|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00517
Department of Molecular, Cellular and Developmental Biology, University of Michigan, Ann Arbor, MI 48109, USA
* Author for correspondence (e-mail: rolf{at}umich.edu)
Accepted 31 March 2003
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Drosophila, Heart, Cardiogenesis, Mesoderm, pannier, u-shaped, tinman, dpp, Gata factors
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
), subtypes of which have been identified based on gene
expression, function and lineage relationships (Alvares et al., 2003;
Han and Bodmer, 2003;
Ponzielli et al., 2002;
Lo et al., 2002). Several
regulatory genes have been identified to be required for the specification of
cardiac progenitors within the dorsal mesoderm, including the homeobox
transcription factor Tinman (Tin), and the TGFß and Wnt signaling
molecules encoded by dpp and wingless (wg),
respectively (Bodmer, 1993;
Azpiazu and Frasch, 1993;
Frasch, 1995;
Wu et al., 1995;
Park et al., 1996;
Azpiazu et al., 1996;
Riechmann et al., 1997).
wg, dpp and tin are not only necessary for heart formation,
but as overexpression studies suggest the spatial convergence of wg
and dpp signaling on cells expressing tin is also sufficient
for cardiac-specific differentiation
(Lockwood and Bodmer, 2002). A
mesodermal mediator of ectodermal wg signaling to the mesoderm is
achieved by activation of a transcription factor encoded by
sloppy-paired (Lee and Frasch,
2000), but it is not known if the cardiogenic dpp signal
is also mediated indirectly.
There are striking molecular and developmental similarities between
vertebrate and Drosophila heart development
(Bodmer, 1995;
Bodmer and Venkatesh, 1998;
Bodmer and Frasch, 1999).
Developmentally, both vertebrate and Drosophila hearts are formed
from bilaterally symmetrical rows of mesodermal cells, which will eventually
migrate to the midline, where they will fuse to form a linear heart tube. More
importantly, tin and dpp, two factors that determine the
initial formation of the Drosophila heart, also have vertebrate
counterparts (Nkx2.5 and Bmp2/4, respectively) with a similar function in
cardiogenesis (Harvey, 1996;
Schultheiss et al., 1997). In
contrast to Drosophila, canonical Wnt signaling in vertebrates needs
to be prevented for promoting heart formation in the anterior lateral plate
mesoderm (Schneider and Mercola,
2001; Marvin et al.,
2001). However, the non-canonical Wnt pathway is required for
heart formation in vertebrates (Pandur et
al., 2002).
Six Gata transcription factors have been identified in vertebrates,
characterized by two conserved DNA-binding zinc fingers
(Evans and Felsenfeld, 1989;
Tsai et al., 1989;
Yamamoto et al., 1990).
Gata1, Gata2 and Gata3 are largely expressed in hematopoietic stem cells
(reviewed by Orkin, 1998), and
Gata4, Gata5 and Gata6 are expressed in several mesoderm- and endoderm-derived
tissues, including the developing heart
(Arceci et al., 1993;
Kelley et al., 1993;
Heikinheimo et al., 1994;
Laverriere et al., 1994;
Jiang and Evans, 1996;
Morrisey et al., 1996), where
they are thought to regulate cardiac-specific genes
(Grepin et al., 1994;
Ip et al., 1994;
Durocher et al., 1997;
Murphy et al., 1997) (reviewed
by Molkentin, 2000). Gata4 is
already expressed in the early cardiac crescent of the lateral plate mesoderm,
and in mice deficient for Gata4, these heart primordia fail to migrate towards
the midline where they normally fuse into the primitive heart tube
(Molkentin et al., 1997;
Kuo et al., 1997). Owing to
these ventral closure defects, it has been difficult to discriminate between a
direct role for Gata4 in heart formation and an indirect involvement via its
function in ventral morphogenesis. Furthermore, Gata4, Gata5 and Gata6 may act
in part redundantly, which may further occlude their cardiogenic potential.
Consistent with the direct involvement of Gata4 in heart development is the
congenital heart disease phenotype observed in individuals heterozygous for
deletions of chromosome 8p23.1 region, which includes the GATA4 gene
(Pehlivan et al., 1999;
Bhatia et al., 1999).
In vitro, Gata4 interacts with a wide array of proteins, including the
Tinman homolog Nkx2.5, the bHLH protein Hand and the multiple zinc-finger
protein Fog2 (Durocher et al.,
1997; Sepulveda et al.,
1998; Lee et al.,
1998; Lu et al.,
1999; Sepulveda et al.,
2002; Svensson et al.,
1999; Tevosian et al.,
1999; Dai et al.,
2002). Fog2 apparently modulates Gata-mediated transcriptional
regulation not only as a repressor, but also as an activator, depending on the
promoter and on cell type (Lu et al.,
1999). Fog2 is co-expressed with Gata4 in embryonic and adult
cardiomyocytes, and Fog2-deficient mice exhibit severe developmental heart
defects, suggesting a direct cardiogenic requirement
(Tevosian et al., 2000;
Svensson et al., 2000).
Moreover, these heart defects are rescued by cardiac-specific transgenic
expression of Fog2, providing strong evidence for a cardiac autonomous
function (Tevosian et al.,
2000).
The three Gata factors found in Drosophila (pannier,
serpent and grain) also play important developmental roles
(Abel et al., 1993;
Ramain et al., 1993;
Winick et al., 1993;
Lin et al., 1995;
Heitzler et al., 1996;
Rehorn et al., 1996;
Sam et al., 1996;
Riechmann et al., 1998;
Gajewski et al., 1999;
Brown and Castelli-Gair Hombria,
2000; Calleja et al.,
2000; Herranz and Morata,
2001). serpent is required for endodermal gut
development, mesodermal fat body formation and hematopoiesis. grain
is involved in filzkorper and head skeleton morphogenesis. pannier
(pnr) is best known for its requirement during embryonic and adult
dorsal closure, and for dorsomedial patterning. The Drosophila
counterpart of Fog2, U-shaped (Ush), can physically interact with Pnr, and (as
with Gata4 and Fog2) this interaction is mediated by the N-terminal zinc
finger of Pnr, which is thought to antagonize the role of Pnr as a
transcriptional activator (Haenlin et al.,
1997; Cubadda et al.,
1997). At blastoderm, pnr and ush are expressed
in response to the dorsal morphogen encoded by dpp
(Winick et al., 1993;
Jazwinska et al., 1999;
Ashe et al., 2000), and are
thought to be part of the process that subdivides the dorsal ectoderm
(Herranz and Morata,
2001).
It has been proposed that pnr promotes myocardial as opposed to
pericardial cell fates within the cardiac mesoderm
(Gajewski et al., 1999;
Gajewski et al., 2001) and
that ush antagonizes this function
(Fossett et al., 2000;
Fossett et al., 2001). Recent
lineage studies, however, have indicated that some heart progenitors give rise
to mixed myocardial/pericardial progeny, but others do not
(Park et al., 1998;
Ward and Skeath, 2000;
Han and Bodmer, 2003;
Alvarez et al., 2003), raising
the question of how pnr functions in different heart progenitor
populations. We have re-examined the cardiogenic role of these two genes. We
find that pnr is required for formation of all
tin-expressing cardiac progenitors, and loss of pnr function
results in loss of both myocardial and pericardial cell populations. By
contrast, loss of ush function did not affect the initial expression
of tin in the cardiac mesoderm, but is required for its maintenance
of expression as well as for the correct differentiation of both myocardial
and pericardial cells. Moreover, specific aspects of early cardiac
differentiation were preferentially affected: most of the seven-up
(svp)-expressing cells were absent in both mutants, more
ladybird (lbe)-expressing cells were absent in pnr
than in ush mutants, and the heart cells expressing
even-skipped (eve) were only moderately affected in
pnr and virtually not at all in ush mutants. Overexpression
of pnr in the entire mesoderm produces ectopic tin
expression, which is strongly antagonized by co-overexpression of
ush, suggesting a dual role for ush: one that is necessary
for cardiogenesis and another that counteracts pnr function. The
heart phenotype of either mutant is rescued by mesoderm-specific expression of
wild-type pnr or ush cDNA, respectively; and mesodermal
expression of a dominant-negative form of pnr (pnrEnR)
mimics the heart defects of pnr mutants when expressed in the
mesoderm. Interestingly, dorsal ectodermal dpp expression fades after
germband retraction in pnr mutants and cardiac differentiation is
also compromised when pnrEnR is overexpressed in the ectoderm.
Moreover, mesoderm-specific expression of brinker (brk), a
repressor of dpp target genes
(Jazwinska et al., 1999;
Zhang et al., 2001), has a
similar phenotype as pnr mutants or mesodermal pnrEnR
expression, suggesting that pnr may be mediating, at least in part,
the cardiogenic dpp signal in the mesoderm. Thus, we propose a dual
role for pnr in heart development: (1) pnr functions as a
mesodermal target and mediator of the ectodermally derived dpp signal
by acting in concert with tinman; and (2) pnr is also
required in the ectoderm for maintaining dorsal stripe dpp
expression.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
Df(2)ushrev18 is a null allele that deletes the entire
gene and some flanking genomic DNA
(Cubadda et al., 1997).
Misexpression of full-length transgenes was achieved using the Gal4-UAS system
(Brand and Perrimon, 1993),
using the following stocks: UAS-pnr
(Haenlin et al., 1997),
UAS-ush (Cubadda et al.,
1997), UAS-pnrD4
(Haenlin et al., 1997),
UAS-tin (Ranganayakulu et al.,
1998), UAS-brk
(Jazwinska et al., 1999),
UAS-pnrEnR (see below), da-Gal4
(Wodarz et al., 1995),
ZKr-Gal4 (Frasch, 1995),
69B-Gal4, 24B-Gal4 (Brand and Perrimon,
1993), twi-Gal4 (Greig and
Akam, 1993) and twi-Gal4;24B-Gal4
(Lockwood and Bodmer, 2002).
twi-Gal4, 24B-Gal4 and twi-Gal4;24B-Gal4 drive expression of UAS constructs
exclusively within the entire trunk mesoderm, without detectable expression in
the ectoderm. twi-Gal4 initiates expression earlier (at least by stage 9) than
24B-Gal4 (stage 11). ZKr-Gal4 drives expression exclusively in the
dorsolateral ectoderm, with highest levels in segments T3-A3, whereas 69B-Gal4
drives expression predominantly throughout the ectoderm but with less germ
layer specificity than ZKr-Gal4. da-Gal4 drives expression ubiquitously. The
following stocks were used for the rescue experiments:
All crosses were performed at 29°C. Combinations of transgene insertions were generated using standard genetic crosses. Oregon-R was used as the wild-type reference strain.
Dominant-negative Pannier
The dominant-negative pnr (UAS-pnrEnR) was constructed
according to the strategy described by Fu et al.
(Fu et al., 1998). Basically
the construct contains the repressor domain from engrailed (EnR,
amino acid 2-298) (Jaynes and O'Farrell,
1991; Smith and Jaynes,
1996; Tolkunova et al.,
1998) and the two N-terminal zinc-finger domains from pnr
(amino acid 153-293) (Ramain et al.,
1993). The pnr zinc-finger domains were PCR amplified
from the full-length pnr cDNA (5' primer,
CATCTCGAGATGCAGTTCTACTCGCCAAACGCC; 3'primer,
GCTCTAGACTACCTCCAAAGTGGAGCCTGTTC) and inserted into XhoI-
and XbaI-digested pUAST vector already containing the EnR domain
(Fu et al., 1998;
Han et al., 2002). Transgenic
flies were generated as previously described
(Brand and Perrimon,
1993).
Immunohistochemistry and in situ hybridization
Immunohistochemistry and in situ hybridization were performed as described
(Wu et al., 1995), except
that Cy3- or FITC-conjugated secondary antibodies (The Jackson Laboratory)
were used for fluorescent confocal microscopy. Fluorescent in situ double
labeling was performed as described (Knirr
et al., 1999). For Lbe staining the TSA Plus Fluorescence System
was used (Perkin Elmer). Embryos were mounted in VectaShield (Vector
Laboratories). Fluorescent embryo staining was analyzed by using a Zeiss
LSM510 confocal microscope. Primary antibodies were used at the following
dilutions: rabbit anti-Eve, 1:300 (Frasch
et al., 1987); mouse anti-PC 1:10
(Yarnitzky and Volk, 1995);
mouse anti-Lbe 1:40 (Jagla et al.,
1997); and rabbit anti-Mef2 1:2000
(Lilly et al., 1995).
Biotinlylated secondary antibodies (Vector Laboratories) were used at 1:200.
The following RNA probes were used: the dpp probe was generated from
the 2.9 kb dpp E55 fragment
(Padgett et al., 1987), the
tin probe from a 1.7 kb insert
(Bodmer et al., 1990), the
svp probe from a 3.1 kb insert
(Mlodzik et al., 1990), the
pnr probe from a 1.6 kb fragment
(Ramain et al., 1993) and the
Hand probe from a 0.5 kb insert
(Moore et al., 2000).
For expression analysis, 25-50 embryos were used as a sample size. Embryos were placed in categories based on expression: +, less than 1/4 staining or expression when compared with wild type; ++, 1/4 to 1/2; +++, 1/2 to 3/4; ++++, 3/4. When ZKr-Gal4 was used, only the segments T3-A3 were assayed.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Fossett et al., 2000). In
order to assess the requirement for pnr and ush in
initiating cardiac mesoderm and cardiac cell type-specific differentiation, we
first examined tin expression at progressively later developmental
stages in null mutants for both pnr and ush. During
mid-stage 11, tin is expressed segmentally in two regions of the
mesoderm (Fig. 2A). The dorsal
clusters of cells correspond to the cardiac precursor cells, whereas the
lateral clusters will become part of the visceral mesoderm. In same stage
pnr mutant embryos, tin expression is dramatically reduced
in the clusters that correspond to the cardiac precursors, indicating that
cardiogenesis is not being initiated (Fig.
2B,D). tin expression in the visceral mesodermal
clusters, as well as tin expression earlier in development, is
unaffected, suggesting the heart is a focal point for pnr function,
which is consistent with its cardiac-restricted expression in the mesoderm
(Fig. 1)
(Gajewski et al., 1999). By
contrast, ush mutant embryos initially seem to exhibit normal
tin expression (Fig.
2C,D). At later stages, when tin expression is solely
restricted to the heart cells, ush mutants display a progressively
more severe reduction in tin expression, approaching the phenotype of
pnr mutants (Fig.
2E-L). Thus, both pnr and ush are required for
heart-specific tin expression, although ush seems to be
initially dispensable.
|
|
;
Ward and Skeath, 2000;
Venkatesh et al., 2000;
Han et al., 2002). To
determine which heart cells are affected in pnr and ush
mutants, we examined mutant embryos with various markers. eve, for
example, is co-expressed with tin in 11 clusters of heart progenitors
(Fig. 2M), and these lineages
give rise to a subset of pericardial cells
(Frasch et al., 1987).
eve expression is only moderately reduced in pnr and hardly
at all in ush mutants at early as well as later stages
(Fig. 2M-S; note, however, the
patterning defects at progressively later stages in
Fig. 2R,S). By contrast, the
lbe-expressing heart progenitors, which produce both myocardial and
pericardial cells, are dramatically reduced in pnr but less so in
ush mutants (Fig.
2Q-T). Moreover, the svp-expressing cells, which also
give rise to a mixed lineage, but cease to co-express tin at later
stages, are dramatically reduced in both mutants
(Fig. 2U-X). Thus, all lineage
markers we assayed are reduced in both mutants, but each is affected with
disproportional severity, which is consistent with the idea that the formation
of each cell type has a direct requirement for pnr and
ush.
By stage 16, dorsal closure is complete and the linear heart tube has
assembled beneath the dorsal midline. A general marker for pericardial cells
shows a severe reduction in these cells in both mutants
(Fig.
2Y1-Y4). As pnr and ush
mutants fail to undergo dorsal closure, we wanted to determine if this process
was a prerequisite for cardiac cell-type specification, by perhaps causing
heart defects indirectly. As a test of this hypothesis, we examined another
dorsal closure mutant, raw (Byars
et al., 1999), in which we observe pericardial cell staining that
is normal or in excess along the dorsal mesoderm
(Fig. 2Z). This increase in
cardiac differentiation is probably due to an excess in dpp
signaling. Thus, a dorsal open phenotype in itself is insufficient to
compromise cardiac differentiation.
pnr can activate but not efficiently maintain ectopic
tin expression
Analysis of pnr and ush mutants suggests that both genes
functions are required for heart formation. In order to explore their
functional relationship in heart development further, we performed
overexpression studies. When pnr is expressed throughout the
mesoderm, tin expression is no longer confined to the heart
precursors by late stage 11, but is expanded laterally throughout the
mesoderm, suggesting that pnr is sufficient to ectopically initiate
tin expression within the mesoderm
(Fig. 3A,B). This is in
contrast to mesodermal overexpression of tin, which does not seem to
cause significant initiation of cardiogenesis without spatially intersecting
with dpp (and wg) signaling
(Lockwood and Bodmer, 2002).
Much of this lateral expansion of tin driven by ectopic pnr
does not persist beyond stage 13, where ectopic tin is reduced to
small ventrolateral cell clusters (Fig.
3H). These results suggest that pnr can activate early
ectopic expression of tin, but by itself is insufficient to maintain
it at significant levels.
|
; Sato and Saigo,
2000; Tomoyasu et al.,
2000). These results further support the idea that the appropriate
level of ush activity is crucial for correct heart development.
Previous data suggest that Ush exerts its inhibitory activity by binding to
the N-terminal zinc finger of Pnr, an interaction that is blocked in the
allele pnrD4, which has an amino acid substitution in this domain and
thereby abolishes Ush binding to Pnr
(Haenlin et al., 1997). When
we overexpressed this gain-of-function allele of pnr in the mesoderm,
we also observed ectopic induction of ventrolateral tin expression in
late stage 11 embryos (Fig.
3E), as with overexpression of the wild-type form of pnr
(Fig. 3B). At later stages,
however, ectopic tin levels increase dramatically in the
ventrolateral mesoderm and exceed those of wild-type pnr mesodermal
overexpression (Fig. 3H,K).
Unlike co-overexpression of wild-type pnr and ush, using
pnrD4 in conjunction with ush does not cause a
ush-like phenotype but rather one like pnrD4, which produces
ectopic tin expression (Fig.
3L), suggesting that ush is unable to inhibit the gain of
function of this pnr allele. Taken together, these data are
consistent with a dual function of ush: (1) a positive role in
maintaining tin expression within the cardiogenic region and (2) a
negative role in limiting the level and spatial distribution of pnr
activity (see Fig. 1D for
normal patterns of expression).
To determine if pnr cooperated with tin in heart
formation, we examined other markers of cardiac-specific differentiation.
Similar to the presence of ectopic tin
(Fig. 3H), ectopic expression
of Hand, a general heart marker
(Fig. 3M)
(Kolsch and Paululat, 2002),
is also observed ventrolaterally when pnr is induced throughout the
mesoderm (Fig. 3N).
Interestingly, more ectopic Hand expression is induced by
co-overexpressing pnr as well as tin
(Fig. 3O), similar to the
extent of ectopic tin with pan-mesodermal pnrD4
(Fig. 3K). This indicates that
pnr and tin act synergistically in their ability to induce
heart formation (overexpression of tin alone does not cause ectopic
heart induction) (see Lockwood and Bodmer,
2002), and that the presence of `activated' PnrD4 is sufficient to
sustain heart formation.
pnr and ush are required within the mesoderm and
ectoderm for heart development
It is well established that both ectodermal and mesodermal patterning
information is required for heart development
(Bodmer, 1993;
Azpiazu and Frasch, 1993;
Frasch, 1995;
Wu et al., 1995;
Park et al., 1996;
Azpiazu et al., 1996;
Lockwood and Bodmer, 2002). As
pnr and ush are expressed in both of these germlayers
(Fig. 1)
(Winick et al., 1993;
Heitzler et al., 1996;
Calleja et al., 2000;
Gajewski et al., 1999; Fosset
et al., 2000; Herranz and Morata,
2001), it is possible they are required for heart development in
either or both germlayers. We already showed that mesodermal overexpression of
pnr and ush alters tin expression, demonstrating
that these two genes can influence heart development within the mesoderm. In
order to test for a specific germlayer requirement directly, we overexpressed
these genes in the respective mutant background either in the mesoderm or the
ectoderm (see Materials and Methods). We then assayed for restoration (i.e.
rescue) of tin expression within the heart-forming mesoderm of these
rescue embryos. When pnr or ush is rescued in the mesoderm
specifically, 57% and 52% of the embryos, respectively, show cardiac-specific
tin expression that is restored close to wild-type levels
(Fig. 4A-C). The ubiquitous
da-Gal4 driver confers similar levels of rescue
(Fig. 4A), which suggests that
forced mesodermal expression of these genes is sufficient to initiate proper
heart formation. However, this interpretation does not exclude the possibility
that ectodermal pnr and ush expression is also a contributor
to heart-specific tin expression. Ectoderm-specific rescue of
pnr, using ZKr-Gal4 (Frasch,
1995) (see Materials and Methods), restores a considerable amount
of tin expression in a small but significant number of pnr
mutant embryos (Fig. 4A,D),
suggesting that pnr activity in the ectoderm can also contribute to
cardiogenesis. Because the level of ectodermal rescue is low, we cannot rule
out that this ectodermal driver also allows low levels of mesodermal
expression, which may be sufficient to achieve considerable rescue.
Nevertheless, these results are consistent with the hypothesis that
pnr and ush are mediators of an ectodermal cardiogenic
signal within both germlayers.
|
Maintaining dpp expression in the dorsal ectoderm requires
pnr and ush
As previously described, the expression patterns of pnr and
ush are initially broadly induced by dpp in the dorsal
ectoderm (Winick et al., 1993;
Ashe et al., 2000). Later,
these expression patterns are further refined but continue to overlap
spatially with ectodermal dpp (as well as wg) expression,
but their genetic relationship at later stages is not known. The maintenance
of dpp expression in a thin dorsal ectodermal stripe
(Fig. 5A) is thought to be
essential for controlling dorsal morphogenesis and closure by regulating a
number of target genes (Winick et al.,
1993; Heitzler et al.,
1996; Calleja et al.,
2000; Herranz and Morata,
2001). As pnr also exhibits an ectodermal requirement for
heart development, we hypothesized that pnr may be needed for
maintaining late dpp expression
(Herranz and Morata, 2001),
which in turn contributes to the progression of cardiogenesis
(Lockwood and Bodmer, 2002). A
late role for dpp in maintaining cardiogenesis has been difficult to
ascertain, because the stage 11 dorsal stripe expression could not be
abolished easily or selectively. When we examined dpp expression in
pnr and ush mutant embryos, we find that dorsal ectodermal
stripe expression of dpp is present at stage 11, but is progressively
reduced after germband retraction (Fig.
5). This finding is consistent with the idea that ectodermal
pnr/ush function acts via maintenance of dpp in a dorsal
stripe overlaying the forming heart. Thus, pnr/ush is likely to play
a crucial role in a crossregulatory network of the cardiogenic function of
dpp: first by mediating the early Dpp signal within the mesoderm and
later by maintaining ectodermal dpp expression.
|
;
Kirkpatrick et al., 2001;
Rushlow et al., 2001;
Saller and Bienz, 2001;
Zhang et al., 2001). When
brk is expressed throughout the mesoderm, there is a considerable
reduction in cardiogenesis as assayed by tin and eve
expression (Fig. 6A-D), similar
to what is observed in pnr mutants and mesodermal expression of
pnrEnR. This suggests that mesodermal pnr maybe a primary
target of the cardiogenic Dpp signal. Moreover, brk overexpression in
the ectoderm with the early onset ZKr-Gal4 driver selectively reduces
cardiac-specific tin expression as early as stage 11
(Fig. 6E, compare with
Fig. 2B). This is unlikely to
be due solely to an elimination of ectodermal pnr expression, which
causes a weaker and later-onset reduction of cardiac tin
(Fig. 4F). Therefore, we
examined if dpp expression itself is inhibited by
ZKr-Gal4>UAS-brk. Indeed, dpp expression is significantly
reduced within the ZKr-Gal4 expression domain already at stage 11
(Fig. 6G), which is much
earlier than is the case in pnr mutants, suggesting that dpp
is a direct target of brk. By contrast, when brk is
overexpressed with the later onset ectodermal driver, 69B-Gal4, tin
expression appears to be reduced later and only slightly
(Fig. 6F), accompanied by a
weak and late reduction of dpp expression
(Fig. 6H). These data suggest
that the Dpp pathway directly affects targets in the mesoderm, and that
pnr/ush (along with tin) are likely mediators and effectors
of dpp signaling that is necessary for proper heart development
(illustrated in Fig. 7).
|
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
),
whereas the function of ush was to limit the development of both by
interfering with dorsal spreading of the ventrally invaginated mesoderm
(Fossett et al., 2000). In
this study, we present evidence that pnr and ush are part of
the initiation and maintenance process of cardiogenesis, respectively, and
that they are required for the formation of both myocardial and pericardial
cell fates. In pnr mutants, tin expression is normal until
early stage 11, but by mid- to late-stage 11 becomes dramatically reduced
along the dorsal mesodermal edge, where the heart precursors normally form,
indicating a failure to specify cardiac mesoderm. By contrast, cardiac
tin expression in ush mutants appears normal initially, and
only later begins to exhibit a pronounced decrease in tin expression,
considerably after dorsal mesodermal migration is complete, unlike what was
observed in migration-defective heartless mutants
(Gisselbrecht et al., 1996),
indicating ush is involved in maintaining cardiac
differentiation. Even though tin expression is dramatically reduced in early and late stage pnr and ush mutants, respectively, cardiac subtype-specific gene expression is not affected equally. In stage 13 embryos, eve-, lbe- and svp-expressing cells were more affected in pnr than in ush mutants, presumably because the reduction in cardiac tin expression occurs earlier in pnr than in ush mutants. The largest difference in susceptibility to pnr relative to ush was observed with lbe expression. Of the three cardiac cell type-specific markers, Eve is the least sensitive to pnr loss-of-function. We speculate that this difference may be due to direct versus indirect (via tin) regulation of the relevant enhancers by pnr.
Ectopic ventrolateral tin expression is observed when pnr
is overexpressed in the mesoderm. This expansion in tin expression is
reminiscent to what is observed when dpp is expressed throughout the
mesoderm (Lockwood and Bodmer,
2002). This raises the question of whether pnr directly
regulates tin expression, or indirectly through dpp (or
both). As shown previously, global overexpression of pnr causes
ectopic dpp expression in the ectoderm
(Herranz and Morata, 2001).
However, we find that pan-mesodermal overexpression of pnr does not
cause an expansion of dpp expression in the mesoderm or the ectoderm
(data not shown). This suggests that pnr must be able to activate the
expression of tin either by itself or with some other factors,
excluding dpp, in this overexpression assay. This does exclude the
possibility that normally pnr and ectodermal Dpp signaling could act
in parallel to activate tin expression in the heart primordial (see
below). The ability of pnr to activate tin is likely to be
direct, as a heart-specific enhancer of tin
(Venkatesh et al., 2000)
contains several consensus Gata sites (M. Liu and R.B., unpublished). As shown
by transcription assays (Gajewski et al.,
2001), pnr is also a likely direct target of
tin, suggesting that they both contribute to maintaining each other's
expression. Both tin and pnr have been shown to be targets
of Dpp signaling at stage 9/10 (Xu et
al., 1998; Ashe et al.,
2000). We propose that dpp is necessary again at stage 11
to activate and maintain pnr and tin expression in the
cardiogenic region of the mesoderm (Fig.
7). First, pnr is activated with the help of early stage
11 tin, which is expressed broadly throughout the dorsal mesoderm,
and dpp, which is expressed in a narrow dorsal ectodermal stripe.
Then, at mid-stage 11, tin is restricted to the cardiogenic region
with the help of mesodermal pnr as well as continuous ectodermal Dpp
signaling. Once both are activated in the cardiogenic mesoderm, they are
likely to contribute to the maintenance of each other's expression, probably
aided again, but only moderately, by ectodermal Dpp signaling. This
interpretation is consistent with mesodermal versus ectodermal expression of
dominant-negative pnrEnR (Fig.
4) and the dpp target repressor encoded by brk
(Fig. 6). They are both equally
effective in reducing cardiac-specific tin when expressed in the
mesoderm, but ectodermal repression is more effective when dorsal-stripe
dpp at stage 11 is also affected (as in the case of
ZKr-Gal4>UAS-brk shown in Fig.
6G, but not with ZKr-Gal4>UAS-pnrEnR, data not
shown).
Mesodermal overexpression of ush and co-overexpression with pnr results in a decrease in the amount of cardiac-specific tin expression, suggesting that ush may not only be required along with pnr for heart development, but also play an inhibitory role. To test this hypothesis further, we overexpressed pnrD4, an allele that abolishes Ush binding to Pnr, and found not only ectopic tin expression at early stages of cardiogenesis, but also undiminished and even increased levels of expression at later stages. A similar phenotype was observed when both pnrD4 and ush were expressed throughout the mesoderm, suggesting that ush plays an anti-cardiogenic role by antagonizing the activity of wild-type Pnr, but not that of PnrD4. It would be interesting to see if pan-mesodermal overexpression of wild-type pnr in a ush mutant background results in ectopic tin expression similar to pnrD4, or if a minimal amount of ush activity is required to maintain normal and ectopic tin expression even with forced pnr expression. Interestingly, overexpression of both pnr and tin together in the mesoderm also causes a pnrD4-like phenotype, as assayed with Hand expression, suggesting that pnr and tin collaborate during initiation and subsequent differentiation of the heart progenitors.
Although in vitro the Ush-related FOG factors are primarily known for their
role as transcriptional repressors
(Svensson et al., 1999;
Tevosian et al., 1999), they
apparently can also function as co-activators: Fog2 can synergistically
activate or repress the transcriptional activity of Gata4, depending on the
(cardiac) promoter and cell line used (Lu
et al., 1999), and FOG-1 can cooperate with Gata1 to transactivate
NF-E2, an erythroid cell-specific promoter
(Tsang et al., 1998).
Moreover, the ventricular hypoplasia and other heart defects observed in
Fog2-deficient mice suggest a deficit rather than an excess in heart
development (Tevosian et al.,
2000; Svensson et al.,
2000). In addition, mice with an equivalent mutation to PnrD4
knocked into the Gata4 locus, thus eliminating binding to Fog2, exhibit in
many ways a similar phenotype to Fog2-deficient mice
(Crispino et al., 2001). These
data are consistent with the idea that Fog2 is normally involved in promoting
rather than antagonizing cardiogenesis, similar to what we have found with our
genetic studies during Drosophila heart development.
The dual role of Ush suggests that the amount of Ush may be crucial for whether it exerts its function as a an activator or repressor, perhaps by binding to different sets of co-factors in a concentration-dependent manner. Alternatively, the mode of transcriptional regulation by Ush could be stage-dependent: at stage 11, Pnr and Ush cooperate as transcriptional activators in initiating cardiac-specific tin expression and heart development, but later Ush becomes a repressor to limit the transcriptional activation of tin by Pnr
pnr and ush are initially broadly expressed in the dorsal
ectoderm of the early embryo, but by germband retraction the ectodermal
expression of pnr is confined to a narrow stripe of cells along the
border of the amnioserosa, which overlaps with the thin dorsal dpp
stripe (Fig. 1D). The early
ectodermal expression of ush is restricted to the presumptive
amnioserosa, and by germband extension, ush also overlaps with the
dorsalmost region of the ectoderm (Fossett
et al., 2000; Herranz and
Morata, 2001). These patterns of expression suggest that
pnr and ush may be acting in both germ layers. Our genetic
data, including germ layer-specific expression of wild-type and
dominant-negative pnr constructs, as well as germ layer-specific
rescue experiments suggest strongly that pnr and ush
function is not only needed in the mesoderm, but also in the ectoderm for
heart formation (see model in Fig.
7). The ectodermal requirement for pnr and ush
in heart development is probably achieved via the maintenance of dpp
expression, as dorsal stripe dpp expression diminishes in
pnr and ush mutants and ectodermal interference with
pnr, ush and/or dpp-signaling function compromises the
normal progression of heart development.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Abel, T., Michelson, A. M. and Maniatis, T. (1993). A Drosophila GATA family member that binds to Adh regulatory sequences is expressed in the developing fat body. Development 119,623 -633.[Abstract]
Alvarez, A. D., Shi, W. S., Wilson, B. A. and Skeath, J. B.
(2003). pannier and pointedP2 act sequentially
to regulate Drosophila development.
Development 130,3015
-3026.
Arceci, R. J., King, A. A., Simon, M. C., Orkin, S. H. and
Wilson, D. B. (1993). Mouse GATA-4: a retinoic acid-inducible
GATA-binding transcription factor expressed in endodermally derived tissues
and heart. Mol. Cell. Biol.
13,2235
-2246.
Ashe, H. L., Mannervick, M. and Levine, M. (2000). Dpp signaling thresholds in the dorsal ectoderm of the Drosophila embryo. Development 127,3305 -3312.[Abstract]
Azpiazu, N. and Frasch, M. (1993). Tinman and
bagpipe: two homeobox genes that determine cell fates in the dorsal mesoderm
of Drosophila. Genes Dev.
7,1325
-1340.
Azpiazu, N., Lawrence, P. A., Vincent, J. P. and Frasch, M.
(1996). Segmentation and specification of the Drosophila
mesoderm. Genes Dev. 10,3183
-3194.
Bhatia, S. N., Suri, V., Bundy, A. and Krauss, C. M. (1999). Prenatal detection and mapping of a distal 8p deletion associated with congenital heart disease. Prenat. Diagn. 19,863 -867.[CrossRef][Medline]
Bodmer, R., Jan, L. Y. and Jan, Y. N. (1990). A
new homeobox-containing gene, msh-2, is transiently expressed early during
mesoderm formation of Drosophila. Development
110,661
-669.
Bodmer, R. (1993). The gene tinman is required for specification of the heart and visceral muscles in Drosophila. Development 118,719 -729.[Abstract]
Bodmer, R. (1995). Heart development in Drosophila and its relationship to vertebrate systems. Trends Cardiovasc. Med. 5,21 -27.[CrossRef]
Bodmer, R. and Venkatesh, T. V. (1998). Heart development in Drosophila and vertebrates: conservation of molecular mechanisms. Dev. Genet. 22,181 -186.[CrossRef][Medline]
Bodmer, R. and Frasch, M. (1999). Genetic determination of Drosophila heart development. In Heart Development (ed. N. Rosenthal and R. Harvey), pp.65 -90. San Diego, London, New York: Academic Press.
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Brown, S. and Castelli-Gair Hombria, J. (2000). Drosophila grain encodes a GATA transcription factor required for cell rearrangement during morphogenesis. Development 127,4867 -4876.[Abstract]
Byars, C. L., Bates, K. L. and Letsou, A. (1999). The dorsal-open group gene raw is required for restricted DJNK signaling during closure. Development 126,4913 -4923.[Abstract]
Calleja, M., Herranz, H., Estella, C., Casal, J., Lawrence, P., Simpson, P. and Morata, G. (2000). Generation of medial and lateral dorsal body domains by the pannier gene of Drosophila. Development 127,3971 -3980.[Abstract]
Chartier, A., Zaffran, S., Astier, M., Semeriva, M. and
Gratecos, D. (2002). Pericardin, a Drosophila type IV
collagen-like protein is involved in the morphogenesis and maintenance of the
heart epithelium during dorsal ectoderm closure.
Development 129,3241
-3253.
Crispino, J. D., Lodish, M. B., Thurberg, B. L., Litovsky, S.
H., Collins, T., Molkentin, J. D. and Orkin, S. H.
(2001). Proper coronary vascular development and heart
morphogenesis depend on interaction of GATA-4 with FOG cofactors.
Genes Dev. 15,839
-844.
Cubadda, Y., Heitzler, P., Ray, R. P., Bourouis, M., Ramain, P.,
Gelbart, W., Simpson, P. and Haenlin, M. (1997).
U-shaped encodes a zinc finger protein that regulates the proneural genes
achaete and scute during the formation of bristles in Drosophila.
Genes Dev. 11,3083
-3095.
Dai, Y. S., Cserjesi, P., Markham, B. E. and Molkentin, J.
D. (2002). The transcription factors GATA4 and dHAND
physically interact to synergistically activate cardiac gene expression
through a p300-dependent mechanism. J. Biol. Chem.
277,24390
-24398.
Durocher, D., Charron, F., Warren, R., Schwartz, R. J. and Nemer, M. (1997). The cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors. EMBO J. 16,5687 -5696.[CrossRef][Medline]
Evans, T. and Felsenfeld. G. (1989). The erythroid-specific transcription factor Eryf1: a new finger protein. Cell 58,877 -885.[CrossRef][Medline]
Frasch, M. (1995). Induction of visceral and cardiac mesoderm by ectodermal Dpp in early Drosophila embryo. Nature 374,464 -467.[CrossRef][Medline]
Frasch, M., Hoey, T., Rushlow, C., Doyle, H. and Levine, M. (1987). Characterization and localization of the even-skipped protein of Drosophila. EMBO J. 6, 749-759.[Medline]
Fossett, N., Zhang, Q., Gajewski, K., Choi, C., Kim, Y. and
Schulz, R. A. (2000). The multitype zinc-finger protein
U-shaped functions in heart cell specification in the Drosophila embryo.
Proc. Natl. Acad. Sci. USA
97,7348
-7353.
Fossett, N., Tevosian, S. G., Gajewski, K., Zhang, Q., Orkin, S.
H. and Schulz, R. A. (2001). The Friend of GATA
proteins U-shaped, FOG-1, and FOG-2 function as negative regulators of blood,
heart, and eye development in Drosophila. Proc. Natl. Acad. Sci.
USA 98,7342
-7347.
Fu, Y., Yan, W., Mohun, T. J. and Evans, S. M. (1998). Vertebrate tinman homologues XNkx2-3 and XNkx2-5 are required for heart formation in a functionally redundant manner. Development 124,4439 -4449.
Gajewski, K., Fossett, N., Molkentin, J. D. and Schulz, R. A. (1999). The zinc finger proteins Pannier and GATA4 function as cardiogenic factors in Drosophila. Development 126,5679 -5688.[Abstract]
Gajewski, K., Zhang, Q., Choi, C. Y., Fossett, N., Dang, A., Kim, Y. H., Kim, Y. and Schulz, R. A. (2001). Pannier is a Transcriptional Target and Partner of Tinman during Drosophila Cardiogenesis. Dev. Biol. 233,425 -436.[CrossRef][Medline]
Gisselbrecht, S., Skeath, J. B., Doe, C. Q. and Michelson, A.
M. (1996). heartless encodes a fibroblast growth
factor receptor (DFR1/DFGF-R2) involved in the directional migration of early
mesodermal cells in the Drosophila embryo. Genes Dev.
10,3003
-3017.
Greig, S. and Akam, M. (1993). Homeotic genes autonomously specify one aspect of pattern in the Drosophila mesoderm. Nature 362,630 -632.[CrossRef][Medline]
Grepin, C., Dagnino, L., Robitaille, L., Haberstroh, L.,
Antakly, T. and Nemer, M. (1994). A hormone-encoding
gene identifies a pathway for cardiac but not skeletal muscle gene
transcription. Mol. Cell. Biol.
14,3115
-3129.
Haenlin, M., Cubadda, Y., Blondeau, F., Heitzler, P., Lutz, Y.,
Simpson, P. and Ramain, P. (1997). Transcriptional activity
of Pannier is regulated negatively by heterodimerization of the GATA
DNA-binding domain with a cofactor encoded by the u-shaped gene in Drosophila.
Genes Dev. 11,3096
-3108.
Han, Z., Fujioka, M., Su, M., Liu, M., Jaynes, J. B. and Bodmer, R. (2002). Transcriptional integration of competence modulated by mutual repression generates cell-type specificity within the cardiogenic mesoderm. Dev Biol. 252,225 -240.[CrossRef][Medline]
Han, Z. and Bodmer, R. (2003). Myogenic cells
fates are antagonized by Notch only in asymmetric lineages of the Drosophila
heart, with or without cell division. Development
130,3039
-3051.
Harvey, R. P. (1996). NK-2 homeobox genes and heart development. Dev. Biol. 178,203 -216.[CrossRef][Medline]
Heikinheimo, M., Scandrett, J. M. and Wilson, D. B. (1994). Localization of transcription factor GATA-4 to regions of the mouse embryo involved in cardiac development. Dev. Biol. 164,361 -373.[CrossRef][Medline]
Heitzler, P., Haenlin, M., Ramain, P., Calleja, M. and Simpson, P. (1996). A genetic analysis of pannier, a gene necessary for viability of dorsal tissues and bristle positioning in Drosophila. Genetics 143,1271 -1286.[Abstract]
Herranz, H. and Morata, G. (2001). The
functions of pannier during Drosophila embryogenesis.
Development 128,4837
-4846.
Ip, H. S., Wilson, D. B., Heikinheimo, M., Tang, Z., Ting, C.
N., Simon, M. C., Leiden, J. M. and Parmacek, M. S.
(1994). The GATA-4 transcription factor transactivates the
cardiac muscle-specific troponin C promoter-enhancer in nonmuscle cells.
Mol. Cell. Biol. 14,7517
-7526.
Jagla, K., Frasch, M., Jagla, T., Dretzen, G., Bellard, R. and Bellard, M. (1997). Ladybird, a new component of the cardiogenic pathway in Drosohila required for diversification of heart precursors. Development 124,3471 -3479.[Abstract]
Jaynes, J. B. and O'Farrel, P. H. (1991). Active repression of transcription by the engrailed homeodomain protein. EMBO J. 10,1427 -1433.[Medline]
Jazwinska, A., Rushlow, C. and Roth, S. (1999). The role of brinker in mediating the graded response to Dpp in early Drosophila embryos. Development 126,3323 -3334.[Abstract]
Jiang, Y. and Evans, T. (1996). The Xenopus GATA-4/5/6 genes are associated with cardiac specification and can regulate cardiac-specific transcription during embryogenesis. Dev. Biol. 174,258 -270.
