|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00549
Botanical Institute III, University of Köln, Gyrhofstrasse 15, Köln, D-50931, Germany
* Authors for correspondence (e mail: jaideep.mathur{at}uni-koeln.de and martin.huelskamp{at}uni-koeln.de)
Accepted 15 April 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Cytoskeleton, ARP2/3-complex, Actin, Trichomes, Morphogenesis
| INTRODUCTION |
|---|
|
|
|---|
Two recent studies have suggested that only certain actin configurations
might be favorable for triggering local growth. It was observed in tip-growing
root hairs that unstable (very dynamic) actin is essential for localized
expansion (Ketelaar et al.,
2003
) and that cell-surface expansion caused by overexpression of
the general actin-cytoskeleton regulator ROP (a plant Rho-like-GTPase)
correlates with an overall increase in fine filamentous (F-) actin
(Fu et al., 2002
). If only
fine F-actin is conducive for local growth, would a denser F-actin
configuration hinder growth? Furthermore, what is the molecular identity of
the factor responsible for the creation of fine F-actin?
We have approached these questions through the cell-biological and
molecular analysis of crooked, an Arabidopsis mutant
belonging to the distorted class, that characteristically exhibits
expansion-related defects of short, irregularly shaped trichome cells
(Hülskamp et al., 1994
).
Actin inhibitors phenocopy the dis mutants and the F-actin
cytoskeleton in mutant trichomes is usually aberrant
(Mathur et al., 1999
;
Szymanski et al., 1999
). We
show that the development of aberrant shapes in different cell types in
crooked is linked to the progressive accumulation of dense actin in
atypical intracellular locations. Furthermore, actin organization and
localized expansion in crooked cells correlates with the behavior and
distribution of subcellular organelles and expansion is promoted only in those
cellular regions that possess fine F-actin, whereas it is severely restricted
in areas with dense F-actin accumulations. Subsequent molecular identification
of CROOKED showed it to be the plant ortholog of ARPC5
(Cooper et al., 2001
), the
smallest subunit of a conserved actin polymerization enhancer, the ARP2/3
complex, that in other organisms is required for creating fine dendritic
arrays of F-actin (Machesky and Gould,
1999
; Svitkina and Borisy,
1999
). Our combined cell-biological and molecular characterization
of CROOKED, and the comparative data from wild-type
Arabidopsis suggest that the local density of F-actin can either
permit or limit exocytic vesicles from reaching the plasma membrane for their
final assimilation step that is required for localized expansion and
differential growth.
| MATERIALS AND METHODS |
|---|
|
|
|---|
20° from the vertical such that roots and hair cells projected
out into an airy environment before reaching the agar medium.
Transient expression of DNA in seedlings
The identification of a positive BAC clone capable of rescuing the
crooked phenotype, as well as initial testing of the different
cDNA/genomic and GFP-linked constructs, was carried out through transient
expression assays. Seeds were sown in the center of plates containing MS
medium and used when the seedlings were 7-9 days old (first leaf primordia
just visible). The DNA (cDNA/genomic, BAC) being tested was mixed with
GFP-mTalin in a 1:1 ratio (ca. 500 ng DNA/µl), precipitated around 1 µm
diameter gold particles (BioRad, Hercules, CA) following the manufacturer's
directions, loaded onto carrier membranes and shot into the plants at 1100 psi
Helium pressure under a vacuum of 25 inches of Hg, using a PDS-1000/Helium
driven Biolistic delivery apparatus (BioRad). Plants were screened for green
fluorescence under FITC filter illumination after 16 hours and the development
of trichome/other cells expressing the shot-DNA followed for up to 48 hours.
The addition of GFP-mTalin ensured visualization of the shot cell and was not
required when other fluorescent fusion constructs such as p35
S-YFP-mTalin and p35S-ERD2-GFP were used.
Microscopy and image processing
Agarose impressions of epidermal surfaces were prepared as described
(Mathur and Koncz, 1997
).
Light and fluorescence microscopy was carried out on a LEICA-DMRE microscope
equipped with a high resolution KY-F70 3-CCD JVC camera and a frame grabbing
DISKUS software (DISKUS, Technisches Büro, Königswinter). Lime lapse
movies were created using DISKUS software or the Leica CLSM software and later
processed using the Quick Time 5.0 movie software. Velocity measurements for
cytoplasmic streaming, peroxisomes and Golgi bodies were taken as described
earlier (Mathur et al., 2002
)
on a minimum of 25 trichomes and root-hair cells each. For confocal laser
scanning microscopy plants were grown as described
(Mathur et al., 1999
). The
descriptions provided here were obtained on 25 (each observation) randomly
selected wild-type and transgenic plants. A spectrophotometric CLSM (Leica
TCS-SP2) was used for visualizing EGFP, and discriminating between EYFP/EGFP
using the settings as described (Mathur et
al., 2002
). Images were sized, processed for brightness/contrast
and CMYK alterations using the Adobe Photoshop 6.0 software.
Molecular techniques
The crooked gene was isolated following a candidate gene approach
based on its map position (chromosome 4) and a cell biological
characterization. The putative actin polymerization factor was identified
(At4g01710 from contig t15b16) in the MIPS Arabidopsis database
(http://mips.gsf.de/cgi-bin/proj/thal/).
Attempts to isolate the crooked cDNA were based on the annotated sequence
available for gene (At4g01710; MIPS). After the web publication of a
full-length cDNA for At4g01710 gene (RAFL06-77-B13; Resource no. pda03657;
NCBI Accession Number AY052191;
http://pfgweb.gsc.riken.go.jp/index.html),
a primer set (JM364R GGAATGATGGATCAAACGGTGTTGATGGTATCAGTAAG and JM365F
GAGAGAAAGATCGAATCGAAGAATGGCAGAATT) was designed to provide a 515 bp clone from
a cDNA library DNA generated from 25-day-old, soil grown plants of
Arabidopsis thaliana (ecotype Landsberg erecta) using standard
procedure (Sambrook and Russel,
2001
). The transcriptional start site for At4g01710 was determined
by RNA ligase-mediated rapid amplification of 5' cDNA ends (RLM-RACE)
carried out using the Gene Racer kit (Cat. No. L1500-01; Invitrogen) according
to the manufacturer's instructions. The genomic clone (ATG to TGA) of
At4g01710 was PCR-amplified from genomic DNA extracted from wild-type and
mutant plants (PCR primers: JM 64F GTACTCAGGATCCTCGGCTTATGTCTCCGG and JM65R
ATACATAAGAGGGAGCTCAATGATGGATCA). Details of other primers and PCR conditions
are available on request. The genomic and cDNA fragments were sub-cloned into
a pGEM-T-easy vector (Promega), sequenced on an ABI-prism sequencer and
finally cloned into a pCAMBIA 1300 binary vector (accession number AF234296)
under the control of a cauliflower mosaic virus promoter (CaMV p35S), or a
trichome specific GLABRA2 promoter
(Szymanski et al., 1998
) for
plant transformation. DNA and protein sequence homology searches were carried
out using the respective BLAST programs
(Altschul et al., 1997
). Amino
acid alignments were carried out using the Clustal-W multiple sequence
alignment algorithm
(http://www.ch.embnet.org/).
| RESULTS |
|---|
|
|
|---|
|
F-actin configuration is aberrant in crooked and
mislocalizes areas of differential expansion
F-actin was visualized in living cells using plants expressing the
GFP-mTalin transgene that has been shown to specifically bind to
filamentous-actin with a high affinity
(McKann and Craig, 1997
;
Kost et al., 2000
). However,
during the early stages of development, both wild-type and crooked
trichomes displayed a general green fluorescence where it was not possible to
discriminate between fine and dense actin (data not shown). Our observations
on the actin cytoskeleton started soon after the formation of branch initials
when the trichome cell enters a rapid expansion phase
(Szymanski et al., 1999
). In
wild-type trichomes, the cortical regions were enmeshed in very fine F-actin,
whereas dense F-actin accumulation was observed only in small domains at the
branch tips, in the region of branch-bifurcation
(Fig. 2A), and as a few
adherent actin patches in elongating branches. With further expansion, the
cortical fine actin filaments became relatively diffuse and difficult to
resolve, actin patches on the sides of branches disappeared and well-defined
F-actin cables became prominent (Fig.
2A). A wild-type trichome cell with fully extended branches thus
displayed prominent longitudinally aligned subcortical F-actin cables,
connecting together in the dense actin patches that are maintained at branch
tips and branch junctions (Fig.
2B). F-actin organization in crooked trichomes started
essentially in a manner similar to the wild type, with fine cortical F-actin
and dense actin configurations at the tips and junction and sides of branches
(Fig. 2A). However, in contrast
to the wild type, actin patches did not disappear with progressing age of the
cell but instead became more prominent through increased actin accumulation
(Fig. 2C). In addition, instead
of developing into the extended actin cables typical to the wild type, the
F-actin in crooked (Fig.
2C-E) became organized into numerous, thick, transversely linked
actin bundles and produced a characteristic, wide-polygonal meshwork
(Fig. 2D,F). Dense actin
bundling in many crooked trichomes did not extend throughout the cell
and left random pockets where fine cortical F-actin could still be observed.
Though crooked trichomes never displayed the diffuse cortical F-actin
state shown by wild-type trichomes, regions containing the relatively fine
cortical actin expanded more when compared with areas filled with dense actin.
Trichomes in crooked trichomes consequently showed randomly localized
regions of expansion (with fine F-actin) and non-expansion (with bundled
F-actin).
|
|
We focused our analysis on visualizing the general cytoplasmic streaming
and the endo-membrane system, the mobility of which is known to depend on the
actin cytoskeleton (Williamson,
1993
; Boevink et al.,
1998
).
Cytoplasmic organization and behavior of Golgi bodies exhibits
regional differences in crooked
The correlation of expanding regions with fine F-actin and non-expanding
regions with dense F-actin in crooked cells suggested that during
their development the dynamics and distribution of organelles might also be
affected in a region-specific manner. In general, wild-type trichomes
displayed a longitudinally oriented cytoplasmic organization with transversely
linked cytoplasmic strands occurring mainly in the stalk region and spanning
the large central vacuole. The cytoplasmic streaming in wild-type trichomes
occurred at an average velocity of 0.8±0.3 µm/second. In
crooked trichomes, the cytoplasmic organization in expanded regions
was similar to the wild type though the velocity of cytoplasmic streaming was
reduced to 0.6±0.3 µm/second (n=25). However, cytoplasmic
strands became thick and transversely linked in non-expanded areas of
crooked trichomes whereas cytoplasmic streaming became reduced to
0.3-0.5 µm/second in these areas. This was independently confirmed by
analyzing the saltatory movement of peroxisomes, known to occur along F-actin
tracks (Mathur et al., 2002
).
In well-expanded regions of crooked trichomes, peroxisome motility
was found to be comparable with that of the wild type (average velocity
0.9±0.2 µm/second; n=25) but was reduced by up to 15-fold
in unexpanded areas. Taken together, these data indicate that actin-dependent
organelle movement was moderately impaired but not blocked in expanding
regions with fine F-actin, whereas organelles were trapped into near
immobility in areas with dense actin.
We focused our further analysis on Golgi bodies, which are known to track
along F-actin strands (Boevink et al.,
1998
; Nebenführ et al.,
1999
) and are suggested to have a direct bearing on localized
growth through its processing and release of exocytosis-competent vesicles
(Miller et al., 1999
). The
stably expressed ERD2-GFP marker (Boevink
et al., 1998
) that we used, predominantly labeled the Golgi stacks
in actively growing Arabidopsis cells
(Fig. 4). In wild-type
trichomes, 0.6-1.0 µm oblong to spherical Golgi bodies were found regularly
distributed and moved with velocities ranging from 0.2 to 1.8 µm/seconds
(n=150). As described for other plant cells
(Boevink et al., 1998
;
Nebenführ et al., 1999
),
both short oscillatory movements, as well as long-range saltations are
observed. Areas with major accumulation of Golgi bodies were not observed in
growing wild-type trichomes, although Golgi bodies did exhibit a tendency to
slow down within the narrow confines of extending branches
(Fig. 4A). By contrast, both
the number and size of Golgi bodies was found to be increased by two- to
fivefold in crooked trichomes
(Fig. 4A,B) with certain
regions showing accumulations of up to 15 individual, 1-3 µm long, Golgi
bodies (Fig. 4B,C).
Paradoxically, despite the regional increase in the Golgi bodies, these
regions corresponded to non-expanded areas of crooked trichomes,
suggesting that the release and transport of Golgi-processed vesicles might be
affected. Transient co-expression of YFP-mTalin (labeled F-actin) and ERD2-GFP
markers followed by their confocal spectral separation allowed simultaneous
visualization of actin and Golgi bodies in developing crooked
trichome cells and confirmed the accumulation of Golgi bodies within pockets
of dense F-actin (Fig. 4D).
More region-specific behavioral differences also became apparent; Golgi bodies
in expanded regions of crooked trichomes moved singly or in pairs in
a manner similar to the wild type, whereas those trapped in dense
F-actin-filled non-expanded regions performed very short 1-3 µm
oscillations. We assumed that fine F-actin had to be present in a cellular
region for Golgi-processed vesicles to be released efficiently for their
assimilation leading to local expansion.
|
|
| DISCUSSION |
|---|
|
|
|---|
Taking these observations together a general picture emerged wherein the
differential localization of loose versus dense F-actin could determine the
localities where vesicles could be released or retained to promote or restrict
expansion. This was tested by predicting intracellular locations in wild type
cells where the placement/maintenance of dense actin could direct the way in
which a cell could expand (sketches, Fig.
6). Subsequent observations on wild-type cells conformed totally
to the predictions (Fig. 6A-D).
Our findings are consistent with observations in animal cells
(Muallem et al., 1995
;
Miyake et al., 2001
), where a
dense actin configuration has been suggested to act as a barrier and hinder
the access of vesicles to their target sites. Further support for this
F-actin-density-based mechanism has come from our molecular identification of
CROOKED that implicates an actin polymerization modulating complex
hitherto unknown in plants as a pivotal player in the cellular machinery
required for creating differential growth conditions.
|
With specific reference to the ARPC5/CROOKED subunit, reconstitution
experiments using individual subunits of the complex have suggested that the
small subunits ARPC2 (p35), 4(p20) and 5(p16) may be important for the overall
integrity of the complex (Gournier et al.,
2001
). A specific deletion of the ARPC5 subunit led to 85 times
less nucleation efficiency of the complex in insect cells
(Gournier et al., 2001
). Our
observations of impaired fine F-actin organization in crooked and
rescue of the mutant phenotype by the human ortholog suggest that the function
of this subunit as a nucleation enhancer may have been conserved across the
kingdoms. Alternatively, the small ARPC5 subunit may be required for
microfilament bundling because loss of its activity results in actin
aggregation and reduced long actin-cable formation (e.g.
Fig. 2). Moreover, studies in
other organisms have so far not revealed the effects of ARPC5 deletion on the
overall actin organization. Though the crooked mutant is clearly not
a null allele, the non-essential nature of Arabidopsis trichomes has
allowed the isolation of seven more mutants with distorted trichomes
(Hülskamp et al., 1994
).
Two of these mutants are now known to correspond to ARP2 and ARP3 subunits of
the complex and exhibit a similar actin organization as crooked
(Mathur et al., 2003
). Taken
together, the mutant phenotypes and the conditional requirement of the complex
during rapid growth have allowed the first glimpse of what goes wrong with
actin organization in living cells when the actin nucleation-enhancing
capability of the ARP2/3 complex is compromised.
ARP2/3 complex mediated actin polymerization may play a role during
the vesicle assimilation step
The ARP2/3 complex is best known for its role in the rocketing motility of
entero-pathogenic organisms and endocytic vesicles
(Machesky, 1999
;
Merrifield et al., 1999
).
Specifically, the ARPC5 subunit has been implicated in the motility and
distribution of mitochondria in yeast
(Boldogh et al., 2001
).
Although our present observations do not provide evidence for a direct role of
CROOKED in vesicle motility, it may be speculated that after the
release of vesicles into the cortical zone, a certain amount of
actin-polymerization generated propulsive force may be required for their
effective assimilation into the plasma membrane. The crooked mutant
may thus be impaired in both vesicle release and assimilation steps.
The molecular identification of CROOKED links different
regulators of the actin cytoskeleton together
The molecular identification of CROOKED and subsequent demonstration of its
functional conservation are strongly suggestive of the occurrence of the
ARP2/3 complex in plants and bring together a number of recent observations
indicating that some of the key interactors of the complex may already have
been identified in plants. For example, from other organisms, the ARP2/3
complex is known to be a downstream target for Rho-like GTPases
(Ridley, 2001
). In plants,
although overexpression of a ROP resulted in increased fine F-actin
(Fu et al., 2002
) the identity
of the downstream effector was so far unclear. Similarly, mutations in the
novel maize BRICK1 gene show actin cytoskeleton linked defects
including an inability to form epidermal lobes and differentiate stomatal
complexes (Frank and Smith,
2002
). A human homolog of BRICK1, the HSPC300
gene, has been shown to interact with the ARP2/3 complex
(Eden et al., 2002
;
Smith, 2003
), whereas two
additional BRICK genes are speculated to be ARP2/3 complex activators
(Frank et al., 2003
) similar
to the WASP family activators in animal systems
(Higgs and Pollard, 2001
). The
molecular link provided by the cloning of CROOKED suggests that the
mechanism for actin modulation involving the ROP and BRK
genes, and the ARP2/3 complex may be well conserved between plants and other
organisms. The complex is also known to interact with profilins
(Mullins et al., 1998b
),
actin-depolymerizing-factors (ADF/cofilin)
(Svitkina and Borisy, 1999
),
which along with different F-actin bundling proteins are already known to
share the same intracellular domains in expanding plant cells
(Jiang et al., 1997
;
Dong et al., 2001
;
Vidali et al., 2001
;
Vantard and Blanchoin, 2002
).
Finally, although not addressed here, the crooked mutant provides an
enviable tool to understand the interactions between the actin and
microtubular components of the cytoskeleton in higher plants, including their
apparent cooperative roles in subcellular motility and cell morphogenesis.
Conclusions
The following generalizations on cell-shape development have emerged from
the cell-biological/molecular characterization of CROOKED: (1) fine
F-actin, generated through the mediation of the ARP2/3 complex (where the
ARPC5/CROOKED subunit plays an important role in maintaining the
complex-nucleating capability), is required for cell expansion to occur; (2) a
localized increase in the presence of organelles and vesicles at a spot does
not necessarily translate into localized expansion, rather expansion can
proceed only when vesicles carrying cell-building material can be released and
assimilated; and (3) the spatiotemporal regulation of F-actin density within a
cell can create a loose sieve to allow vesicle release or a dense barrier to
trap vesicles and thus determine where and when vesicles will be released for
effective local expansion; The cumulative result from these phenomenon can
account for the diverse cell shapes observed in plants
(Fig. 6).
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J.,
Zhang, Z., Miller, W. and Lipman, D. J. (1997). Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res. 25,3389
-3402.
Baluska, F., Jasik, J., Edelmann, H. G., Salajova, T. and
Volkmann, D. (2001). Latrunculin-B induced plant dwarfism:
plant cell elongation is F-actin dependent. Dev. Biol.
231,618
-632.
Boevink, P., Oparka, K., Santa Cruz, S., Martin, B., Betteridge,
A. and Hawes, C. (1998). Stacks on tracks: the plant
Golgi apparatus traffics on an actin/ER network. Plant
J. 15,441
-447.[CrossRef][Medline]
Boldogh, I. R., Hyeong-Cheol, L., Nowakowski, W. D., Karmon, S.
L., Hays, L. G., Yates, J. R., III and Pon, L. A.
(2001). ARP2/3 complex and actin dynamics are required for
actin-based mitochondrial motility in yeast. Proc. Natl. Acad. Sci.
USA 98,3162
-3167.
Clough, S. J. and Bent, A. F. (1998). Floral
dip: a simplified method for Agrobacterium-mediated transformation of
Arabidopsis thaliana. Plant J.
16,735
-743.[CrossRef][Medline]
Cooper, J. A., Wear, M. A. and Weaver, A. M.
(2001). ARP2/3 complex: advances on the inner workings of a
molecular machine. Cell
107,703
-705.[CrossRef][Medline]
Dong, C. H., Kost, B., Xia, G. and Chua, N.-H.
(2001). Molecular identification and characterization of the
Arabidopsis AtADF1, AtADF5 and ATADF6 genes.
Plant Mol. Biol. 45,517
-527.[CrossRef][Medline]
Eden, S., Rohtagi, R., Podtelejnikov, A. V., Mann, M. and
Kirschner, M. W. (2002). Mechanism of regulation of
WAVE1-induced actin nucleation by Rac1 and Nck. Nature
418,790
-793.[CrossRef][Medline]
Foissner, I., Lichtscheidl, I. K. and Wasteneys, G. O.
(1996). Actin-based vesicle dynamics and exocytosis during wound
wall formation in Characean internodal cells. Cell. Motil.
Cytoskeleton 35,35
-48.[CrossRef][Medline]
Frank, M. J. and Smith, L. G. (2002). A small,
novel protein highly conserved in plants and animals promotes the polarized
growth and division of maize leaf epidermal cells. Curr.
Biol. 12,849
-853.[CrossRef][Medline]
Frank, M. J., Cartwright, H. N. and Smith, L. G.
(2003). Three Brick genes have distinct functions in a common
pathway promoting polarized cell division and cell morphogenesis in the maize
leaf epidermis. Development
130,753
-762.
Fu, Y., Li, H. and Yang, Z. (2002). The ROP2
GTPase controls the formation of cortical fine F-actin and the early phase of
directional cell expansion during Arabidopsis organogenesis.
Plant Cell 14,777
-794.
Geitmann, A. and Emons, A. M. (2000). The
cytoskeleton in plant and fungal cell tip growth. J.
Microsc. 198,218
-245.[Medline]
Gournier, H., Goley, E. D., Niederstrasser, H., Trinh, T. and
Welch, M. D. (2001). Reconstitution of human Arp2/3 complex
reveals critical roles of individual subunits in complex structure and
activity, Mol. Cell. 8,1041
-1052.[CrossRef][Medline]
Hawes, C. R., Brandizzi, F. and Andreeva, A. V.
(1999). Endomembranes and vesicle trafficking. Curr.
Opin. Plant Biol. 2,454
-461.[CrossRef][Medline]
Hepler, P. K., Vidali, L. and Cheung, A. Y.
(2001). Polarized cell growth in higher plants. Annu.
Rev. Cell Dev. Biol. 17,159
-187.[CrossRef][Medline]
Higgs, H. N. and Pollard, T. D. (2001).
Regulation of actin filament network formation through Arp2/3 complex:
activation by a diverse array of proteins. Annu. Rev.
Biochem. 70,649
-676.[CrossRef][Medline]
Hudson, A. M. and Cooley, L. (2002). A subset
of dynamic actin rearrangements in Drosophila requires the ARP2/3
complex. J. Cell Biol.
156,677
-668.
Hülskamp, M., Misera, S. and Jürgens, G.
(1994). Genetic dissection of trichome cell development in
Arabidopsis. Cell 76,555
-566.[CrossRef][Medline]
Jiang, C. J., Weeds, A. G. and Hussey, P. J.
(1997). The maize actin-depolymerizing-factor, ZmADF3,
redistributes to the growing tip of elongating root hairs and can be induced
to translocate into the nucleus with actin. Plant J.
12,1035
-1043.[CrossRef][Medline]
Ketelaar, T., de Ruijter, N. C. A. and Emons, A. M. C.
(2003). Unstable F-actin specifies the area and microtubule
direction of cell expansion in Arabidopsis root hairs.
Plant Cell. 15,285
-292.
Kost, B., Spielhofer, P. and Chua, N.-H.
(1998). A GFP-mouse talin fusion protein labels plant actin
filaments in vivo and visualizes the actin cytoskeleton in growing pollen
tubes. Plant J. 16,393
-401.[CrossRef][Medline]
Kost, B., Spielhofer, P., Mathur, J., Dong, C. H. and Chua,
N.-H. (2000). Non-invasive F-actin visualization in living
plant cells using a GFP-mouse talin fusion protein. In Actin: A
Dynamic Framework for Multiple Plant Cell Functions (ed. C. J.
Staiger, F. Baluska, D. Volkmann and P. W. Barlow), pp.637
-659. Dordrecht: Kluwer Academic.
Machesky, L. (1999). Rocket-based motility: A
universal mechanism? Nat. Cell. Biol.
1, E29-E31.[CrossRef][Medline]
Machesky, L. M. and Gould, K. L. (1999). The
ARP2/3 complex: a multifunctional actin organizer. Curr. Opin. Cell
Biol. 11,117
-121.[CrossRef][Medline]
Machesky, L. M., Reeves, E., Wientjes, F., Mattheyse, F. J.,
Grogan, A., Totty, N. F., Burlingame, A. L., Hsuan, J. J. and Segal, A.
W. (1997). Mammalian actin-related protein 2/3 complex
localizes to regions of lamellipodia protrusion and is composed of
evolutionary conserved proteins. Biochem. J.
328,105
-112.[Medline]
Mathur, J. and Koncz, C. (1997). Method for
Preparation of Epidermal Imprints using agarose.
Biotechniques 22,280
-282.[Medline]
Mathur, J., Spielhofer, P., Kost, B. and Chua, N. H.
(1999). The actin cytoskeleton is required to elaborate and
maintain spatial patterning during trichome cell morphogenesis in
Arabidopsis thaliana. Development
126,5559
-5568.[Abstract]
Mathur, J., Mathur, N. and Hülskamp, M.
(2002). Simultaneous visualization of peroxisome and cytoskeletal
elements reveals actin and not microtubule-based peroxisome motility in
plants. Plant Physiol.
128,1031
-1045.
Mathur, J. and Hülskamp, M. (2002).
Microtubules and microfilaments in cell morphogenesis in higher plants.
Curr. Biol. 12,R669
-R676.[CrossRef][Medline]
Mathur, J., Mathur, N., Kernebeck, B. and Hulskamp, M.
(2003). Mutations in Actin Related Proteins 2 and 3 affect cell
shape development in Arabidopsis thaliana. Plant Cell
(in press).
McKann, R. O. and Craig, S. W. (1997). The
I/LWEQ module: A conserved sequence that signifies F-actin binding in
functionally diverse proteins from yeast to mammals. Proc. Natl.
Acad. Sci. USA 94,5679
-5684.
Merrifield, C. J., Moss, S. E., Ballestrem, C., Imhof, B. A.,
Giese, G., Wunderlich, I. and Almers, W. (1999).
Endocytic vesicles move at the tips of actin tails in cultured mast cells.
Nat. Cell Biol. 1,72
-74[CrossRef][Medline]
Miller, D. D., de Ruitjer, N. C. A., Bisseling, T. and Emons, A.
M. C. (1999). the role of actin in root hair morphogenesis:
studies with lipochito-oligosaccharide as a growth stimulator and cytochalasin
as an actin perturbing drug. Plant J.
17,141
-154.[CrossRef]
Miyake, K., McNeil, P. l., Suzuki, K., Tsunoda, R. and Sugai,
N. (2001). An actin barrier to resealing. J. Cell
Sci. 114,3487
-3492.
Muallem, S., Kwiatkowska, K., Xu, X. and Lin, H. L.
(1995). Actin filament disassembly is a sufficient final trigger
for exocytosis in non-excitable cells. J. Cell Biol.
128,589
-598.
Mullins, R. D., Heuser, J. A. and Pollard, T. D.
(1998a). The interaction of Arp2/3 complex with actin:
Nucleation, high affinity pointed end capping, and formation of branching
networks of filaments. Proc. Natl. Acad. Sci. USA
95,6181
-6186.
Mullins, R. D., Kelleher, J. F., Xu, J. and Pollard, T. D.
(1998b). Arp2/3 complex from Acanthamoeba binds profilin and
cross-links actin filaments. Mol. Biol. Cell
9, 841-852.
Murashige, T. and Skoog, F. (1962). A revised
medium for rapid growth and bioassays with tobacco tissue cultures.
Physiol. Plant 15,473
-497.[CrossRef]
Nebenführ, A., Gallagher, L. A., Dunahay, T. G., Frohlick,
J., Mazurkiewicz, A. M., Meehl, J. B. and Staehelin, A. L.
(1999). Stop-and-go movements of plant golgi stacks are mediated
by actin-myosin system. Plant Physiol.
121,1127
-1141.
Qualmann, B., Kessels, M. M. and Kelly, R. B.
(2000). Molecular links between endocytosis and the actin
cytoskleton. J. Cell Biol.
150,F111
-F116.[CrossRef][Medline]
Ridley, A. J. (2001). Rho proteins: linking
signaling with mmbrane trafficking. Traffic
2, 303-310.[CrossRef][Medline]
Sambrook, J. and Russell, D. W. (2001).
Molecular Cloning. A Laboratory Manual. Cold Spring
Harbor, New York: Cold Spring Harbor Laboratory Press.
Smith, L. G. (2003). Cytoskeletal control of
plant cell shape: getting the fine points. Curr. Opin. Plant
Biol. 6,63
-73.[CrossRef][Medline]
Svitkina, T. M. and Borisy, G. G. (1999).
ARP2/3 complex and actin depolymerizing factor/cofilin in dendritic
organization and treadmilling of actin filament array in lamellipodia.
J. Cell Biol. 145,1009
-1026.
Szymanski, D. B., Jilk, R. A., Pollock, S. M. and Marks, M.
D. (1998). Control of GL2 expression in Arabidopsis
leaves and trichomes. Development
125,1161
-1171.[Abstract]
Szymanski, D. B., Marks, D. M. and Wick, S. M.
(1999). Organized F-actin is essential for normal trichome
morphogenesis in Arabidopsis. Plant Cell
11,2331
-2347.
Vantard, M. and Blanchoin, L. (2002). Actin
polymerization processes in plant cells. Curr. Opin. Plant
Biol. 5,502
-506.[CrossRef][Medline]
Vidali, L., Mckenna, S. T. and Hepler, P. K.
(2001). Actin polymerization is essential for pollen tube growth.
Mol. Biol. Cell 12,2534
-2545.
Volkmann, N., Amann, K. J., Stoilova-McPhie, S., Egile, C.,
Winter, D. C., Hazelwood, L., Heuser, J. E., Li, R., Pollard, T. D. and
Hanein, D. (2001). Structure of Arp2/3 complex in its
activated state and in actin filament branch junctions.
Science 293,2456
-2459.
Welch, M. D., DePace, A. H., Verma, S., Iwamatsu, A. and
Mitchison, T. J. (1997). The human ARP2/3 complex is
composed of evolutionary conserved subunits and is localized to cellular
regions of dynamic actin filament assembly. J. Cell
Biol. 138,375
-384.
Welch, M. D. (1999). The world according to
Arp: regulation of actin nucleation by the Arp2/3 complex. Trends
Cell Biol. 9,423
-427.[CrossRef][Medline]
Williamson, R. E. (1993). Organelle movements.
Annu. Rev. Plant Physiol. Plant Mol. Biol.
44,181
-202.[CrossRef]
Winter, D. C., Choe, E. Y. and Li, R. (1999).
Genetic dissection of the budding yeast ARP2/3 complex: a comparison of the in
vivo and structural roles of individual subunits. Proc. Natl. Acad.
Sci. USA 96,7288
-7293.
Related articles in Development:
This article has been cited by other articles:
![]() |
M. D. Marks, J. P. Wenger, E. Gilding, R. Jilk, and R. A. Dixon Transcriptome Analysis of Arabidopsis Wild-Type and gl3-sst sim Trichomes Identifies Four Additional Genes Required for Trichome Development Mol Plant, July 1, 2009; 2(4): 803 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Maisch, J. Fiserova, L. Fischer, and P. Nick Tobacco Arp3 is localized to actin-nucleating sites in vivo J. Exp. Bot., February 1, 2009; 60(2): 603 - 614. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yokota, E. Fukai, L. H. Madsen, A. Jurkiewicz, P. Rueda, S. Radutoiu, M. Held, M. S. Hossain, K. Szczyglowski, G. Morieri, et al. Rearrangement of Actin Cytoskeleton Mediates Invasion of Lotus japonicus Roots by Mesorhizobium loti PLANT CELL, January 1, 2009; 21(1): 267 - 284. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dyachok, M.-R. Shao, K. Vaughn, A. Bowling, M. Facette, S. Djakovic, L. Clark, and L. Smith Plasma Membrane-Associated SCAR Complex Subunits Promote Cortical F-Actin Accumulation and Normal Growth Characteristics in Arabidopsis Roots Mol Plant, November 1, 2008; 1(6): 990 - 1006. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhang, E. L. Mallery, J. Schlueter, S. Huang, Y. Fan, S. Brankle, C. J. Staiger, and D. B. Szymanski Arabidopsis SCARs Function Interchangeably to Meet Actin-Related Protein 2/3 Activation Thresholds during Morphogenesis PLANT CELL, April 1, 2008; 20(4): 995 - 1011. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-F. Perroud and R. S. Quatrano BRICK1 Is Required for Apical Cell Growth in Filaments of the Moss Physcomitrella patens but Not for Gametophore Morphology PLANT CELL, February 1, 2008; 20(2): 411 - 422. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Guimil and C. Dunand Cell growth and differentiation in Arabidopsis epidermal cells J. Exp. Bot., November 1, 2007; 58(14): 3829 - 3840. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Uhrig, M. Mutondo, I. Zimmermann, M. J. Deeks, L. M. Machesky, P. Thomas, S. Uhrig, C. Rambke, P. J. Hussey, and M. Hulskamp The role of Arabidopsis SCAR genes in ARP2-ARP3-dependent cell morphogenesis Development, March 1, 2007; 134(5): 967 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Djakovic, J. Dyachok, M. Burke, M. J. Frank, and L. G. Smith BRICK1/HSPC300 functions with SCAR and the ARP2/3 complex to regulate epidermal cell shape in Arabidopsis Development, March 15, 2006; 133(6): 1091 - 1100. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Grennan High Impact Plant Physiology, December 1, 2005; 139(4): 1574 - 1575. [Full Text] [PDF] |
||||
![]() |
P. A. Harries, A. Pan, and R. S. Quatrano Actin-Related Protein2/3 Complex Component ARPC1 Is Required for Proper Cell Morphogenesis and Polarized Cell Growth in Physcomitrella patens PLANT CELL, August 1, 2005; 17(8): 2327 - 2339. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, J. Dyachok, S. Krishnakumar, L. G. Smith, and D. G. Oppenheimer IRREGULAR TRICHOME BRANCH1 in Arabidopsis Encodes a Plant Homolog of the Actin-Related Protein2/3 Complex Activator Scar/WAVE That Regulates Actin and Microtubule Organization PLANT CELL, August 1, 2005; 17(8): 2314 - 2326. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Prassinos, J.-H. Ko, J. Yang, and K.-H. Han Transcriptome Profiling of Vertical Stem Segments Provides Insights into the Genetic Regulation of Secondary Growth in Hybrid Aspen Trees Plant Cell Physiol., August 1, 2005; 46(8): 1213 - 1225. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Michelot, C. Guerin, S. Huang, M. Ingouff, S. Richard, N. Rodiuc, C. J. Staiger, and L. Blanchoin The Formin Homology 1 Domain Modulates the Actin Nucleation and Bundling Activity of Arabidopsis FORMIN1 PLANT CELL, August 1, 2005; 17(8): 2296 - 2313. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tamura, T. Shimada, M. Kondo, M. Nishimura, and I. Hara-Nishimura KATAMARI1/MURUS3 Is a Novel Golgi Membrane Protein That Is Required for Endomembrane Organization in Arabidopsis PLANT CELL, June 1, 2005; 17(6): 1764 - 1776. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zhong, D. H. Burk, C. J. Nairn, A. Wood-Jones, W. H. Morrison III, and Z.-H. Ye Mutation of SAC1, an Arabidopsis SAC Domain Phosphoinositide Phosphatase, Causes Alterations in Cell Morphogenesis, Cell Wall Synthesis, and Actin Organization PLANT CELL, May 1, 2005; 17(5): 1449 - 1466. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-B. Li, X.-P. Fan, X.-L. Wang, L. Cai, and W.-C. Yang The Cotton ACTIN1 Gene Is Functionally Expressed in Fibers and Participates in Fiber Elongation PLANT CELL, March 1, 2005; 17(3): 859 - 875. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mathur Conservation of boundary extension mechanisms between plants and animals J. Cell Biol., February 28, 2005; 168(5): 679 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Basu, J. Le, S. E.-D. El-Essal, S. Huang, C. Zhang, E. L. Mallery, G. Koliantz, C. J. Staiger, and D. B. Szymanski DISTORTED3/SCAR2 Is a Putative Arabidopsis WAVE Complex Subunit That Activates the Arp2/3 Complex and Is Required for Epidermal Morphogenesis PLANT CELL, February 1, 2005; 17(2): 502 - 524. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. O. Wasteneys and Z. Yang New Views on the Plant Cytoskeleton Plant Physiology, December 1, 2004; 136(4): 3884 - 3891. [Full Text] [PDF] |
||||
![]() |
M. B. Sheahan, C. J. Staiger, R. J. Rose, and D. W. McCurdy A Green Fluorescent Protein Fusion to Actin-Binding Domain 2 of Arabidopsis Fimbrin Highlights New Features of a Dynamic Actin Cytoskeleton in Live Plant Cells Plant Physiology, December 1, 2004; 136(4): 3968 - 3978. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Frank, C. Egile, J. Dyachok, S. Djakovic, M. Nolasco, R. Li, and L. G. Smith Activation of Arp2/3 complex-dependent actin polymerization by plant proteins distantly related to Scar/WAVE PNAS, November 16, 2004; 101(46): 16379 - 16384. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, K. Sorefan, G. Hemmann, and M. W. Bevan Arabidopsis NAP and PIR Regulate Actin-Based Cell Morphogenesis and Multiple Developmental Processes Plant Physiology, November 1, 2004; 136(3): 3616 - 3627. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Basu, S. E.-D. El-Assal, J. Le, E. L. Mallery, and D. B. Szymanski Interchangeable functions of Arabidopsis PIROGI and the human WAVE complex subunit SRA1 during leaf epidermal development Development, September 1, 2004; 131(17): 4345 - 4355. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Brembu, P. Winge, M. Seem, and A. M. Bones NAPP and PIRP Encode Subunits of a Putative Wave Regulatory Protein Complex Involved in Plant Cell Morphogenesis PLANT CELL, September 1, 2004; 16(9): 2335 - 2349. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Saedler, N. Mathur, B. P. Srinivas, B. Kernebeck, M. Hulskamp, and J. Mathur Actin Control Over Microtubules Suggested by DISTORTED2 Encoding the Arabidopsis ARPC2 Subunit Homolog Plant Cell Physiol., July 15, 2004; 45(7): 813 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. Cheung and H.-m. Wu Overexpression of an Arabidopsis Formin Stimulates Supernumerary Actin Cable Formation from Pollen Tube Cell Membrane PLANT CELL, January 1, 2004; 16(1): 257 - 269. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||