|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00516
1 Department of Cell Biology, Institute of Development, Aging and Cancer, Tohoku
University, Sendai 980-8575, Japan
2 Department of Anatomy, School of Medicine, Iwate Medical University, Morioka
020-8505, Japan
3 Department of Molecular, Cellular and Developmental Biology, University of
Michigan, Ann Arbor, MI 48109-1048, USA
* Author for correspondence (e-mail: wshoji{at}idac.tohoku.ac.jp)
Accepted 31 March 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Cell migration, Semaphorin, Zebrafish, Angioblast, Neuropilin
| INTRODUCTION |
|---|
|
|
|---|
The receptor for Sema3a consists of a complex of neuropilin and plexin
molecules (Tamagnone et al.,
1999
; Takahashi et al.,
1999
). Neuropilins are a small family of conserved proteins
whereas plexins are a larger family of conserved proteins. Interestingly,
neuropilins are also part of the receptors for a spliced isoform of vascular
endothelial growth factor (Vegf), Vegf165. Vegf165 binds
to a complex of neuropilin and Vegfr2 (KDR/flk1) on endothelial and tumor
cells and elicits mitogenic and chemotactic responses
(Soker et al., 1998
). The fact
that both Vegf and semaphorins use neuropilins as part of their receptors
suggests the possibility of dynamic interactions between the formation of
blood vessels and development of the nervous system. Indeed, Semas can inhibit
the action of Vegf in vitro and vice versa via competition for binding to
neuropilin. Sema3a can inhibit Vegf165-mediated aortic endothelial
cell migration and capillary angiogenesis, and Vegf165 can inhibit
Sema3a-induced collapse of dorsal root ganglion growth cones and apoptosis of
neural progenitor cells (Miao et al.,
1999
; Bagnard et al.,
2001
). However, it is unknown whether interactions between
semaphorins and Vegf occur in vivo.
In zebrafish, vascular endothelial precursors (angioblasts) along with
hematopoietic progenitors arise initially within the lateral mesoderm at
gastrula stages (Gering et al.,
1998
; Detrich et al.,
1995
; Brown et al.,
2000
). Subsequently, these cells converge to the midline where
they give rise to axial blood vessels and blood cells
(Al-Adhami and Kunz, 1977
;
Zon 1995
;
Childs et al., 2002
;
Zhong et al., 2001
). At these
stages, Vegf is expressed by the ventromedial region of each somite that the
angioblasts migrate on (Liang et al.,
1998
; Liang et al.,
2001
) and is required for early vasculature formation
(Nasevicius et al., 2000
).
Zebrafish contain two copies of the sema3a gene, sema3a1
and sema3a2 (Shoji et al.,
1998
; Roos et al.,
1999
; Yee et al.,
1999
). The expression of sema3a1 by the somites guides
the growth cones of spinal motor and posterior lateral line neurons
(Shoji et al., 1998
;
Yee et al., 1999
;
Halloran et al., 2000
).
sema3a1 is normally expressed by the dorsal and ventral regions of
the somites but not the horizontal myoseptal region found in-between these
regions. The horizontal myoseptal region is adjacent to the notochord and the
dorsal aorta, suggesting that Sema3a1 may act to restrict migrating
angioblasts to the vicinity of the notochord. Furthermore, some mutations that
affect the notochord or notochord-derived factors lead to both expression of
sema3a1 in the entire somite including the horizontal myoseptal
region (Shoji et al., 1998
)
and selectively delete the dorsal aorta
(Fouquet et al., 1997
;
Brown et al., 2000
). These
correlations suggest that Sema3a1 is involved in dorsal aorta formation in
addition to growth cone guidance.
Here we demonstrate that Sema3a1 can regulate vascular development in vivo. A subset of mesodermal cells that are probably angioblasts express neuropilin 1, and these cells migrate dorsally toward the notochord. Antisense knockdown of Sema3a1 inhibits the formation of the dorsal aorta. Furthermore, induced ubiquitous expression of sema3a1 interferes with dorsal migration by angioblasts and adversely affects dorsal aorta formation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Transgenic fish
Zebrafish sema3a1 cDNA (Yee et
al., 1999
) was tagged with Egfp (Clontech) and 6 Myc epitopes
(Roth et al., 1991
). Egfp was
inserted between the 25th and 26th amino acids, between the putative signal
peptide and the sema domain, and the Myc epitope was added at the C-terminus.
Following transfection of HEK 293 cells with the tagged sema3a1
expression construct, the media conditioned by the transfected cells was
compared with untagged Sema3a1 for activity using the chick dorsal root
ganglion growth cone collapse assay (Luo
et al., 1993
). Both untagged and tagged Sema3a1 were effective in
inducing collapse of DRG growth cones and there was no difference in the
potency of the two recombinant proteins. The 1.5 kb zebrafish hsp70
promoter (Halloran et al.,
2000
) was then linked to the tagged sema3a1 and injected
into one blastomere of embryos at 1-4 cell stage. The injected embryos were
raised to sexual maturity, pair-wise mated with wild-type fish, and their F1
progeny screened with PCR for the transgene using primers for the transgene
(tcaagtccgccatgcccgaa/cgtccaygccgagagtgatc) to identify founder fish. F1
embryos were also examined for expression by GFP fluorescence and western
blotting (see below) following heat induction. We established two independent
lines in which sema3a1 is expressed ubiquitously after heat
treatment. Embryos were heat-induced by raising the water temperature from
28.5°C to 38°C over a period of 15 minutes using a programmable water
bath (BU150P, Yamato) and then holding the temperature at 38°C for another
30 minutes. Full-length fusion protein was detected by western blotting as
early as 15 minutes after heat treatment. In all experiments, heat treatment
was started at 15 hpf.
In situ hybridization
Digoxygenin-labeled riboprobes for sema3a1, sema3a2, neuropilin 1,
fli1 and gata1 were synthesized by in vitro transcription and
hydrolyzed to an average length of 200-500 base pairs by limited alkaline
hydrolysis (Cox et al., 1984
).
Hybridization on wholemounted embryos was performed according to the protocol
of Schulte-Merker et al. (Schulte-Merker
et al., 1992
). For double in situ hybridization, fli1 and
neuropilin 1 riboprobes were labeled with FITC and digoxygenin,
respectively. First the red color was developed with AP-conjugated anti-FITC
and FAST Red (Sigma), then the green color was developed with HRP-conjugated
anti-digoxygenin and the TSA system (Perkin Elmer Life Sciences). Sections
were made with cryostat (Cryocut 1800, Leica) or microslicer (DTK-3000W,
Dosaka EM) after wholemount hybridization. For cryostat sectioning, embryos
were equilibrated in 30% sucrose, embedded in OCT compound (Sakura
Finetechnical, Tokyo, Japan) and cut into 20 µm. For microslicer
sectioning, embryos were embedded in 30% albumin, 0.5% gelatin, 0.8%
glutaraldehyde in PBS and cut into 40 µm.
Western blotting
Whole zebrafish protein (10 µg) was separated with SDS-PAGE gel
electrophoresis. The protein was transferred onto PVDF membrane (Millipore)
and incubated with 1/100 dilution of anti-Myc (9E10, Roche) in 5% skim
milk/PBS followed by an HRP conjugated anti-mouse IgG and ECL immunostain kit
(Amersham).
Cell tracing
Embryos were anesthetized in 0.01% tricaine (3-aminobenzonic acid
ethylester, Sigma) and mounted in 1% agar on a microslide
(Shoji et al., 1998
). A 0.2%
solution of diI
(1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine
perchlorate, Molecular Probes) dissolved in dimethylformamide was passed
iontophoretically from a micropipette onto approximately 10 mesodermal cells
lateral and ventral to somites 10-12 at 18 hpf. Nomarski images and
epifluorescence images were captured by 3CCD Video Camera System (DEI-750
Optronics), and combined using Adobe Photoshop. The position of the
dorsal-most diI-labeled cells were measured from the dorsal boundary of the
yolk tube at 18 hpf and 22 hpf following heat induction at 15 hpf.
Labeling of the vascular system
Anesthetized embryos were embedded and their vascular system labeled with
ink as previously described (Isogai et
al., 2001
). The sinus venosus was incised for drainage, and then
0.75% Berlin Blue solution was pressure-injected into the dorsal aorta. After
perfusion, the embryos were fixed in 4% paraformaldehyde. In yot
mutants, dye was injected into the heart cavity because the narrower dorsal
aorta was difficult to visualize.
Morpholino oligonucleotide injection
Morpholino oligonucleotides (MOs) were obtained from Gene Tools, LLC. The
antisense sema3a1 morpholino sequence (25 mer) was complimentary to a
sequence of the 5'UTR (59 to 34). The control morpholino
sequence had 4 bases mismatched compared with the sema3a1 antisense
morpholino sequence. Sequences were as follows: sema3a1 antisense MO,
5'-CTTGTAGCCCACAGTGCCCAGAGCA-3'; sema3a1 control MO,
5'-CTTCTAGCCGACAGAGCCCAGTGCA3'. Morpholino oligonucleotides were
solubilized in 1x Danieau Solution (58 mM NaCl, 0.7 mM KCl, 0.4 mM
MgSO4, 0.6 mM Ca(NO3)2, 5 mM HEPES, pH 7.6)
and injected into 1 cell-stage embryos. For the knockdown experiments, 0.3
pmol of these MOs were injected into
hsp70:gfpsema3a1myc embryos.
| RESULTS |
|---|
|
|
|---|
Recently fertilized embryos were injected with the hsp70:gfpsema3a1myc construct. The injected embryos were raised to maturity and founder fish were identified by pairwise crosses with wild-type zebrafish and PCR of DNA isolated from the F1 embryos using primers for gfp. Of 96 injected fish, 4 transmitted the transgene to F1 offspring. Of the F1 progeny from different founders, 2.8-24.8% expressed the transgene as assayed by GFP fluorescence and Myc immunohistochemistry, indicating that the germlines of the founders were mosaic. As expected, each transgenic F1 produced F2 offspring that were 50% transgenic when crossed with wild-type fish. We also generated lines of fish homozygous for the sema3a1 transgene, by incrossing pairs of F1 or F2 hemizygous fish. Mature homozygous offspring were identified based on their ability to generate 100% transgenic embryos when crossed with a wild-type fish. Homozygous transgenic embryos but not wild-type embryos showed strong, widespread induction of the sema3a1 transgene as assayed by GFP fluorescence following exposure to increased temperatures, whereas transgenic embryos were not induced to express the transgene without elevated temperatures (Fig. 1A). Western blots against Myc-tag revealed an approximately 150 kDa protein corresponding to the predicted size of the fusion protein. Expression peaked 1-7 hours following heat induction and began to decrease after 15 hours (Fig. 1B).
|
|
Interestingly, by 21.5-22.5 hpf the dorsal-most neuropilin 1-positive cells have reached a site just ventral to the notochord in segments 10-15, whereas CaP axons labeled with monoclonal antibody Znp-1 are still located at the muscle pioneers (not shown), a site that is dorsal to the notochord. This suggests that the neuropilin 1-positive cells are not following the CaP axons from the ventrolateral somite to the notochord. Furthermore, following ubiquitous induction of sema3a1 in hsp70:gfpsema3a1myc transgenic embryos at 15 hpf, there were many fewer neuropilin 1-positive cells along the somites between the notochord and the yolk tube (Fig. 2F,K), suggesting angioblast migration was retarded.
Putative angioblasts failed to migrate dorsally following induced
ubiquitous expression of sema3a1
The distribution of neuropilin 1-positive cells along the
anterior-posterior axis suggested that the cells expressing neuropilin
1 migrate dorsally. To test this hypothesis, putative neuropilin
1-positive cells were labeled with the fluorescent dye, diI, to see if
they migrate. DiI was injected into cells lateral and ventral to the somites.
When diI was injected in 18 hpf wild-type embryos (n=5), some of the
labeled cells were found in a more dorsal position several hours later,
whereas others had not changed their positions suggesting that a subset of
cells from ventrolateral mesoderm migrated dorsally
(Table 1;
Fig. 3A-C).
|
|
Sema3a1 regulates migration by vascular angioblasts but not
hematopoietic progenitor cells
Development of endothelial and hematopoietic lineages are closely related
in early embryogenesis (Stainer et al., 1996;
Thompson et al., 1998
). They
express common early markers, emerge simultaneously, and mutations in mice and
zebrafish can cause the loss of both lineages
(Shalaby et al., 1995
; Stainer
et al., 1996). Furthermore, in zebrafish both lineages migrate in a similar
manner from the lateral mesoderm (Detrich
et al., 1995
; Gering et al.,
1998
; Zhong et al.,
2001
). In order to see which population is regulated by Sema3a1,
we examined fli1, which is expressed by differentiating endothelial
cells as well as by immature endothelial and hematopoietic progenitors
(Brown et al., 2000
), and
gata1, which is selectively expressed by hematopoietic progenitors
following misexpression of Sema3a1
(Detrich et al., 1995
).
Fli1 is an ETS domain transcription factor and is expressed by early
vascular and hematopoietic precursor cells
(Brown et al., 2000
). At 20
hpf, fli1 is expressed diffusely by many cells found between the
notochord and the yolk tube (n=4;
Fig. 4A), but at 25 hpf
expression is clearly seen in presumptive dorsal aorta cells just ventral to
the notochord (n=5; Fig.
4B) (Brown et al.,
2000
). In the notochord mutant you-too (yot)
that fails to develop the dorsal aorta
(Fouquet et al., 1997
;
Chen et al., 1996
), and that
expresses sema3a1 in the entire somite
(Fig. 2H) (Shoji et al., 1998
),
fli1 expression is restricted abnormally in patches rather than in
cells just ventral to the notochord at 25 hpf (n=5;
Fig. 4C). Thus aberrant
expression of sema3a1 throughout the entire somite correlates with
the abnormal distribution of fli1 cells. Finally, following induction
of sema3a1 in hsp70:gfpsema3a1myc
embryos at 15 hpf, the distribution of fli1-positive cells was
abnormal with cells diffusely distributed between the notochord and yolk tube
at 25 hpf (n=5; Fig.
4D), suggesting that ubiquitous misexpression of Sema3a1 partially
inhibits dorsal migration of angioblasts. This result is consistent with our
finding that misexpression of Sema3a1 interferes with dorsal migration by
ventro-lateral mesodermal cells, and suggests that these cells are
fli1-positive angioblasts that give rise to the dorsal aorta.
|
Ubiquitous induction of sema3a1 reduces blood circulation
and interferes with the development of the dorsal aorta
The previous sections showed that induced ubiquitous expression of
sema3a1 interfered with dorsal migration of putative angioblasts from
the ventrolateral mesoderm. This finding predicts that overexpression of
sema3a1 should lead to defects in the dorsal aorta and thus blood
circulation. Indeed, blood circulation was abnormal at 30 hpf in transgenic
embryos (n=20) following induction of sema3a1 at 15 hpf
(Fig. 5). Initially, the heart
was seen to be beating in many transgenic embryos, but by 27 hpf the blood
cells were restricted to the heart and yolk sac and tube and did not circulate
into other parts of the embryo. Subsequently the heart cavity became swollen
and eventually stopped beating (29-30 hpf). The dorsal aorta was present in
hsp70:gfpsema3a1myc embryos (30 hpf) following
induced ubiquitous expression, but the lumen of the dorsal aorta contained no
blood cells and was constricted when visualized by dye injection
(Fig. 5D,E). The axial vein and
other cranial vessels at this stage appear relatively unaffected. Thus, it
appears that constriction of the dorsal aorta is responsible for the lack of
circulation in these embryos. Corroborating these findings, in yot
mutants high pressures that actually ruptured the axial vein were required to
fill the dorsal aorta, and the lumen of the dorsal aorta was constricted at
various points (Fig. 5F). These
results suggest that Sema3a1 in the somites acts to regulate angioblast
migration and, thereby, the formation of the dorsal aorta.
|
|
| DISCUSSION |
|---|
|
|
|---|
Recently, MO knockdown of neuropilin 1 was shown to lead to defective
circulation in intersegmental vessels but not axial vessels, and MO knockdown
of Vegf to defective circulation in both intersegmental and axial vessels
(Lee et al., 2002
). Because
neuropilin 1 serves as a coreceptor for both Sema3a and Vegf, one would have
expected a knockdown of neuropilin 1 to interfere with dorsal aorta formation.
It is possible that defects of the dorsal aorta require higher levels of
neuropilin 1 knockdown compared to defects of the intersegmental vessels. In
fact, neuropilin 1 does appear to contribute to formation of the dorsal aorta
because injection of neuropilin 1 antisense MO with a non-effective level of
Vegf antisense MO did interfere with both intersegmental and axial circulation
(Lee et al., 2002
).
Mechanism of Sema3a1 action during dorsal aorta formation
How does Sema3a1 regulate angioblast migration? One possibility is that
migration by angioblasts is directed by CaP motor axons whose pathway
partially coincides with that of the angioblasts. Consistent with this idea is
that CaP growth cones are repulsed by Sema3a1
(Halloran et al., 2000
). Thus,
it is possible that the deleterious effects on angioblast migration following
manipulation of Sema3a1 are secondary effects mediated via erroneous outgrowth
by the CaP motor axons. However, our evidence suggests that angioblasts do not
appear to follow the CaP axons. Angioblasts start ventrolateral to the somites
and first migrate medially and then dorsally to the notochord. The CaP motor
axon starts out in the spinal cord and extends ventrally then laterally to the
ventrolateral edge of the somite (Myers et
al., 1986
). In midtrunk segments angioblasts are arriving at their
destination just ventral to the notochord whereas the CaP motor axons are
still at the muscle pioneers, a site that is dorsal to the destination of the
angioblasts. Thus, many angioblasts have completed their migration prior to
extension of the CaP motor axon beyond the notochord, suggesting that
angioblasts need not follow CaP axons to complete their migration.
A second possibility is that Sema3a1 may directly repulse angioblasts.
First, class 3 semaphorins are secreted molecules that repulse specific growth
cones (Raper, 2000
). Second,
class 3 semaphorins regulate migration by neural crest cells
(Eickholt et al., 1999
) and
neurons (Marin et al., 2001
).
Third, Dev cells, a human medulloblastoma cell line, avoid migrating on a
Sema3a substrate in vitro (Bagnard et al.,
2001
).
A third possibility is that because class 3 semaphorins and Vegf both use
neuropilins as a component of their functional receptor
(Takahashi et al., 1999
;
Soker et al., 1998
), Sema3a1
may regulate migration of angioblasts by interfering with the chemoattractant
activity of Vegf for these cells. Because semaphorins can inhibit the action
of Vegf in vitro and vice versa via competition for binding to neuropilin
(Miao et al., 1999
;
Bagnard et al., 2001
), the
effects on migration of putative vascular endothelial cells following
misexpression of Sema3a1 could be accounted for by this mechanism. In fact,
migration of angioblasts that form the dorsal aorta in Xenopus is
guided by Vegf expressed by the hypochord cells ventral to the notochord
(Cleaver and Krieg, 1998
). In
zebrafish, Vegf is expressed by the ventromedial region of each somite
(Liang et al., 1998
),
neuropilin 1 and Flk1/Vegfr2 is expressed by putative angioblasts (this study)
(Fouquet et al., 1997
), and
knocking down Vegf leads to defective vascular development including that of
the dorsal aorta (Nasevicius et al.,
2000
). Interestingly, the expression domains of Vegf and Sema3a1
within the somites appear to partially overlap
(Fig. 7). Thus it is possible
that Sema3a1 secreted by the ventral third of the somite may create a
functional gradient of secreted Vegf activity such that the level of Vegf is
high dorsal and low ventral in the ventral half of the somite. Such a
functional Vegf gradient would be consistent with the dorsal migration of the
angioblasts. Furthermore, it is possible that competitive interactions between
Vegf and Sema3a1 may also generate a functional gradient of Sema3a1 within the
ventral third of the somites. Here the repulsive activity of Sema3a1 would be
high ventral and low dorsal in the ventral half of the somites. Thus, there
exists the intriguing possibility that complementary gradients of attractive
and repulsive molecules may regulate dorsal migration by angioblasts.
|
Whether migration of angioblasts is regulated by complementary gradients of
Vegf and Sema3a1 is an open question. What is clear is that both Vegf and
Sema3a1 can regulate the formation of the dorsal aorta. That they do so in
concert in vivo is suggested by the correlation of dorsal aorta defects and
concomitant changes in expression of Vegf and Sema3a1 in the zebrafish
floating head (flh) mutant. Vegf expression is missing in
somites and Sema3a1 is expressed throughout the entire somite in flh
embryos (Shoji et al., 1998
;
Liang et al., 2001
). The
defects of the dorsal aorta are more severe in flh
(Brown et al., 2000
;
Liang et al., 2001
) compared
to that seen following antisense knockdown of Vegf (Nascevicius et al., 2000),
knockdown of Sema3a1 or misexpression of Sema3a1 throughout the entire somite
(this study). Furthermore, the fact that the notochord is missing in
flh suggests that notochord signaling is critical for guiding
angioblasts that form the dorsal aorta
(Fouquet et al., 1997
;
Weinstein et al., 1999). Sonic hedgehog from the notochord appears to play a
major role in this concerted process, because it downregulates Sema3a1
(Shoji et al., 1998
) and
upregulates Vegf (Lawson et al.,
2002
) on the somites. A similar dorsal aorta phenotype is found in
other midline mutants, which appear to lack hedgehog signaling
(Chen et al., 1996
;
Brown et al., 2000
) (W.S.,
unpublished).
Sema3a regulates vascular formation in other vertebrates
Our evidence demonstrates that in zebrafish Sema3a1 can affect migration by
putative angioblasts and the formation of the dorsal aorta. Intriguingly,
Sema3a is expressed in early somites of mammals in a pattern similar to that
seen in zebrafish (Giger et al.,
1996
; Taniguchi et al.,
1997
). Endothelial precursors in avian embryos migrate from the
somitic mesoderm and splanchnopleural mesoderm to form the dorsal aorta
(Pardanaud et al., 1996
).
Furthermore, Sema3a knockout mice and neuropilin 1 knockout mice exhibit
cardiovascular defects (Behar et al.,
1996
; Kawasaki et al.,
1999
). This suggests that Sema3a may also regulate migration of
angioblasts in other vertebrates as well.
Other class 3 semaphorins also regulate cardiovascular development.
sema3C is expressed along the path followed by migrating cardiac
neural crest cells to the truncus arteriosus and the aortic arch
(Feiner et al., 2001
). In
Sema3C knockout mice these vascular elements are defective suggesting that
Sema3C is an attractive cue for neural crest migration
(Feiner et al., 2001
). Thus,
Sema3a and Sema3C appear to regulate different processes in cardiovascular
development.
Ephrins and their Eph receptors are also involved in patterning of the
vascular system. Ephrin B2 (Efnb2) is expressed by arterial but not venous
endothelial cells, whereas Ephb4 the proposed Efnb2 receptor is expressed at
higher levels by venous endothelial cells
(Wang et al., 1998
;
Adams et al., 1999
;
Gerety et al., 1999
).
Furthermore, mice lacking Efnb2 or Efnb4 exhibit aberrant vascular patterning
(Wang et al., 1998
;
Gerety et al., 1999
). Because
ephrins and their receptors are well-known regulators of growth cone guidance
and cell migration, it is possible that they may also regulate migration by
angioblasts during vascular development. In the zebrafish efnb2 is
expressed by somites (Durbin et al.,
1998
) in a pattern that is similar to that of sema3a1.
Early the posterior half of each somite expresses efnb2, but later
expression changes so that the dorsal and ventrolateral somite expresses
efnb2. Thus the expression pattern of efnb2 is appropriate
for the guidance of angioblast migration as well. efnb2 is also
expressed by dorsal arterial angioblasts in zebrafish, but only after
migration (Lawson et al.,
2001
). Similarly, Ephb4 is expressed by the venous angioblasts in
the trunk after cell migration but is only diffusely expressed prior to vessel
formation (Zhong et al.,
2001
). This later expression suggests that Efnb2/Ephb4 may be
involved in the patterning and separation of dorsal arterial and posterior
cardinal venous angioblasts in their final positions ventral to the
notochord.
In conclusion, our experiments demonstrate that Sema3a1, a factor that guides growth cone extension, can also regulate migration of putative angioblasts. Interestingly, Vegf, which is an important regulator of migration by angioblasts, also affects growth cones (W.S., unpublished). Thus, factors that regulate migration/guidance in the nervous system also regulate migration in the vascular system and vice versa.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adams, R. H., Wilkinson, G. A., Weiss, C., Diella, F., Gale, N.
W., Deutsch, U., Risau, W. and Klein, R. (1999). Roles of
ephrinB ligands and EphB receptors in cardiovascular development: demarcation
of arterial/venous domains, vascular morphogenesis, and sprouting
angiogenesis. Genes Dev.
13,295
-306.
Al-Adhami, M. A. and Kunz, Y. W. (1977). Ontogenic of hematopoietic sites in brachydanio rerio. Dev. Growth Differ. 19,171 -179.[CrossRef]
Bagnard, D., Vaillant, C., Khuth, S. T., Dufay, N., Lohrum, M.,
Puschel, A. W., Belin, M. F., Bolz, J. and Thomasset, N.
(2001). Semaphorin 3A-vascular endothelial growth factor-165
balance mediates migration and apoptosis of neural progenitor cells by the
recruitment of shared receptor. J. Neurosci.
21,3332
-3341.
Behar, O., Golden, J. A., Mashimo, H., Schoen, F. J. and Fishman, M. C. (1996). Semaphorin III is needed for normal patterning and growth of nerves, bones and heart. Nature 383,525 -528.[CrossRef][Medline]
Brown, L. A., Rodaway, A. R., Schilling, T. F., Jowett, T., Ingham, P. W., Patient, R. K. and Sharrocks, A. D. (2000). Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech. Dev. 90,237 -252.[CrossRef][Medline]
Chen, J. N., Haffter, P., Odenthal, J., Vogelsang, E., Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Hammerschmidt, M. and Heisenberg, C. P. et al. (1996). Mutations affecting the cardiovascular system and other internal organs in zebrafish. Development 123,293 -302.[Abstract]
Childs, S., Chen, J. N., Garrity, D. M. and Fishman, M. C. (2002). Patterning of angiogenesis in the zebrafish embryo. Development 129,973 -982.[Medline]
Cleaver, O. and Krieg, P. A. (1998). VEGF mediates angioblast migration during development of the dorsal aorta in Xenopus. Development 125,3905 -3914.[Abstract]
Cox, K. H., DeLeon, D. V., Angerer, L. M. and Angerer, R. C. (1984). Detection of mrnas in sea urchin embryos by in situ hybridization using asymmetric RNA probes. Dev. Biol. 101,485 -502.[CrossRef][Medline]
Detrich, H. W., 3rd, Kieran, M. W., Chan, F. Y., Barone, L. M.,
Yee, K., Rundstadler, J. A., Pratt, S., Ransom, D. and Zon, L. I.
(1995). Intraembryonic hematopoietic cell migration during
vertebrate development. Proc. Natl. Acad. Sci. USA
92,10713
-10717.
Durbin, L., Brennan, C., Shiomi, K., Cooke, J., Barrios, A.,
Shanmugalingam, S., Guthrie, B., Lindberg, R. and Holder, N.
(1998). Eph signaling is required for segmentation and
differentiation of the somites. Genes Dev.
12,3096
-3109.
Eickholt, B. J., Mackenzie, S. L., Graham, A., Walsh, F. S. and Doherty, P. (1999). Evidence for collapsin-1 functioning in the control of neural crest migration in both trunk and hindbrain regions. Development 126,2181 -2189.[Abstract]
Feiner, L., Webber, A. L., Brown, C. B., Lu, M. M., Jia, L., Feinstein, P., Mombaerts, P., Epstein, J. A. and Raper, J. A. (2001). Targeted disruption of semaphorin 3C leads to persistent truncus arteriosus and aortic arch interruption. Development 128,3061 -3070.[Medline]
Fouquet, B., Weinstein, B. M., Serluca, F. C. and Fishman, M. C. (1997). Vessel patterning in the embryo of the zebrafish: guidance by notochord. Dev. Biol. 183, 37-48.[CrossRef][Medline]
Gerety, S. S., Wang, H. U., Chen, Z. F. and Anderson, D. J. (1999). Symmetrical mutant phenotypes of the receptor EphB4 and its specific transmembrane ligand ephrin-B2 in cardiovascular development. Mol. Cell 4,403 -414.[CrossRef][Medline]
Gering, M., Rodaway, A. R., Gottgens, B., Patient, R. K. and Green, A. R. (1998). The SCL gene specifies haemangioblast development from early mesoderm. EMBO J. 17,4029 -4045.[CrossRef][Medline]
Giger, R. J., Wolfer, D. P., De Wit, G. M. and Verhaagen, J. (1996). Anatomy of rat semaphorin III/collapsin-1 mRNA expression and relationship to developing nerve tracts during neuroembryogenesis. J. Comp. Neurol. 375,378 -392.[CrossRef][Medline]
Halloran, M. C., Sato-Maeda, M., Warren, J. T., Su, F., Lele, Z., Krone, P. H., Kuwada, J. Y. and Shoji, W. (2000). Laser-induced gene expression in specific cells of transgenic zebrafish. Development 127,1953 -1960.[Abstract]
Isogai, S., Horiguchi, M. and Weinstein, B. M. (2001). The vascular anatomy of the developing zebrafish: an atlas of embryonic and early larval development. Dev. Biol. 230,278 -301.[CrossRef][Medline]
Kawasaki, T., Kitsukawa, T., Bekku, Y., Matsuda, Y., Sanbo, M., Yagi, T. and Fujisawa, H. (1999). A requirement for neuropilin-1 in embryonic vessel formation. Development 126,4895 -4902.[Abstract]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Kolodkin, A. L. (1998). Semaphorin-mediated neuronal growth cone guidance. Prog. Brain Res. 117,115 -132.[Medline]
Lawson, N. D., Scheer, N., Pham, V. N., Kim, C. H., Chitnis, A.
B., Campos-Ortega, J. A. and Weinstein, B. M. (2001). Notch
signaling is required for arterial-venous differentiation during embryonic
vascular development. Development
128,3675
-3683.
Lawson, N. D., Vogel, A. M. and Weinstein, B. M. (2002). Sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation. Dev. Cell 3,127 -136.[CrossRef][Medline]
Lee, P., Goishi, K., Davidson, A. J., Mannix, R., Zon, L. I. and
Klagsbrun, M. (2002). Neuropilin-1 is required for vascular
development and is a mediator of VEGF-dependent angiogenesis in zebrafish.
Proc. Natl. Acad. Sci. USA
99,10470
-10475.
Liang, D., Xu, X., Chin, A. J., Balasubramaniyan, N. V., Teo, M. A., Lam, T. J., Weinberg, E. S. and Ge, R. (1998). Cloning and characterization of vascular endothelial growth factor (VEGF) from zebrafish, Danio rerio. Biochim. Biophys. Acta 1397,14 -20.[Medline]
Liang, D., Chang, J. R., Chin, A. J., Smith, A., Kelly, C., Weinberg, E. S. and Ge, R. (2001). The role of vascular endothelial growth factor (VEGF) in vasculogenesis, angiogenesis, and hematopoiesis in zebrafish development. Mech. Dev. 108, 29-43.[CrossRef][Medline]
Luo, Y., Raible, D. and Raper, J. A. (1993). Collapsin: a protein in brain that induces the collapse and paralysis of neuronal growth cones. Cell 75,217 -227.[CrossRef][Medline]
Marin, O., Yaron, A., Bagri, A., Tessier-Lavigne, M. and
Rubenstein, J. L. (2001). Sorting of striatal and cortical
interneurons regulated by semaphorin-neuropilin interactions.
Science 293,872
-875.
Miao, H. Q., Soker, S., Feiner, L., Alonso, J. L., Raper, J. A.
and Klagsbrun, M. (1999). Neuropilin-1 mediates
collapsin-1/semaphorin III inhibition of endothelial cell motility: functional
competition of collapsin-1 and vascular endothelial growth factor-165.
J. Cell Biol. 146,233
-242.
Myers, P. Z., Eisen, J. S. and Westerfield, M. (1986). Development and axonal outgrowth of identified motoneurons in the zebrafish. J. Neurosci. 6,2278 -2289.[Abstract]
Nasevicius, A., Larson, J. and Ekker, S. C. (2000). Distinct requirements for zebrafish angiogenesis revealed by a VEGF-A morphant. Yeast 17,294 -301.[CrossRef][Medline]
Orkin, S. H. (1992). GATA-binding transcription
factors in hematopoietic cells. Blood
80,575
-581.
Pardanaud, L., Luton, D., Prigent, M., Bourcheix, L. M., Catala, M. and Dieterlen-Lievre, F. (1996). Two distinct endothelial lineages in ontogeny, one of them related to hemopoiesis. Development 122,1363 -1371.[Abstract]
Pevny, L., Simon, M. C., Robertson, E., Klein, W. H., Tsai, S. F., D'Agati, V., Orkin, S. H. and Costantini, F. (1991). Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature 349,257 -260.[CrossRef][Medline]
Polleux, F., Giger, R. J., Ginty, D. D., Kolodkin, A. L. and
Ghosh, A. (1998). Patterning of cortical efferent projections
by semaphorin-neuropilin interactions. Science
282,1904
-1906.
Raper, J. A. (2000). Semaphorins and their receptors in vertebrates and invertebrates. Curr. Opin. Neurobiol. 10,88 -94.[CrossRef][Medline]
Roos, M., Schachner, M. and Bernhardt, R. R. (1999). Zebrafish semaphorin Z1b inhibits growing motor axons in vivo. Mech. Dev. 87,103 -117.[CrossRef][Medline]
Roth, M. B., Zahler, A. M. and Stolk, J. A.
(1991). A conserved family of nuclear phosphoproteins localized
to sites of polymerase II transcription. J. Cell Biol.
115,587
-596.
Schulte-Merker, S., Ho, R. K., Herrmann, B. G. and Nusslein-Volhard, C. (1992). The protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of the early embryo. Development 116,1021 -1032.[Abstract]
Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsenstein, M., Wu, X. F., Breitman, M. L. and Schuh, A. C. (1995). Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature 376,62 -66.[CrossRef][Medline]
Shoji, W., Yee, C. S. and Kuwada, J. Y. (1998). Zebrafish semaphorin Z1a collapses specific growth cones and alters their pathway in vivo. Development 125,1275 -1283.[Abstract]
Soker, S., Takashima, S., Miao, H. Q., Neufeld, G. and Klagsbrun, M. (1998). Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor. Cell 92,735 -745.[CrossRef][Medline]
Stainier, D. Y., Fouquet, B., Chen, J. N., Warren, K. S., Weinstein, B. M., Meiler, S. E., Mohideen, M. A., Neuhauss, S. C., Solnica-Krezel, L. and Schier, A. F. et al. (1996). Mutations affecting the formation and function of the cardiovascular system in the zebrafish embryo. Development 123,285 -292.[Abstract]
Takahashi, T., Fournier, A., Nakamura, F., Wang, L. H., Murakami, Y., Kalb, R. G., Fujisawa, H. and Strittmatter, S. M. (1999). Plexin-neuropilin-1 complexes form functional semaphorin-3A receptors. Cell 99, 59-69.[CrossRef][Medline]
Tamagnone, L., Artigiani, S., Chen, H., He, Z., Ming, G. I., Song, H., Chedotal, A., Winberg, M. L., Goodman, C. S. and Poo, M. et al. (1999). Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell 99,71 -80.[CrossRef][Medline]
Taniguchi, M., Yuasa, S., Fujisawa, H., Naruse, I., Saga, S., Mishina, M. and Yagi, T. (1997). Disruption of semaphorin III/D gene causes severe abnormality in peripheral nerve projection. Neuron 19,519 -530.[CrossRef][Medline]
Tessier-Lavigne, M. and Goodman, C. S. (1996).
The molecular biology of axon guidance. Science
274,1123
-1133.
Thompson, M. A., Ransom, D. G., Pratt, S. J., MacLennan, H., Kieran, M. W., Detrich, H. W., 3rd, Vail, B., Huber, T. L., Paw, B. and Brownlie, A. J. et al. (1998). The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis. Dev. Biol. 197,248 -269.[CrossRef][Medline]
Walter, J., Muller, B. and Bonhoeffer, F. (1990). Axonal guidance by an avoidance mechanism. J. Physiologie 84,104 -110.
Wang, H. U., Chen, Z. F. and Anderson, D. J. (1998). Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell 93,741 -753.[CrossRef][Medline]
Weinstein, B. M. (1999). What guides early embryonic blood vessel formation? Dev. Dyn. 215, 2-11.[CrossRef][Medline]
Yee, C. S., Chandrasekhar, A., Halloran, M. C., Shoji, W., Warren, J. T. and Kuwada, J. Y. (1999). Molecular cloning, expression, and activity of zebrafish semaphorin Z1a. Brain Res. Bull. 48,581 -593.[CrossRef][Medline]
Zhong, T. P., Childs, S., Leu, J. P. and Fishman, M. C. (2001). Gridlock signalling pathway fashions the first embryonic artery. Nature 414,216 -220.[CrossRef][Medline]
Zon, L. I. (1995). Developmental biology of
hematopoiesis. Blood 86,2876
-2891.
This article has been cited by other articles:
![]() |
G. Serini, L. Napione, M. Arese, and F. Bussolino Besides adhesion: new perspectives of integrin functions in angiogenesis Cardiovasc Res, May 1, 2008; 78(2): 213 - 222. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Acevedo, S. Barillas, S. M. Weis, J. R. Gothert, and D. A. Cheresh Semaphorin 3A suppresses VEGF-mediated angiogenesis yet acts as a vascular permeability factor Blood, March 1, 2008; 111(5): 2674 - 2680. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sato-Maeda, M. Obinata, and W. Shoji Position fine-tuning of caudal primary motoneurons in the zebrafish spinal cord Development, January 15, 2008; 135(2): 323 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Liu, J. Wang, B. Kinzel, M. Mueller, X. Mao, R. Valdez, Y. Liu, and E. Li Dosage-dependent requirement of BMP type II receptor for maintenance of vascular integrity Blood, September 1, 2007; 110(5): 1502 - 1510. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Schmidt, K. Brixius, and W. Bloch Endothelial Precursor Cell Migration During Vasculogenesis Circ. Res., July 20, 2007; 101(2): 125 - 136. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Y. Miyasaka, Y. S. Kida, T. Sato, M. Minami, and T. Ogura Csrp1 regulates dynamic cell movements of the mesendoderm and cardiac mesoderm through interactions with Dishevelled and Diversin PNAS, July 3, 2007; 104(27): 11274 - 11279. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Vieira, Q. Schwarz, and C. Ruhrberg Selective requirements for NRP1 ligands during neurovascular patterning Development, May 15, 2007; 134(10): 1833 - 1843. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. S. Kida, T. Sato, K. Y. Miyasaka, A. Suto, and T. Ogura Daam1 regulates the endocytosis of EphB during the convergent extension of the zebrafish notochord PNAS, April 17, 2007; 104(16): 6708 - 6713. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Kuan, H.-H. Yu, C. B. Moens, and M. E. Halpern Neuropilin asymmetry mediates a left-right difference in habenular connectivity Development, March 1, 2007; 134(5): 857 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Favier, A. Alam, P. Barron, J. Bonnin, P. Laboudie, P. Fons, M. Mandron, J.-P. Herault, G. Neufeld, P. Savi, et al. Neuropilin-2 interacts with VEGFR-2 and VEGFR-3 and promotes human endothelial cell survival and migration Blood, August 15, 2006; 108(4): 1243 - 1250. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Miano Fishing for Function in Zebrafish Circ. Res., March 31, 2006; 98(6): 723 - 726. [Full Text] [PDF] |
||||
![]() |
M. Sato-Maeda, H. Tawarayama, M. Obinata, J. Y. Kuwada, and W. Shoji Sema3a1 guides spinal motor axons in a cell- and stage-specific manner in zebrafish Development, March 1, 2006; 133(5): 937 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-W. Jin, D. Beis, T. Mitchell, J.-N. Chen, and D. Y. R. Stainier Cellular and molecular analyses of vascular tube and lumen formation in zebrafish Development, December 1, 2005; 132(23): 5199 - 5209. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Basile, T. Afkhami, and J. S. Gutkind Semaphorin 4D/Plexin-B1 Induces Endothelial Cell Migration through the Activation of PYK2, Src, and the Phosphatidylinositol 3-Kinase-Akt Pathway Mol. Cell. Biol., August 15, 2005; 25(16): 6889 - 6898. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Walzer, L. Galibert, and T. De Smedt Dendritic cell function in mice lacking Plexin C1 Int. Immunol., July 1, 2005; 17(7): 943 - 950. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Autiero, F. De Smet, F. Claes, and P. Carmeliet Role of neural guidance signals in blood vessel navigation Cardiovasc Res, February 15, 2005; 65(3): 629 - 638. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Serini and F. Bussolino Common Cues in Vascular and Axon Guidance Physiology, December 1, 2004; 19(6): 348 - 354. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Wolman, Y. Liu, H. Tawarayama, W. Shoji, and M. C. Halloran Repulsion and Attraction of Axons by Semaphorin3D Are Mediated by Different Neuropilins In Vivo J. Neurosci., September 29, 2004; 24(39): 8428 - 8435. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Basile, A. Barac, T. Zhu, K.-L. Guan, and J. S. Gutkind Class IV Semaphorins Promote Angiogenesis by Stimulating Rho-Initiated Pathways through Plexin-B Cancer Res., August 1, 2004; 64(15): 5212 - 5224. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu, J. Berndt, F. Su, H. Tawarayama, W. Shoji, J. Y. Kuwada, and M. C. Halloran Semaphorin3D Guides Retinal Axons along the Dorsoventral Axis of the Tectum J. Neurosci., January 14, 2004; 24(2): 310 - 318. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||