|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online January 18, 2008
doi: 10.1242/10.1242/dev.00543




1 Department of the Control of Genetic Processes, Institute of Gene Biology,
Russian Academy of Sciences, Moscow 117334, Russia
2 Center for Medical Studies, University of Oslo at the Institute of Gene
Biology, Russian Academy of Sciences, Moscow 117334, Russia
3 Department of Zoology, University of Geneva, CH1211 Geneva, Switzerland
* Present address: Institute de Genetique et de Biologie Moleculaire et
Cellulaire, CNRS/INSERM/ULP, 67404 IIIkirch Cedex, France
These authors contributed equally to the work
Author for correspondence (e-mail:
georgiev_p{at}mail.ru)
Accepted 27 March 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila melanogaste, Achaete-scute Complex, Insulator, Su(Hw), Mod(mdg4), Enhancer blocking
| INTRODUCTION |
|---|
|
|
|---|
Genetic and molecular approaches have led to the identification and
characterization of two proteins that are required for activity of the
gypsy insulator. One is Suppressor of Hairy wing [Su(Hw)], a twelve
zinc finger protein encoded by the suppressor of Hairy wing [su(Hw)]
gene, which binds to the repeated sequence motifs in the gypsy
insulator (Dorsett, 1990
;
Spana and Corces, 1990
). Of
the protein domains comprising Su(Hw), 9 out of 12 zinc fingers and a domain
of approximately 150 amino acids including the C-terminal leucine zipper, but
not the N- and C-terminal acidic regions, are required for enhancer blocking
(Harrison et al., 1993
;
Kim et al., 1996
).
Mutations in another gene, modifier of mdg4, alter the phenotypes
of gypsy-induced mutations, indicating that the product of this gene
is also involved in the function of the gypsy insulator
(Georgiev and Gerasimova,
1989
; Gerasimova et al.,
1995
; Georgiev and Kozycina,
1996
; Cai and Levine,
1997
; Gdula and Corces,
1997
; Cai and Shen,
2001
). The mod(mdg4) gene, also known as
E(var)3-93D, encodes a large set of individual protein isoforms with
specific functions in regulating the chromatin structure of different genes
(Gerasimova et al., 1995
;
Buchner et al., 2000
). The
available genetic data suggest that Mod(mdg4) is required for the
enhancer-blocking activity (Georgiev and
Kozycina, 1996
; Gdula and
Corces, 1997
; Cai and Chen,
2001
). Biochemical studies using purified Su(Hw) and Mod(mdg4)
proteins indicate that one protein isoform of the mod(mdg4) gene,
Mod(mdg4)-67.2, interacts with the enhancer-blocking domain of the Su(Hw)
protein (Gause et al., 2001
;
Ghosh et al., 2001
).
The Mod(mdg4)-67.2 protein is present in approximately 500 sites on
polytene chromosomes (Gerasimova and
Corces, 1998
). About 200 of these sites also contain the Su(Hw)
protein (Gerasimova and Corces,
1998
; Gerasimova et al.,
2000
). These sites of co-localization do not contain copies of the
gypsy retrotransposon and are presumed to be endogenous insulators.
In spite of these promising observations, no endogenous Su(Hw) insulators have
been identified. The viable mod(mdg4)u1 mutation effects
only the isoform of mod(mdg4), Mod(mdg4)-67.2, that directly
interacts with the Su(Hw) protein
(Gerasimova et al., 1995
;
Buchner et al., 2000
). In
contrast to lethal loss of-function alleles of the mod(mdg4) gene,
mod(mdg4)u1 flies are viable and have no visible
phenotypic defects (Georgiev and
Gerasimova, 1989
) suggesting that the function of the
Mod(mdg4)-67.2 protein can be compensated by other proteins.
Here we describe the identification of the first endogenous functional
Su(Hw) insulator, located between the yellow gene and
Achaete-scute gene complex (ASC). The yellow gene determines
the proper pigmentation of cuticle structures, and its expression in different
tissues is controlled by enhancers located in the 5' region and in the
first intron of the gene (Geyer et al.,
1986
; Geyer and Corces,
1987
; Martin et al.,
1989
). The achaete (ac), scute
(sc) and l'sc genes, members of ASC, are located in the
vicinity of the yellow gene and differ from yellow in their
spatial and temporal patterns of expression
(Campuzano et al., 1985
). The
proteins encoded by the ac and sc genes are essential for
the formation of bristle sensory organs (macrochaetae)
(Modolell and Campuzano,
1998
). A very complex pattern of ac and sc
expression is mediated by the action of site-specific, enhancer-like elements
distributed over about 90 kb of the AS-C
(Ruiz-Gomez and Modolell,
1987
; Gomez-Skarmeta et al.,
1995
; Modolell and Campuzano,
1998
). The new insulator we identified contains two Su(Hw) binding
sites that are required for insulator function, blocking the yellow
and white enhancers. Mutations in the su(Hw) and
mod(mdg4) genes strongly affect expression of the AS-C genes in
rearrangements that partially disrupt the proper organization of the AS-C
regulatory region. Thus, Su(Hw) and Mod(mdg4) proteins participate in proper
regulation of the AS-C.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The transposon constructs, together with a P element with defective
inverted repeats used as a transposase source, P25.7wc (Karess and Rubin,
1984), were injected into y ac w1118 preblastoderm embryos
as described previously (Rubin and
Spradling, 1982
; Spradling and
Rubin, 1982
). The resulting flies were crossed with y ac
w1118 flies, and transgenic progeny were identified by their
eye color. Chromosome localization of various transgene insertions was
determined by crossing the transformants with the y ac
w1118 balancer stock containing dominant markers:
In(2RL),CyO for chromosome two, In(3LR)TM3,Sb for chromosome
three. The transformed lines were examined by Southern blot hybridization, to
check for transposon integrity and copy number.
The su(Hw)v/su(Hw)f,
su(Hw)v/su(Hw)2,
mod(mdg4)u1/mod(mdg4)u1 and
mod(mdg4)u1/Df(3R)GC14 mutations were combined with
sc mutations or transposons as previously described
(Georgiev and Kozycina, 1996
).
The lines with a tested DNA fragment, or eye enhancer or Su(Hw) excisions were
obtained by crossing flies bearing the transposons with Flp or Cre
recombinase-expressing lines. All excisions were confirmed by PCR
analysis.
In order to determine the yellow and white phenotypes, the extent of pigmentation in the abdominal cuticle, as well as eye pigmentation of adult flies was estimated visually in 3- to 5-day-old males developing at 25°C. Wild-type expression in abdominal cuticle and wings was assigned an arbitrary score of 5, while the absence of y expression was ranked 1. Flies with the previously characterized y allele were used as a reference in order to determine y pigmentation levels. Wild-type w expression results in bright red eye color (R), while the absence of w expression results in white eyes (W). Intermediate levels of pigmentation are defined by eye color ranging through pale yellow (p-Y), yellow (Y), dark yellow (d-Y), orange (Or), dark orange (d-Or), brown (Br), brown-red (Br-R), reflecting, respectively, low, intermediate, and high levels of the white expression. The scores were determined independently by two people and based upon at least 30 flies from two independent crosses.
Transgenic constructs and in vitro mutagenesis
The 8 kb fragment containing the yellow gene and the cDNA
yellow clone were kindly provided by P. Geyer. The 3 kb
SalI-BamHI fragment containing the yellow
regulatory region (yr) was subcloned into BamHI +
XhoI-digested pGEM7 (yr plasmid). The 5 kb
BamHI-BglII fragment containing the coding region (yc) was
subcloned into CaSpeR3 (C3-yc).
The 430 bp gypsy sequence containing the Su(Hw) binding region was PCR-amplified from the gypsy retrotransposon. After sequencing to confirm its identity, the product was inserted between two loxP sites (lox(su)) and in CaSpeR3 (C3-su). The lox(su) fragment was blunt-ligated to the CaSpeR2 vector restricted with BglII (C2-lox(su)).
The yellow regulatory region includes the body enhancer, located
between -1266 bp and -1963 bp, and wing enhancer, located between -1863 bp and
-2873 bp relative the transcription start site of the yellow gene
(Geyer and Corces, 1987
). The
white regulatory sequences from position -1084 to -1465 bp relative
to the transcription start site (Ee) were cloned between two frt sites
(frt(Ee)). These sequences contain testes and eye enhancers
(Qian et al., 1992
). After
that the frt(Ee) fragment was inserted at position -1868 from the
yellow transcription start site (yr-frt(Ee)).
The 125 bp sequence containing the Su(Hw) binding region was PCR amplified
with pr-1 (5' tcctaatttccttac 3') and pr-2 (5'
attcttttaccatgc 3') primers from the
sc133 phage
(donated by J. Modolell). After sequencing to confirm its identity, the
product, one copy (125 bp) or three copies (3x125 bp) of the 125 bp
fragment were inserted between two lox sites [lox(125 bp) and lox(3x125
bp)]. The 2 kb DNA fragment was cloned from the
sc133 phage
DNA restricted with PstI between two lox sites (lox(2 kb)). The 454
bp fragment was PCR-amplified with pr-5 (5' ggagtactactaccaggc 3')
and pr-6 (5' caagaacatttccgatatg 3') primers from the
sc133 phage and inserted between lox sites (lox(454 bp)). To
mutate both Su(Hw) binding sites in the 454 bp fragment (454*)
oligonucleotides carrying the desired mutated sequences, pr-7 (5'
attggccagtatatattatgtgtttaatac 3') and pr-8 (5'
agaagtccctcgcaaaaaagtattaaatac 3') were used to amplify PCR products.
Two PCR-amplified DNA fragments with pr-5 and pr-8 primers or pr-6 and pr-7
primers were blunt ligated. The resulting 454* bp DNA fragment was
sequenced to verify that the intended mutant sequences had been introduced and
other PCR-induced mutations did not exist.
Ey(e)(2 kb)YSW and Ey(e)(3x125 bp)YSW
The lox(2 kb) or lox(3x125 bp) fragment was inserted in the yr-frt(Ee) restricted with Eco47III at -893 from the yellow transcription start site [yr-frt(Ee)-lox(2 kb) and yr-frt(Ee)-lox(3x125 bp)]. The yr-frt(Ee)-lox(2 kb) or yr-frt(Ee)-lox(3x125 bp) fragment was ligated into C3-su restricted with XbaI and BamHI.
Ey(e)125 bpY(S)W and Ey(e)454 bpY(S)W
The 125 bp or 454 bp fragment was inserted in the yr-frt(Ee) restricted with Eco47III (yr-frt(Ee)-125 bp and yr-frt(Ee)-454 bp). The yr-frt(Ee)-125 bp and yr-frt(Ee)-454 bp fragments were ligated into C2-lox(su) restricted with XbaI and BamHI.
Ey454* bpYW
The 454* bp fragment was inserted in the yr restricted with Eco47III (yr-454* bp). The yr-454* bp fragment was ligated into C3-yc restricted with XbaI and BamHI.
To alter consensus sequences for the number 1 (#1) Su(Hw) binding site, oligonucleotides carrying the desired mutated sequences (available upon request) were used to amplify PCR products. Both mutant Su(Hw)#1 binding sites were sequenced to verify that the intended mutant sequences had been introduced and other PCR-induced mutations did not exist.
Electrophoretic mobility shift assays
For the purpose of synthesizing Su(Hw) in vitro, the Su(Hw) ORF encoding a
945 amino acid polypeptide was subcloned from the Su(Hw) cDNA (kindly provided
by D. Dorsett). Su(Hw) protein was synthesized in vitro in the TNT coupled
transcription/translation reticulocyte lysate (Promega) from a T7
promoter-Su(Hw) cDNA template cloned in the pET 30a plasmid (Novagen). In the
binding assay, 25 fmole of a radioactively labeled DNA fragment was mixed with
10 µl of the in vitro translation reaction in 25 µl of 15 mM Hepes (pH
7.6), 100 mM KCl, 5 mM MgCl2, 0.1 mM ZnCl2, 5mM DTT, 10%
glycerol and 5 µg of poly[d(I-C)]. After incubation at 4°C for 10
minutes, the reactions were loaded on 1.5% agarose gel and the complexes
fractionated in 1x TBE buffer (89 mM Tris-borate, 89 mM borate and 3 mM
EDTA) at 5 V/cm.
PCR was done by standard techniques. The primers used in DNA amplification were derived from the yellow and AS-C sequences:
The products of amplification were fractionated by electrophoresis in 1.5% agarose gels in TAE. The successfully amplified products were cloned into a Bluescript plasmid (Stratagene, La Jolla, CA) and sequenced using the Amersham sequence kit (Amersham, Arlington Heights, IL).
| RESULTS |
|---|
|
|
|---|
|
|
To examine the potential enhancer blocking activity of the new Su(Hw)
binding sites, we used the yellow gene, required for dark
pigmentation of Drosophila larval and adult cuticle and its
derivatives. Two upstream enhancers, En-b and En-w, activate yellow
expression in the body cuticle and wing blades, respectively (Geyer and
Corces, 1997). The gypsy insulator is able to effectively block the
wing and body enhancers (Geyer et al.,
1986
; Geyer and Corces,
1992
; Muravyova et al.,
2001
). To test the insulator activity of the intergenic Su(Hw)
sites we made constructs that exploit two properties of the gypsy
insulator. One is the blocking activity when interposed between enhancer and
promoter; the other is the ability of two gypsy insulators to
neutralize one another (Gause et al.,
1998
; Cai and Shen,
2001
; Muravyova et al.,
2001
). The constructs depicted in
Fig. 3A contain a
gypsy Su(Hw) insulator inserted between the yellow and
white gene and the eye enhancer of the white gene inserted
between the wing and body enhancers of yellow. It has been shown that
interposition of the Su(Hw) insulator between the eye enhancer and the
white promoter completely blocked enhancer activity
(Roseman et al., 1993
;
Muravyova et al., 2001
).
|
When the gypsy insulator is inserted at position -893, the
yellow enhancer action is completely blocked, resulting in yellow
instead of dark pigmentation of body and wing, whereas the eye enhancer was
fully active because of neutralization of the enhancer-blocking activity
(Muravyova et al., 2001
).
To test the intergenic Su(Hw) sites we first made Ey(e)(2kb)YSW, in which
the 2 kb DNA fragment containing the 3' part of the yellow
coding region and the 5' part of the ac regulatory region
(Fig. 3A,
Fig. 4A) is inserted at the
-893 position. The 2 kb DNA fragment was flanked by Cre recognition (Lox)
sites to permit its excision from transgenic flies
(Siegal and Hartl, 2000
). In
all 9 transgenic Ey(e)(2kb)YSW lines, wing and body pigmentation was yellow
suggesting that the 2 kb DNA fragment is able to completely block the
yellow enhancers (Fig.
3B, lanes 1, 4). The deletion of the 2 kb DNA fragment in the
Ey(e)(
2kb)YSW derivatives restored wild-type cuticle pigmentation. When
three of the less pigmented lines were tested in the
su(Hw)- background, wild-type pigmentation was restored
(Fig. 3B, lane 7). Thus, the
Su(Hw) protein is required to block the yellow enhancers.
|
2kb)YSW derivatives bearing only the
gypsy insulator (Fig.
3B, lanes 2-3, 5-6). The role of the eye enhancer in activation of
the white promoter was supported by deleting the eye enhancer from
the Ey(e)(2kb)YSW lines, which strongly diminished eye pigmentation. Thus, the
2 kb fragment can neutralize the enhancer-blocking activity of the
gypsy insulator.
We next tested the minimal 125 bp fragment from the intergenic region by
inserting it at position -893 to give the Ey(e)125bpY(S)W construct
(Fig. 3A). In this construct
the gypsy insulator between the yellow and white
genes was flanked by lox sites. In 10 Ey(e)125bpY(S)W lines, wing and body
pigmentation was between yellow and wild type
(Fig. 3B, lane 15), indicating
that the yellow enhancers were only partially blocked in comparison
with the transgenic lines with the 2 kb fragment
(Fig. 3B, lane 1). Five
Ey(e)125bpY(S)W lines tested in the su(Hw)- background
showed restored wild-type level of pigmentation, confirming that the binding
of the Su(Hw) protein to the 125 bp fragment is required to block the
yellow enhancers (Fig.
3B, lane 21). The deletion of the eye enhancer diminished eye
pigmentation in 8 out of 10 Ey(e)125bpY(S)W transgenic lines, implying that
the minimal 125 bp fragment is able to neutralize the gypsy insulator
(Fig. 3B, lanes 16, 17). The
deletion of the gypsy insulator (
S) in most
Ey(e)125bpY(
S)W derivatives reduced eye pigmentation and made them
insensitive to the additional deletion of the eye enhancer
(Fig. 3B, 19, 20). These
results suggest that the 125 bp fragment by itself can block the interaction
between the eye enhancer and the white promoter.
The 2 kb DNA fragment has stronger enhancer-blocking activity than the 125 bp fragment. To exclude a role of the yellow coding and the ac regulatory regions in the insulation activity, we tested a 454 bp DNA subfragment that contains the 125 bp fragment and surrounding sequences (Fig. 3A). In all 9 transgenic Ey(e)454bpY(S)W lines, wing and body pigmentation was yellow suggesting that the 454 bp DNA fragment blocks the yellow enhancer as well as the 2 kb DNA fragment (Fig. 3B, lane 23). Like the 125 bp fragment, the 454 bp fragment also blocks the eye enhancer and efficiently neutralizes the activity of the gypsy insulator (Fig. 3B, lanes 24-26).
The strong blocking of the yellow enhancer by the 454 bp fragment, compared with 125 bp fragment, may be explained either by existence of additional Su(Hw) binding sites in the 454 bp fragment or by the possible involvement of one or more other proteins binding to neighboring sequences. To test these possibilities, we mutated both Su(Hw) binding sites in the 454 bp fragment (454*). The 454 bp and 454* bp DNA fragments were tested in electrophoretic mobility shift assays (EMSAs) using in vitro-synthesized Su(Hw) protein (Fig. 2B). The binding of Su(Hw) to the 454 bp fragment but not to 454* argues against additional Su(Hw) binding sites in the 454 bp fragment. To examine the ability of 454* to block the yellow enhancer, we inserted the 454* bp fragment at position -893 to give the Ey454*bpYW construct. In all 7 transgenic Ey454*bpYW lines, flies had nearly wild-type levels of wing and body pigmentation suggesting that the 454* bp fragment has lost the insulator activity (Fig. 3B, lane 27). Thus, these results confirm that the Su(Hw) protein is required but not sufficient for the blocking activity of the 454 bp fragment.
The multiplication of binding sites for the Su(Hw) protein has been shown
to increase insulator activity (Scott et
al., 1999
). To test this rule, we inserted three copies of the 125
bp fragment between lox sites at -893 in the yellow regulatory region
(Fig. 3A). All seven transgenic
Ey(e)(125bpx3)YSW lines obtained had yellow wing and body cuticle
indicating strong blocking of the wing and body enhancers
(Fig. 3B, lane 9). At the same
time, these lines had high levels of eye pigmentation that were strongly
reduced after deletion of the eye enhancer
(Fig. 3B, lanes 10, 11),
indicating mutual neutralization of the triplicated 125 bp fragment and the
gypsy insulator.
These results suggest that the intergenic region contains binding sites for other protein(s) in addition to Su(Hw) that is (are) required for efficient blocking of the yellow enhancers.
The su(Hw) and mod(mdg4) mutations influence expression of ASC alleles
Mutations in the su(Hw) and mod(mdg4) genes have no
visible effect on the ac or sc phenotype. To determine the
potential role of these genes in the regulation of AS-C, we examined the
influence of the su(Hw) and mod(mdg4) mutations on the
mutant phenotype of the AS-C alleles.
First, we examined several inversions with breakpoints in the regulatory region of the yellow and AS-C and the centric heterochromatin.
The breakpoint in the In(1)y3P mutation is located in
the regulatory region of the yellow gene
(Fig. 4A)
(Campuzano et al., 1985
). The
centric heterochromatin in the In(1)y3P mutation does not
influence yellow expression in bristles or expression of the ASC
genes, but the loss of the upstream body and wing enhancers causes a yellow
wing and body phenotype. The su(Hw)v/su(Hw)f
and su(Hw)v/su(Hw)2 transheterozygotes strongly
affected ac and sc gene expression, but did not influence
yellow expression: bristles remained entirely pigmented
(Fig. 4B). The homozygous
mod(mdg4)u1 mutation and
mod(mdg4)u1/Df(3R)GC14 transheterozygotes produced a
similar effect on the ac and sc phenotype, although slightly
milder than that produced by su(Hw)-. These results
suggest an involvement of Su(Hw) and Mod(mdg4) proteins in protecting the AS-C
genes from heterochromatic silencing.
Similar results were obtained with two other inversions tested. The In(1)scV2 and In(1)sc8 inversions have breakpoints between ac and sc (Fig. 4A). The breakpoint in In(1)scV2 is located very close to the 3' end of the ac coding region. Despite the close proximity to centric heterochromatin, both mutations cause only a weak mutant phenotype (Fig. 4B). However, in su(Hw)v/su(Hw)f (su(Hw)v/su(Hw)2) or mod(mdg4)u1/mod(mdg4)u1 (mod(mdg4)u1/Df(3R)GC14) backgrounds these inversions caused strongly enhanced ac- and sc- phenotypes. In the case of In(1)scV2, in particular, the mod(mdg4) and su(Hw) mutations induced strong variegation of bristle pigmentation (Fig. 4B) suggesting that the Su(Hw)-Mod(mdg4) complex blocks the spread of heterochromatin in the yellow region.
The sc2 and sc5 mutations are
associated with deletions. The 1.3 kb deletion in the sc5
mutation (Fig. 4A) partially
suppresses the formation of scutellar bristles suggesting that the sc
enhancer is affected (Campuzano et al.,
1985
). The su(Hw) mutations weakly suppressed ASA, AOR,
OC and PV bristle formation (Fig.
4B). sc2, also called
ase1, is an intercalary 17-18 kb deletion that removes the
regulatory sequences for the SC bristles and also the coding sequence of the
ase gene (Gonzalez et al.,
1989
). The sc2 mutation has a weak sc
phenotype associated with partial suppression of SC bristle formation
(Fig. 4B). Unexpectedly the
combination of sc2 with
su(Hw)v/su(Hw)f or with
su(Hw)v/su(Hw)2 was lethal. The homozygous
mod(mdg4)u1 mutation or transheterozygous
mod(mdg4)u1/Df(3R)GC14 also strongly decreased the
survival of sc2 mutants and completely blocked the
formation of SC bristles. Even sc2;
mod(mdg4)u1/+ flies had a very low viability if they were
obtained from homozygous mod(mdg4)u1 females, suggesting
that maternally supplied Mod(mdg4) is required for sc2
survival. The proneural gene l'sc is expressed only in early embryos
and its inactivation results in embryonic lethality
(Campuzano et al., 1985
;
Carmena et al., 1995
),
suggesting that loss of Mod(mdg4) or Su(Hw) causes repression of
l'sc in the sc2 mutant. We hypothesize that an
additional Su(Hw) insulator might normally protect the l'sc gene and
might become essential when enhancer elements in the sc2
region are deleted.
| DISCUSSION |
|---|
|
|
|---|
Using in vivo and in vitro assays, we have shown that there exists a
functional Su(Hw) insulator between the yellow gene and AS-C.
Previously it was found that at least four Su(Hw) binding sites are required
for effective enhancer blocking (Scott et
al., 1999
). Here we found that the 125 bp fragment including only
two Su(Hw) binding sites can partially block the strong yellow
enhancer, while the larger 454 bp fragment including the same Su(Hw) sites
completely blocks yellow enhancers. Thus, additional proteins binding
to neighboring sequences are required for strong insulator action of the
element between yellow and AS-C. The sequencing of the
Drosophila genome shows the absence of large clusters of endogenous
Su(Hw) binding sites, such as are found in the gypsy retrotransposon.
It seems possible that in endogenous insulators, Su(Hw) cooperates with
additional DNA-binding proteins to produce insulator activity. This assumption
may also explain the absence of lethal phenotypes in the
su(Hw)- background since other proteins would partly
compensate for the loss of Su(Hw) function.
Our results further confirm the initial observation of the interaction
between two gypsy insulators
(Gause et al., 1998
;
Cai and Shen, 2001
;
Muravyova et al., 2001
). The
two Su(Hw) binding sites in the 125 bp fragment and the gypsy
insulator mutually neutralize each other's enhancer-blocking activity. Thus,
the difference in the number of Su(Hw) binding sites between interacting
insulators is not critical for the effective neutralization of the enhancer
blocking activity.
As has been observed previously (Scott
et al., 1999
; Smith and
Corces, 1992
; Hagstrom et al.,
1996
; Hoover et al.,
1992
), increasing the number of Su(Hw) binding sites increases
insulator strength, and three copies of the 125 bp insulator block better than
a single copy. How can this be reconciled with the observation that two Su(Hw)
insulators neutralize one another? We suppose that, as proposed earlier
(Cai and Shen, 2001
;
Muravyova et al., 2001
), the
neutralization requires the pairing between two insulators. Interaction
between neighboring insulators would pre-empt their interaction with larger
assemblies of Su(Hw) binding sites that have been proposed to associate
together at the nuclear periphery through the Mod(mdg4) protein
(Mongelard and Corces, 2001
;
West et al., 2002
;
Labrador and Corces, 2002
).
Thus, for neutralization, we suppose that the Su(Hw) binding sites must adopt
a paired configuration, therefore requiring a sufficient distance between them
for DNA to form a loop. In contrast, putting more Su(Hw) binding sites very
close together merely ensures that enough Su(Hw) protein will be bound at any
one time to produce insulator action.
The role of the Su(Hw) and Mod(mdg4) proteins in the expression of ASC
genes becomes obvious when the normal architecture of the ASC regulatory
region is altered by chromosome rearrangements. Many previously described
inversions with breakpoints in the AS-C regulatory region and centric
heterochromatin (Campuzano et al.,
1985
) have weak mutant phenotypes, suggesting the presence of
sequences that effectively impede the spread of heterochromatic silencing. The
appearance of strong variegating repression of the ac and sc
genes when the inversions are combined with loss of su(Hw) or
mod(mdg4) function suggests that the Su(Hw) and Mod(mdg4) proteins
are involved in the stability of the ac and sc
expression.
In the In(1)y3p mutation, a heterochromatic breakpoint in the upstream regulatory region does not effect yellow expression suggesting that the yellow promoter is relatively resistant to heterochromatin proximity at this breakpoint. At the same time, ac and sc expression is strongly affected by su(Hw) or mod(mdg4) mutations, supporting the idea that Su(Hw) binding sites between yellow and ac block heterochromatin spreading.
The In(1)sc8 and In(1)scv2
inversions separate the ac and sc genes. The requirement of
the Su(Hw) and Mod(mdg4) proteins for normal sc expression suggests
the existence of additional Su(Hw) binding sites in the AS-C regulatory
region. The strong genetic interaction between sc2 and
mutations in mod(mdg4) or su(Hw) also supports the presence
of additional Su(Hw) binding sites in ASC. The expression of ASC genes is
regulated by a large number of enhancer-like elements
(Ruiz-Gomez and Modolell,
1987
; Gomez-Skarmeta et al.,
1995
; Modolell and Campuzano,
1998
). It seems reasonable that these ASC enhancers should be
separated by boundary elements as was found for the 3' cis-regulatory
region of Abdominal B (Abd-B), which is subdivided into a
series of iab domains (Mihaly et
al., 1998
). Boundary elements like MCP, Fab-7 and Fab-8 separate
the iab domains and protect each against positive and negative
chromatin modifications induced by neighboring iab domains
(Barges et al., 2000
;
Hagstrom et al., 1996
;
Mihaly et al., 1998
;
Zhou et al., 1996
;
Zhou et al., 1999
). Our
genetic results might be explained by the assumption that the Su(Hw)-Mod(mdg4)
protein complex participates in formation of boundary elements between certain
AS-C enhancers. The absence of noticeable changes in the wild-type AS-C gene
expression on the su(Hw) or mod(mdg4) mutant background
might be the consequence of the functional redundancy of the Su(Hw)-Mod(mdg4)
protein complex. We did not find clusters of potential endogenous Su(Hw)
binding sites inside the AS-C sequence. Thus, it seems possible that
Su(Hw)-Mod(mdg4) cooperates with other non-identified proteins in formation of
the functional boundaries in the regulatory region of AS-C. The identification
and characterization of new Su(Hw) binding sites may help in understanding the
role of Su(Hw)/Mod(mdg4) in transcriptional regulation of AS-C genes and
provide new insights into the mechanisms of the insulator action.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Barges, S., Mihaly, J., Galloni, M., Hagstrom, K., Muller, M.,
Shanower, G., Schedl, P., Gyurkovics, H. and Karch, F.
(2000). The Fab-8 boundary defines the distal limit of the
bithorax complex iab-7 domain and insulated iab-7
from initiation elements and a PRE in the adjacent iab-8 domain.
Development 127,779
-790.
Bell, A. C., West, A. G. and Felsenfeld, G.
(2001). Insulators and boundaries: versatile regulatory elements
in the eukaryotic genome. Science
291,447
-450.
Buchner, K., Roth, P., Schotta, G., Krauss, V., Saumweber, H.,
Reuter, G. and Dorn, R. (2000). Genetic and molecular
complexity of the position effect variegation modifier mod(mdg4) in
Drosophila. Genetics
155,141
-157.
Cai, H. and Chen, P. (2001). Effects of cis
arrangement chromatin insulators on enhancer blocking activity.
Science 291,493
-495.
Cai, H. and Levine, M. (1995). Modulation of
enhancer-promoter interactions by insulators in the Drosophila
embryo. Nature 376,533
-536.
Cai, H. N. and Levine, M. (1997). The
gypsy insulator can function as a promoter-specific silencer in the
Drosophila embryo. EMBO J.
16,1732
-1741.
Cai, H. N. and Shen, P. (2001). Effects of cis
arrangement of chromatin insulators on enhancer-blocking activity.
Science 291,493
-495.
Campuzano, S., Carramolino, L., Cabrera, C., Ruiz-Gomez, M.,
Villares, R., Boronat, A. and Modolell, J. (1985). Molecular
genetics of the achaete-scute gene complex of D. melanogaster.Cell 44,327
-338.
Carmena, A., Bate, M. and Jimenez, F. (1995).
Lethal of scute, a proneural gene, participates in the specification
of muscle progenitors during Drosophila embryogenesis. Genes
Dev. 9,2373
-2383.
Dorsett, D. (1990). Potentiation of a
polyadenylation site by a downstream protein DNA interaction. Proc.
Natl. Acad. Sci. USA. 87,4373
-4377.
Dorsett, D. (1999). Distant liaisons: long
range enhancer-promoter interactions in Drosophila. Curr. Opin.
Genet. Dev. 9,505
-514.
Gause, M., Hovhannisyan, H., Kahn, T., Kuhfittig, S., Mogila, V.
and Georgiev, P. (1998). hobo induced rearrangements
in the yellow locus influence the insulation effect of the
gypsy su(Hw)-binding region in Drosophila melanogaster.Genetics 149,1393
-1405.
Gause, M., Morcillo, P. and Dorsett, D. (2001).
Cooperation between Suppressor of Hairy Wing and Modifier of mdg4 proteins in
insulation of enhancer-promoter communication by the gypsy transposon
in the Drosophila cut gene. Mol. Cell. Biol.
21,4807
-4817.
Gdula, D. A. and Corces, V. G. (1997).
Characterization of functional domains of the su(Hw) protein that mediate the
silencing effect of mod(mdg4) mutations.
Genetics 145,153
-161.
Georgiev, P. G. and Gerasimova, T. I. (1989).
Novel genes influencing the expression of the yellow locus and mdg4
(gypsy) in Drosophila melanogaster. Mol. Gen.
Genet. 220,121
-126.
Georgiev, P. and Kozycina, M. (1996).
Interaction between mutations in the suppressor of Hairy wing and
modifier of mdg4 genes of Drosophila melanogaster affecting
the phenotype of gypsy-induced mutations.Genetics, 142,425
-436.
Gerasimova, T. I., Gdula, D. A., Gerasimov, D. V., Simonova, O.
and Corces, V. G. (1995). A Drosophila protein that imparts
directionality on a chromatin insulator is an enhancer of position-effect
variegation. Cell 82,587
-597.
Gerasimova, T. I. and Corces, V. G. (1998).
Polycomb and trithorax group proteins mediate the function
of a chromatin insulator. Cell
92,511
-521.
Gerasimova, T. I., Byrd, K. and Corces, V. G.
(2000). A chromatin insulator determines the nuclear localization
of DNA. Mol. Cell 6,1025
-1035.
Gerasimova, T. I. and Corces, V. G. (2001).
Chromatin insulators and boundaries: effects on transcription and nuclear
organization. Annu. Rev. Genet.
35,193
-208.
Geyer, P. K., Spana, C. and Corces, V. G.
(1986). On the molecular mechanism of gypsy-induced
mutations at the yellow locus of Drosophila melanogaster.EMBO J. 5,2657
-2662.
Geyer, P. K. and Corces, V. G. (1987). Separate
regulatory elements are responsible for the complex pattern of tissue-specific
and developmental transcription of the yellow locus in Drosophila
melanogaster. Genes Dev. 1,996
-1004.
Geyer, P. K. and Corces, V. G. (1992). DNA
position-specific repression of transcription by a Drosophila zinc
finger protein. Genes Dev.
6,1865
-1873.
Geyer, P. K. (1997). The role of insulator
elements in defining domains of gene expression. Curr. Opin. Genet.
Dev. 7,242
-248.
Ghosh, D., Gerasimova, T. I. and Corces, V. G.
(2001). Interactions between the Su(Hw) and Mod(mdg4) proteins
required for gypsy insulator function. EMBO J.
20,2518
-2527.
Golic, K. G. and Lindquist, S. (1989). The FLP
recombinase of yeast catalyzes site-specific recombination in the Drosophila
genome. Cell 59,499
-509.
Golovnin, A., Gause, M., Georgieva, S., Gracheva, E. and
Georgiev, P. (1999). Su(Hw) insulator can disrupt
enhancer-promoter interactions when located more than 20 kilobases away from
the Drosophila achaete-scute complex. Mol. Cell
Biol. 19,3443
-3456.
Gomez-Skarmeta, J. L., Rodriguez, I., Martinez, C., Culi, J.,
Ferres-Marco, D., Beamonte, D. and Modolell, J. (1995).
Cis-regulation of achaete and scute: shared
enhancer-like elements drive their coexpression in proneural clusters of the
imaginal discs. Genes Dev.
9,1869
-1882.
Gonzalez, F., Romani, S., Cubas, P., Modolell, J. and Mayor,
R. (1989). Molecular analysis of the asense gene, a
member of the achaete-scute complex of Drosophila
melanogaster, and its novel role in optic lobe development.
EMBO J. 17,181
-190.
Hagstrom, K., Muller, M. and Schedl, P. (1996).
Fab-7 functions as a chromatin domain boundary to ensure proper segment
specification by the Drosophila bithorax complex. Genes.
Dev. 10,3202
-3215.
Harrison, D. A., Gdula, D. A., Coyne, R. S. and Corces, V.
G. (1993). A leucine zipper domain of the suppressor of
Hairy-wing protein mediates its repressive effect on enhancer
function. Genes Dev. 7,1966
-1978.
Holdridge, C. and Dorsett, D. (1991).
Repression of hsp70 heat shock gene transcription by the suppressor
of Hairy-wing protein of Drosophila melanogaster. Mol. Cell.
Biol. 11,1894
-1900.
Hoover, K. K., Gerasimova, T. I., Chien, A. J. and Corces, V.
G. (1992). Dominant effects of suppressor of Hairy-wing
mutations on gypsy-induced alleles of forked and
cut in Drosophila melanogaster. Genetics
132,691
-697.
Kares, R. E. and Rubin, G. M. (1984). Analysis
of P transposable element functions in Drosophila.Cell 38,135
-146.
Kim, J., Shen, B., Rosen, C. and Dorsett, D.
(1996). The DNA-binding and enhancer-blocking domains of the
Drosophila suppressor of Hairy-wing protein. Mol. Cell.
Biol. 16,3381
-3392.
Labrador, M. and Corces, V. G. (2002). Setting
the boundaries of chromatin domains and nuclear organization.
Cell 111,151
-154.
Lindsley, D. L. and Zimm, G. G. (1992).
The Genome of Drosophila melanogaster. New York:
Academic Press.
Mallin, D. R., Myung, J. S., Patton, J. S. and Geyer, P. K.
(1998). Polycomb group repression is blocked by the Drosophila
suppressor of Hairy-wing [su(Hw)] insulator.
Genetics 148,331
-339.
Martin, M., Meng, Y. B. and Chia, W. (1989).
Regulatory elements involved in the tissue-specific expression of the
yellow gene of Drosophila. Mol. Gen. Genet.
218,118
-126.
Mazo, A. M., Mizrokhi, L. J., Karavanov, A. A., Sedkov, Y. A.,
Krichevskaja, A. A. and Ilyin, Y. V. (1989). Suppression in
Drosophila: Su(Hw) and su(f) gene products interact
with a region of gypsy (mdg4) regulating its transcriptional
activity. EMBO J. 8,903
-911.
Mihaly. J., Hogga, I., Barges, S., Galloni, M., Mishra, R.K.,
Hagstrom, K., Muller, M., Schedl, P., Sipos, L., Gausz, J., Gyurkovics, H. and
Karch, F. (1998). Chromatin domain boundaries in the Bithorax
complex. Cell Mol. Life Sci.
54, 60-70.
Modolell, J. and Campuzano, S. (1998). The
achaete-scute complex as an integrating device. Int. J.
Dev. Biol. 42,275
-282.
Mongelard, F. and Corces, V. G. (2001). Two
insulators are not better than one. Nat. Struct. Biol.
8, 192-194.
Muravyova, E., Golovnin, A., Gracheva, E., Parshikov, P.,
Belenkaya, T., Pirrotta, V. and Georgiev, P. (2001). Loss of
insulator activity by paired Su(Hw) chromatin insulators.
Science 291,495
-497.
Qian, S., Varjavand, B. and Pirrotta, V.
(1992). Molecular analysis of the zeste-white interaction reveals
a promoter-proximal element essential for distant enhancer-promoter
communication. Genetics
131, 79-90.
Roseman, R. R., Pirrotta, V. and Geyer, P. K.
(1993). The su(Hw) protein insulates expression of the
Drosophila melanogaster white gene from chromosomal
position-effects. EMBO J.
12,435
-442.
Roseman, R. R., Johnson, E. A., Rodesch, C. K., Bjerke, M.,
Nagoshi, R. N. and Geyer, P. (1995). A P element
containing suppressor of Hairy-wing binding region has novel
properties for mutagenesis in Drosophila melanogaster.Genetics 141,1061
-1074.
Rubin, G. M. and Spradling, A. C. (1982).
Genetic transformation of Drosophila with transposable element
vectors. Science 218,348
-353.
Ruiz-Gomez, M. and Modolell, J. (1987).
Deletion analysis of the achaete-scute locus of Drosophila
melanogaster. Genes Dev. 1,1238
-1246.
Scott, K. S. and Geyer, P. K. (1995). Effects
of the su(Hw) insulator protein on the expression of the divergently
transcribed Drosophila yolk protein genes. EMBO
J. 14,6258
-6279.
Scott, K. S., Taubman, A. D. and Geyer, P. K.
(1999). Enhancer blocking by the Drosophila gypsy
insulator depends upon insulator anatomy and enhancer strength.
Genetics 153,787
-798.
Siegal, M. L. and Hartl, D. L. (2000).
Application of Cre/loxP in Drosophila. Site-specific recombination and
transgene coplacement. Methods Mol. Biol.
136,487
-495.
Sigrist, C. J. A. and Pirrotta, V. (1997).
Chromatin insulator elements block the silencing of a target gene by the
Drosophila Polycomb Response Element (PRE) but allow trans
interactions between PREs on different chromosomes.Genetics 147,209
-221.
Smith, P. A. and Corces, V. G. (1992). The
suppressor of Hairy-wing binding region is required for gypsy mutagenesis.
Mol Gen Genet. 233,65
-70.
Spana, C., Harrison, D. A. and Corces, V. G.
(1988). The Drosophila melanogaster supressor of
Hairy-wing protein binds to specific sequences of the gypsy
retrotransposon. Genes Dev.
2,1414
-1423.
Spana, C. and Corces, V. G. (1990). DNA bending
is a determinant of binding specificity for a Drosophila zinc finger
protein. Genes Dev. 4,1505
-1515.
Spradling, A. C. and Rubin, G. M. (1982).
Transposition of cloned P elements into germline chromosomes.Science 218,341
-347.
Udvardy, A. (1999). Dividing the empire:
boundary chromatin elements delimit the territory of enhancers.
EMBO J. 18,1
-8.
West, A. G., Gaszner, M. and Felsenfeld, G.
(2002). Insulators: many functions, many mechanisms.
Genes Dev. 16,271
-288.
Zhou, J., Barolo, S., Szymanski, P. and Levine, M.
(1996). The Fab-7 element of the bithorax complex
attenuates enhancer-promoter interactions in the Drosophila embryo.
Genes Dev. 10,3195
-3201.
Zhou, J., Ashe, H., Burks, C. and Levine, M.
(1999). Characterization of the transvection mediating region of
the Abdominal-B locus in Drosophila.Development 126,3057
-3065.
This article has been cited by other articles:
![]() |
D. Chetverina, E. Savitskaya, O. Maksimenko, L. Melnikova, O. Zaytseva, A. Parshikov, A. V. Galkin, and P. Georgiev Red flag on the white reporter: a versatile insulator abuts the white gene in Drosophila and is omnipresent in mini-white constructs Nucleic Acids Res., February 11, 2008; 36(3): 929 - 937. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Aoki, S. Schweinsberg, J. Manasson, and P. Schedl A Stage-Specific Factor Confers Fab-7 Boundary Activity during Early Embryogenesis in Drosophila Mol. Cell. Biol., February 1, 2008; 28(3): 1047 - 1060. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Gohl, M. Muller, V. Pirrotta, M. Affolter, and P. Schedl Enhancer Blocking and Transvection at the Drosophila apterous Locus Genetics, January 1, 2008; 178(1): 127 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Golovnin, A. Mazur, M. Kopantseva, M. Kurshakova, P. V. Gulak, B. Gilmore, W. G. F. Whitfield, P. Geyer, V. Pirrotta, and P. Georgiev Integrity of the Mod(mdg4)-67.2 BTB Domain Is Critical to Insulator Function in Drosophila melanogaster Mol. Cell. Biol., February 1, 2007; 27(3): 963 - 974. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Parnell, E. J. Kuhn, B. L. Gilmore, C. Helou, M. S. Wold, and P. K. Geyer Identification of Genomic Sites That Bind the Drosophila Suppressor of Hairy-wing Insulator Protein. Mol. Cell. Biol., August 1, 2006; 26(16): 5983 - 5993. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Pomerantseva, I. Biryukova, R. Silicheva, E. Savitskaya, A. Golovnin, and P. Georgiev Transposition of Regulatory Elements by P-Element-Mediated Rearrangements in Drosophila melanogaster Genetics, April 1, 2006; 172(4): 2283 - 2291. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ramos, D. Ghosh, E. Baxter, and V. G. Corces Genomic Organization of gypsy Chromatin Insulators in Drosophila melanogaster Genetics, April 1, 2006; 172(4): 2337 - 2349. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Savitskaya, L. Melnikova, M. Kostuchenko, E. Kravchenko, E. Pomerantseva, T. Boikova, D. Chetverina, A. Parshikov, P. Zobacheva, E. Gracheva, et al. Study of Long-Distance Functional Interactions between Su(Hw) Insulators That Can Regulate Enhancer-Promoter Communication in Drosophila melanogaster Mol. Cell. Biol., February 1, 2006; 26(3): 754 - 761. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kravchenko, E. Savitskaya, O. Kravchuk, A. Parshikov, P. Georgiev, and M. Savitsky Pairing between gypsy Insulators Facilitates the Enhancer Action in trans throughout the Drosophila Genome Mol. Cell. Biol., November 1, 2005; 25(21): 9283 - 9291. [Abstract] [Full Text] [PDF] |