|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00491
DEVELOPMENT AND DISEASE |
1 Department of Molecular Biology and Pharmacology, Washington University
Medical School, Campus Box 8103, 660 S. Euclid Avenue, St. Louis, Missouri
63110, USA
2 Department of Molecular Biology, UT Southwestern Medical Center at Dallas,
5323 Harry Hines Boulevard, Dallas, Texas 75390, USA
3 Department of Internal Medicine, Washington University Medical School, Campus
Box 8103, 660 S. Euclid Avenue, St. Louis, Missouri 63110, USA
* Author for correspondence (e-mail: dornitz{at}pcg.wustl.edu)
Accepted 3 March 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Fibroblast growth factor, FGF, FGF receptor, FGFR2, Endochondral bone growth, Chondrocyte, Osteoblast, Ossification, Dermo1, Twist2, Cre recombinase, Conditional gene deletion
| INTRODUCTION |
|---|
|
|
|---|
Crouzon syndrome affects suture development and is not associated with limb
abnormalities, whereas Pfeiffer syndrome and Jackson-Weiss syndrome are
characterized by both craniosynostosis and broad medially displaced toes
(Jabs et al., 1994
;
Rutland et al., 1995
). In
contrast, Apert syndrome patients develop coronal synostosis, severe bony and
soft tissue syndactyly with associated joint fusion, and often have mental
retardation (Cohen, 2000
). The
unique features of craniosynostosis syndromes probably reflect differences in
the mechanism by which FGFR activity is altered by specific missense mutations
(Wilkie, 1997
).
Four FGFR tyrosine kinases bind with varying affinity and specificity to a
family of 22 FGF ligands (Ornitz and Itoh,
2001
). Ligand binding specificity is regulated by specific
sequences in the extracellular region and by the alternative splicing of exons
encoding the carboxyl-terminal half of immunoglobulin (Ig) domain III.
Alternative splicing of Fgfr2 is tissue specific, resulting in
epithelial variants (b splice forms) and mesenchymal variants (c splice forms)
(Miki et al., 1992
;
Naski and Ornitz, 1998
;
Orr-Urtreger et al., 1993
).
Ligand binding studies demonstrate that mesenchymally expressed ligands such
as FGF7 and 10, activate FGFR2b, whereas FGF2, 4, 6, 8 and 9 activate FGFR2c
(Ornitz and Itoh, 2001
;
Ornitz et al., 1996
).
The majority of missense mutations in FGFR2 result in some
ligand-independent dimerization, phosphorylation and constitutive receptor
signaling. Interestingly, a single missense mutation which causes Apert
syndrome (P252R or S253W in FGFR2) abolishes its ability to discriminate
between epithelially and mesenchymally expressed FGF ligands, providing an
explanation for the increased severity of Apert syndrome compared to other
craniosynostosis syndromes resulting from mutations in FGFR2
(Anderson et al., 1998
;
Yu et al., 2000
;
Yu and Ornitz, 2001
).
Gain-of-function mutations in FGFR3 result in three related dwarfing
chondrodysplasia syndromes; hypochondroplasia, achondroplasia (ACH) and
thanatophoric dysplasia (TD) (Naski and
Ornitz, 1998
; Ornitz and
Marie, 2002
). Fgfr3 is expressed in the cartilage of the
developing embryo, prior to formation of ossification centers. In the
epiphyseal growth plate, Fgfr3 is expressed in proliferating and
prehypertrophic chondrocytes. Mouse models for ACH and TD demonstrate that
activation of FGFR3 inhibits chondrocyte proliferation and differentiation
(Chen et al., 1999
;
Chen et al., 2001
;
Iwata et al., 2001
;
Li et al., 1999
;
Naski et al., 1998
;
Segev et al., 2000
;
Wang et al., 1999
). In
contrast, mice lacking Fgfr3 exhibit skeletal overgrowth
(Colvin et al., 1996
).
Together, these data establish Fgfr3 as a negative regulator of
endochondral bone growth.
Mice homozygous for null alleles of Fgfr2 die at embryonic day
10.5 (E10.5) with multiple defects in organogenesis, including the absence of
limb buds (Xu et al., 1998
).
Specific deletion of the b exon of Fgfr2 results in a neonatal lethal
phenotype, also lacking limb buds (De
Moerlooze et al., 2000
). This phenotype is similar to that of mice
lacking Fgf10 (Min et al.,
1998
; Sekine et al.,
1999
). At E10.5, skeletal development has not progressed beyond
the condensation stage. However, Fgfr2 is expressed at high levels in
condensed mesenchyme that will give rise to cartilage and bone and later in
the perichondrial and periosteal tissues that give rise to osteoblasts
(Ornitz and Marie, 2002
). To
evaluate the function of Fgfr2 in skeletal development, we used the
conditional gene silencing approach to specifically disrupt Fgfr2
signaling in the chondrocyte and osteoblast lineages. We show that
Fgfr2 is not required for osteoblast differentiation but is essential
for osteoblast proliferation and for the maintenance of osteoblast anabolic
function.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
|
To generate the Fgfr2
allele,
Fgfr2+/flox heterozygous mice were mated with
ß-actin-cre mice (Lewandoski
et al., 1997a
) and F1 animals were screened for the
presence of Fgfr2flox and ß-actin-cre
alleles. The double heterozygous mice were then mated to wild-type mice to
obtain a germline-transmitted Fgfr2
allele.
Primer F1 (5'-ATAGGAGCAACAGGCGG), F2 (5'- TGCAAGAGGCGACCAGTCAG)
and F3 (5'- CATAGCACAGGCCAGGTTG) were used for PCR genotyping of
Fgfr2 alleles. F1 and F2 produced a 142 bp and a 207 bp fragment from
wild type and Fgfr2flox alleles, respectively, and F1 and
F3 produced a 471 bp fragment from the Fgfr2
allele
(Fig. 2D).
Skeletal preparations and radiography
Skeletons were prepared as described previously
(Colvin et al., 1996
).
Radiography studies were carried out using a Specimen Radiography System
(Faxitron X-ray Corporation, IL) X-ray source. Bone mineral density was
determined using dual energy X-ray absorptiometry (DEXA) with a PIXImus Mouse
Densitometer (GE Lunar Medical Systems).
ß-galactosidase histochemistry
For whole-mount staining, E11.5 embryos were fixed in 4% paraformaldehyde
in PBS for 60 minutes, washed in PBS and stained in ß-gal staining buffer
(5 mM K3Fe(CN)6, 5 mM
K4FE(CN)6·3H2O, 1 mM MgCl2,
0.01% sodium desoxycholate, 0.009% NP40, 0.002% X-gal) for 8 hours, at
4°C. After post-fixing in 4% paraformaldehyde, the limb buds were cut off,
embedded in paraffin wax and sectioned (4 µm). E15.5 embryos, immediately
after dissection were embedded in OCT at -20°C and sectioned (8 µm).
Frozen sections were dried at room temperature for 20 minutes, fixed in 4%
paraformaldehyde for 10 minutes and stained for 2 hours at 37°C. At
postnatal ages, the bones of the mice were dissected, fixed in 4%
paraformaldehyde in PBS, decalcified in 14% EDTA for 10 days at 4°C and
embedded in OCT at -20°C. 8 µm frozen sections were stained for 2 hours
at 37°C. All sections were counter stained with Nuclear Fast Red.
Histological analysis
Tissues were fixed in 4% paraformaldehyde in PBS, decalcified in 14% EDTA
and embedded in paraffin wax. Sections were stained with Hematoxylin and Eosin
(H&E), von Kossa staining (for minerized bone tissues) or tartrate
resistant alkaline phosphatase (TRAP) staining (for osteoclast activity).
Computer imaging using AxioVision 3.0 software (Zeiss) was used for
histomorphometric analysis. The bone volume and tissue volume were measured on
the trabecular bone region of the proximal tibia, including both the primary
and secondary spongiosa. The length of proliferating and hypertrophic
chondrocyte zones and the length of the metaphysis was measured along the
midline of the proximal tibia growth plate.
Osteoblasts and osteoclasts in the primary spongiosa were counted in a region extending 100 µm from the chondro-osseous junction and including the entire width of the metaphysis. The total areas counted were measured using AxioVision 3.0 image software (Zeiss).
The mineral apposition rate (MAR) was determined by calcein double labeling. Mice were injected with calcein (20 mg/kg) 13 days and 4 days prior to sacrifice. Following dissection, long bones were fixed in 70% ethanol and embedded in polymethyl methacrylate resin for sectioning. Coronal sections of comparable anatomic position were examined by fluorecence microscopy. The mean distance between the calcein double labels was measured using AxioVision 3.0 image software (Zeiss).
Analysis of cell proliferation
Anti-BrdU immunohistochemistry was carried out as previously described
(Naski et al., 1998
).
Proliferating osteoblasts were counted as described above for total
osteoblasts. The percentage of BrdU-positive nuclei versus total nuclei was
calculated as the proliferation index.
RT-PCR
Total RNA was prepared from E10.5 whole embryos or from legs of E16.5
embryos using the RNeasy kit (Qiagen) according to the manufacturer's
instructions. At E10.5, the amniotic membrane was removed and
Fgfr2
/
embryos were identified by lack of limb buds. At E16.5, legs were dissected
from the whole embryos and the skin were carefully removed. First strand cDNA
synthesis and subsequent PCR amplification were carried out as described
previously (McEwen and Ornitz,
1997
). The forward primer 5'-CAAAGGCAACTACACCTGCC and the
reverse primer 5'-CAGCCATGACTACTTGCCCG used in RT-PCR analysis were
located in exon 6 and 12 of Fgfr2, respectively. qRT-PCR was
performed on an Applied Biosystems Gene Amp 5700 Sequence Detection system
using Sybr Green fluorescent dye binding to PCR products
(Bustin, 2000
). Osteocalcin
gene expression was quantified as previously described
(Willis et al., 2002
).
In situ hybridization
In situ hybridization was performed as described previously
(Liu et al., 2002
). The
Fgfr2 IIIcTM domain probe, which is 348 bp long and includes exon 9
(IIIc) and 10 (TM) sequences, was generated by PCR amplification with forward
primer 5'-CCGCCGGTGTTAACACCAC and reverse primer
5'-TGTTACCTGTCTCCGCAG and cloned into the pGEM-T EASY vector (Promaga).
Plasmids used for generating 33P-labeled riboprobes were:
Fgfr1 (Peters et al.,
1992
), Fgfr2-TK (De
Moerlooze et al., 2000
), collagen type I
(Metsaranta et al., 1991
);
osteocalcin (provided by K. Nakashima); osteopontin
(provided by K. Lee) and Cbfa1 (Runx2; provided by K.
Nakashima).
| RESULTS |
|---|
|
|
|---|
To test in vivo function and tissue specificity of Dermo1-CRE,
Dermo1cre/+ mice were mated to Rosa26 reporter
mice (R26R) in which the original ß-galactosidase (ß-gal)
insertion into the Rosa26 locus was disrupted by insertion of a
loxP-neo cassette (Soriano,
1999
). The lacZ gene can be reactivated through
CRE-mediated excision of the loxP-neo sequence
(Soriano, 1999
). In double
heterozygous (Dermo1cre/+; R26R/+) embryos or mice
ß-gal activity was detected at the surface of the embryo as early as E9.5
and in mesodermal tissues such as branchial arches and somites
(Fig. 1D). Little ß-gal
activity was detected in neural and ectodermal tissues
(Fig. 1D,E). During
endochondral ossification, ß-gal activity was first detected in condensed
mesenchyme from which both chondrocytes and osteoblasts are derived
(Fig. 1F). Later in development
ß-gal activity was detected in chondrocytes in growth plate cartilage and
in osteoblasts in the perichondrium, periosteum and endosteum
(Fig. 1G,I,J,L). Occasionally a
clone of chondrocytes was observed that failed to express ß-gal activity
(Fig. 1G,I). Interestingly,
bone marrow cells and osteoclasts were negative for ß-gal activity
(Fig. 1L). During
intramembranous ossification in developing sutures, ß-gal activity was
present at the osteogenic fronts and in surrounding mesenchymal tissues (data
not shown).
In situ hybridization studies were used to compare the pattern of
Fgfr2 expression with that of Dermo1-CRE activity.
Consistent with published data (Delezoide
et al., 1998
; Orr-Urtreger et
al., 1991
; Peters et al.,
1992
), Fgfr2 was expressed throughout all phases of
skeletal developmental. Initially, Fgfr2 was expressed in condensing
mesenchyme (Delezoide et al.,
1998
; Orr-Urtreger et al.,
1991
; Peters et al.,
1992
). Later in development, Fgfr2 was predominantly
localized to perichondrial and periosteal tissue and weakly to endosteal
tissue and trabecular bone (Fig.
1H,K). Fgfr2 was also present in periarticular
chondrocytes but was not detected in growth plate chondrocytes
(Fig. 3D,E). In developing
sutures, Fgfr2 expression was found in osteoblasts in the osteogenic
fronts (data not shown). The prominent expression of Fgfr2 in
osteoblast lineages suggested an essential function for FGFR2 during skeletal
development. Because ß-gal activity patterns indicated that osteoblasts
were lineage descendants of cells that expressed Dermo1-cre, the
function of FGFR2 during osteoblast development and bone formation can be
studied by a Dermo1-CRE-mediated conditional gene silencing
approach.
|
Mice heterozygous for the Fgfr2-flox allele
(Fgfr2+/flox) were bred to ß-actin-cre
transgenic mice (Lewandoski et al.,
1997a
) to create a germline null allele of Fgfr2
(Fgfr2
) (Fig.
2A). The consequence of different allelic combinations of wild
type Fgfr2(Fgfr2+), Fgfr2flox and
Fgfr2
alleles showed that all allelic combinations
(Fgfr2+/flox, Fgfr2flox/flox,
Fgfr2+/
or
Fgfr2flox/
) were phenotypically wild
type, except for the
Fgfr2
/
embryos, which
died between E10 and E11.
Fgfr2
/
embryos
developed no limb buds, and failed to form a functional placenta, a probable
cause of early embryonic lethality (data not shown). These phenotypes were
consistent with that of other Fgfr2 null mice
(Xu et al., 1998
), suggesting
that the two inserted loxP sites used for conditional targeting of
Fgfr2 are functional and that the Fgfr2
allele is a null allele.
The level of Fgfr2 transcription in E10.5 wild type and
Fgfr2
/
embryos was evaluated by semi-quantitative RT-PCR using primers in exons
flanking the three targeted exons (Fig.
3H). Similar amounts of mRNA were transcribed from both wild type
Fgfr2 and Fgfr2
alleles, suggesting that
deletion of exons 8-10 did not affect mRNA transcription, processing, or
stability. However, proteins translated from the
Fgfr2
transcript, if any, would be non-functional
because of the lack of exons required for ligand binding (IIIb or IIIc) and
membrane insertion (TM domain).
Generation of Fgfr2 conditional knockout (CKO) mice
To conditionally inactivate Fgfr2 in the developing skeleton,
Fgfr2+/
; Dermo1cre/+ double heterozygous
mice were mated with Fgfr2flox/flox homozygous mice
(Fig. 2D,
Fig. 3A). Fgfr2
conditional knockout (Fgfr2cko) mice
(Fgfr2flox/
;
Dermo-1cre/+) were born alive with the expected
Mendelian frequency (
25%). The efficiency of Dermo1-CRE-mediated
recombination was assessed by detecting Fgfr2 expression in
developing long bones of control and Fgfr2cko mice by in
situ hybridization (Fig. 3B-E)
and by RT-PCR (Fig. 3H). An in
situ hybridization probe, derived from exons 9 and 10 (encoding IIIc and TM
domain, respectively), only detected intact Fgfr2 in normal control
but not Fgfr2cko femurs of E16.5 and P10 mice
(Fig. 3B,C, and data not
shown). In contrast, a probe derived from the tyrosine kinase domains of
Fgfr2 detected both intact and deleted Fgfr2. The probe
showed similar expression patterns in both Fgfr2cko and
control femurs of E16.5 and P10 mice (Fig.
3D,E, and data not shown). RT-PCR analysis also revealed that
intact Fgfr2 transcripts were undetectable in skeletal tissues
dissected from Fgfr2cko mice
(Fig. 3H). Together, these data
demonstrated that the Fgfr2flox allele was
effectively targeted by Dermo1-CRE-mediated recombination in
developing skeletal tissues. In most experiments an
Fgfr2
allele was incorporated to increase the
efficiency of CRE-mediated recombination. However,
Fgfr2flox/flox, Dermo1cre/+ mice appeared
phenotypically identical to
Fgfr2flox/
;
Dermo-1cre/+ mice.
FGFR1 is another member of the FGF receptor family that closely resembles FGFR2 in both structure and function. Fgfr1 could be partially redundant with Fgfr2 and could be upregulated in mice lacking a functional Fgfr2 allele. Fgfr1 expression was therefore examined. The results showed that Fgfr1 expression clearly overlapped with that of Fgfr2 in developing bone. However, no difference in Fgfr1 expression between Fgfr2cko and control mice was observed (Fig. 3F,G).
Fgfr2cko embryos and newborn pups were phenotypically similar to littermate controls. However, during early postnatal development, Fgfr2cko pups exhibited severe growth retardation and by four weeks of age, Fgfr2cko mice were 40-50% smaller than controls (Fig. 3I,J). After a characteristic plateau in growth between 14 and 22 days, Fgfr2cko mice showed a relatively normal growth curve. However, adult Fgfr2cko mice remained 30-40% smaller than controls. Fgfr2cko mice were fertile and had a similar life span to that of controls (>1year).
Skeletal abnormalities in Fgfr2cko mice
All Fgfr2cko mice exhibited a dwarfism phenotype. At
P15 and P21, the femur length of Fgfr2cko mice was 87% and
79% of control (Table 1),
respectively. Skeletal preparations showed a shortened axial and appendicular
skeleton (in 21 of 23 skeletons examined) as well as a domed-shaped skull
(Fig. 4A,B). Other skeletal
abnormalities were also found in Fgfr2cko mice with
variable severity. The midline sutures (sagittal and metopic) remained patent
and the occipital arch was open at the dorsal midline (in 5 of 7 mice
examined) (data not shown). Vertebrae also showed abnormalities, including a
non-ossified gap in the dorsal midline of both cervical and thoracic vertebrae
and absence of the spinous processes (in 7 of 7 mice examined)
(Fig. 4C,D). In
Fgfr2cko mice, several tarsal joints failed to develop (13
of 13 mice examined) (Fig.
4E-H). The origin of the joint fusion appeared to be a failure of
cavitation of the cartilaginous anlage prior to ossification of these bones
(Fig. 4E,F).
|
|
Fgfr2 is not necessary for differentiation of the osteoblast
lineage
Because the osteoblast is the only cell type that engages in bone formation
and was one of the cell types effectively targeted by Dermo1-CRE,
reduced bone density in Fgfr2cko mice was likely the
result of decreased bone formation as a consequence of osteoblast malfunction.
Previous in vitro studies suggested that FGFR signaling affects osteoblast
differentiation by regulating osteoblast-specific gene expression
(Chikazu et al., 2001
;
Newberry et al., 1996
;
Newberry et al., 1997
;
Zhou et al., 2000
). Reduced
bone formation in Fgfr2cko mice could result from
down-regulation of genes required for osteoblast differentiation. The
expression of several osteoblast marker genes were examined by in situ
hybridization and quantitative RT-PCR (qRT-PCR). At E16.5, although functional
Fgfr2 transcripts were no longer present, skeletal development was
not dramatically affected. Skeletal preparations at this age show no evidence
of delayed ossification (data not shown) and long bones were of normal size
with a well developed and ossified bone collar
(Fig. 5A,D). The expression of
the genes Cbfa1, osteopontin and osteocalcin showed a
similar pattern and intensity in Fgfr2cko and control mice
(Fig. 5B,C,E,F and data not
shown). However, during early postnatal development, histological analysis
showed dramatic differences between Fgfr2cko mice and
normal controls in osteogenic regions (see below). At P7, expression of
Cbfa1, collagen type I, osteopontin and osteocalcin in
Fgfr2cko mice showed decreased signal intensity and area,
when compared with that of controls (Fig.
5G-L). This corresponded with reduced total osteoblast number in
osteogenic regions of Fgfr2cko mice (see below). qRT-PCR
showed a modest decrease in osteocalcin expression in
Fgfr2cko mice (80% of control, P<0.05).
osteopontin expression was not significantly different in
Fgfr2cko mice and control mice. These data suggest that
loss of Fgfr2 does not block osteoblast differentiation.
|
In Fgfr2cko mice, the metaphysis contained significantly less trabecular bone and in some instances was nearly devoid of trabecular bone (Fig. 6A,B, Table 2 and data not shown). Morphometric analysis showed that trabecular zone length and width was reduced, resulting in a 40% decrease in metaphyseal area (Table 2). Because osteoblasts were distributed throughout the entire metaphysis, the total osteoblast number was reduced. However, osteoblast cell density was not significantly different in the primary spongiosa in Fgfr2cko mice (Table 3). Significantly, in Fgfr2cko mice, metaphyseal osteoblasts were disorganized along the trabecular surface and showed an atrophic morphology with a granular-appearing cytoplasm (Fig. 6C,D).
|
|
|
The periosteal surface in the mid-diaphysis is another osteogenic zone in
developing long bone (Caplan and Pechak,
1987
). In control mice, active osteoblasts line the periosteal
surface of cortical bone. In Fgfr2cko mice, the number of
active osteoblasts residing in the diaphyseal periosteum was decreased
(Fig. 6G,H). Additionally, in
control mice the mid-diaphysis of the femur contained many lacunae, which were
occupied by osteoblasts. However, in Fgfr2cko mice, the
mid-diaphyseal region of the femur contained only a few lacunae. The lacunae
that were present were more compact and contained fewer atrophic-appearing
osteoblasts (Fig. 6H).
The ability of osteoblast to produce bone matrix was assessed by measuring MAR by calcein double labeling. During the third and forth postnatal week the MAR on Fgfr2cko mice was too low to measure while control mice had a MAR value of 2.11±0.03 µm/day on the diaphyseal endosteum and 2.43±0.07 µm/day on the diaphyseal periosteum of the femur (Fig. 7A,B).
|
Another possible reason for decreased cell number is increased cell death due to loss of Fgfr2. However, total numbers of apoptotic cells, analyzed by TUNEL labeling and caspase 3 immunohistochemistry, were similar in femur sections of Fgfr2cko and control mice at both embryonic and postnatal stages (data not shown). These results suggested that Fgfr2 was essential for proliferation but not survival of osteoblasts.
Reduced hypertrophic chondrocyte zone in Fgfr2cko
mice
Longitudinal bone growth is tightly coupled to proliferation and
differentiation of chondrocytes in the growth plate. When either process is
disrupted, longitudinal bone growth is affected. Since
Fgfr2cko mice also showed a dwarfism phenotype, the growth
plate of Fgfr2cko mice was examined. At all developmental
stages examined, the growth plate of Fgfr2cko mice showed
an overall intact histomorphologic architecture
(Fig. 6A,B). In
Fgfr2cko mice the length of the proliferation zone was
similar to that of controls (Table
2) and the BrdU labeling index was not significantly changed
(Fig. 7C,D). However, the
length of the hypertrophic zone was greatly reduced during early postnatal
development (Table 2). The
length of the hypertrophic zone is controlled by the rate of proliferating
chondrocyte differentiation and by osteoclast (chondroclast)-mediated
degradation at the chondro-osseous junction
(Gerber et al., 1999
;
Turner et al., 1994
).
The Indian hedgehog (IHH) signaling pathway is an important regulator of
chondrocyte proliferation and differentiation
(Karsenty and Wagner, 2002
;
Ornitz and Marie, 2002
). The
IHH receptor, Patched, is expressed by proliferating chondrocytes
(St-Jacques et al., 1999
) and
its level of expression is a measure of the strength of the IHH signal
(Chen and Struhl, 1996
;
Ingham, 1998
). No significant
difference was observed in Patched expression in
Fgfr2cko and control mice (data not shown), indicating
that IHH activation in the growth plate was intact during skeletal
development. These observations suggest that the primary cause of dwarfism and
the reduced size of the hypertrophic zone are unlikely to be caused by
defective chondrocyte differentiation.
Osteoclasts were examined by staining for TRAP activity. During embryogenesis (E16.5), no significant difference was found between control and Fgfr2cko mice (data not shown). However during early postnatal development, although the distribution pattern of TRAP-positive cells was similar in Fgfr2cko and control mice, the relative number of TRAP-positive cells in the chondro-osseous junction increased by 40% (n=6 mice, P<0.001) in Fgfr2cko mice (Fig. 7G,H). Interestingly, osteoclasts were also more mature (larger) than in control mice.
| DISCUSSION |
|---|
|
|
|---|
Fgfr2 is one of the earliest genes expressed in the mesenchymal
condensation (Delezoide et al.,
1998
; Orr-Urtreger et al.,
1991
; Peters et al.,
1992
); probably before the very first expression of
Dermo1-cre (Li et al.,
1995
). It is not known how long it takes for complete CRE-mediated
gene inactivation after cre is first expressed and translated. It is
therefore possible that FGFR2 protein is synthesized and retained in
condensing mesenchymal cells, even after the Fgfr2 gene is disrupted.
The precise timing of Fgfr2 inactivation could therefore lead to
heterogeneity in the onset and possible severity of the skeletal phenotype.
Because of this potential delay in Fgfr2 inactivation, the complete
function of FGFR2 in the mesenchymal condensation has not been clearly
addressed by this study. However, based on the comparative expression patterns
of Dermo1-cre and Fgfr2, we conclude that the skeletal
phenotype in Fgfr2cko mice is a direct cell autonomous
consequence of loss of FGFR2 function in the osteoblast, following the
formation of the mesenchymal condensation. Interestingly, introduction of a
frame shift mutation into the c exon of Fgfr2 resulted in a viable
mouse with a similar degree of skeletal dwarfism and similar defects in
skeletal morphology (Eswarakumar et al.,
2002
). However, in Fgfr2IIIc-/- mice a delay
in ossification was observed whereas in Fgfr2cko mice
there was no delay in ossification. This may reflect differences in timing of
Fgfr2 inactivation.
Regulation of osteoblast development
Recent studies have established the transcription factor Cbfa1 as
a determinant of osteoblast differentiation. Cbfa1 is the earliest
and most specific gene expressed during osteoblast differentiation. In
Cbfa1-deficient mice, the osteoblast differentiation process is
completely blocked (Komori et al.,
1997
; Otto et al.,
1997
). CBFA1 controls the expression of genes that encode various
bone matrix proteins. The similar expression of Cbfa1 and other
osteoblast-specific genes in both Fgfr2cko and control
mice indicated that Fgfr2 is not necessary for the early stages of
osteoblast differentiation. However, osteoblast differentiation is normally
accompanied by profound morphological and functional changes. Osteoprogenitor
cells, which appear morphologically like fibroblasts, are relatively small and
have a compact cytoplasm. Although osteoprogenitor cells produce bone matrix
proteins, their main function is to maintain the progenitor pool through
proliferation. In contrast, mature osteoblasts are plump cuboidal cells with
ample cytoplasm. Electron microscopy studies reveal that the cytoplasm of
mature osteoblasts contains large amounts of rough endoplasmic reticulum and
an extensive Golgi apparatus, consistent with their function in synthesizing
large amounts of bone matrix proteins. The presence of atrophic cytoplasm in
osteoblasts of Fgfr2cko mice and the dramatically
decreased MAR strongly indicates that their protein synthesis capacity was
reduced. Fgfr2 was expressed by osteoprogenitor cells in
perichondrial and periosteal tissues (Fig.
1H,K) and by mature osteoblasts in the metaphysis, and in
diaphyseal lacunae (Fig. 1K).
Notably, osteoblasts in diaphyseal lacunae were post mitotic
(Fig. 7E). The Fgfr2
expression pattern and the osteogenic phenotype in
Fgfr2cko mice suggests that FGFR2 signaling regulates
proliferation of osteoprogenitor cells and the anabolic function of mature
osteoblasts. Consistent with this observation, the effect of implanting FGF2
beads over the coronal suture in mice suggested that the primary function of
FGFR2 is to regulate osteoblast proliferation in suture mesenchyme
(Iseki et al., 1999
).
It has been shown that FGFR1 signaling can directly regulate Cbfa1
expression in osteoblasts (Zhou et al.,
2000
). In this study, loss of Fgfr2 did not affect
Cbfa1 expression, suggesting that FGFR2 signaling may function in a
Cbfa1-independent manner. Whether Cbfa1 is directly involved
in osteoblast proliferation is not clear. Interestingly, low-density
lipoprotein receptor-related protein (Lrp)-5-deficient mice have been
shown to have a Cbfa1-independent decrease in osteoblast
proliferation and bone formation (Kato et
al., 2002
). Since LRP5 mediates WNT signaling, these data,
together with this study, suggest that proliferation of the osteoblast lineage
is regulated by multiple signaling pathways that do not require CBFA1 as a
downstream effector. Moreover, the morphological characteristics of mature
osteoblasts are similar to other cell-types engaged in the synthesis and
secretion of large amounts of proteins. This also suggests
non-lineage-specific regulation of metabolic function because, unlike the
complete lack of bone formation in Cbfa1-deficient mice, the
diminished bone formation in Fgfr2cko mice suggests that
FGFR2 signaling is complementary to that of CBFA1 during skeletal development.
Indeed, we have identified a transcriptional activation domain in CBFA1 that
is markedly enhanced in response to FGFR2 activation (D.A.T. and D.M.O.,
unpublished).
Metaphyseal osteogenesis as a determinant of longitudinal bone
growth
Skeletal dwarfism is often associated with decreased chondrocyte
proliferation. In ACH, the hypertrophic zone is shortened as a result of
reduced chondrocyte proliferation and differentiation
(Naski et al., 1998
;
Ornitz and Marie, 2002
). In
contrast, Fgfr2cko mice have decreased bone length without
apparent defects in chondrocyte proliferation. However, similar to
Fgfr2IIIc-/- mice
(Eswarakumar et al., 2002
),
Fgfr2cko mice also exhibit a shortened hypertrophic zone.
Interestingly, the decreased length of the hypertrophic zone in
Fgfr2cko mice was accompanied by an increase in the number
of mature osteoclasts in the chondro-osseous junction. Increased osteoclast
activity could account for the decrease in hypertrophic zone length by
increasing the rate of removal of calcified hypertrophic chondrocyte matrix.
Furthermore, in contrast to ACH, in which bone formation in the diaphysis is
not affected and diaphyseal cortical bone has normal thickness
(Rimoin et al., 1970
),
Fgfr2cko mice showed a dramatic reduction in diaphyseal
thickness. These data suggest that the pathogenesis of the dwarfism in
Fgfr2cko mice is significantly different from that of ACH
and that metaphyseal osteogenesis, which is severely affected in
Fgfr2cko mice, is an important regulator of longitudinal
bone growth.
Fgfr2cko mice exhibit decreased bone density throughout their life (examined up to 58 weeks). The finding that FGFR2 is required by the osteoblast to regulate mineral deposition suggests that FGF signaling may be important for the maintenance of bone density.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Anderson, J., Burns, H. D., Enriquez-Harris, P., Wilkie, A. O.
M. and Heath, J. K. (1998). Apert syndrome mutations in
fibroblast growth factor receptor 2 exhibit increased affinity for FGF ligand.
Hum. Mol. Genet. 7,1475
-1483.
Bustin, S. A. (2000). Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25,169 -193.[Abstract]
Caplan, A. I. and Pechak, D. G. (1987). The cellular and molecular embryology of bone formation. In Bone and Mineral Research, vol. 5 (ed. W. A. Peck), pp. 117-183. New York: Elsevier Science Publishers.
Chen, L., Adar, R., Yang, X., Monsonego, E. O., Li, C., Hauschka, P. V., Yayon, A. and Deng, C. X. (1999). Gly369Cys mutation in mouse FGFR3 causes achondroplasia by affecting both chondrogenesis and osteogenesis. J. Clin. Invest. 104,1517 -1525.[Medline]
Chen, L., Li, C., Qiao, W., Xu, X. and Deng, C.
(2001). A Ser(365)>Cys mutation of fibroblast growth
factor receptor 3 in mouse downregulates Ihh/PTHrP signals and causes severe
achondroplasia. Hum. Mol. Genet.
10,457
-465.
Chen, Y. and Struhl, G. (1996). Dual roles for patched in sequestering and transducing Hedgehog. Cell 87,553 -563.[CrossRef][Medline]
Chikazu, D., Katagiri, M., Ogasawara, T., Ogata, N., Shimoaka, T., Takato, T., Nakamura, K. and Kawaguchi, H. (2001). Regulation of osteoclast differentiation by fibroblast growth factor 2: stimulation of receptor activator of nuclear factor kappaB ligand/osteoclast differentiation factor expression in osteoblasts and inhibition of macrophage colony-stimulating factor function in osteoclast precursors. J. Bone Miner. Res. 16,2074 -2081.[CrossRef][Medline]
Cohen, M. M. J. (2000). Apert Syndrome. In Craniosynostosis, Diagnosis, Evaluation, and Management (ed. M. M. J. Cohen and R. E. MacLean), pp.316 -353. New York: Oxford University Press.
Colvin, J. S., Bohne, B. A., Harding, G. W., McEwen, D. G. and Ornitz, D. M. (1996). Skeletal overgrowth and deafness in mice lacking fibroblast growth factor receptor 3. Nat. Genet. 12,390 -397.[CrossRef][Medline]
De Moerlooze, L., Spencer-Dene, B., Revest, J., Hajihosseini, M., Rosewell, I. and Dickson, C. (2000). An important role for the IIIb isoform of fibroblast growth factor receptor 2 (FGFR2) in mesenchymal-epithelial signalling during mouse organogenesis. Development 127,483 -492.[Abstract]
Delezoide, A. L., Benoistlasselin, C., Legeaimallet, L., Lemerrer, M., Munnich, A., Vekemans, M. and Bonaventure, J. (1998). Spatio-temporal expression of Fgfr 1, 2 and 3 genes during human embryo-fetal ossification. Mech. Dev. 77, 19-30.[CrossRef][Medline]
Dymecki, S. M. (1996). A modular set of Flp, FRT and lacZ fusion vectors for manipulating genes by site-specific recombination. Gene 171,197 -201.[CrossRef][Medline]
Eswarakumar, V. P., Monsonego-Ornan, E., Pines, M., Antonopoulou, I., Morriss-Kay, G. M. and Lonai, P. (2002). The IIIc alternative of Fgfr2 is a positive regulator of bone formation. Development 129,3783 -3793.
Gerber, H. P., Vu, T. H., Ryan, A. M., Kowalski, J., Werb, Z. and Ferrara, N. (1999). VEGF couples hypertrophic cartilage remodeling, ossification and angiogenesis during endochondral bone formation. Nat. Med. 5,623 -628.[CrossRef][Medline]
Ingham, P. W. (1998). Transducing hedgehog: the story so far. EMBO J. 17,3505 -3511.[CrossRef][Medline]
Iseki, S., Wilkie, A. O. and Morriss-Kay, G. M. (1999). Fgfr1 and Fgfr2 have distinct differentiation- and proliferation-related roles in the developing mouse skull vault. Development 126,5611 -5620.[Abstract]
Iwata, T., Li, C. L., Deng, C. X. and Francomano, C. A.
(2001). Highly activated Fgfr3 with the K644M mutation causes
prolonged survival in severe dwarf mice. Hum. Mol.
Genet. 10,1255
-1264.
Jabs, E. W., Li, X., Scott, A. F., Meyers, G., Chen, W., Eccles, M., Mao, J., Charnas, L. R., Jackson, C. E. and Jaye, M. (1994). Jackson-Weiss and Crouzon syndromes are allelic with mutations in fibroblast growth factor receptor 2. Nat. Genet. 8,275 -279.[CrossRef][Medline]
Karsenty, G. and Wagner, E. F. (2002). Reaching a genetic and molecular understanding of skeletal development. Dev. Cell 2,389 -406.[CrossRef][Medline]
Kato, M., Patel, M. S., Levasseur, R., Lobov, I., Chang, B. H.,
Glass, D. A., 2nd, Hartmann, C., Li, L., Hwang, T. H., Brayton, C. F. et
al. (2002). Cbfa1-independent decrease in osteoblast
proliferation, osteopenia, and persistent embryonic eye vascularization in
mice deficient in Lrp5, a Wnt coreceptor. J. Cell
Biol. 157,303
-314.
Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y., Bronson, R. T., Gao, Y. H., Inada, M. et al. (1997). Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89,755 -764.[CrossRef][Medline]
Lewandoski, M., Meyers, E. N. and Martin, G. R. (1997a). Analysis of Fgf8 gene function in vertebrate development. Cold Spring Harb. Symp. Quant. Biol. 62,159 -168.[Medline]
Lewandoski, M., Wassarman, K. M. and Martin, G. R. (1997b). Zp3-cre, a transgenic mouse line for the activation or inactivation of loxP-flanked target genes specifically in the female germ line. Curr. Biol. 7,148 -151.[CrossRef][Medline]
Li, C., Chen, L., Iwata, T., Kitagawa, M., Fu, X. Y. and Deng,
C. X. (1999). A Lys644Glu substitution in fibroblast growth
factor receptor 3 (FGFR3) causes dwarfism in mice by activation of STATs and
ink4 cell cycle inhibitors. Hum. Mol. Genet.
8, 35-44.
Li, L., Cserjesi, P. and Olson, E. N. (1995). Dermo-1: a novel twist-related bHLH protein expressed in the developing dermis. Dev. Biol. 172,280 -292.[CrossRef][Medline]
Liu, Z., Xu, J., Colvin, J. S. and Ornitz, D. M.
(2002). Coordination of chondrogenesis and osteogenesis by
fibroblast growth factor 18. Genes Dev.
16,859
-869.
McEwen, D. G. and Ornitz, D. M. (1997). Determination of fibroblast growth factor receptor expression in mouse, rat and human samples using a single primer pair. Biotechniques 22,1068 -1070.[Medline]
Metsaranta, M., Toman, D., de Crombrugghe, B. and Vuorio, E. (1991). Specific hybridization probes for mouse type I, II, III and IX collagen mRNAs. Biochim. Biophys. Acta 1089,241 -243.[Medline]
Miki, T., Bottaro, D. P., Fleming, T. P., Smith, C. L., Burgess,
W. H., Chan, A. M. and Aaronson, S. A. (1992). Determination
of ligand-binding specificity by alternative splicing: two distinct growth
factor receptors encoded by a single gene. Proc. Natl. Acad. Sci.
USA 89,246
-250.
Min, H., Danilenko, D. M., Scully, S. A., Bolon, B., Ring, B.
D., Tarpley, J. E., DeRose, M. and Simonet, W. S. (1998).
Fgf-10 is required for both limb and lung development and exhibits striking
functional similarity to Drosophila branchless. Genes
Dev. 12,3156
-3161.
Naski, M. C., Colvin, J. S., Coffin, J. D. and Ornitz, D. M. (1998). Repression of hedgehog signaling and BMP4 expression in growth plate cartilage by fibroblast growth factor receptor 3. Development 125,4977 -4988.[Abstract]
Naski, M. C. and Ornitz, D. M. (1998). FGF signaling in skeletal development. Front. Biosci. 3,D781 -D794.
Newberry, E. P., Boudreaux, J. M. and Towler, D. A. (1996). The rat osteocalcin fibroblast growth factor (FGF)-responsive element: an okadaic acid-sensitive, FGF-selective transcriptional response motif. Mol. Endocrinol. 10,1029 -1040.[Abstract]
Newberry, E. P., Willis, D., Latifi, T., Boudreaux, J. M. and
Towler, D. A. (1997). Fibroblast growth factor receptor
signaling activates the human interstitial collagenase promoter via the
bipartite Ets-AP1 element. Mol. Endocrinol.
11,1129
-1144.
Ornitz, D. M. and Itoh, N. (2001). Fibroblast growth factors. Genome Biol. 2, REVIEWS3005.
Ornitz, D. M. and Marie, P. J. (2002). FGF
signaling pathways in endochondral and intramembranous bone development and
human genetic disease. Genes Dev.
16,1446
-1465.
Ornitz, D. M., Xu, J., Colvin, J. S., McEwen, D. G., MacArthur,
C. A., Coulier, F., Gao, G. and Goldfarb, M. (1996). Receptor
specificity of the fibroblast growth factor family. J. Biol.
Chem. 271,15292
-15297.
Orr-Urtreger, A., Bedford, M. T., Burakova, T., Arman, E., Zimmer, Y., Yayon, A., Givol, D. and Lonai, P. (1993). Developmental localization of the splicing alternatives of fibroblast growth factor receptor-2 (FGFR2). Dev. Biol. 158,475 -486.[CrossRef][Medline]
Orr-Urtreger, A., Givol, D., Yayon, A., Yarden, Y. and Lonai, P. (1991). Developmental expression of two murine fibroblast growth factor receptors, flg and bek.Development 113,1419 -1434.[Abstract]
Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K. C., Rosewell, I. R., Stamp, G. W., Beddington, R. S., Mundlos, S., Olsen, B. R. et al. (1997). Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89,765 -771.[CrossRef][Medline]
Peters, K. G., Werner, S., Chen, G. and Williams, L. T. (1992). Two FGF receptor genes are differentially expressed in epithelial and mesenchymal tissues during limb formation and organogenesis in the mouse. Development 114,233 -243.[Abstract]
Rimoin, D. L., Hughes, G. N., Kaufman, R. L., Rosenthal, R. E., McAlister, W. H. and Silberberg, R. (1970). Endochondral ossification in achondroplastic dwarfism. N. Engl. J. Med. 283,728 -735.
Rutland, P., Pulleyn, L. J., Reardon, W., Baraitser, M., Hayward, R., Jones, B., Malcolm, S., Winter, R. M., Oldridge, M., Slaney, S. F. et al. (1995). Identical mutations in the FGFR2 gene cause both Pfeiffer and Crouzon syndrome phenotypes. Nat. Genet. 9,173 -176.[CrossRef