|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00520
1 Department of Molecular and Cellular Biology, Harvard University, 16 Divinity
Avenue, Cambridge, MA 02138, USA
2 Biocenter Oulu and Department of Biochemistry, Faculties of Science and
Medicine, University of Oulu, FIN-90014, Oulu, Finland
3 Institut für Molekularbiologie, OE5250, Medizinische Hochschule Hannover,
Carl-Neuberg-Strasse 1, 30625 Hannover, Germany
* Author for correspondence (e-mail: amcmahon{at}mcb.harvard.edu)
Accepted 1 April 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Wnt11, Metanephric kidney, Ureteric branching morphogenesis, Ret, Gdnf, Epithelial mesenchymal interaction, Mouse
| INTRODUCTION |
|---|
|
|
|---|
Epithelial branching morphogenesis is common to the development of the
kidney, lung, pancreas and other ductal organs, and involves the regulated
growth and branching of an epithelial primordium within a mesenchymal
environment. The Ret/Gdnf signaling pathway is a major
regulator of ureteric branching in the metanephric kidney
(Airaksinen and Saarma, 2002
;
Davies and Bard, 1998
;
Lechner and Dressler, 1997
;
Manie et al., 2001
). Glial
cell-derived neurotrophic factor (Gdnf), a member of the TGFß
superfamily, functions as a ligand secreted by the metanephric mesenchyme that
binds to the Ret tyrosine kinase receptor and GFR
1 co-receptor, both of
which are expressed within the ureteric epithelium
(Durbec et al., 1996
;
Pachnis et al., 1993
;
Sariola and Saarma, 1999
;
Vega et al., 1996
). Targeted
mutagenesis of Gdnf, Ret or Gfra1 results in failed ureteric
bud morphogenesis and consequently kidney agenesis
(Schuchardt et al., 1994
;
Sanchez et al., 1996
;
Schuchardt et al., 1996
;
Cacalano et al., 1998
;
Enomoto et al., 1998
).
Conversely, ectopic activation of the Ret/Gdnf pathway induces the
appearance of supernumary ureteric tips. Implantation of Gdnf-coated beads
into kidney explant cultures stimulates ectopic ureteric tip formation from
the Wolffian duct (Brophy et al.,
2001
; Pepicelli et al.,
1997
; Sainio et al.,
1997
). Similarly, in the Foxc1 mutant, an expanded
mesenchymal Gdnf expression domain is the target of ectopic ureteric
bud invasion from the Wolffian duct resulting in multi-lobular kidneys
(Kume et al., 2000
). Based on
these and cell migration studies using MDCK cells, Gdnf has been
proposed as a mesenchymally localized chemoattractant that promotes Wolffian
duct derived ureteric bud outgrowth (Tang
et al., 1998
).
Several members of the Wnt gene family are expressed in the developing
kidney. Wnt genes encode secreted glycoproteins with important roles in
regulating cell proliferation, tissue patterning and morphogenesis during
vertebrate embryogenesis (Wodarz and
Nusse, 1998
). The Wnt ligands are thought to elicit their cellular
responses by binding to transmembrane Frizzled receptors
(Bhanot et al., 1996
). Among
the Wnt members, Wnt11, Wnt7b, Wnt6, Wnt2b and Wn-4 have
been reported to be in unique domains within the embryonic mouse kidney
(Kispert et al., 1996
;
Lin et al., 2001
;
Stark et al., 1994
).
Wnt11 is unique in that it shows a striking expression pattern in the
branching ureteric tips suggesting a possible function in regulating ureteric
branching morphogenesis (Kispert et al.,
1996
). In addition to its kidney expression, Wnt11 is
expressed in multiple embryonic tissues, including the node, heart primordium,
somites, branchial arches and limb buds
(Kispert et al., 1996
).
Analysis of zebrafish silberblick (slb), a mutation in
zebrafish wnt11, and experiments in Xenopus suggest that
Wnt11 signals through the planar cell polarity (PCP), and not the
canonical ß-catenin pathway, to regulate convergence and extension
movements during gastrulation that elongate the axis
(Heisenberg et al., 2000
;
Tada and Smith, 2000
).
Recently, Wnt11 has been implicated in the regulation of
cardiogenesis in Xenopus (Pandur
et al., 2002
).
In the kidney, Wnt11 is expressed in the tips of the branching
ureter at all stages of ureteric development
(Kispert et al., 1996
). In
addition, the implantation of Gdnf coated beads causes induction of
ectopic ureteric tips and upregulation of Wnt11 at these sites
(Pepicelli et al., 1997
;
Sainio et al., 1997
).
Furthermore, genetic and chemical perturbation of sulfated proteoglycan
synthesis blocks ureteric branching and simultaneously results in loss of
Wnt11 expression (Bullock et al.,
1998
; Kispert et al.,
1996
). These experiments indicate a correlation between the
formation of ureteric tips, the appearance of Wnt11 expression and
the initiation of ureteric branching.
In order to determine the function of Wnt11 during metanephric kidney development, we generated a targeted knockout mutation of the Wnt11 locus. We report here the phenotypic analysis of the Wnt11 mutant mice and show that Wnt11 is required for embryonic viability and also for normal ureteric branching morphogenesis. In the absence of Wnt11 function, branching morphogenesis is abnormal resulting in kidney hypoplasia. We show that Wnt11 regulates ureteric branching, at least in part, by regulating mesenchymal Gdnf expression. Ureteric Wnt11 expression is reciprocally dependent upon Ret/Gdnf signaling. Wnt11 and Ret mutants genetically interact in the branching morphogenesis process. We propose that the Wnt11 and Ret/Gdnf signals may participate in a positive, autoregulatory feedback loop to coordinate branching of the ureteric epithelium and hence normal morphogenesis of the normal kidney.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Mouse crosses
All Wnt11 phenotypic analysis was performed with mice maintained
in the 129/Sv background. The Ret mutant allele was obtained from F.
Costantini and maintained in the 129/Sv background. To visualize ureteric
branching morphogenesis, male mice expressing the Cre recombinase
under control of the HoxB7 enhancer were crossed to Rosa26
YFP females (Srinivas et al.,
2001
; Yu et al.,
2002
). Kidneys from HoxB7 Cre; Rosa26 YFP
embryos were dissected and examined under fluorescence using a GFP filter set
on a Nikon SMZ1500 stereoscope.
RNA isolation and RT-PCR
Total RNA was isolated from P1 kidneys using TRI reagent (Sigma) and
treated with RNase free DNase (Gibco BRL). RT-PCR was performed using the
SuperScript Plasmid System (Invitrogen) with the Wnt11 forward primer
5'GAATTCCGAGGAGAGAGCTCCGGAGA3' and the Wnt11 reverse
primer 5'TCTAGAGAGCCACCCCAAAGAAAAAG3'. PCR products were digested
with EcoRI and XbaI and cloned into pCR2.1 (Invitrogen). PCR
products were sequenced using ABI BigDye cycle sequencing. Wild-type and
mutant Wnt11 cDNA sequences were compared to genomic sequence
obtained from the Celera database.
Histology and quantitating kidney size
Kidneys were fixed in 4% paraformaldehyde and taken through a graded
alcohol series in preparation for paraffin wax sectioning. Sections were cut
at 6 µm and stained with Hematoxylin/Eosin. Kidney size was quantified
throughout the whole kidney by counting absolute numbers of glomeruli in
Hematoxylin/Eosin stained sections. Glomeruli were identified by the presence
of a Bowmann's capsule and capillary tuft.
Immunohistochemistry
For whole-mount immunocytochemistry, same stage E12.5 kidneys were fixed in
methanol prior to antibody staining. Kidneys were rehydrated, blocked in
PBS/0.1% Triton X-100/1% dry milk/2% BSA and stained with a 1:20 dilution of
pan-cytokeratin mAb (Sigma) at 4°C overnight. After washes in
PBS/0.1% Triton X-100, staining was visualized with a 1:2000 dilution of Alexa
568 goat-anti-mouse secondary antibody (Molecular Probes). Confocal images
were taken on a Zeiss LSM510 Axioplan confocal microscope.
In situ hybridization
Whole-mount in situ hybridization was performed based on the method
described by Wilkinson (Wilkinson and
Nieto, 1993
). Digoxygenin-UTP labeled antisense riboprobes were
prepared from the following templates Wnt11 (XhoI/T3),
Ret (BamHI/T7), Pax2 (XbaI/T3),
Emx2 (EcoRI/T7). The Gdnf antisense probe
(HindIII/SP6) was made from pcDNA3/Gdnf originally cloned by Andreas
Zimmer.
In all hybridization experiments, only kidneys from same stage embryos were used. Embryos were staged according to the lung branching pattern and only embryos with the same stage of lung branching were used. At this stage of lung development, the medial, caudal and accessory bronchi of the right lobe, and the left lobe main bronchus are clearly visible. Wild-type and mutant kidneys were pooled together during all steps of the protocol to ensure that they were exposed to identical experimental conditions. Wild-type and mutant kidneys were distinguished based on attachment to entire gonad (wild-type kidney) or half a gonad (mutant kidney). After color development, kidneys were washed in PBT (PBS + 0.1% Tween-20), fixed in 4% paraformaldehyde, dehydrated in methanol and photographed in benzyl alcohol:benzyl benzoate (1:1). Images were captured with a Nikon DXM1200 digital camera on a Nikon SMZ1500 stereoscope and assembled using Photoshop 7.0.
| RESULTS |
|---|
|
|
|---|
Analysis of the Wnt11 allele
RT-PCR analysis on RNA from Wnt11/ P1
kidneys identified a cDNA of
1.4 kb in agreement with the predicted size
of a transcript resulting from deletion of exons IV and V
(Fig. 1C). In Wnt11
mutants, a stable transcript is made containing exons I-III upstream and exons
VI and VII downstream of the targeted deletion. Sequence analysis of the
Wnt11 mutant cDNA demonstrated the fusion of exon III to exon VI, and
conceptual translation of the open reading frame predicts that only the
N-terminal 28 amino acids, including the signal peptide sequence, matches the
wild-type sequence while the reading frame downstream of the deletion is out
of frame (Fig. 1D). Thus, the
targeted allele is expected to eliminate wild-type Wnt11
function.
Wnt11/ mutants show lethality in
utero
All Wnt11/ mutant pups died by 2 days
post-partum (pp). In addition, of 152 genotyped pups, only 13% were
Wnt11/ indicating an earlier lethality
(Table 1). Analysis of E12.5
embryos revealed a statistically significant (
2 test,
P<0.001) deviation from expected Mendelian ratios. The cause of
the early lethality was not investigated but could correlate with potential
roles for Wnt11 in node and cardiac signaling that has been
associated with axis elongation and cardiac morphogenesis in zebrafish
(Heisenberg et al., 2000
) and
Xenopus (Pandur et al.,
2002
) embryogenesis, respectively.
|
|
|
|
|
-cytokeratin antibody stains renal epithelia and, prior to the
formation of mature nephrons, visualizes the early architecture of the
branching ureteric duct network. Importantly,
-cytokeratin antibody
stained kidneys from E12.5 Wnt11/ embryos
show loss of ureteric tips and some ampullae with abnormal morphology where
ampullae do not appear to be well separated and continue to share a common
lumen (data not shown). Quantification of ureteric tips at this stage in
Wnt11/ kidneys shows a statistically
significant difference from wild type (
2 test,
P<0.001; Table
3). To address the branching phenotype more thoroughly, we examined expression of Ret and Wnt11 at several stages. In all experiments, only kidneys from equivalent stage wild-type and mutant embryos were compared. Embryos were staged according to lung branching pattern whereby only embryos with the identical pattern of lung branching were used (see Materials and Methods). In E11.5 Wnt11/ kidneys, the ureteric bud has undergone one round of branching giving rise to two ampullae by the T-stage of E11.5 suggesting that the timing of ureteric bud invasion into the mesenchyme and first branching event occur on schedule (Fig. 4A-D). At E12.0, the two ampullae of the T-stage appear smaller than those of wild-type kidneys possibly reflecting retarded growth (compare Fig. 4F with 4E). Each trifurcation is retarded in tip formation by E12.25 (Fig. 4I-L). Wnt11 expression levels are markedly reduced in the tips of mutant kidneys, despite the fact that the Wnt11 antisense probe is identical to sequences common to wild-type and Wnt11 mutant transcripts 3' of the targeted deletion. The early defects result in the loss of ureteric branches when these have clearly resolved from the trifurcation at E12.5, though Ret and Wnt11 are strongly expressed at the branch points (Fig. 4M-P). Thus, the timecourse analysis of the Wnt11/ kidney phenotype shows a retarded morphogenesis that results in a defect in branching trifurcation resulting in loss of ureteric tips. The loss of ureteric tips at these early stages is a likely explanation for the small kidney phenotype observed in Wnt11/ newborns. Nevertheless, some ureteric tips do form in Wnt11/ kidneys and continue to grow and branch during later kidney development, suggesting other signals may be operating to support continued ureteric branching (see Discussion).
|
|
Genetic interactions between Wnt11 and Ret
The observation that Wnt11 and Gdnf expression levels are
mutually interdependent in E12.5 kidneys, prompted us to ask whether
Wnt11 genetically interacts with members of the
Ret/Gdnf pathway. We crossed the Ret mutation into
the Wnt11 genetic background to generate
Ret+/; Wnt11+/ compound
heterozygotes and Ret+/;
Wnt11/ mutant mice. As shown in
Fig. 6 and
Table 4,
Wnt11+/; Ret+/ E18.5
kidneys are 52% (P=0.007) the size of same stage wild-type kidneys,
indicating a genetic interaction between the Wnt11 and Ret
mutations in the compound heterozygote state
(Fig. 6E,F). Removal of another
copy of Wnt11 demonstrates dose-dependent interactions between
Wnt11 and Ret. Ret+/;
Wnt11/ kidneys are 67% (P=0.0001)
the size of Ret+/;
Wnt11+/ and 44% (P=0.0008) the size of
Wnt11/ kidneys, again suggesting a genetic
interaction between the Ret/Gdnf and Wnt11 pathways
(compare Fig. 6H with 6E-G).
Ret+/ kidneys are not significantly different in
size from genotypically wild-type kidneys (P=0.65).
|
|
| DISCUSSION |
|---|
|
|
|---|
Initial ingrowth of the ureteric bud into the mesenchyme appears to be independent of Wnt11 function as all Wnt11 mutant kidneys examined had progressed to the T-stage on schedule. The progression of ureteric branching to the T-stage in Wnt11/ mutants is associated with normal Gdnf expression (data not shown). However, an abnormal branching pattern comprised of retarded morphogenesis and loss or ureteric tips was observed in Wnt11/ kidneys from the T stage. These branching defects are associated with a reduction in mesenchymal Gdnf expression. Given that Gdnf can function as a chemoattractant, low Gdnf levels may result in lower outgrowth promoting activity and decreased numbers of ureteric tips as is observed in Wnt11/ mutants. The loss of ureteric tips early in metanephric development results in significantly smaller kidney size by birth.
In wild type, Wnt11 is expressed robustly in ureteric tips during all stages of metanephric development, suggesting a potential role for Wnt11 in branching morphogenesis throughout kidney development. The defects in Wnt11/ kidneys correlate with a trifurcation and trifurcations are observed at later stages of kidney development (A.M., unpublished), again pointing to a larger role for Wnt11 in branching. Our analysis of Wnt11 in a genetically sensitized Ret+/ background supports this hypothesis, as Wnt11+/; Ret+/ E18.5 kidneys are significantly reduced in size compared with controls, even though the branching pattern at E12.5 is indistinguishable from wild type. Furthermore, we observe that Wnt11+/; Ret+/ kidneys are smaller than Wnt11/ kidneys, even though the branching at E12.5 in the compound heterozygotes is unaffected. This may suggest that ureteric branching is differentially sensitive to the level of Wnt11 and Ret/Gdnf signals at different times during kidney development. Thus, the genetic interaction studies in the sensitized Ret+/ background reveal a wider requirement for Wnt11 in ureteric branching beyond the stages analyzed here.
Although it is clear that Wnt11 is required for normal ureteric branching, considerable branching morphogenesis still occurs in Wnt11/ mutant kidneys. As the targeted allele encodes only the first 28 amino acids of the total 354 amino acid wild-type Wnt11 ligand, our Wnt11 allele most probably encodes a nonfunctional peptide. Thus, no residual Wnt11 signaling should remain in Wnt11/ kidneys.
A second possibility that might explain the branching in
Wnt11/ kidneys is the functional redundancy
of another Wnt in the ureteric epithelium. Though Gdnf expression is
reduced in E12.5 Wnt11/ kidneys,
Gdnf expression appears normal by E13.5 (data not shown) suggesting
that the kidney has invoked a compensatory mechanism to support continued
branching in the absence of Wnt11 activity. Although other Wnt genes,
including Wnt7b. Wnt6 and Wnt15 are expressed in the
branching ureter proximal to the Wnt11 domain, none extend into the
ureteric tips themselves nor do any of these Wnt expression domains alter in
the ureteric epithelium in Wnt11/ kidneys.
Of these, Wnt6 is weakly expressed throughout the ureteric epithelium
at the stages studied here. However, renal tubulogenesis induction assays
suggest that Wnt11 and Wnt6 have different activities
(Kispert et al., 1998
;
Itaranta et al., 2002
).
An alternative explanation for branching in
Wnt11/ kidneys is the influence of other
functionally redundant signaling pathways regulating branching. Multiple
fibroblast growth factor (Fgf) ligands and their receptors are expressed
during metanephric development and can modulate ureteric branching
(Qiao et al., 2001
). Among the
Fgfs, mesenchymally expressed Fgf7 has been proposed as a modulator of
ureteric growth and branching (Qiao et
al., 1999
). Like Wnt11, Fgf7 does not appear to be
required for ureteric bud invasion into the mesenchyme, but is required for
subsequent elaboration of the collecting duct system, as
Fgf7/ mutants have normally patterned but
smaller kidneys. Whether Gdnf expression is dependent upon
Fgf7 is not known. Kidney culture experiments have shown that members
of the TGFß and bone morphogenetic protein families can also modulate
ureteric branching (Grisaru et al.,
2001
; Piscione et al.,
1997
). Finally, the stroma is known to provide signals promoting
ureteric Ret expression and ureteric outgrowth
(Batourina et al., 2001
;
Mendelsohn et al., 1999
).
Wnt2b is expressed at sites of epithelial/mesenchymal interaction in
multiple organs (Lin et al.,
2001
). In the kidney, Wnt2b is expressed in the
presumptive stromal cell population. In kidney explant culture experiments,
incubation of ureteric buds with NIH3T3 cells expressing Wnt2b
results in increased ureteric branching. This result has been interpreted as
evidence that Wnt2b present in the stroma promotes, either directly
or indirectly, branching of the ureteric epithelium. Wnt2b mutants
have not been reported. Therefore, it is likely that multiple signaling
pathways acting from different cellular populations are integrated by the
ureteric epithelium and metanephric mesenchyme to maintain appropriate
Ret/Gdnf signal levels to support collecting duct morphogenesis, and
one such signal appears to be Wnt11.
The silberblick (slb) mutation demonstrates a requirement
for Wnt11 in regulating convergence/extension movements during
zebrafish gastrulation (Heisenberg et al.,
2000
) and Wnt11 appears to have a similar role in
Xenopus (Djiane et al.,
2000
; Tada and Smith,
2000
). Wnt11 is thought to signal through a planar cell
polarity (PCP) pathway to regulate cytoskeletal rearrangements, thus
coordinating polarized cell movement during vertebrate gastrulation. Recently,
a role for Wnt11 PCP signaling has been demonstrated in
Xenopus cardiogenesis (Pandur et
al., 2002
). We found no similar absolute requirement for
Wnt11 in either mouse gastrulation or cardiac development. This may
reflect a difference in the genetic regulation of gastrulation between mouse
and zebrafish or it may reflect a functional redundancy in mouse. Although
Wnt11 is required for viability during the embryonic and post-partum
stages, these lethalities do not arise from the kidney defects we describe
here.
Although our analysis advances Wnt11 as a modulator of
Ret/Gdnf signaling, Wnt11 may have other roles in the branching
process. Wnt11 PCP signaling employs Rho kinase 2 (Rok2), Rho GTPase
and Jun N-terminal kinase (JNK) to effect changes in actin cytoskeleton
organization (Marlow et al.,
2002
; Mlodzik,
2002
). In the kidney, Wnt11 may regulate branching
morphogenesis by causing cytoskeletal reorganization within the plane of the
ureteric epithelium. These additional roles for Wnt11 in ureteric
branching await further investigation.
Wnt11 and Ret/Gdnf signals cooperate in a
regulatory circuit to control ureteric branching morphogenesis
Three observations suggest that Wnt11 and
Ret/Gdnf signals cooperate to regulate ureteric branching
morphogenesis. First, mesenchymal Gdnf expression is dependent upon
ureteric Wnt11 signal. Second, Wnt11 expression is
reciprocally dependent upon Ret/Gdnf signaling within the
ureteric epithelium. Third, Wnt11 and Ret mutants
synergistically interact during ureteric branching morphogenesis, suggesting
both pathways are functioning cooperatively and interdependently in a common
branching process.
What is not clear is whether Wnt11 acts as a paracrine factor to
regulate Gdnf expression directly in the metanephric mesenchyme or if
Wnt11 itself is a direct transcriptional target of the
Ret/Gdnf signaling pathway. Mesenchymal Gdnf expression is
known to be dependent upon at least two transcription factors, Pax2
and Sal1 (Brophy et al.,
2001
; Miyamoto et al.,
1997
; Nishinakamura et al.,
2001
). Indeed, cell culture experiments and analysis of
cis-regulatory regions in the Gdnf gene indicate that Pax2
may be a direct regulator of Gdnf expression
(Brophy et al., 2001
).
Wnt-mediated regulation of Pax gene expression in the kidney has been reported
in Wnt4 mutants where Pax8 and Pax2 expressions are
absent in the pre-tubular aggregates
(Stark et al., 1994
). We
failed to observe any obvious alteration in Pax2 levels in
Wnt11/ kidneys.
In addition, our results suggest that Wnt11 expression is
dependent upon Ret/Gdnf signaling within the ureteric epithelium and
the Wnt11 locus may therefore be a downstream target of
Ret/Gdnf signaling, consistent with our earlier observations where
implantation of Gdnf-coated beads into kidney explant cultures significantly
upregulated Wnt11 expression
(Pepicelli et al., 1997
;
Sainio et al., 1997
). Upon
ligand binding, Ret activates multiple downstream signaling pathways (reviewed
by Airaksinen and Saarma, 2002
;
Manie et al., 2001
).
Inhibition of PI-3 kinase activity with the small molecule LY294002 prevented
Gdnf-induced ectopic ureteric outgrowth in kidney explant culture, implicating
PI-3 kinase signaling in ureteric morphogenesis
(Tang et al., 2002
). Whether
Wnt11 expression is altered in these experiments has not been
addressed.
The genetic interactions observed in Ret+/; Wnt11+/ kidneys suggest that the Wnt11 and Ret/Gdnf signaling pathways function serially and not in parallel. The Wnt11 and Ret/Gdnf signals may participate in a positive, autoregulatory feedback loop to coordinate ureteric branching by maintaining a balance between appropriate amounts of Gdnf-expressing mesenchyme with Wnt11-expressing ureteric tips. Wnt11 levels may inform the mesenchyme as to the number of ureteric buds present. Therefore, this regulatory network may function as a counting mechanism for the developing kidney to determine the extent of branching, convey this information to the mesenchyme and respond with a matching level of outgrowth-promoting Gdnf.
Wnt genes and branching morphogenesis
Other Wnt genes have also been proposed to play roles in branching
morphogenesis. In addition to Wnt2b (discussed earlier), the
Wnt4/ knockout mouse has been used to
demonstrate a requirement for Wnt4 function in progesterone induced
mammary epithelium branching morphogenesis during pregnancy
(Brisken et al., 2000
).
However, substantial branching still occurs in grafted
Wnt4/ ductal tissue at later stages of
pregnancy, implying that Wnt4 may act in concert with other Wnt genes
in this tissue. Although past studies of Wnt genes have focused on their roles
in growth and patterning, future investigations may uncover other examples of
these genes in morphogenetic processes during vertebrate development.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Airaksinen, M. S. and Saarma, M. (2002). The
GDNF family: signalling, biological functions and therapeutic value.
Nat. Rev. Neurosci. 3,383
-394.[CrossRef][Medline]
al-Awqati, Q. and Goldberg, M. R. (1998).
Architectural patterns in branching morphogenesis in the kidney.
Kidney Int. 54,1832
-1842.[CrossRef][Medline]
Batourina, E., Gim, S., Bello, N., Shy, M., Clagett-Dame, M.,
Srinivas, S., Costantini, F. and Mendelsohn, C. (2001).
Vitamin A controls epithelial/mesenchymal interactions through Ret expression.
Nat. Genet. 27,74
-78.[Medline]
Bhanot, P., Brink, M., Samos, C. H., Hsieh, J. C., Wang, Y.,
Macke, J. P., Andrew, D., Nathans, J. and Nusse, R. (1996). A
new member of the frizzled family from Drosophila functions as a Wingless
receptor. Nature 382,225
-230.[CrossRef][Medline]
Brisken, C., Heineman, A., Chavarria, T., Elenbaas, B., Tan, J.,
Dey, S. K., McMahon, J. A., McMahon, A. P. and Weinberg, R. A.
(2000). Essential function of Wnt-4 in mammary gland development
downstream of progesterone signaling. Genes Dev.
14,650
-654.
Brophy, P. D., Ostrom, L., Lang, K. M. and Dressler, G. R.
(2001). Regulation of ureteric bud outgrowth by Pax2-dependent
activation of the glial derived neurotrophic factor gene.
Development 128,4747
-4756.
Bullock, S. L., Fletcher, J. M., Beddington, R. S. and Wilson,
V. A. (1998). Renal agenesis in mice homozygous for a gene
trap mutation in the gene encoding heparan sulfate 2-sulfotransferase.
Genes Dev. 12,1894
-1906.
Cacalano, G., Farinas, I., Wang, L. C., Hagler, K., Forgie, A.,
Moore, M., Armanini, M., Phillips, H., Ryan, A. M., Reichardt, L. F. et
al. (1998). GFR
1 is an essential receptor component
for GDNF in the developing nervous system and kidney.
Neuron 21,53
-62.[CrossRef][Medline]
Davies, J. (2001). Intracellular and
extracellular regulation of ureteric bud morphogenesis. J.
Anat. 198,257
-264.[CrossRef][Medline]
Davies, J. A. and Bard, J. B. (1998). The
development of the kidney. Curr. Top. Dev. Biol.
39,245
-301.[Medline]
Davies, J. A. and Davey, M. G. (1999).
Collecting duct morphogenesis. Pediatr. Nephrol.
13,535
-541.[CrossRef][Medline]
Djiane, A., Riou, J., Umbhauer, M., Boucaut, J. and Shi, D.
(2000). Role of frizzled 7 in the regulation of convergent
extension movements during gastrulation in Xenopus laevis.
Development 127,3091
-3100.[Abstract]
Dressler, G. R., Deutsch, U., Chowdhury, K., Nornes, H. O. and
Gruss, P. (1990). Pax2, a new murine paired-box-containing
gene and its expression in the developing excretory system.
Development 109,787
-795.
Durbec, P., Marcos-Gutierrez, C. V., Kilkenny, C., Grigoriou,
M., Wartiowaara, K., Suvanto, P., Smith, D., Ponder, B., Costantini, F.,
Saarma, M. et al. (1996). GDNF signalling through the Ret
receptor tyrosine kinase. Nature
381,789
-793.[CrossRef][Medline]
Enomoto, H., Araki, T., Jackman, A., Heuckeroth, R. O., Snider,
W. D., Johnson, E. M., Jr and Milbrandt, J. (1998). GFR
1-deficient mice have deficits in the enteric nervous system and
kidneys. Neuron 21,317
-324.[CrossRef][Medline]
Grisaru, S., Cano-Gauci, D., Tee, J., Filmus, J. and Rosenblum,
N. D. (2001). Glypican-3 modulates BMP- and FGF-mediated
effects during renal branching morphogenesis. Dev.
Biol. 231,31
-46.[CrossRef][Medline]
Grobstein, C. (1953). Inductive
epithelio-mesenchymal interactions in cultured organ rudiments of the mouse.
Science 118,52
-55.
Heisenberg, C. P., Tada, M., Rauch, G. J., Saude, L., Concha, M.
L., Geisler, R., Stemple, D. L., Smith, J. C. and Wilson, S. W.
(2000). Silberblick/Wnt11 mediates convergent extension movements
during zebrafish gastrulation. Nature
405, 76-81.[CrossRef][Medline]
Itaranta, P., Lin, Y., Perasaari, J., Roel, G., Destree, O. and
Vainio, S. (2002). Wnt-6 is expressed in the ureter bud and
induces kidney tubule development in vitro. Genesis
32,259
-268.[CrossRef][Medline]
Kispert, A., Vainio, S., Shen, L., Rowitch, D. H. and McMahon,
A. P. (1996). Proteoglycans are required for maintenance of
Wnt-11 expression in the ureter tips. Development
122,3627
-3637.[Abstract]
Kispert, A., Vainio, S. and McMahon, A. P.
(1998). Wnt-4 is a mesenchymal signal for epithelial
transformation of metanephric mesenchyme in the developing kidney.
Development 125,4225
-4234.[Abstract]
Kume, T., Deng, K. and Hogan, B. L. (2000).
Murine forkhead/winged helix genes Foxc1 (Mf1) and Foxc2 (Mfh1) are required
for the early organogenesis of the kidney and urinary tract.
Development 127,1387
-1395.[Abstract]
Lechner, M. S. and Dressler, G. R. (1997). The
molecular basis of embryonic kidney development. Mech.
Dev. 62,105
-120.[CrossRef][Medline]
Lin, Y., Liu, A., Zhang, S., Ruusunen, T., Kreidberg, J. A.,
Peltoketo, H., Drummond, I. and Vainio, S. (2001). Induction
of ureter branching as a response to Wnt-2b signaling during early kidney
organogenesis. Dev. Dyn.
222, 26-39.[CrossRef][Medline]
Manie, S., Santoro, M., Fusco, A. and Billaud, M.
(2001). The RET receptor: function in development and dysfunction
in congenital malformation. Trends Genet.
17,580
-589.[CrossRef][Medline]
Mansour, S. L., Thomas, K. R. and Capecchi, M. R.
(1988). Disruption of the proto-oncogene int-2 in mouse
embryo-derived stem cells: a general strategy for targeting mutations to
non-selectable genes. Nature
336,348
-352.[CrossRef][Medline]
Marlow, F., Topczewski, J., Sepich, D. and Solnica-Krezel,
L. (2002). Zebrafish rho kinase 2 acts downstream of wnt11 to
mediate cell polarity and effective convergence and extension movements.
Curr. Biol. 12,876
-884.[CrossRef][Medline]
Mendelsohn, C., Batourina, E., Fung, S., Gilbert, T. and Dodd,
J. (1999). Stromal cells mediate retinoid-dependent functions
essential for renal development. Development
126,1139
-1148.[Abstract]
Miyamoto, N., Yoshida, M., Kuratani, S., Matsuo, I. and Aizawa,
S. (1997). Defects of urogenital development in mice lacking
Emx2. Development 124,1653
-1664.[Abstract]
Mlodzik, M. (2002). Planar cell polarization:
do the same mechanisms regulate Drosophila tissue polarity and vertebrate
gastrulation? Trends Genet
18,564
-571.[CrossRef][Medline]
Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. and Roder,
J. C. (1993). Derivation of completely cell culture-derived
mice from early-passage embryonic stem cells. Proc. Natl. Acad.
Sci. USA 90,8424
-8428.
Nishinakamura, R., Matsumoto, Y., Nakao, K., Nakamura, K., Sato,
A., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Scully, S., Lacey, D. L.
et al. (2001). Murine homolog of SALL1 is essential for
ureteric bud invasion in kidney development.
Development 128,3105
-3115.[Medline]
Pachnis, V., Mankoo, B. and Costantini, F.
(1993). Expression of the c-ret proto-oncogene during mouse
embryogenesis. Development
119,1005
-1017.[Abstract]
Pandur, P., Lasche, M., Eisenberg, L. M. and Kuhl, M.
(2002). Wnt-11 activation of a non-canonical Wnt signalling
pathway is required for cardiogenesis. Nature
418,636
-641.[CrossRef][Medline]
Pellegrini, M., Pantano, S., Lucchini, F., Fumi, M. and
Forabosco, A. (1997). Emx2 developmental expression in the
primordia of the reproductive and excretory systems. Anat.
Embryol. 196,427
-433.[CrossRef][Medline]
Pepicelli, C. V., Kispert, A., Rowitch, D. H. and McMahon, A.
P. (1997). GDNF induces branching and increased cell
proliferation in the ureter of the mouse. Dev. Biol.
192,193
-198.[CrossRef][Medline]
Piscione, T. D., Yager, T. D., Gupta, I. R., Grinfeld, B., Pei,
Y., Attisano, L., Wrana, J. L. and Rosenblum, N. D. (1997).
BMP-2 and OP-1 exert direct and opposite effects on renal branching
morphogenesis. Am. J. Physiol.
273,F961
-F975.[Medline]
Qiao, J., Bush, K. T., Steer, D. L., Stuart, R. O., Sakurai, H.,
Wachsman, W. and Nigam, S. K. (2001). Multiple fibroblast
growth factors support growth of the ureteric bud but have different effects
on branching morphogenesis. Mech. Dev.
109,123
-135.[CrossRef][Medline]
Qiao, J., Uzzo, R., Obara-Ishihara, T., Degenstein, L., Fuchs,
E. and Herzlinger, D. (1999). FGF-7 modulates ureteric bud
growth and nephron number in the developing kidney.
Development 126,547
-554.[Abstract]
Sainio, K., Suvanto, P., Davies, J., Wartiovaara, J.,
Wartiovaara, K., Saarma, M., Arumae, U., Meng, X., Lindahl, M., Pachnis, V. et
al. (1997). Glial-cell-line-derived neurotrophic factor is
required for bud initiation from ureteric epithelium.
Development 124,4077
-4087.[Abstract]
Sanchez, M. P., Silos-Santiago, I., Frisen, J., He, B., Lira, S.
A. and Barbacid, M. (1996). Renal agenesis and the absence of
enteric neurons in mice lacking GDNF. Nature
382, 70-73.[CrossRef][Medline]
Sariola, H. and Saarma, M. (1999). GDNF and its
receptors in the regulation of the ureteric branching. Int. J. Dev.
Biol. 43,413
-418.[Medline]
Sariola, H. and Sainio, K. (1997). The tip-top
branching ureter. Curr. Opin. Cell Biol.
9, 877-884.[CrossRef][Medline]
Saxen, L. (1987). Organogenesis of
the Kidney. New York: Cambridge University Press.
Schuchardt, A., D'Agati, V., Larsson-Blomberg, L., Costantini,
F. and Pachnis, V. (1994). Defects in the kidney and enteric
nervous system of mice lacking the tyrosine kinase receptor Ret.
Nature 367,380
-383.[CrossRef][Medline]
Schuchardt, A., D'Agati, V., Pachnis, V. and Costantini, F.
(1996). Renal agenesis and hypodysplasia in ret-k-mutant mice
result from defects in ureteric bud development.
Development 122,1919
-1929.[Abstract]
Srinivas, S., Wu, Z., Chen, C. M., D'Agati, V. and Constantini,
F. (1999). Expression of green fluorescent protein in the
ureteric bud of transgenic mice: a new tool for the analysis of ureteric bud
morphogenesis. Development
126,1375
-1386.[Abstract]
Srinivas, S., Watanabe, T., Lin, C. S., William, C. M., Tanabe,
Y., Jessell, T. M. and Costantini, F. (2001). Cre reporter
strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus.
Dev. Biol. 1,4
.[CrossRef][Medline]
Stark, K., Vainio, S., Vassileva, G. and McMahon, A. P.
(1994). Epithelial transformation of metanephric mesenchyme in
the developing kidney regulated by Wnt-4. Nature
372,679
-683.[CrossRef][Medline]
Stark, K., Vainio, S., Vassileva, G. and McMahon, A. P.
(1994). Epithelial transformation of metanephric mesenchyme in
the developing kidney regulated by Wnt-4. Nature
372,679
-683.[CrossRef][Medline]
Swiatek, P. J., Lindsell, C. E., del Amo, F. F., Weinmaster, G.
and Gridley, T. (1994). Notch1 is essential for
postimplantation development in mice. Genes Dev.
8, 707-719.
Tada, M. and Smith, J. C. (2000). Xwnt11 is a
target of Xenopus Brachyury: regulation of gastrulation movements via
Dishevelled, but not through the canonical Wnt pathway.
Development 127,2227
-2238.[Abstract]
Tang, M. J., Worley, D., Sanicola, M. and Dressler, G. R.
(1998). The RET-glial cell-derived neurotrophic factor (GDNF)
pathway stimulates migration and chemoattraction of epithelial cells.
J. Cell Biol. 142,1337
-1345.
Tang, M. J., Cai, Y., Tsai, S. J., Wang, Y. K. and Dressler, G.
R. (2002). Ureteric bud outgrowth in response to RET
activation is mediated by phosphatidylinositol 3-kinase. Dev.
Biol. 243,128
-136.[CrossRef][Medline]
Torres, M., Gomez-Pardo, E., Dressler, G. R. and Gruss, P.
(1995). Pax-2 controls multiple steps of urogenital development.
Development 121,4057
-4065.[Abstract]
Vega, Q. C., Worby, C. A., Lechner, M. S., Dixon, J. E. and
Dressler, G. R. (1996). Glial cell line-derived neurotrophic
factor activates the receptor tyrosine kinase RET and promotes kidney
morphogenesis. Proc. Natl. Acad. Sci. USA
93,10657
-10661.
Wilkinson, D. G. and Nieto, M. A. (1993).
Detection of messenger RNA by in situ hybridization to tissue sections and
whole mounts. Methods Enzymol.
225,361
-373.[Medline]
Wodarz, A. and Nusse, R. (1998). Mechanisms of
Wnt signaling in development. Annu. Rev. Cell Dev.
Biol. 14,59
-88.[CrossRef][Medline]
Yu, J., Carroll, T. J. and McMahon, A. P.
(2002). Sonic hedgehog regulates proliferation and
differentiation of mesenchymal cells in the mouse metanephric kidney.
Development 129,5301
-5312.[Medline]
This article has been cited by other articles:
![]() |
S. Sims-Lucas, L. Cullen-McEwen, V. P. Eswarakumar, D. Hains, K. Kish, B. Becknell, J. Zhang, J. F. Bertram, F. Wang, and C. M. Bates Deletion of Frs2{alpha} from the ureteric epithelium causes renal hypoplasia Am J Physiol Renal Physiol, November 1, 2009; 297(5): F1208 - F1219. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. I. Nagy, A. Railo, R. Rapila, T. Hast, R. Sormunen, P. Tavi, J. Rasanen, and S. J. Vainio Wnt-11 signalling controls ventricular myocardium development by patterning N-cadherin and {beta}-catenin expression Cardiovasc Res, August 8, 2009; (2009) cvp254v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Friedman, S. M. Oyserman, and K. D. Hankenson Wnt11 Promotes Osteoblast Maturation and Mineralization through R-spondin 2 J. Biol. Chem., May 22, 2009; 284(21): 14117 - 14125. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hayashi, D. W. Erikson, S. A. Tilford, B. M. Bany, J. A. Maclean II, E. B. Rucker III, G. A. Johnson, and T. E. Spencer Wnt Genes in the Mouse Uterus: Potential Regulation of Implantation Biol Reprod, May 1, 2009; 80(5): 989 - 1000. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu, N. Chattopadhyay, S. Qin, C. Szekeres, T. Vasylyeva, Z. X. Mahoney, M. Taglienti, C. M. Bates, H. A. Chapman, J. H. Miner, et al. Coordinate integrin and c-Met signaling regulate Wnt gene expression during epithelial morphogenesis Development, March 1, 2009; 136(5): 843 - 853. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yu, T. J. Carroll, J. Rajagopal, A. Kobayashi, Q. Ren, and A. P. McMahon A Wnt7b-dependent pathway regulates the orientation of epithelial cell division and establishes the cortico-medullary axis of the mammalian kidney Development, January 1, 2009; 136(1): 161 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Horowitz and M. Simons Branching Morphogenesis Circ. Res., October 10, 2008; 103(8): 784 - 795. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Afouda, J. Martin, F. Liu, A. Ciau-Uitz, R. Patient, and S. Hoppler GATA transcription factors integrate Wnt signalling during heart development Development, October 1, 2008; 135(19): 3185 - 3190. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Grigoryan, P. Wend, A. Klaus, and W. Birchmeier Deciphering the function of canonical Wnt signals in development and disease: conditional loss- and gain-of-function mutations of {beta}-catenin in mice Genes & Dev., September 1, 2008; 22(17): 2308 - 2341. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hartwig, D. Bridgewater, V. Di Giovanni, J. Cain, Y. Mishina, and N. D. Rosenblum BMP Receptor ALK3 Controls Collecting System Development J. Am. Soc. Nephrol., January 1, 2008; 19(1): 117 - 124. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hayashi, R. C. Burghardt, F. W. Bazer, and T. E. Spencer WNTs in the Ovine Uterus: Potential Regulation of Periimplantation Ovine Conceptus Development Endocrinology, July 1, 2007; 148(7): 3496 - 3506. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kopan, H.-T. Cheng, and K. Surendran Molecular Insights into Segmentation along the Proximal Distal Axis of the Nephron J. Am. Soc. Nephrol., July 1, 2007; 18(7): 2014 - 2020. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Michos, A. Goncalves, J. Lopez-Rios, E. Tiecke, F. Naillat, K. Beier, A. Galli, S. Vainio, and R. Zeller Reduction of BMP4 activity by gremlin 1 enables ureteric bud outgrowth and GDNF/WNT11 feedback signalling during kidney branching morphogenesis Development, July 1, 2007; 134(13): 2397 - 2405. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Linton, G. R. Martin, and L. F. Reichardt The ECM protein nephronectin promotes kidney development via integrin {alpha}8{beta}1-mediated stimulation of Gdnf expression Development, July 1, 2007; 134(13): 2501 - 2509. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Narlis, D. Grote, Y. Gaitan, S. K. Boualia, and M. Bouchard Pax2 and Pax8 Regulate Branching Morphogenesis and Nephron Differentiation in the Developing Kidney J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1121 - 1129. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hatton-Ellis, C. Ainsworth, Y. Sushama, S. Wan, K. VijayRaghavan, and H. Skaer From the Cover: Genetic regulation of patterned tubular branching in Drosophila PNAS, January 2, 2007; 104(1): 169 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Weatherbee, K. V. Anderson, and L. A. Niswander LDL-receptor-related protein 4 is crucial for formation of the neuromuscular junction. Development, December 1, 2006; 133(24): 4993 - 5000. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ilagan, R. Abu-Issa, D. Brown, Y.-P. Yang, K. Jiao, R. J. Schwartz, J. Klingensmith, and E. N. Meyers Fgf8 is required for anterior heart field development Development, June 15, 2006; 133(12): 2435 - 2445. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jain, M. Encinas, E. M. Johnson Jr., and J. Milbrandt Critical and distinct roles for key RET tyrosine docking sites in renal development Genes & Dev., February 1, 2006; 20(3): 321 - 333. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Grote, A. Souabni, M. Busslinger, and M. Bouchard Pax2/8-regulated Gata3 expression is necessary for morphogenesis and guidance of the nephric duct in the developing kidney Development, January 1, 2006; 133(1): 53 - 61. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Puppo, M. Musso, D. Pirulli, P. Griseri, T. Bachetti, S. Crovella, G. Patrone, I. Ceccherini, and R. Ravazzolo Comparative genomic sequence analysis coupled to chromatin immunoprecipitation: a screening procedure applied to search for regulatory elements at the RET locus Physiol Genomics, November 17, 2005; 23(3): 269 - 274. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kobayashi, K.-M. Kwan, T. J. Carroll, A. P. McMahon, C. L. Mendelsohn, and R. R. Behringer Distinct and sequential tissue-specific activities of the LIM-class homeobox gene Lim1 for tubular morphogenesis during kidney development Development, June 15, 2005; 132(12): 2809 - 2823. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. V. Sampogna and S. K. Nigam Implications of Gene Networks for Understanding Resilience and Vulnerability in the Kidney Branching Program Physiology, December 1, 2004; 19(6): 339 - 347. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jain, C. K. Naughton, M. Yang, A. Strickland, K. Vij, M. Encinas, J. Golden, A. Gupta, R. Heuckeroth, E. M. Johnson Jr, et al. Mice expressing a dominant-negative Ret mutation phenocopy human Hirschsprung disease and delineate a direct role of Ret in spermatogenesis Development, November 1, 2004; 131(21): 5503 - 5513. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Mohamed, D. Dufort, and H. J. Clarke Expression and Estradiol Regulation of Wnt Genes in the Mouse Blastocyst Identify a Candidate Pathway for Embryo-Maternal Signaling at Implantation Biol Reprod, August 1, 2004; 71(2): 417 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chi, S. Zhang, Y. Lin, R. Prunskaite-Hyyrylainen, R. Vuolteenaho, P. Itaranta, and S. Vainio Sprouty proteins regulate ureteric branching by coordinating reciprocal epithelial Wnt11, mesenchymal Gdnf and stromal Fgf7 signalling during kidney development Development, July 15, 2004; 131(14): 3345 - 3356. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ouko, T. R. Ziegler, L. H. Gu, L. M. Eisenberg, and V. W. Yang Wnt11 Signaling Promotes Proliferation, Transformation, and Migration of IEC6 Intestinal Epithelial Cells J. Biol. Chem., June 18, 2004; 279(25): 26707 - 26715. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Shah, R. V. Sampogna, H. Sakurai, K. T. Bush, and S. K. Nigam Branching morphogenesis and kidney disease Development, April 1, 2004; 131(7): 1449 - 1462. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||