|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00527
1 Department of Molecular, Cellular and Developmental Biology, University of
Michigan, Natural Science Building, Ann Arbor, MI 48109, USA
2 Whitehead Institute for Biomedical Research, Massachusetts Institute of
Technology, Cambridge, MA 02142, USA
* Author for correspondence (e-mail: cadigan{at}umich.edu)
Accepted 3 April 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, wingless, split ends, SHARP, MINT
| INTRODUCTION |
|---|
|
|
|---|
Cells respond to Wg via a highly conserved signaling cascade that centers
on Armadillo (Arm). In unstimulated cells, Arm is constitutively expressed but
the cytosolic pool is phosphorylated by a degradation complex containing two
kinases, Shaggy/Zeste white 3 (Sgg/Zw3) and Casein Kinase I
(CKI
). Phosphorylated Arm is then rapidly degraded through the
ubiquitination/proteosome pathway
(Yanagawa et al., 2002
). Wg
signaling, through a membrane receptor complex, activates the cytoplasmic
protein Disheveled, which in turn inhibits the function of the degradation
complex, resulting in the stabilization and accumulation of Arm
(Cadigan and Nusse, 1997
;
Polakis, 2000
). The consensus
view of downstream events is that the stabilized Arm translocates to the
nucleus where it forms a complex with the DNA-binding protein TCF
(PangolinFlyBase) and two other proteins, Legless and Pygopus (Pygo)
(Belenkaya et al., 2002
;
Kramps et al., 2002
;
Parker et al., 2002
;
Thompson et al., 2002
). How
this nuclear complex mediates the regulation of Wg transcriptional targets is
not understood, though several other factors have also been implicated in the
process (for a review, see Hurlstone and
Clevers, 2002
).
In the absence of Arm, TCF is thought to transcriptionally repress Wg
target genes by interacting with the transcriptional co-repressor Groucho
(Cavallo et al., 1998
). In
addition, the ARID domain protein Osa has been shown to repress Wg target
genes by acting in a chromatin remodeling complex that contains the
bromodomain protein Brahma (Collins et
al., 1999
; Collins and
Treisman, 2000
). Binding of Arm to TCF somehow blocks the
functions of these factors and converts TCF into an activator
(Hurlstone and Clevers,
2002
).
The Wg signaling pathway is used repeatedly throughout fly development
where it exerts differential regulation on many genes in various tissues and
cell types (Klingensmith and Nusse,
1994
; Zecca et al.,
1996
). The molecular basis for this specificity is not well
understood. Some of these differential responses are due to combinatorial
inputs of multiple signaling cascades
(Campbell et al., 1993
;
Lockwood and Bodmer, 2002
). In
other instances, there is evidence suggesting that other co-factors may be
involved in regulating the activity of Arm/TCF in specific tissues or stages.
Such examples include the zinc-finger protein Teashirt (Tsh) and
transcriptional repressor Brinker in the embryonic ventral epidermis and
midgut (Gallet et al., 1998
;
Waltzer et al., 2001
;
Saller et al., 2002
) and the
nuclear protein Lines (Lin) in the dorsal epidermis of the embryo
(Hatini et al., 2000
).
This report describes the role of the split ends (spen)
gene in Wg signaling. Spen is a predominantly nuclear protein containing three
RNA recognition motifs (RRM) and a SPOC domain at the C terminus
(Kuang et al., 2000
;
Rebay et al., 2000
;
Wiellette et al., 1999
). Spen
has previously been implicated in neuronal cell fate, survival and axonal
guidance (Chen and Rebay,
2000
; Kuang et al.,
2000
), cell cycle regulation
(Lane et al., 2000
) and
repression of head identity in the embryonic trunk
(Wiellette et al., 1999
). At
the genetic level, spen has been suggested to act with the Hox gene
Deformed (Wiellette et al.,
1999
) and the EGF/Ras signaling pathway
(Chen and Rebay, 2000
;
Rebay et al., 2000
). The human
homolog SHARP has been shown to act as a transcriptional co-repressor for
steroid hormone receptors (Shi et al.,
2001
) and RBP-J
, which mediates Notch signaling
(Oswald et al., 2002
). The
mouse homolog MINT has also been shown to bind to specific DNA sequences
through its RRM domains (Newberry et al.,
1999
). We demonstrate that Spen is a positive regulator of Wg
signaling in the larval eye, wing and leg imaginal discs. Consistent with its
nuclear location, Spen acts downstream of stabilized Arm. Interestingly, we
could find no requirement for spen in embryonic Wg signaling,
indicating that it is a tissue or target promoter specific regulator of the
pathway.
| MATERIALS AND METHODS |
|---|
|
|
|---|
For mosaics, spen9C7 and spen14C2
were recombined onto a P[FRT, hs-neo]40A chromosome as
described previously (Xu and Rubin,
1993
). The P[FRT, hs-neo]82B,
pygo10 stock was described previously
(Parker et al., 2002
). Clonal
markers were P[arm-lacZ]3R (from D. J. Pan) and a
P[Ubi-GFPnls] on 2L
(Davis et al., 1995
). Mitotic
clones were induced with P[hs-flp]1
(Golic and Lindquist, 1989
) in
the wing (60-90 minute heatshock 48-72 hours after egg laying), and
P[eyeless-flp]T11 (eye-flp) or
P[eye-flp]T12 (Newsome
et al., 2000
) in the eye. Embryonic balancer chromosome markers
were CyO P[larB208] (Grossniklaus
et al., 1992
) and TM3 eve-lacZ.
P[UAS-spenDN] lines were constructed by PCR amplifying
the C-terminal 2.8 kb of the spen-coding region (amino acids
4540-5476) using the oligos
5'GGAAGATCTATGCCGAAGAAGAAGCGCAAGGTGGTTGCCGCCAGTCATTTGGCACC3' and
5'CCGCTCGAGTTAGACAGTAGCGATGACAATCAG3', digesting with
BglII and XhoI, ligating into pUAST and injecting into
w1118 embryos to obtain transgenics. The first primer
contains a nuclear localization signal (PKKKRKV). Two lines were used,
P[UAS-spenDN]II and
P[UAS-spenDN]III, the latter of which gave
significantly stronger phenotypes. These transgenes cause midline glia defects
similar to those previously observed in spen mutants
(Chen and Rebay, 2000
). In
addition, the severity of this phenotype is enhanced in spen
heterozygotes and a spenDN rough eye phenotype is
suppressed in animals carrying a duplication of the spen locus
(D.B.D. and I.R., unpublished). These results suggest that the
SpenDN protein is acting to antagonize endogenous spen
activity.
Excisions were generated from spenk07721 and
spenk13624 using the
2-3, Sb chromosome
(Robertson et al., 1988
);
homozygous viable revertant lines were isolated.
Fly crosses were maintained at 25°C unless otherwise noted.
Isolation of new spen alleles
The spen alleles were generated using the mutagen ethyl methane
sulfonate, and identified in a screen for modifiers of the
P[sev-wgts] interommatidial bristle phenotype. The screen
was performed at 17.6°C as described previously
(Cadigan et al., 2002
). Two
suppressors belonged to a single lethal complementation group and were
subsequently found to be allelic to spen (see Results). The molecular
nature of these alleles was not determined.
Whole-mount staining and microscopy
Immunostaining was as described previously
(Cadigan and Nusse, 1996
). Rat
anti-Spen (1:1000) was from P. Kolodziej, affinity-purified rabbit anti-Wg
antisera (1:50) and mouse anti-Dfz2 (1:50) were from R. Nusse, mouse
monoclonal anti-Ac (1:20) was from the Developmental Hybridoma Bank, rat
anti-Elav (1:100) was from G. Rubin, and guinea pig anti-Slp1 (1:100) was from
S. Small. Guinea pig anti-Sens (1:1000) was from H. Bellen, rabbit anti-Eve
(1:100) was from Z. Han and R. Bodmer, mouse monoclonal anti-En supernatant
(1:2) was from the University of Iowa Hybridoma Bank, mouse and rabbit
anti-ß-galactosidase (1:500) were from Sigma and Cappel, respectively.
Cy3- and Cy5-conjugated secondary antibodies were from Jackson Immunochemicals
and Alexa Flour 488-conjugated secondaries were from Molecular Probes. All
fluorescent pictures were obtained with a Zeiss Axiophot coupled to a Zeiss
LSM510 confocal apparatus. All images were processed as Adobe Photoshop files.
Cuticles were prepared and photographed as previously described
(Bhanot et al., 1999
). Flies
were prepared for scanning electron microscopy (SEM) as described
(Cadigan et al., 2002
). The
samples were viewed with a scanning electron microscope and photographed using
Polapan 400 film (Kodak).
| RESULTS |
|---|
|
|
|---|
|
400/eye
(Fig. 1B, data not shown). They
form one lethal complementation group, which was mapped to the tip of
chromosome 2L between 21B4-B6. Several lines of evidence demonstrate that
these suppressors are alleles of spen, and they will hereby be
referred to as spen9C7 and spen14C2.
First, both spen9C7 and spen14C2 fail
to complement alleles of spen. Second, immunostaining using
Spen-specific antiserum (Kuang et al.,
2000
|
Spen potentiates Wg signaling in the eye
The suppression of the P[sev-wgts] phenotype suggests
that Spen is a positive effector of Wg signaling in the eye. To examine this
in more detail, we used clonal analysis with spen mutant alleles and
spen hypomorphic combinations to explore its requirement on
Wg-dependent inhibition of bristle formation and morphogenetic furrow (MF)
initiation.
Ectopic Wg in P[sev-wg] flies represses the expression of a
proneural protein, Acheate (Ac) (Cadigan
and Nusse, 1996
). In clones of spen in a
P[sev-wg] background, Ac is significantly derepressed
(Fig. 3B), while the expression
of Wg is not affected (Fig.
3C). This strongly suggests that spen alleles do not
suppress the P[sev-wg] phenotypes by reducing Wg expression. Ac is
not derepressed in all areas of the spen clones
(Fig. 3B, arrows), indicating
that a significant level of Wg-dependent Ac repression still occurs in the
absence of spen. Ac derepression is occasionally seen in cells
adjacent to the spen clones (Fig.
3B, arrowhead), which may be caused by defects in Ras-dependent
activation of Delta (Dl) expression (see Discussion).
|
To determine if spen was required for other Wg readouts in the
eye, we examined its effect on Wg-mediated inhibition of the MF. The MF is a
coordinated wave of apical constriction of the columnar epithelial cells that
triggers differentiation of the fly eye. The MF starts at the early third
larval instar and sweeps across the eye imaginal disc, from the posterior to
the anterior (Wolff and Ready,
1993
). Clusters of photoreceptors develop behind the MF
(Fig. 4G,J, marked by the
neuronal protein Elav). Wg is expressed at the dorsal and ventral edges of the
eye disc (Fig. 4D,J), where it
inhibits MF initiation (Ma and Moses,
1995
; Treisman and Rubin,
1995
). Decapentaplegic (Dpp) signaling at the posterior edge
represses Wg expression. In the eye-specific dppblk
mutant, Wg expression in early third instar discs expands posteriorly
(Royet and Finkelstein, 1997
)
(compare Fig. 4J with 4K), causing a partial inhibition of the MF, reduced photoreceptor differentiation
(Fig. 4H) and resulting in an
adult small eye phenotype (Fig.
4B) (Chanut and Heberlein,
1997
). Posterior expansion and upregulation of Wg is also observed
in late third instar dppblk eyes
(Fig. 4E).
|
In an otherwise wild-type eye, loss of Wg at the lateral edges allows
ectopic MF initiation and inward progression
(Ma and Moses, 1995
;
Treisman and Rubin, 1995
).
Therefore, removal of Wg signaling components at the lateral edge of the eye
should result in an ectopic MF. This is indeed observed in mutant clones of
pygo (Fig. 4M, arrow),
in which Wg signaling is blocked (Belenkaya
et al., 2002
; Kramps et al.,
2002
; Parker et al.,
2002
; Thompson et al.,
2002
). To establish the role of spen in Wg-mediated MF
inhibition in the wild-type situation, we looked at spen clones at
similar positions. In contrast to pygo, clones of spen never
give rise to ectopic photoreceptors (Fig.
4N, arrow), suggesting that spen is not essential for Wg
signaling in this context.
spen is required for Wg signaling in the wing and leg
To determine whether spen plays a role in Wg signaling in other
tissues, we examined its effects on the developing wing. In the third instar
wing imaginal disc, wg is expressed in a narrow stripe along the
dorsoventral (DV) border from which it emanates to form a morphogen gradient
that regulates the expression of many genes
(Neumann and Cohen, 1997
;
Zecca et al., 1996
). The
zinc-finger nuclear protein Senseless (Sens) is activated by Wg signaling in
the proneural clusters on either side of the DV border, immediately adjacent
to the wg-expressing stripe (Nolo
et al., 2000
; Parker et al.,
2002
) (Fig. 5A). In
addition, Wg signaling refines the distribution of Wg protein by
auto-repression of wg expression
(Rulifson et al., 1996
) and
downregulation of the Wg receptor Fz2
(Cadigan et al., 1998
). Thus,
loss of Wg signaling in this tissue would lead to loss of Sens expression,
expansion of the Wg stripe, and derepression of Fz2.
|
The effect of a putative dominant-negative spen transgene (spenDN) on Wg targets in the presumptive wing provides evidence that the clonal analysis of spen underestimates the contribution of spen to Wg signaling. The spenDN construct contains the C-terminal 936 amino acids of spen, including a nuclear localization signal and the conserved SPOC domain. en-Gal4 was used to express spenDN throughout the posterior compartment of the wing disc, while the anterior compartment remains wild type. With this Gal4 driver, spenDN caused reduced (Fig. 5D) or complete absence (Fig. 5F) of Sens expression. The penetrance of loss of Sens expression was higher than seen in spen clones. More strikingly, a significant Wg depression was always observed, even when Sens is only moderately affected (Fig. 5E). By contrast, no effect on Wg-dependent Fz2 inhibition was observed (Fig. 5G). Thus, the spenDN construct indicates an absolute requirement for spen in Wg stripe refinement and an important role in Wg-mediated regulation of Sens, but it has no discernable role in Wg-dependent Fz2 repression.
We believe that the spenDN experiments may also underestimate the importance of spen in Wg signaling. Gal4 is known to be cold sensitive in flies and we observe a strict temperature dependence in our en-Gal4/spenDN experiments. The discs shown in Fig. 5 were reared at 18°C. At higher temperatures (e.g. 20°C or 25°C) where Gal4 is more active, we observe either gross deformities of the wing disc or organismal lethality before the 3rd instar larval stage (data not shown). Thus, we cannot assay the effect of spenDN on Wg signaling when expressed at higher levels than the ones shown in Fig. 5. However, at those levels, spenDN expression results in morphologically normal wing discs with strong Wg signaling defects.
In the leg imaginal discs, we see a similar situation as has just been
described in the developing wing (Fig.
6). In the leg, Wg signaling inhibits dpp expression in
the ventral portion of the discs (Brook and
Cohen, 1996
; Heslip et al.,
1997
; Jiang and Struhl,
1996
) (Fig. 6A-C).
Expression of spenDN with ptc-Gal4, which is
active in a stripe overlapping both the dpp and wg
expression domains, causes a complete breakdown of disc morphology (data not
shown) at 25°C. At lower temperatures (18-22°C), small leg discs are
observed with either normal restriction of dpp-lacZ expression to the
dorsal half (Fig. 6D-F) or
derepression in the ventral region (Fig.
6G-I). This derepression is consistent with a block in Wg
signaling.
|
and Sgg/Zw3, and then degraded
(Peifer et al., 1994
|
Wild-type embryos have a distinctive denticle patterning on their ventral
cuticles with trapezoidal arrays of denticle belts intermittent with naked
cuticles (Fig. 8A). Wg
signaling is required for naked cuticle formation; and wg mutants
form ectopic denticles in place of naked cuticle
(Nusslein-Volhard and Wieschaus,
1980
). The cuticles of embryos carrying
UAS-spenDN and the ubiquitous driver da-Gal4 were
examined. At 25°C, these embryos show cuticle phenotypes ranging from wild
type (data not shown) to moderate reduction of denticle formation
(Fig. 8D), inconsistent with
reduced Wg signaling. At 29°C, spenDN expression
causes complete disruption of cuticle formation (data not shown).
|
The effects of spenDN expression were further
characterized using molecular markers. En is normally expressed in epidermal
stripes of single segment periodicity. Wg is required for the maintenance of
En expression (DiNardo et al.,
1988
); expression of a dominant-negative TCF
(TCFDN), which blocks Wg signaling in the nucleus, causes
En to fade from the epidermis by full germband extension
(Fig. 8B). Expression of
spenDN using prd-Gal4
(Fig. 8E), or the ubiquitous
drivers arm-Gal4 and da-Gal4 (data not shown) does not
affect En expression at full germband extension, indicating that spen
is not needed for En maintenance. Similarly, expression of another Wg target
in the embryonic ectoderm, Sloppy-paired 1 (Slp1)
(Lee and Frasch, 2000
), is
markedly reduced by TCFDN expression
(Fig. 8C), but is not affected
by spenDN expression under the control of prdGal4
(Fig. 8F), armGal4 or
daGal4 (data not shown).
Wg signaling in the mesoderm is required for the expression of Even-skipped
(Eve) in a subset of pericardial cells (Wu
et al., 1995
) (Fig.
8G). At 25°C or 29°C, Eve expression in embryos expressing
spenDN throughout the mesoderm using twi-Gal4
ranges from wild-type (Fig. 8H)
to an increased number of Eve-positive cells
(Fig. 8I). Some embryos
expressing spenDN via two mesodermal drivers
(twi-Gal4 and 24B-Gal4) simultaneously exhibit general
disorganization of Eve-positive pericardial cells, with occasional segmental
gaps (one or two per embryo) missing Eve expression, and an overall increased
number of Eve-positive cells (data not shown). As Eve expression is always
present in these embryos, and segments missing Eve are always concurrent with
those with more Eve expression in the same embryo, we conclude that
spen is not required for Wg signaling in this readout, and that
functions of spen in other pathways or the non-specificity of
spenDN may be the culprit for the defects in Eve
expression.
| DISCUSSION |
|---|
|
|
|---|
Interpreting spen phenotypes is complicated by the fact that
spen has been implicated in several other pathways. Can these
functions explain the apparent loss of Wg signaling phenotypes we observed?
spen has been found to act with Deformed to suppress head
identity in the embryonic trunk (Wiellette
et al., 1999
) and spen genetically interacts with cell
cycle mutants (Lane et al.,
2000
). We think it unlikely that these spen functions can
account for the phenotypes observed. However, Spen has also been shown to be
involved with the Ras and Notch signaling pathways, which do affect the
readouts we employed for studying Wg signaling. Therefore, it is possible that
some of the spen phenotypes we have documented are due to disruption
of these signaling cascades, though we argue below that this is unlikely.
spen mutations affect some Ras targets in a way that suggests it
acts positively in Ras signaling (Chen and
Rebay, 2000
; Rebay et al.,
2000
). This may be the explanation for the non-autonomous
derepression of Ac expression adjacent to spen clones in
P[sev-wg] eyes (Fig.
3B, arrowhead), as Dl expression is activated by the
EGF/Ras pathway in the eye (Tsuda et al.,
2002
). Ras signaling plays a positive role in MF progression
(Greenwood and Struhl, 1999
;
Kumar and Moses, 2001
) and
elevated Ras signaling can suppress a Wg or Arm induced small eye phenotype
(Freeman and Bienz, 2001
)
(K.M.C., unpublished). Therefore, a reduction in Ras signaling caused by loss
of spen cannot explain our observations. Ras signaling has no effect
on wing margin formation (Diaz-Benjumea
and Hafen, 1994
; Nagaraj et
al., 1999
) and acts downstream of Wg/Dpp crossregulation in the
leg (Campbell, 2002
;
Galindo et al., 2002
), again
arguing that the role of Spen in Ras signaling cannot account for the apparent
Wg signaling defects we observed.
Expression of Suppressor of Hairless [Su(H)], a transcription factor
required for Notch signaling, is significantly reduced in spen mutant
embryos (Kuang et al., 2000
).
Can a reduction of Notch signaling explain our results? Notch signaling is
required for interommatidial bristle inhibition
(Cagan and Ready, 1989
) so
this could explain the requirement of spen for Wg-dependent Ac
inhibition (Fig. 3). However,
Notch is absolutely required for Wg expression at the DV stripe in the wing
(Rulifson and Blair, 1995
) and
plays a positive role in MF progression
(Kumar and Moses, 2001
). Thus,
reducing Notch activity by loss of spen or spenDN
cannot explain the wider Wg stripe (Fig.
5) and suppression of the dppblk MF defect
(Fig. 4) that we observed.
Though no evidence for elevated Notch signaling in spen mutants
has been reported in Drosophila, a recent report has suggested that
SHARP, a human Spen homolog, functions as a transcriptional co-repressor for
RBP-J
/CBL, the ortholog of Su(H)
(Oswald et al., 2002
). In
addition, the fly homolog of human SMRT, which binds to SHARP
(Shi et al., 2001
), has been
shown to act as a negative regulator of Notch signaling
(Tsuda et al., 2002
). This
could mean that loss of spen activity in flies results in higher
expression of Notch/Su(H) targets, owing to derepression. Although this could
conceivably contribute to the MF and wing phenotypes we found, such
derepression could not account for the suppression of Wg-dependent reduction
of eye size and bristle inhibition (Figs
1,
3) or the derepression of
dpp expression in the leg (Fig.
6). In summary, the only explanation consistent with all the
spen (or spenDN) imaginal disc phenotypes
discussed above is a loss of Wg signaling.
Spen is not required for embryonic Wg signaling
In contrast to the data in the imaginal discs, we could find no evidence
for the involvement of spen in Wg signaling in the embryo
(Fig. 8), either by removing
spen gene activity or expressing spenDN. Thus, it
appears that Spen may be a tissue-specific regulator of Wg signaling. Spen is
a predominately nuclear protein expressed ubiquitously in embryos and imaginal
discs (Kuang et al., 2000
;
Wiellette et al., 1999
)
(Fig. 2; data not shown). It
could be that a Spen co-factor is not expressed in embryos, or that Spen is
post-translationally modified in a tissue-specific way. Alternatively, the
specificity could lie in the promoters of the targets that were tested. This
appears to be the case in the wing, where Wg and Sens regulation by Wg
signaling is spen dependent (Fig.
5A-F), while that of Fz2 is not
(Fig. 5G).
The negative results we obtained in the embryo cannot be viewed as
definitive. Embryos that lack maternal and zygotic spen activity
could be normal for Wg signaling because of redundancy (see below). Likewise,
even though expression of spenDN in the imaginal discs
caused strong Wg loss of function phenotypes (Figs
5,
6,
7), and caused
spen-like phenotypes under mild expression conditions in the embryo
(data not shown), it is possible that we did not supply adequate amounts of
spenDN in our embryonic assays. To address this issue, we
used several Gal4 drivers at 29°C (to ensure optimal Gal4 activity; see
Results for details). We did observe phenotypes with
spenDN not previously reported that are Wg independent.
For example, arm-Gal4- and da-Gal4-driven
spenDN expression causes reduced denticle formation to
varying degrees in the embryonic ventral cuticle
(Fig. 8). A possible
explanation is reduced DER/Ras signaling, which promotes the denticle fate by
activating shavenbaby (Payre et
al., 1999
). In addition, spenDN expression
also causes a variable increase in the number of Eve-expressing cells in the
embryonic dorsal mesoderm. This could be explained by a reduction in Su(H)
levels, as impairment of Notch signaling causes an increase in Eve-positive
pericardial cells (Carmena et al.,
2002
). Under conditions where spenDN blocked
other pathways, we could observe no reduction in Wg signaling.
Spen may have a redundant partner
Our experiments with loss of function spen alleles indicate that
spen is not absolutely required for Wg signaling in the wing and eye.
Although reduction of spen activity could suppress a
dppblk MF defect (Fig.
4C), which can be explained by a reduction in Wg signaling,
complete removal of spen did not cause an ectopic MF
(Fig. 4N). Because removal of
Wg signaling is known to induce an ectopic MF
(Ma and Moses, 1995
;
Treisman and Rubin, 1995
)
(Fig. 4M), this indicates that
sufficient Wg signaling still occurs in the spen clones. In the wing,
spen clones affect Wg readouts, but with incomplete penetrance
(Fig. 5A-C), again indicating a
partial reduction in Wg signaling in the absence of spen.
Our experiments with spenDN suggest that the partial loss of Wg signaling in spen mutants may be due to redundancy. Expressing spenDN causes more severe phenotypes and much higher penetrance in disruption of Sens and expansion of Wg in the wing than complete removal of spen (Fig. 5D-F). A likely explanation is that the SpenDN protein also inhibits the function of another gene that has roles in the Wg pathway redundant to spen.
Although many genes exist in the fly genome that encode proteins containing
RRMs, only one other besides Spen is predicted to encode a protein with both
RRMs and a SPOC domain. This factor has been called short Spen-like protein
(SSLP or DmSSp) (Kuang et al.,
2000
; Wiellette et al.,
1999
) and is referred to as CG2910 in the annotated genome. No
genetic or molecular characterization of SSLP has been reported and we are
pursuing its possible redundancy with spen.
Mechanism of Spen action
Where does Spen act in the Wg pathway? Our epitasis experiments in the eye
(Fig. 7) indicate that
SpenDN blocks Wg signaling downstream of Arm stabilization. Thus,
Spen could act in Arm nuclear import, or in mediating TCF/Arm transcriptional
regulation. Consistent with a role in Wg target gene transcription, Spen is
predominantly nuclear in imaginal tissues
(Fig. 2; data not shown). In
addition, the mouse and human homologs of Spen have been implicated as
transcription factors (see below).
Studies on the vertebrate homologs of Spen have provided functions for the
RRM and SPOC domain that these proteins share with Spen. Spen has three
predicted RRMs near its N terminus. The role of RRMs in specific RNA binding
is well established (Burd and Dreyfuss,
1994
) and the RRM domains in the human Spen homolog SHARP has been
shown to bind to the steroid receptor RNA co-activator SRA
(Shi et al., 2001
). By
contrast, the RRM domain of the mouse Spen homolog, MINT, has been shown to
bind to specific double-stranded DNA, including the proximal promoter of the
osteocalcin gene (Newberry et al.,
1999
). SHARP also binds to the nuclear receptor co-repressor SMRT
and acts as a transcription corepressor by recruiting histone deacetylases
(HDACs) through its SPOC domain (Shi et
al., 2001
). A similar co-repressor function for SHARP with the
DNA-binding protein RBP-J
/CBL has also been reported
(Oswald et al., 2002
).
Finally, MINT was also found to interact with Msx2, a known transcriptional
repressor (Newberry et al.,
1999
). These studies on the vertebrate homologs suggest that Spen
may bind DNA or RNA at its N terminus, and may regulate the Wg pathway as a
transcription corepressor.
Why is spen required for only a subset of Wg targets? Based on
studies with its vertebrate homologs, could spen only regulate the Wg
targets that are transcriptionally repressed by TCF/Arm? Wg-dependent
transcriptional inhibition through TCF has been shown for the stripe
gene in the embryo (Piepenburg et al.,
2000
) and has been suggested for bristle inhibition in the eye
(Cadigan et al., 2002
).
However, no direct targets of Wg signaling in the imaginal discs have been
determined and our attempts to determine whether stripe repression in
the embryo requires spen have been inconclusive (H.V.L. and K.M.C.,
unpublished). It is interesting to note that two embryonic targets tested
which were spen independant, eve and slp1, are both
directly activated by TCF/Arm (Halfon et
al., 2000
; Knirr and Frasch,
2001
; Lee and Frasch,
2000
; Han et al.,
2002
). Identification of spen-dependent direct targets of
Wg signaling will be necessary to explore this model.
Two factors have previously been reported that are tissue/promoter-specific
regulators of Wg signaling. tsh has been shown to be required for
Wg-mediated inhibition of denticle formation in the ventral embryonic
epidermis (Gallet et al.,
1998
) and lin, which is needed for Wg signaling only in
the dorsal epidermis (Hatini et al.,
2000
). We report a third factor, Spen, which is only needed for
imaginal disc regulation of Wg targets. The existence of these specific
factors begs the question: what is the difference between the various Wg
targets that requires such specificity?
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Belenkaya, T. Y., Han, C., Standley, H. J., Lin, X., Houston, D.
W. and Heasman, J. (2002). pygopus Encodes a nuclear
protein essential for wingless/Wnt signaling.
Development 129,4089
-4101.
Bhanot, P., Fish, M., Jemison, J. A., Nusse, R., Nathans, J. and Cadigan, K. M. (1999). Frizzled and Dfrizzled-2 function as redundant receptors for Wingless during Drosophila embryonic development. Development 126,4175 -4186.[Abstract]
Blackman, R. K., Sanicola, M., Raftery, L. A., Gillevet, T. and Gelbart, W. M. (1991). An extensive 3' cis-regulatory region directs the imaginal disk expression of decapentaplegic, a member of the TGF-beta family in Drosophila. Development 111,657 -666.[Abstract]
Brook, W. J. and Cohen, S. M. (1996). Antagonistic interactions between wingless and decapentaplegic responsible for dorsal-ventral pattern in the Drosophila Leg. Science 273,1373 -1377.[Abstract]
Brunner, E., Peter, O., Schweizer, L. and Basler, K. (1997). pangolin encodes a Lef-1 homologue that acts downstream of Armadillo to transduce the Wingless signal in Drosophila. Nature 385,829 -833.[CrossRef][Medline]
Burd, C. G. and Dreyfuss, G. (1994). Conserved
structures and diversity of functions of RNA-binding proteins.
Science 265,615
-621.
Cadigan, K. M. and Nusse, R. (1996). wingless signaling in the Drosophila eye and embryonic epidermis. Development 122,2801 -2812.[Abstract]
Cadigan, K. M. and Nusse, R. (1997). Wnt
signaling: a common theme in animal development. Genes
Dev. 11,3286
-3305.
Cadigan, K. M., Fish, M. P., Rulifson, E. J. and Nusse, R. (1998). Wingless repression of Drosophila frizzled 2 expression shapes the Wingless morphogen gradient in the wing. Cell 93,767 -777.[CrossRef][Medline]
Cadigan, K. M., Jou, A. D. and Nusse, R. (2002). Wingless blocks bristle formation and morphogenetic furrow progression in the eye through repression of Daughterless. Development 129,3393 -3402.
Cagan, R. L. and Ready, D. F. (1989). Notch is
required for successive cell decisions in the developing Drosophila retina.
Genes Dev. 3,1099
-1112.
Campbell, G. (2002). Distalization of the Drosophila leg by graded EGF-receptor activity. Nature 418,781 -785.[CrossRef][Medline]
Campbell, G., Weaver, T. and Tomlinson, A. (1993). Axis specification in the developing Drosophila appendage: the role of wingless, decapentaplegic, and the homeobox gene aristaless. Cell 74,1113 -1123.[CrossRef][Medline]
Carmena, A., Buff, E., Halfon, M. S., Gisselbrecht, S., Jimenez, F., Baylies, M. K. and Michelson, A. M. (2002). Reciprocal regulatory interactions between the Notch and Ras signaling pathways in the Drosophila embryonic mesoderm. Dev. Biol. 244,226 -242.[CrossRef][Medline]
Cavallo, R. A., Cox, R. T., Moline, M. M., Roose, J., Polevoy, G. A., Clevers, H., Peifer, M. and Bejsovec, A. (1998). Drosophila Tcf and Groucho interact to repress Wingless signalling activity. Nature 395,604 -608.[CrossRef][Medline]
Chanut, F. and Heberlein, U. (1997). Role of decapentaplegic in initiation and progression of the morphogenetic furrow in the developing Drosophila retina. Development 124,559 -567.[Abstract]
Chen, F. and Rebay, I. (2000). split ends, a new component of the Drosophila EGF receptor pathway, regulates development of midline glial cells. Curr Biol 10,943 -946.[CrossRef][Medline]
Collins, R. T. and Treisman, J. E. (2000).
Osa-containing Brahma chromatin remodeling complexes are required for the
repression of wingless target genes. Genes Dev.
14,3140
-3152.
Collins, R. T., Furukawa, T., Tanese, N. and Treisman, J. E. (1999). Osa associates with the Brahma chromatin remodeling complex and promotes the activation of some target genes. EMBO J. 18,7029 -7040.[CrossRef][Medline]
Davis, I., Girdham, C. H. and O'Farrell, P. H. (1995). A nuclear GFP that marks nuclei in living Drosophila embryos; maternal supply overcomes a delay in the appearance of zygotic fluorescence. Dev. Biol. 170,726 -729.[CrossRef][Medline]
Diaz-Benjumea, F. J. and Hafen, E. (1994). The sevenless signalling cassette mediates Drosophila EGF receptor function during epidermal development. Development 120,569 -578.[Abstract]
DiNardo, S., Sher, E., Heemskerk-Jongens, J., Kassis, J. A. and O'Farrell, P. H. (1988). Two-tiered regulation of spatially patterned engrailed gene expression during Drosophila embryogenesis. Nature 332,604 -609.[CrossRef][Medline]
Freeman, M. (1996). Reiterative use of the EGF receptor triggers differentiation of all cell types in the Drosophila eye. Cell 87,651 -660.[CrossRef][Medline]
Freeman, M. and Bienz, M. (2001). EGF receptor/Rolled MAP kinase signalling protects cells against activated Armadillo in the Drosophila eye. EMBO Rep. 2, 157-162.[CrossRef][Medline]
Galindo, M. I., Bishop, S. A., Greig, S. and Couso, J. P.
(2002). Leg patterning driven by proximal-distal interactions and
EGFR signaling. Science
297,256
-259.
Gallet, A., Erkner, A., Charroux, B., Fasano, L. and Kerridge, S. (1998). Trunk-specific modulation of wingless signalling in Drosophila by teashirt binding to armadillo. Curr. Biol. 8,893 -902.[CrossRef][Medline]
Golic, K. G. and Lindquist, S. (1989). The FLP recombinase of yeast catalyzes site-specific recombination in the Drosophila genome. Cell 59,499 -509.[CrossRef][Medline]
Greenwood, S. and Struhl, G. (1999). Progression of the morphogenetic furrow in the Drosophila eye: the roles of Hedgehog, Decapentaplegic and the Raf pathway. Development 126,5795 -5808.[Abstract]
Grossniklaus, U., Pearson, R. K. and Gehring, W. J.
(1992). The Drosophila sloppy paired locus encodes two proteins
involved in segmentation that show homology to mammalian transcription
factors. Genes Dev. 6,1030
-1051.
Halfon, M. S., Carmena, A., Gisselbrecht, S., Sackerson, C. M., Jimenez, F., Baylies, M. K. and Michelson, A. M. (2000). Ras pathway specificity is determined by the integration of multiple signal-activated and tissue-restricted transcription factors. Cell 103,63 -74.[CrossRef][Medline]
Han, Z., Fujioka. M., Su, M., Liu, M., Jaynes, J. B. and Bodmer, R. (2002). Transcriptional Integration of Competence Modulated by Mutual Repression Generates Cell-Type Specificity within the Cardiogenic Mesoderm. Dev. Biol. 252,225 -240.[CrossRef][Medline]
Hatini, V., Bokor, P., Goto-Mandeville, R. and DiNardo, S.
(2000). Tissue- and stage-specific modulation of Wingless
signaling by the segment polarity gene lines. Genes
Dev. 14,1364
-1376.
Heslip, T. R., Theisen, H., Walker, H. and Marsh, J. L. (1997). Shaggy and dishevelled exert opposite effects on Wingless and Decapentaplegic expression and on positional identity in imaginal discs. Development 124,1069 -1078.[Abstract]
Hurlstone, A. and Clevers, H. (2002). T-cell factors: turn-ons and turn-offs. EMBO J. 21,2303 -2311.[CrossRef][Medline]
Jiang, J. and Struhl, G. (1996). Complementary and mutually exclusive activities of decapentaplegic and wingless organize axial patterning during Drosophila leg development. Cell 86,401 -409.[CrossRef][Medline]
Klingensmith, J. and Nusse, R. (1994). Signaling by wingless in Drosophila. Dev. Biol. 166,396 -414.[CrossRef][Medline]
Knirr, S. and Frasch, M. (2001). Molecular integration of inductive and mesoderm-intrinsic inputs governs even-skipped enhancer activity in a subset of pericardial and dorsal muscle progenitors. Dev. Biol. 238,13 -26.[CrossRef][Medline]
Kramps, T., Peter, O., Brunner, E., Nellen, D., Froesch, B., Chatterjee, S., Murone, M., Zullig, S. and Basler, K. (2002). Wnt/wingless signaling requires BCL9/legless-mediated recruitment of pygopus to the nuclear beta-catenin-TCF complex. Cell 109,47 -60.[CrossRef][Medline]
Kuang, B., Wu, S. C., Shin, Y., Luo, L. and Kolodziej, P. (2000). split ends encodes large nuclear proteins that regulate neuronal cell fate and axon extension in the Drosophila embryo. Development 127,1517 -1529.[Abstract]
Kumar, J. P. and Moses, K. (2001). The EGF receptor and notch signaling pathways control the initiation of the morphogenetic furrow during Drosophila eye development. Development 128,2689 -2697.
Lane, M. E., Elend, M., Heidmann, D., Herr, A., Marzodko, S.,
Herzig, A. and Lehner, C. F. (2000). A screen for modifiers
of cyclin E function in Drosophila melanogaster identifies Cdk2 mutations,
revealing the insignificance of putative phosphorylation sites in Cdk2.
Genetics 155,233
-244.
Lee, H. H. and Frasch, M. (2000). Wingless effects mesoderm patterning and ectoderm segmentation events via induction of its downstream target sloppy paired. Development 127,5497 -5508.[Abstract]
Lockwood, W. and Bodmer, R. (2002). The patterns of wingless, decapentaplegic, and tinman position the Drosophila heart. Mech. Dev. 114,13 .[CrossRef][Medline]
Ma, C. and Moses, K. (1995). Wingless and patched are negative regulators of the morphogenetic furrow and can affect tissue polarity in the developing Drosophila compound eye. Development 121,2279 -2289.[Abstract]
Nagaraj, R., Pickup, A. T., Howes, R., Moses, K., Freeman, M. and Banerjee, U. (1999). Role of the EGF receptor pathway in growth and patterning of the Drosophila wing through the regulation of vestigial. Development 126,975 -985.[Abstract]
Neumann, C. J. and Cohen, S. M. (1997). Long-range action of Wingless organizes the dorsal-ventral axis of the Drosophila wing. Development 124,871 -880.[Abstract]
Newberry, E. P., Latifi, T. and Towler, D. A. (1999). The RRM domain of MINT, a novel Msx2 binding protein, recognizes and regulates the rat osteocalcin promoter. Biochemistry 38,10678 -10690.[CrossRef][Medline]
Newsome, T. P., Schmidt, S., Dietzl, G., Keleman, K., Asling, B., Debant, A. and Dickson, B. J. (2000). Trio combines with dock to regulate Pak activity during photoreceptor axon pathfinding in Drosophila. Cell 101,283 -294.[CrossRef][Medline]
Nolo, R., Abbott, L. A. and Bellen, H. J. (2000). Senseless, a Zn finger transcription factor, is necessary and sufficient for sensory organ development in Drosophila. Cell 102,349 -362.[CrossRef][Medline]
Nusslein-Volhard, C. and Wieschaus, E. (1980). Mutations affecting segment number and polarity in Drosophila. Nature 287,795 -801.[CrossRef][Medline]
Oswald, F., Kostezka, U., Astrahantseff, K., Bourteele, S., Dillinger, K., Zechner, U., Ludwig, L., Wilda, M., Hameister, H., Knochel, W. et al. (2002). SHARP is a novel component of the Notch/RBP-Jkappa signalling pathway. EMBO J. 21,5417 -5426.[CrossRef][Medline]
Pai, L. M., Orsulic, S., Bejsovec, A. and Peifer, M. (1997). Negative regulation of Armadillo, a Wingless effector in Drosophila. Development 124,2255 -2266.[Abstract]
Parker, D. S., Jemison, J. and Cadigan, K. M.
(2002). Pygopus, a nuclear PHD-finger protein required for
Wingless signaling in Drosophila. Development
129,2565
-2576.
Payre, F., Vincent, A. and Carreno, S. (1999). ovo/svb integrates Wingless and DER pathways to control epidermis differentiation. Nature 400,271 -275.[CrossRef][Medline]
Peifer, M., Sweeton, D., Casey, M. and Wieschaus, E. (1994). wingless signal and Zeste-white 3 kinase trigger opposing changes in the intracellular distribution of Armadillo. Development 120,369 -380.[Abstract]
Piepenburg, O., Vorbruggen, G. and Jackle, H. (2000). Drosophila segment borders result from unilateral repression of hedgehog activity by wingless signaling. Mol. Cell 6,203 -209.[CrossRef][Medline]
Polakis, P. (2000). Wnt signaling and cancer.
Genes Dev. 14,1837
-1851.
Rebay, I., Chen, F., Hsiao, F., Kolodziej, P. A., Kuang, B. H.,
Laverty, T., Suh, C., Voas, M., Williams, A. and Rubin, G. M.
(2000). A genetic screen for novel components of the
Ras/Mitogen-activated protein kinase signaling pathway that interact with the
yan gene of Drosophila identifies split ends, a new RNA recognition motif-
containing protein. Genetics
154,695
-712.
Robertson, H. M., Preston, C. R., Phillis, R. W.,
Johnson-Schlitz, D. M., Benz, W. K. and Engels, W. R.
(1988). A stable genomic source of P element transposase in
Drosophila melanogaster. Genetics
118,461
-470.
Royet, J. and Finkelstein, R. (1997). Establishing primordia in the Drosophila eye-antennal imaginal disc: the roles of decapentaplegic, wingless and hedgehog. Development 124,4793 -4800.[Abstract]
Rulifson, E. J. and Blair, S. S. (1995). Notch regulates wingless expression and is not required for reception of the paracrine wingless signal during wing margin neurogenesis in Drosophila. Development 121,2813 -2824.[Abstract]
Rulifson, E. J., Micchelli, C. A., Axelrod, J. D., Perrimon, N. and Blair, S. S. (1996). wingless refines its own expression domain on the Drosophila wing margin. Nature 384,72 -74.[CrossRef][Medline]
Saller, E., Kelley, A. and Bienz, M. (2002) The
transcriptional repressor Brinker antagonizes Wingless signaling.
Genes Dev. 16,1828
-1838.
Shi, Y., Downes, M., Xie, W., Kao, H. Y., Ordentlich, P., Tsai,
C. C., Hon, M. and Evans, R. M. (2001). Sharp, an
inducible cofactor that integrates nuclear receptor repression and activation.
Genes Dev. 15,1140
-1151.
Thompson, B., Townsley, F., Rosin-Arbesfeld, R., Musisi, H. and Bienz, M. (2002). A new nuclear component of the Wnt signalling pathway. Nat. Cell Biol. 22, 22.
Treisman, J. E. and Rubin, G. M. (1995). wingless inhibits morphogenetic furrow movement in the Drosophila eye disc. Development 121,3519 -3527.[Abstract]
Tsuda, L., Nagaraj, R., Zipursky, S. and Banerjee, U. (2002). An EGFR/Ebi/Sno pathway promotes Delta expression by inactivating Su(H)/SMRTER repression during inductive Notch signaling. Cell 110,625 .[CrossRef][Medline]
Waltzer, L., Vandel, L. and Bienz, M. (2001). Teashirt is required for transcriptional repression mediated by high Wingless levels. EMBO J. 20,137 -145.[CrossRef][Medline]
Wiellette, E. L., Harding, K. W., Mace, K. A., Ronshaugen, M. R., Wang, F. Y. and McGinnis, W. (1999). spen encodes an RNP motif protein that interacts with Hox pathways to repress the development of head-like sclerites in the Drosophila trunk. Development 126,5373 -5385.[Abstract]
Wolff, T. and Ready, D. F. (1993). Pattern Formation in the Drosophila Retina. In The Development of Drosophila melanogaster, Vol. II (ed. A. Bate and M. Martinez Arias), pp. 1277-1326. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Wu, X., Golden, K. and Bodmer, R. (1995). Heart development in Drosophila requires the segment polarity gene wingless. Dev. Biol. 169,619 -628.[CrossRef][Medline]
Xu, T. and Rubin, G. M. (1993). Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117,1223 -1237.[Abstract]
Yanagawa, S., Matsuda, Y., Lee, J. S., Matsubayashi, H., Sese, S., Kadowaki, T. and Ishimoto, A. (2002). Casein kinase I phosphorylates the Armadillo protein and induces its degradation in Drosophila. EMBO J. 21,1733 -1742.[CrossRef][Medline]
Zecca, M., Basler, K. and Struhl, G. (1996). Direct and long-range action of a wingless morphogen gradient. Cell 87,833 -844.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. H. Eun, K. Lea, E. Overstreet, S. Stevens, J.-H. Lee, and J. A. Fischer Identification of Genes That Interact With Drosophila liquid facets Genetics, March 1, 2007; 175(3): 1163 - 1174. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Feng, G. T. Bommer, Y. Zhai, A. Akyol, T. Hinoi, I. Winer, H. V. Lin, K. M. Cadigan, K. R. Cho, and E. R. Fearon Drosophila split ends Homologue SHARP Functions as a Positive Regulator of Wnt/{beta}-Catenin/T-Cell Factor Signaling in Neoplastic Transformation Cancer Res., January 15, 2007; 67(2): 482 - 491. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Bondos, X.-X. Tan, and K. S. Matthews Physical and Genetic Interactions Link Hox Function with Diverse Transcription Factors and Cell Signaling Proteins Mol. Cell. Proteomics, May 1, 2006; 5(5): 824 - 834. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jemc and I. Rebay Characterization of the split ends-Like Gene spenito Reveals Functional Antagonism Between SPOC Family Members During Drosophila Eye Development Genetics, May 1, 2006; 173(1): 279 - 286. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Seto and H. J. Bellen Internalization is required for proper Wingless signaling in Drosophila melanogaster. J. Cell Biol., April 10, 2006; 173(1): 95 - 106. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hiriart, H. Gruffat, M. Buisson, I. Mikaelian, S. Keppler, P. Meresse, T. Mercher, O. A. Bernard, A. Sergeant, and E. Manet Interaction of the Epstein-Barr Virus mRNA Export Factor EB2 with Human Spen Proteins SHARP, OTT1, and a Novel Member of the Family, OTT3, Links Spen Proteins with Splicing Regulation and mRNA Export J. Biol. Chem., November 4, 2005; 280(44): 36935 - 36945. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Arca, F. Lombardo, J. G. Valenzuela, I. M. B. Francischetti, O. Marinotti, M. Coluzzi, and J. M. C. Ribeiro An updated catalogue of salivary gland transcripts in the adult female mosquito, Anopheles gambiae J. Exp. Biol., October 15, 2005; 208(20): 3971 - 3986. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brumby, J. Secombe, J. Horsfield, M. Coombe, N. Amin, D. Coates, R. Saint, and H. Richardson A Genetic Screen for Dominant Modifiers of a cyclin E Hypomorphic Mutation Identifies Novel Regulators of S-Phase Entry in Drosophila Genetics, September 1, 2004; 168(1): 227 - 251. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Ludewig, C. Kober-Eisermann, C. Weitzel, A. Bethke, K. Neubert, B. Gerisch, H. Hutter, and A. Antebi A novel nuclear receptor/coregulator complex controls C. elegans lipid metabolism, larval development, and aging Genes & Dev., September 1, 2004; 18(17): 2120 - 2133. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||