. (1995). Laminin is
required for heart, somatic muscles, and gut development in the Drosophila
embryo. Dev. Biol. 169,609
-618.[CrossRef][Medline]
Zhang, H., Levine, M. and Ashe, M. L. (2001).
Brinker is a sequence-specific transcriptional repressor in the Drosophila
embryo. Genes Dev. 15,261
-266.
Related articles in Development:
This article has been cited by other articles:
![]() |
L. Qian and R. Bodmer Partial loss of GATA factor Pannier impairs adult heart function in Drosophila Hum. Mol. Genet., September 1, 2009; 18(17): 3153 - 3163. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Mann, R. Bodmer, and P. Pandur The Drosophila homolog of vertebrate Islet1 is a key component in early cardiogenesis Development, January 15, 2009; 136(2): 317 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Johnson, L. A. Burnett, J. Sellin, A. Paululat, and S. J. Newfeld Defective Decapentaplegic Signaling Results in Heart Overgrowth and Reduced Cardiac Output in Drosophila Genetics, July 1, 2007; 176(3): 1609 - 1624. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Akasaka, S. Klinedinst, K. Ocorr, E. L. Bustamante, S. K. Kim, and R. Bodmer The ATP-sensitive potassium (KATP) channel-encoded dSUR gene is required for Drosophila heart function and is regulated by tinman PNAS, August 8, 2006; 103(32): 11999 - 12004. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Han, P. Yi, X. Li, and E. N. Olson Hand, an evolutionarily conserved bHLH transcription factor required for Drosophila cardiogenesis and hematopoiesis Development, March 15, 2006; 133(6): 1175 - 1182. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fujioka, R. J. Wessells, Z. Han, J. Liu, K. Fitzgerald, G. L. Yusibova, M. Zamora, P. Ruiz-Lozano, R. Bodmer, and J. B. Jaynes Embryonic even skipped-Dependent Muscle and Heart Cell Fates Are Required for Normal Adult Activity, Heart Function, and Lifespan Circ. Res., November 25, 2005; 97(11): 1108 - 1114. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Reim and M. Frasch The Dorsocross T-box genes are key components of the regulatory network controlling early cardiogenesis in Drosophila Development, November 15, 2005; 132(22): 4911 - 4925. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Singh, J. Chan, J. J. Chern, and K.-W. Choi Genetic Interaction of Lobe With Its Modifiers in Dorsoventral Patterning and Growth of the Drosophila Eye Genetics, September 1, 2005; 171(1): 169 - 183. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Han and E. N. Olson Hand is a direct target of Tinman and GATA factors during Drosophila cardiogenesis and hematopoiesis Development, August 1, 2005; 132(15): 3525 - 3536. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rojas, S. De Val, A. B. Heidt, S.-M. Xu, J. Bristow, and B. L. Black Gata4 expression in lateral mesoderm is downstream of BMP4 and is activated directly by Forkhead and GATA transcription factors through a distal enhancer element Development, August 1, 2005; 132(15): 3405 - 3417. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, Y. Tao, I. Reim, K. Gajewski, M. Frasch, and R. A. Schulz Expression, Regulation, and Requirement of the Toll Transmembrane Protein during Dorsal Vessel Formation in Drosophila melanogaster Mol. Cell. Biol., May 15, 2005; 25(10): 4200 - 4210. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tsarovina, A. Pattyn, J. Stubbusch, F. Muller, J. van der Wees, C. Schneider, J.-F. Brunet, and H. Rohrer Essential role of Gata transcription factors in sympathetic neuron development Development, October 1, 2004; 131(19): 4775 - 4786. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zikova, J.-P. Da Ponte, B. Dastugue, and K. Jagla Patterning of the cardiac outflow region in Drosophila PNAS, October 14, 2003; 100(21): 12189 - 12194. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||