spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

doi: 10.1242/10.1242/dev.00543


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Golovnin, A.
Right arrow Articles by Georgiev, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Golovnin, A.
Right arrow Articles by Georgiev, P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 130, 3249-3258 (2003)
Copyright © 2003 The Company of Biologists Limited

An endogenous Su(Hw) insulator separates the yellow gene from the Achaete-scute gene complex in Drosophila

Anton Golovnin1,2,3,{dagger}, Inna Biryukova1,*,{dagger}, Olga Romanova1,{dagger}, Margarita Silicheva1, Akeksander Parshikov1, Ekaterina Savitskaya1,2, Vincenzo Pirrotta3 and Pavel Georgiev1,{ddagger}

1 Department of the Control of Genetic Processes, Institute of Gene Biology, Russian Academy of Sciences, Moscow 117334, Russia
2 Center for Medical Studies, University of Oslo at the Institute of Gene Biology, Russian Academy of Sciences, Moscow 117334, Russia
3 Department of Zoology, University of Geneva, CH1211 Geneva, Switzerland
* Present address: Institute de Genetique et de Biologie Moleculaire et Cellulaire, CNRS/INSERM/ULP, 67404 IIIkirch Cedex, France
{dagger} These authors contributed equally to the work

{ddagger} Author for correspondence (e-mail: georgiev_p{at}mail.ru)

Accepted 27 March 2003


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The best characterized chromatin insulator in Drosophila is the Suppressor of Hairy wing binding region contained within the gypsy retrotransposon. Although cellular functions have been suggested, no role has been found yet for the multitude of endogenous Suppressor of Hairy wing binding sites. Here we show that two Suppressor of Hairy wing binding sites in the intergenic region between the yellow gene and the Achaete-scute gene complex form a functional insulator. Genetic analysis shows that at least two proteins, Suppressor of Hairy wing and Modifier of MDG4, required for the activity of this insulator, are involved in the transcriptional regulation of Achaete-scute.

Key words: Drosophila melanogaste, Achaete-scute Complex, Insulator, Su(Hw), Mod(mdg4), Enhancer blocking


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Enhancer-mediated activation is a fundamental mechanism of gene regulation in eukaryotes. Enhancers can act over large distances to activate transcription, independent of their orientation and position relative to the promoter and without affecting adjacent genes. Recently, sequences referred to as insulators have been found in different organisms that prevent activation or repression from extending across them to a promoter (Geyer, 1997Go; Dorsett, 1999Go; Udvardy, 1999Go; Gerasimova and Corces, 2001Go; Bell et al., 2001Go; West et al., 2002Go). The gypsy insulator of Drosophila was first identified within the gypsy retrotransposon (Spana et al., 1988Go; Mazo et al., 1989Go). It consists of 340 bp containing 12 binding sites for the Su(Hw) protein. Insertion of this sequence between an enhancer and a promoter inhibits the activity of the enhancer (Holdridge and Dorsett, 1991Go; Geyer and Corces, 1992Go; Cai and Levine, 1995Go; Scott and Geyer, 1995Go). The gypsy insulator can also function as a barrier, blocking the silencing activity of Polycomb Response Element (PRE) (Sigrist and Pirrotta, 1997Go; Mallin et al., 1998Go) and partially protecting a transgene from silencing when inserted into heterochromatin (Roseman et al., 1993Go; Roseman et al., 1995Go).

Genetic and molecular approaches have led to the identification and characterization of two proteins that are required for activity of the gypsy insulator. One is Suppressor of Hairy wing [Su(Hw)], a twelve zinc finger protein encoded by the suppressor of Hairy wing [su(Hw)] gene, which binds to the repeated sequence motifs in the gypsy insulator (Dorsett, 1990Go; Spana and Corces, 1990Go). Of the protein domains comprising Su(Hw), 9 out of 12 zinc fingers and a domain of approximately 150 amino acids including the C-terminal leucine zipper, but not the N- and C-terminal acidic regions, are required for enhancer blocking (Harrison et al., 1993Go; Kim et al., 1996Go).

Mutations in another gene, modifier of mdg4, alter the phenotypes of gypsy-induced mutations, indicating that the product of this gene is also involved in the function of the gypsy insulator (Georgiev and Gerasimova, 1989Go; Gerasimova et al., 1995Go; Georgiev and Kozycina, 1996Go; Cai and Levine, 1997Go; Gdula and Corces, 1997Go; Cai and Shen, 2001Go). The mod(mdg4) gene, also known as E(var)3-93D, encodes a large set of individual protein isoforms with specific functions in regulating the chromatin structure of different genes (Gerasimova et al., 1995Go; Buchner et al., 2000Go). The available genetic data suggest that Mod(mdg4) is required for the enhancer-blocking activity (Georgiev and Kozycina, 1996Go; Gdula and Corces, 1997Go; Cai and Chen, 2001Go). Biochemical studies using purified Su(Hw) and Mod(mdg4) proteins indicate that one protein isoform of the mod(mdg4) gene, Mod(mdg4)-67.2, interacts with the enhancer-blocking domain of the Su(Hw) protein (Gause et al., 2001Go; Ghosh et al., 2001Go).

The Mod(mdg4)-67.2 protein is present in approximately 500 sites on polytene chromosomes (Gerasimova and Corces, 1998Go). About 200 of these sites also contain the Su(Hw) protein (Gerasimova and Corces, 1998Go; Gerasimova et al., 2000Go). These sites of co-localization do not contain copies of the gypsy retrotransposon and are presumed to be endogenous insulators. In spite of these promising observations, no endogenous Su(Hw) insulators have been identified. The viable mod(mdg4)u1 mutation effects only the isoform of mod(mdg4), Mod(mdg4)-67.2, that directly interacts with the Su(Hw) protein (Gerasimova et al., 1995Go; Buchner et al., 2000Go). In contrast to lethal loss of-function alleles of the mod(mdg4) gene, mod(mdg4)u1 flies are viable and have no visible phenotypic defects (Georgiev and Gerasimova, 1989Go) suggesting that the function of the Mod(mdg4)-67.2 protein can be compensated by other proteins.

Here we describe the identification of the first endogenous functional Su(Hw) insulator, located between the yellow gene and Achaete-scute gene complex (ASC). The yellow gene determines the proper pigmentation of cuticle structures, and its expression in different tissues is controlled by enhancers located in the 5' region and in the first intron of the gene (Geyer et al., 1986Go; Geyer and Corces, 1987Go; Martin et al., 1989Go). The achaete (ac), scute (sc) and l'sc genes, members of ASC, are located in the vicinity of the yellow gene and differ from yellow in their spatial and temporal patterns of expression (Campuzano et al., 1985Go). The proteins encoded by the ac and sc genes are essential for the formation of bristle sensory organs (macrochaetae) (Modolell and Campuzano, 1998Go). A very complex pattern of ac and sc expression is mediated by the action of site-specific, enhancer-like elements distributed over about 90 kb of the AS-C (Ruiz-Gomez and Modolell, 1987Go; Gomez-Skarmeta et al., 1995Go; Modolell and Campuzano, 1998Go). The new insulator we identified contains two Su(Hw) binding sites that are required for insulator function, blocking the yellow and white enhancers. Mutations in the su(Hw) and mod(mdg4) genes strongly affect expression of the AS-C genes in rearrangements that partially disrupt the proper organization of the AS-C regulatory region. Thus, Su(Hw) and Mod(mdg4) proteins participate in proper regulation of the AS-C.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Drosophila strains, transformation and genetic crosses
All flies were maintained at 25°C on a standard yeast medium. The lines bearing mutations in the su(Hw) gene were obtained from V. Corces. The structure and origin of the su(Hw) mutations is described by Harrison et al. (Harrison et al., 1993Go). Df(3R)GC14 is a deletion covering the region where the mod(mdg4) gene is located. All other mutant alleles and chromosomes used in this work and all balancer chromosomes are described by Lindsley and Zimm (Lindsley and Zimm, 1992Go).

The transposon constructs, together with a P element with defective inverted repeats used as a transposase source, P25.7wc (Karess and Rubin, 1984), were injected into y ac w1118 preblastoderm embryos as described previously (Rubin and Spradling, 1982Go; Spradling and Rubin, 1982Go). The resulting flies were crossed with y ac w1118 flies, and transgenic progeny were identified by their eye color. Chromosome localization of various transgene insertions was determined by crossing the transformants with the y ac w1118 balancer stock containing dominant markers: In(2RL),CyO for chromosome two, In(3LR)TM3,Sb for chromosome three. The transformed lines were examined by Southern blot hybridization, to check for transposon integrity and copy number.

The su(Hw)v/su(Hw)f, su(Hw)v/su(Hw)2, mod(mdg4)u1/mod(mdg4)u1 and mod(mdg4)u1/Df(3R)GC14 mutations were combined with sc mutations or transposons as previously described (Georgiev and Kozycina, 1996Go). The lines with a tested DNA fragment, or eye enhancer or Su(Hw) excisions were obtained by crossing flies bearing the transposons with Flp or Cre recombinase-expressing lines. All excisions were confirmed by PCR analysis.

In order to determine the yellow and white phenotypes, the extent of pigmentation in the abdominal cuticle, as well as eye pigmentation of adult flies was estimated visually in 3- to 5-day-old males developing at 25°C. Wild-type expression in abdominal cuticle and wings was assigned an arbitrary score of 5, while the absence of y expression was ranked 1. Flies with the previously characterized y allele were used as a reference in order to determine y pigmentation levels. Wild-type w expression results in bright red eye color (R), while the absence of w expression results in white eyes (W). Intermediate levels of pigmentation are defined by eye color ranging through pale yellow (p-Y), yellow (Y), dark yellow (d-Y), orange (Or), dark orange (d-Or), brown (Br), brown-red (Br-R), reflecting, respectively, low, intermediate, and high levels of the white expression. The scores were determined independently by two people and based upon at least 30 flies from two independent crosses.

Transgenic constructs and in vitro mutagenesis
The 8 kb fragment containing the yellow gene and the cDNA yellow clone were kindly provided by P. Geyer. The 3 kb SalI-BamHI fragment containing the yellow regulatory region (yr) was subcloned into BamHI + XhoI-digested pGEM7 (yr plasmid). The 5 kb BamHI-BglII fragment containing the coding region (yc) was subcloned into CaSpeR3 (C3-yc).

The 430 bp gypsy sequence containing the Su(Hw) binding region was PCR-amplified from the gypsy retrotransposon. After sequencing to confirm its identity, the product was inserted between two loxP sites (lox(su)) and in CaSpeR3 (C3-su). The lox(su) fragment was blunt-ligated to the CaSpeR2 vector restricted with BglII (C2-lox(su)).

The yellow regulatory region includes the body enhancer, located between -1266 bp and -1963 bp, and wing enhancer, located between -1863 bp and -2873 bp relative the transcription start site of the yellow gene (Geyer and Corces, 1987Go). The white regulatory sequences from position -1084 to -1465 bp relative to the transcription start site (Ee) were cloned between two frt sites (frt(Ee)). These sequences contain testes and eye enhancers (Qian et al., 1992Go). After that the frt(Ee) fragment was inserted at position -1868 from the yellow transcription start site (yr-frt(Ee)).

The 125 bp sequence containing the Su(Hw) binding region was PCR amplified with pr-1 (5' tcctaatttccttac 3') and pr-2 (5' attcttttaccatgc 3') primers from the {lambda}sc133 phage (donated by J. Modolell). After sequencing to confirm its identity, the product, one copy (125 bp) or three copies (3x125 bp) of the 125 bp fragment were inserted between two lox sites [lox(125 bp) and lox(3x125 bp)]. The 2 kb DNA fragment was cloned from the {lambda}sc133 phage DNA restricted with PstI between two lox sites (lox(2 kb)). The 454 bp fragment was PCR-amplified with pr-5 (5' ggagtactactaccaggc 3') and pr-6 (5' caagaacatttccgatatg 3') primers from the {lambda}sc133 phage and inserted between lox sites (lox(454 bp)). To mutate both Su(Hw) binding sites in the 454 bp fragment (454*) oligonucleotides carrying the desired mutated sequences, pr-7 (5' attggccagtatatattatgtgtttaatac 3') and pr-8 (5' agaagtccctcgcaaaaaagtattaaatac 3') were used to amplify PCR products. Two PCR-amplified DNA fragments with pr-5 and pr-8 primers or pr-6 and pr-7 primers were blunt ligated. The resulting 454* bp DNA fragment was sequenced to verify that the intended mutant sequences had been introduced and other PCR-induced mutations did not exist.

Ey(e)(2 kb)YSW and Ey(e)(3x125 bp)YSW

The lox(2 kb) or lox(3x125 bp) fragment was inserted in the yr-frt(Ee) restricted with Eco47III at -893 from the yellow transcription start site [yr-frt(Ee)-lox(2 kb) and yr-frt(Ee)-lox(3x125 bp)]. The yr-frt(Ee)-lox(2 kb) or yr-frt(Ee)-lox(3x125 bp) fragment was ligated into C3-su restricted with XbaI and BamHI.

Ey(e)125 bpY(S)W and Ey(e)454 bpY(S)W

The 125 bp or 454 bp fragment was inserted in the yr-frt(Ee) restricted with Eco47III (yr-frt(Ee)-125 bp and yr-frt(Ee)-454 bp). The yr-frt(Ee)-125 bp and yr-frt(Ee)-454 bp fragments were ligated into C2-lox(su) restricted with XbaI and BamHI.

Ey454* bpYW

The 454* bp fragment was inserted in the yr restricted with Eco47III (yr-454* bp). The yr-454* bp fragment was ligated into C3-yc restricted with XbaI and BamHI.

To alter consensus sequences for the number 1 (#1) Su(Hw) binding site, oligonucleotides carrying the desired mutated sequences (available upon request) were used to amplify PCR products. Both mutant Su(Hw)#1 binding sites were sequenced to verify that the intended mutant sequences had been introduced and other PCR-induced mutations did not exist.

Electrophoretic mobility shift assays
For the purpose of synthesizing Su(Hw) in vitro, the Su(Hw) ORF encoding a 945 amino acid polypeptide was subcloned from the Su(Hw) cDNA (kindly provided by D. Dorsett). Su(Hw) protein was synthesized in vitro in the TNT coupled transcription/translation reticulocyte lysate (Promega) from a T7 promoter-Su(Hw) cDNA template cloned in the pET 30a plasmid (Novagen). In the binding assay, 25 fmole of a radioactively labeled DNA fragment was mixed with 10 µl of the in vitro translation reaction in 25 µl of 15 mM Hepes (pH 7.6), 100 mM KCl, 5 mM MgCl2, 0.1 mM ZnCl2, 5mM DTT, 10% glycerol and 5 µg of poly[d(I-C)]. After incubation at 4°C for 10 minutes, the reactions were loaded on 1.5% agarose gel and the complexes fractionated in 1x TBE buffer (89 mM Tris-borate, 89 mM borate and 3 mM EDTA) at 5 V/cm.

PCR was done by standard techniques. The primers used in DNA amplification were derived from the yellow and AS-C sequences:

Pr-1 5' TCCTAATTTCCTTAC 3'
Pr-2 5' ATTCTTTTACCATGC 3'
Pr-3 5' GAGGGACTTCTATTG 3'
Pr-4 5' CACATAATATATACTGGC 3'
Su(Hw)#1* 5' CTTGTATTGCATACTTTTTTGCG 3'
Su(Hw)#1** 5' CTTGTATTTAATACTTTTTTGCG 3'

The products of amplification were fractionated by electrophoresis in 1.5% agarose gels in TAE. The successfully amplified products were cloned into a Bluescript plasmid (Stratagene, La Jolla, CA) and sequenced using the Amersham sequence kit (Amersham, Arlington Heights, IL).


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The yellow-ac intergenic region, inserted in the AS-C regulatory region affects sc activation
We have previously described the P-element-mediated insertion of fragments of the yellow gene into the regulatory region of ASC (Golovnin et al., 1999Go). Starting from y2ssc+s flies, which have wild-type sc expression, mutants were recovered in which yellow sequences, including the yellow promoter, were inserted between two adjacent P elements (P3 and P4 in Fig. 1A) at the AS-C regulatory region, resulting in the y2sscls mutants in which sc expression is slightly affected which results in the loss of humeral bristles. Additional derivatives, scms1 and scms2, were isolated with much stronger sc phenotypes in which many bristles regulated by sc are affected (Fig. 1B). Southern blot analysis and sequencing of DNA fragments amplified by PCR showed that in these derivatives all coding sequences and 3' flanking region of the yellow gene were duplicated between the P3 and P4 elements in AS-C (Fig. 1A).


Figure 1
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 1. The nature and properties of original mutations in AS-C. (A) Schematic presentation of the yellow/ac/sc region. Small arrowheads show insertions of the P elements associated with certain mutations. Thick horizontal arrows show the direction of transcription of the yellow, ac and sc genes. The arrows in boxes indicate the orientation of the P elements. The structure of the scls1, scls2 and scls3 alleles was described previously (Golovnin et al., 1999Go). (B) Phenotypes of the indicated sc bristle mutations in males. The standard nomenclature for each bristle is indicated as follows (Lindsley and Zimm, 1992Go): HU, humeral; AOR, anterior orbital; PS, presutural; ASA, anterior supra-alar; OC, ocellar; PV, postvertical; ANP, anterior notopleural; SC, scutellar. Only the bristles affected in sc mutations are shown. Empty boxes indicate that the corresponding bristles are present (wild-type phenotype). In all but the scutellar, one quarter black, half black and fully black boxes mean that the corresponding bristle(s) was (were) absent in over 10%, 50% or 90% of the flies, respectively. For scutellars, quarter black, half black and fully black boxes mean that 3-4, 2-3 or 0-1 scutellar bristles, respectively, were present. Number of bristles is the mean of about 100 scored flies. The phenotypes of scls1, scls2 and scls3 flies were taken from Golovnin et al. (Golovnin et al., 1999Go). The su(Hw)v/su(Hw)f and su(Hw)v/su(Hw)2 transheterozygous lines had similar effect on the scms1 and scms2 mutations.

 
The striking difference in phenotypes suggested that the yellow 3' region, when inserted in the AS-C regulatory region, inhibited the expression of the sc function. Since this region contains two consensus binding sequences for the Su(Hw) protein (Fig. 2A), we examined the effect of su(Hw)- and mod(mdg4)u1 mutations on the scms phenotype (Fig. 1B). The suppression of the mutant sc phenotype in scms; su(Hw)v/su(Hw)f or scms; su(Hw)v/su(Hw)2 flies supports the idea that the Su(Hw) protein plays a role in the repression of the sc gene (Fig. 1B). The homozygous mod(mdg4)u1 mutation had a similar suppressive effect on the sc phenotype (Fig. 1B), implying that Su(Hw) and Mod(mdg4) are required for repression of the sc activation in two scms derivatives.


Figure 2
View larger version (40K):
[in this window]
[in a new window]

 
Fig. 2. Binding of in vitro synthesized Su(Hw) to two putative Su(Hw) binding sites in the 125 bp DNA fragment. (A) The sequence of the 125 bp DNA fragment is shown. Putative Su(Hw) binding sites are boxed. The primers used to obtain the DNA fragments are shown as arrows. The mutated residues are indicated below the sequence. The consensus for the Su(Hw) binding site was taken from Scott and Geyer (Scott and Geyer, 1999). (B) Electrophoretic mobility shift assays. The radioactively labeled gypsy, 125 bp fragment, Su(Hw)#1, Su(Hw)#2, Su(Hw)#1*, Su(Hw)#1**, 454 bp and 454* bp fragments were used as probes, incubated with in vitro-synthesized Su(Hw) protein and run on a 1.5% agarose gel (Materials and Methods). One shifted band (indicated by arrows) presumably corresponds to a protein-DNA complex formed by Su(Hw) with only one Su(Hw) binding site. The binding of Su(Hw) to the 125 bp DNA fragment was examined in the presence of competitors. The binding is competed by excess unlabeled Su(Hw)#1* fragment but not by the Su(Hw)#1** fragment with the mutated Su(Hw) binding site.

 
The yellow-ac intergenic region contains a functional Su(Hw) insulator
To determine if the effect of Su(Hw) can be attributed to the presumed Su(Hw) binding sites between the yellow and ac genes, we cloned the 125 bp fragment that contains both Su(Hw) consensus sequences (Fig. 2A) and tested its ability to bind Su(Hw) protein in vitro. As a control we used the gypsy insulator that contains 12 putative binding sites for Su(Hw). These DNA fragments were tested in electrophoretic mobility shift assays (EMSAs) using in vitro-synthesized Su(Hw) protein (see Materials and methods). One shifted band (arrow in Fig. 2B) probably corresponds to a complex of the 125 bp DNA fragment with one Su(Hw) protein. The inability of the Su(Hw) protein to simultaneously bind two closely spaced sites was previously described by Kim et al. (Kim et al., 1996Go) who suggested that the Su(Hw) protein interferes with binding to neighboring sites. To show that both putative binding sites in the 125 bp fragment can interact with Su(Hw), we subcloned smaller fragments that contain only the first or the second Su(Hw) binding site (Fig. 2A) and found that both can be band-shifted by Su(Hw) protein (Fig. 2B) Site #1 contains a C instead of A in the core consensus but this base substitution did not significantly influence the efficiency of Su(Hw) binding (Fig. 2B).

To examine the potential enhancer blocking activity of the new Su(Hw) binding sites, we used the yellow gene, required for dark pigmentation of Drosophila larval and adult cuticle and its derivatives. Two upstream enhancers, En-b and En-w, activate yellow expression in the body cuticle and wing blades, respectively (Geyer and Corces, 1997). The gypsy insulator is able to effectively block the wing and body enhancers (Geyer et al., 1986Go; Geyer and Corces, 1992Go; Muravyova et al., 2001Go). To test the insulator activity of the intergenic Su(Hw) sites we made constructs that exploit two properties of the gypsy insulator. One is the blocking activity when interposed between enhancer and promoter; the other is the ability of two gypsy insulators to neutralize one another (Gause et al., 1998Go; Cai and Shen, 2001Go; Muravyova et al., 2001Go). The constructs depicted in Fig. 3A contain a gypsy Su(Hw) insulator inserted between the yellow and white gene and the eye enhancer of the white gene inserted between the wing and body enhancers of yellow. It has been shown that interposition of the Su(Hw) insulator between the eye enhancer and the white promoter completely blocked enhancer activity (Roseman et al., 1993Go; Muravyova et al., 2001Go).


Figure 3
View larger version (35K):
[in this window]
[in a new window]

 
Fig. 3. Study of transgenic lines to test the enhancer-blocking activity. (A) Transposon constructs. The maps of the constructs (not to scale) show the yellow wing (En-w) and body enhancers (En-b) as partially overlapping white boxes and the eye enhancer (Eye) as a white oval. Downward pointing arrows labeled FRT or Lox mark the target sites of the Flp or Cre recombinase, respectively. The 125 bp, 454 bp, 454* bp, 125 bpx3 and 2 kb DNA fragments were inserted at -893 bp relative to the yellow transcription start site. The Su(Hw) insulator was inserted between yellow and white. The yellow and white genes are shown with arrows indicating the direction of transcription. (B) Analysis of yellow and white expression in males from transgenic lines heterozygous for the construct. Small symbols in the boxes indicate the number of independent transgenic lines displaying similar abdominal (black square) or eye (black circle) pigmentation. To determine the y and w phenotypes, the extent of pigmentation in the abdominal cuticle (reflecting the activity of the En-b enhancer) as well as the eye pigmentation of adult flies were estimated visually in 3- to 5-day-old males developing at 25°C (see Materials and Methods). Expression levels were determined without excision of functional elements in the wild type and after excision of the Su(Hw) insulator ({Delta}Su), of the eye enhancer ({Delta}E), or the tested DNA fragment ({Delta}Fr). Abbreviation: su(Hw)-, su(Hw)v/su(Hw)f.

 
The eye enhancer was flanked by Flp recognition target sites (FRTs) in order to excise it from transgenic flies by crossing with flies expressing the Flp recombinase (Golic and Lindquist, 1989Go). The DNA fragments to be tested were inserted between the yellow enhancers and promoter, at position -893 relative to the yellow transcription start site (Fig. 3A).

When the gypsy insulator is inserted at position -893, the yellow enhancer action is completely blocked, resulting in yellow instead of dark pigmentation of body and wing, whereas the eye enhancer was fully active because of neutralization of the enhancer-blocking activity (Muravyova et al., 2001Go).

To test the intergenic Su(Hw) sites we first made Ey(e)(2kb)YSW, in which the 2 kb DNA fragment containing the 3' part of the yellow coding region and the 5' part of the ac regulatory region (Fig. 3A, Fig. 4A) is inserted at the -893 position. The 2 kb DNA fragment was flanked by Cre recognition (Lox) sites to permit its excision from transgenic flies (Siegal and Hartl, 2000Go). In all 9 transgenic Ey(e)(2kb)YSW lines, wing and body pigmentation was yellow suggesting that the 2 kb DNA fragment is able to completely block the yellow enhancers (Fig. 3B, lanes 1, 4). The deletion of the 2 kb DNA fragment in the Ey(e)({Delta}2kb)YSW derivatives restored wild-type cuticle pigmentation. When three of the less pigmented lines were tested in the su(Hw)- background, wild-type pigmentation was restored (Fig. 3B, lane 7). Thus, the Su(Hw) protein is required to block the yellow enhancers.


Figure 4
View larger version (27K):
[in this window]
[in a new window]

 
Fig. 4. Role of Su(Hw) and Mod(mdg4) in the regulation of ASC. (A) Schematic presentation of the yellow/ac/sc region in the previously described y, ac and sc mutants (Campuzano et al., 1985Go). The coordinates of the ASC region are as defined in Campuzano et al. Vertical arrows indicate the positions of chromosomal breakpoints associated with the y3P, scv2 and sc8 mutations. The localization of the sc2 and sc5 deletions is indicated by an elongated open box (Campuzano et al., 1985Go). Arrows with a triangle show insertions of P elements associated with duplication of the yellow sequences. Relative orientations of P elements are indicated by arrows in boxes. Thick horizontal white arrows show the positions and direction of yellow and ASC genes transcripts. The gray oval indicates the putative Su(Hw) binding sites in the 125 bp DNA fragment. (B) The effect of the su(Hw) (su(Hw)v/su(Hw)f and su(Hw)v/su(Hw)2) and mod(mdg4) (mod(mdg4)u1/mod(mdg4)u1 and mod(mdg4)u1/Df(3R)GC14) mutations on the phenotype of the mutations in ASC. The su(Hw)v/su(Hw)f and su(Hw)v/su(Hw)2 transheterozygous lines had similar effects on the mutations in ASC. Phenotypes of the indicated sc mutations were examined in males. The standard nomenclature for bristles whose formation is regulated by ac are as follows (Lindsley and Zimm, 1992Go): ADC, anterior dorsocentral; PDC, posterior dorsocentral; PSA, posterior supraalar; AVT, anterior vertical; MC, the rows of microchaetae on the notum. Other designations as in Fig. 1. Only affected bristles in ac and sc mutations are shown. Bristle pigmentation: w-v, weak variegation indicates that 1-3 bristles in thorax and head are yellow; m-v, mild variegation shows that about half of bristles are yellow; +, wild-type pigmentation of all bristles. Viability: +, about normal viability; -, lethal. The figures indicate viability for combination of mod(mdg4)u1/mod(mdg4)u1 with sc2, i.e. ratio of sc2 males to yw males obtained in the progeny of heterozygous yw/sc2; mod(mdg4)u1/mod(mdg4)u1 females. The total number of sc2 and yw males scored is shown in brackets.

 
At the same time, white expression was stronger in Ey(e)(2kb)YSW transgenic lines than in Ey(e)({Delta}2kb)YSW derivatives bearing only the gypsy insulator (Fig. 3B, lanes 2-3, 5-6). The role of the eye enhancer in activation of the white promoter was supported by deleting the eye enhancer from the Ey(e)(2kb)YSW lines, which strongly diminished eye pigmentation. Thus, the 2 kb fragment can neutralize the enhancer-blocking activity of the gypsy insulator.

We next tested the minimal 125 bp fragment from the intergenic region by inserting it at position -893 to give the Ey(e)125bpY(S)W construct (Fig. 3A). In this construct the gypsy insulator between the yellow and white genes was flanked by lox sites. In 10 Ey(e)125bpY(S)W lines, wing and body pigmentation was between yellow and wild type (Fig. 3B, lane 15), indicating that the yellow enhancers were only partially blocked in comparison with the transgenic lines with the 2 kb fragment (Fig. 3B, lane 1). Five Ey(e)125bpY(S)W lines tested in the su(Hw)- background showed restored wild-type level of pigmentation, confirming that the binding of the Su(Hw) protein to the 125 bp fragment is required to block the yellow enhancers (Fig. 3B, lane 21). The deletion of the eye enhancer diminished eye pigmentation in 8 out of 10 Ey(e)125bpY(S)W transgenic lines, implying that the minimal 125 bp fragment is able to neutralize the gypsy insulator (Fig. 3B, lanes 16, 17). The deletion of the gypsy insulator ({Delta}S) in most Ey(e)125bpY({Delta}S)W derivatives reduced eye pigmentation and made them insensitive to the additional deletion of the eye enhancer (Fig. 3B, 19, 20). These results suggest that the 125 bp fragment by itself can block the interaction between the eye enhancer and the white promoter.

The 2 kb DNA fragment has stronger enhancer-blocking activity than the 125 bp fragment. To exclude a role of the yellow coding and the ac regulatory regions in the insulation activity, we tested a 454 bp DNA subfragment that contains the 125 bp fragment and surrounding sequences (Fig. 3A). In all 9 transgenic Ey(e)454bpY(S)W lines, wing and body pigmentation was yellow suggesting that the 454 bp DNA fragment blocks the yellow enhancer as well as the 2 kb DNA fragment (Fig. 3B, lane 23). Like the 125 bp fragment, the 454 bp fragment also blocks the eye enhancer and efficiently neutralizes the activity of the gypsy insulator (Fig. 3B, lanes 24-26).

The strong blocking of the yellow enhancer by the 454 bp fragment, compared with 125 bp fragment, may be explained either by existence of additional Su(Hw) binding sites in the 454 bp fragment or by the possible involvement of one or more other proteins binding to neighboring sequences. To test these possibilities, we mutated both Su(Hw) binding sites in the 454 bp fragment (454*). The 454 bp and 454* bp DNA fragments were tested in electrophoretic mobility shift assays (EMSAs) using in vitro-synthesized Su(Hw) protein (Fig. 2B). The binding of Su(Hw) to the 454 bp fragment but not to 454* argues against additional Su(Hw) binding sites in the 454 bp fragment. To examine the ability of 454* to block the yellow enhancer, we inserted the 454* bp fragment at position -893 to give the Ey454*bpYW construct. In all 7 transgenic Ey454*bpYW lines, flies had nearly wild-type levels of wing and body pigmentation suggesting that the 454* bp fragment has lost the insulator activity (Fig. 3B, lane 27). Thus, these results confirm that the Su(Hw) protein is required but not sufficient for the blocking activity of the 454 bp fragment.

The multiplication of binding sites for the Su(Hw) protein has been shown to increase insulator activity (Scott et al., 1999Go). To test this rule, we inserted three copies of the 125 bp fragment between lox sites at -893 in the yellow regulatory region (Fig. 3A). All seven transgenic Ey(e)(125bpx3)YSW lines obtained had yellow wing and body cuticle indicating strong blocking of the wing and body enhancers (Fig. 3B, lane 9). At the same time, these lines had high levels of eye pigmentation that were strongly reduced after deletion of the eye enhancer (Fig. 3B, lanes 10, 11), indicating mutual neutralization of the triplicated 125 bp fragment and the gypsy insulator.

These results suggest that the intergenic region contains binding sites for other protein(s) in addition to Su(Hw) that is (are) required for efficient blocking of the yellow enhancers.

The su(Hw) and mod(mdg4) mutations influence expression of ASC alleles
Mutations in the su(Hw) and mod(mdg4) genes have no visible effect on the ac or sc phenotype. To determine the potential role of these genes in the regulation of AS-C, we examined the influence of the su(Hw) and mod(mdg4) mutations on the mutant phenotype of the AS-C alleles.

First, we examined several inversions with breakpoints in the regulatory region of the yellow and AS-C and the centric heterochromatin.

The breakpoint in the In(1)y3P mutation is located in the regulatory region of the yellow gene (Fig. 4A) (Campuzano et al., 1985Go). The centric heterochromatin in the In(1)y3P mutation does not influence yellow expression in bristles or expression of the ASC genes, but the loss of the upstream body and wing enhancers causes a yellow wing and body phenotype. The su(Hw)v/su(Hw)f and su(Hw)v/su(Hw)2 transheterozygotes strongly affected ac and sc gene expression, but did not influence yellow expression: bristles remained entirely pigmented (Fig. 4B). The homozygous mod(mdg4)u1 mutation and mod(mdg4)u1/Df(3R)GC14 transheterozygotes produced a similar effect on the ac and sc phenotype, although slightly milder than that produced by su(Hw)-. These results suggest an involvement of Su(Hw) and Mod(mdg4) proteins in protecting the AS-C genes from heterochromatic silencing.

Similar results were obtained with two other inversions tested. The In(1)scV2 and In(1)sc8 inversions have breakpoints between ac and sc (Fig. 4A). The breakpoint in In(1)scV2 is located very close to the 3' end of the ac coding region. Despite the close proximity to centric heterochromatin, both mutations cause only a weak mutant phenotype (Fig. 4B). However, in su(Hw)v/su(Hw)f (su(Hw)v/su(Hw)2) or mod(mdg4)u1/mod(mdg4)u1 (mod(mdg4)u1/Df(3R)GC14) backgrounds these inversions caused strongly enhanced ac- and sc- phenotypes. In the case of In(1)scV2, in particular, the mod(mdg4) and su(Hw) mutations induced strong variegation of bristle pigmentation (Fig. 4B) suggesting that the Su(Hw)-Mod(mdg4) complex blocks the spread of heterochromatin in the yellow region.

The sc2 and sc5 mutations are associated with deletions. The 1.3 kb deletion in the sc5 mutation (Fig. 4A) partially suppresses the formation of scutellar bristles suggesting that the sc enhancer is affected (Campuzano et al., 1985Go). The su(Hw) mutations weakly suppressed ASA, AOR, OC and PV bristle formation (Fig. 4B). sc2, also called ase1, is an intercalary 17-18 kb deletion that removes the regulatory sequences for the SC bristles and also the coding sequence of the ase gene (Gonzalez et al., 1989Go). The sc2 mutation has a weak sc phenotype associated with partial suppression of SC bristle formation (Fig. 4B). Unexpectedly the combination of sc2 with su(Hw)v/su(Hw)f or with su(Hw)v/su(Hw)2 was lethal. The homozygous mod(mdg4)u1 mutation or transheterozygous mod(mdg4)u1/Df(3R)GC14 also strongly decreased the survival of sc2 mutants and completely blocked the formation of SC bristles. Even sc2; mod(mdg4)u1/+ flies had a very low viability if they were obtained from homozygous mod(mdg4)u1 females, suggesting that maternally supplied Mod(mdg4) is required for sc2 survival. The proneural gene l'sc is expressed only in early embryos and its inactivation results in embryonic lethality (Campuzano et al., 1985Go; Carmena et al., 1995Go), suggesting that loss of Mod(mdg4) or Su(Hw) causes repression of l'sc in the sc2 mutant. We hypothesize that an additional Su(Hw) insulator might normally protect the l'sc gene and might become essential when enhancer elements in the sc2 region are deleted.


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To explain how the long-range activation potential of eukaryotic enhancers could be restricted to the relevant target promoter, it was proposed that eukaryotic chromatin is organized into functionally independent domains that prevent illegitimate enhancer-promoter communication (West et al., 2002Go). Recent publications (Gerasimova and Corces, 1998Go; Gerasimova et al., 2000Go; Gerasimova and Corces, 2001Go; Labrador and Corces, 2002Go) suggest a model in which distant chromosomal binding sites of Su(Hw) are brought together by Mod(mdg4) into a small number of insulator bodies located at the nuclear periphery. It was suggested that in this way Su(Hw) marks the base of topologically independent looped chromatin domains. However, despite the presence of many endogenous Su(Hw) binding sites in polytene chromosomes, no specific function has been attributed to any site in a particular gene.

Using in vivo and in vitro assays, we have shown that there exists a functional Su(Hw) insulator between the yellow gene and AS-C. Previously it was found that at least four Su(Hw) binding sites are required for effective enhancer blocking (Scott et al., 1999Go). Here we found that the 125 bp fragment including only two Su(Hw) binding sites can partially block the strong yellow enhancer, while the larger 454 bp fragment including the same Su(Hw) sites completely blocks yellow enhancers. Thus, additional proteins binding to neighboring sequences are required for strong insulator action of the element between yellow and AS-C. The sequencing of the Drosophila genome shows the absence of large clusters of endogenous Su(Hw) binding sites, such as are found in the gypsy retrotransposon. It seems possible that in endogenous insulators, Su(Hw) cooperates with additional DNA-binding proteins to produce insulator activity. This assumption may also explain the absence of lethal phenotypes in the su(Hw)- background since other proteins would partly compensate for the loss of Su(Hw) function.

Our results further confirm the initial observation of the interaction between two gypsy insulators (Gause et al., 1998Go; Cai and Shen, 2001Go; Muravyova et al., 2001Go). The two Su(Hw) binding sites in the 125 bp fragment and the gypsy insulator mutually neutralize each other's enhancer-blocking activity. Thus, the difference in the number of Su(Hw) binding sites between interacting insulators is not critical for the effective neutralization of the enhancer blocking activity.

As has been observed previously (Scott et al., 1999Go; Smith and Corces, 1992Go; Hagstrom et al., 1996Go; Hoover et al., 1992Go), increasing the number of Su(Hw) binding sites increases insulator strength, and three copies of the 125 bp insulator block better than a single copy. How can this be reconciled with the observation that two Su(Hw) insulators neutralize one another? We suppose that, as proposed earlier (Cai and Shen, 2001Go; Muravyova et al., 2001Go), the neutralization requires the pairing between two insulators. Interaction between neighboring insulators would pre-empt their interaction with larger assemblies of Su(Hw) binding sites that have been proposed to associate together at the nuclear periphery through the Mod(mdg4) protein (Mongelard and Corces, 2001Go; West et al., 2002Go; Labrador and Corces, 2002Go). Thus, for neutralization, we suppose that the Su(Hw) binding sites must adopt a paired configuration, therefore requiring a sufficient distance between them for DNA to form a loop. In contrast, putting more Su(Hw) binding sites very close together merely ensures that enough Su(Hw) protein will be bound at any one time to produce insulator action.

The role of the Su(Hw) and Mod(mdg4) proteins in the expression of ASC genes becomes obvious when the normal architecture of the ASC regulatory region is altered by chromosome rearrangements. Many previously described inversions with breakpoints in the AS-C regulatory region and centric heterochromatin (Campuzano et al., 1985Go) have weak mutant phenotypes, suggesting the presence of sequences that effectively impede the spread of heterochromatic silencing. The appearance of strong variegating repression of the ac and sc genes when the inversions are combined with loss of su(Hw) or mod(mdg4) function suggests that the Su(Hw) and Mod(mdg4) proteins are involved in the stability of the ac and sc expression.

In the In(1)y3p mutation, a heterochromatic breakpoint in the upstream regulatory region does not effect yellow expression suggesting that the yellow promoter is relatively resistant to heterochromatin proximity at this breakpoint. At the same time, ac and sc expression is strongly affected by su(Hw) or mod(mdg4) mutations, supporting the idea that Su(Hw) binding sites between yellow and ac block heterochromatin spreading.

The In(1)sc8 and In(1)scv2 inversions separate the ac and sc genes. The requirement of the Su(Hw) and Mod(mdg4) proteins for normal sc expression suggests the existence of additional Su(Hw) binding sites in the AS-C regulatory region. The strong genetic interaction between sc2 and mutations in mod(mdg4) or su(Hw) also supports the presence of additional Su(Hw) binding sites in ASC. The expression of ASC genes is regulated by a large number of enhancer-like elements (Ruiz-Gomez and Modolell, 1987Go; Gomez-Skarmeta et al., 1995Go; Modolell and Campuzano, 1998Go). It seems reasonable that these ASC enhancers should be separated by boundary elements as was found for the 3' cis-regulatory region of Abdominal B (Abd-B), which is subdivided into a series of iab domains (Mihaly et al., 1998Go). Boundary elements like MCP, Fab-7 and Fab-8 separate the iab domains and protect each against positive and negative chromatin modifications induced by neighboring iab domains (Barges et al., 2000Go; Hagstrom et al., 1996Go; Mihaly et al., 1998Go; Zhou et al., 1996Go; Zhou et al., 1999Go). Our genetic results might be explained by the assumption that the Su(Hw)-Mod(mdg4) protein complex participates in formation of boundary elements between certain AS-C enhancers. The absence of noticeable changes in the wild-type AS-C gene expression on the su(Hw) or mod(mdg4) mutant background might be the consequence of the functional redundancy of the Su(Hw)-Mod(mdg4) protein complex. We did not find clusters of potential endogenous Su(Hw) binding sites inside the AS-C sequence. Thus, it seems possible that Su(Hw)-Mod(mdg4) cooperates with other non-identified proteins in formation of the functional boundaries in the regulatory region of AS-C. The identification and characterization of new Su(Hw) binding sites may help in understanding the role of Su(Hw)/Mod(mdg4) in transcriptional regulation of AS-C genes and provide new insights into the mechanisms of the insulator action.


    ACKNOWLEDGMENTS
 
This work was supported by the Russian Foundation for Basic Research, by an International Research Scholar award from the Howard Hughes Medical Institute and by the Volkswagen-Stiftung Foundation Federal Republic of Germany to P.G., by a JRP grant from the Swiss National Science Foundation and by INTAS 99-01088 to V.P. and P.G. The work of A.G. and E.S. was also supported by a stipend from the Center for Medical Studies, University of Oslo.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Barges, S., Mihaly, J., Galloni, M., Hagstrom, K., Muller, M., Shanower, G., Schedl, P., Gyurkovics, H. and Karch, F. (2000). The Fab-8 boundary defines the distal limit of the bithorax complex iab-7 domain and insulated iab-7 from initiation elements and a PRE in the adjacent iab-8 domain. Development 127,779 -790.[Abstract]
Bell, A. C., West, A. G. and Felsenfeld, G. (2001). Insulators and boundaries: versatile regulatory elements in the eukaryotic genome. Science 291,447 -450.[Abstract/Free Full Text]
Buchner, K., Roth, P., Schotta, G., Krauss, V., Saumweber, H., Reuter, G. and Dorn, R. (2000). Genetic and molecular complexity of the position effect variegation modifier mod(mdg4) in Drosophila. Genetics 155,141 -157.[Abstract/Free Full Text]
Cai, H. and Chen, P. (2001). Effects of cis arrangement chromatin insulators on enhancer blocking activity. Science 291,493 -495.[Abstract/Free Full Text]
Cai, H. and Levine, M. (1995). Modulation of enhancer-promoter interactions by insulators in the Drosophila embryo. Nature 376,533 -536.[CrossRef][Medline]
Cai, H. N. and Levine, M. (1997). The gypsy insulator can function as a promoter-specific silencer in the Drosophila embryo. EMBO J. 16,1732 -1741.[CrossRef][Medline]
Cai, H. N. and Shen, P. (2001). Effects of cis arrangement of chromatin insulators on enhancer-blocking activity. Science 291,493 -495.[Abstract/Free Full Text]
Campuzano, S., Carramolino, L., Cabrera, C., Ruiz-Gomez, M., Villares, R., Boronat, A. and Modolell, J. (1985). Molecular genetics of the achaete-scute gene complex of D. melanogaster.Cell 44,327 -338.
Carmena, A., Bate, M. and Jimenez, F. (1995). Lethal of scute, a proneural gene, participates in the specification of muscle progenitors during Drosophila embryogenesis. Genes Dev. 9,2373 -2383.[Abstract/Free Full Text]
Dorsett, D. (1990). Potentiation of a polyadenylation site by a downstream protein DNA interaction. Proc. Natl. Acad. Sci. USA. 87,4373 -4377.[Abstract/Free Full Text]
Dorsett, D. (1999). Distant liaisons: long range enhancer-promoter interactions in Drosophila. Curr. Opin. Genet. Dev. 9,505 -514.[CrossRef][Medline]
Gause, M., Hovhannisyan, H., Kahn, T., Kuhfittig, S., Mogila, V. and Georgiev, P. (1998). hobo induced rearrangements in the yellow locus influence the insulation effect of the gypsy su(Hw)-binding region in Drosophila melanogaster.Genetics 149,1393 -1405.[Abstract/Free Full Text]
Gause, M., Morcillo, P. and Dorsett, D. (2001). Cooperation between Suppressor of Hairy Wing and Modifier of mdg4 proteins in insulation of enhancer-promoter communication by the gypsy transposon in the Drosophila cut gene. Mol. Cell. Biol. 21,4807 -4817.[Abstract/Free Full Text]
Gdula, D. A. and Corces, V. G. (1997). Characterization of functional domains of the su(Hw) protein that mediate the silencing effect of mod(mdg4) mutations. Genetics 145,153 -161.[Abstract]
Georgiev, P. G. and Gerasimova, T. I. (1989). Novel genes influencing the expression of the yellow locus and mdg4 (gypsy) in Drosophila melanogaster. Mol. Gen. Genet. 220,121 -126.[Medline]
Georgiev, P. and Kozycina, M. (1996). Interaction between mutations in the suppressor of Hairy wing and modifier of mdg4 genes of Drosophila melanogaster affecting the phenotype of gypsy-induced mutations.Genetics, 142,425 -436.[Abstract]
Gerasimova, T. I., Gdula, D. A., Gerasimov, D. V., Simonova, O. and Corces, V. G. (1995). A Drosophila protein that imparts directionality on a chromatin insulator is an enhancer of position-effect variegation. Cell 82,587 -597.[CrossRef][Medline]
Gerasimova, T. I. and Corces, V. G. (1998). Polycomb and trithorax group proteins mediate the function of a chromatin insulator. Cell 92,511 -521.[CrossRef][Medline]
Gerasimova, T. I., Byrd, K. and Corces, V. G. (2000). A chromatin insulator determines the nuclear localization of DNA. Mol. Cell 6,1025 -1035.[CrossRef][Medline]
Gerasimova, T. I. and Corces, V. G. (2001). Chromatin insulators and boundaries: effects on transcription and nuclear organization. Annu. Rev. Genet. 35,193 -208.[CrossRef][Medline]
Geyer, P. K., Spana, C. and Corces, V. G. (1986). On the molecular mechanism of gypsy-induced mutations at the yellow locus of Drosophila melanogaster.EMBO J. 5,2657 -2662.[Medline]
Geyer, P. K. and Corces, V. G. (1987). Separate regulatory elements are responsible for the complex pattern of tissue-specific and developmental transcription of the yellow locus in Drosophila melanogaster. Genes Dev. 1,996 -1004.[Abstract/Free Full Text]
Geyer, P. K. and Corces, V. G. (1992). DNA position-specific repression of transcription by a Drosophila zinc finger protein. Genes Dev. 6,1865 -1873.[Abstract/Free Full Text]
Geyer, P. K. (1997). The role of insulator elements in defining domains of gene expression. Curr. Opin. Genet. Dev. 7,242 -248.[CrossRef][Medline]
Ghosh, D., Gerasimova, T. I. and Corces, V. G. (2001). Interactions between the Su(Hw) and Mod(mdg4) proteins required for gypsy insulator function. EMBO J. 20,2518 -2527.[CrossRef][Medline]
Golic, K. G. and Lindquist, S. (1989). The FLP recombinase of yeast catalyzes site-specific recombination in the Drosophila genome. Cell 59,499 -509.[CrossRef][Medline]
Golovnin, A., Gause, M., Georgieva, S., Gracheva, E. and Georgiev, P. (1999). Su(Hw) insulator can disrupt enhancer-promoter interactions when located more than 20 kilobases away from the Drosophila achaete-scute complex. Mol. Cell Biol. 19,3443 -3456.[Abstract/Free Full Text]
Gomez-Skarmeta, J. L., Rodriguez, I., Martinez, C., Culi, J., Ferres-Marco, D., Beamonte, D. and Modolell, J. (1995). Cis-regulation of achaete and scute: shared enhancer-like elements drive their coexpression in proneural clusters of the imaginal discs. Genes Dev. 9,1869 -1882.[Abstract/Free Full Text]
Gonzalez, F., Romani, S., Cubas, P., Modolell, J. and Mayor, R. (1989). Molecular analysis of the asense gene, a member of the achaete-scute complex of Drosophila melanogaster, and its novel role in optic lobe development. EMBO J. 17,181 -190.[CrossRef]
Hagstrom, K., Muller, M. and Schedl, P. (1996). Fab-7 functions as a chromatin domain boundary to ensure proper segment specification by the Drosophila bithorax complex. Genes. Dev. 10,3202 -3215.[Abstract/Free Full Text]
Harrison, D. A., Gdula, D. A., Coyne, R. S. and Corces, V. G. (1993). A leucine zipper domain of the suppressor of Hairy-wing protein mediates its repressive effect on enhancer function. Genes Dev. 7,1966 -1978.[Abstract/Free Full Text]
Holdridge, C. and Dorsett, D. (1991). Repression of hsp70 heat shock gene transcription by the suppressor of Hairy-wing protein of Drosophila melanogaster. Mol. Cell. Biol. 11,1894 -1900.[Abstract/Free Full Text]
Hoover, K. K., Gerasimova, T. I., Chien, A. J. and Corces, V. G. (1992). Dominant effects of suppressor of Hairy-wing mutations on gypsy-induced alleles of forked and cut in Drosophila melanogaster. Genetics 132,691 -697.[Abstract]
Kares, R. E. and Rubin, G. M. (1984). Analysis of P transposable element functions in Drosophila.Cell 38,135 -146.[CrossRef][Medline]
Kim, J., Shen, B., Rosen, C. and Dorsett, D. (1996). The DNA-binding and enhancer-blocking domains of the Drosophila suppressor of Hairy-wing protein. Mol. Cell. Biol. 16,3381 -3392.[Abstract]
Labrador, M. and Corces, V. G. (2002). Setting the boundaries of chromatin domains and nuclear organization. Cell 111,151 -154.[CrossRef][Medline]
Lindsley, D. L. and Zimm, G. G. (1992). The Genome of Drosophila melanogaster. New York: Academic Press.
Mallin, D. R., Myung, J. S., Patton, J. S. and Geyer, P. K. (1998). Polycomb group repression is blocked by the Drosophila suppressor of Hairy-wing [su(Hw)] insulator. Genetics 148,331 -339.[Abstract/Free Full Text]
Martin, M., Meng, Y. B. and Chia, W. (1989). Regulatory elements involved in the tissue-specific expression of the yellow gene of Drosophila. Mol. Gen. Genet. 218,118 -126.[CrossRef][Medline]
Mazo, A. M., Mizrokhi, L. J., Karavanov, A. A., Sedkov, Y. A., Krichevskaja, A. A. and Ilyin, Y. V. (1989). Suppression in Drosophila: Su(Hw) and su(f) gene products interact with a region of gypsy (mdg4) regulating its transcriptional activity. EMBO J. 8,903 -911.[Medline]
Mihaly. J., Hogga, I., Barges, S., Galloni, M., Mishra, R.K., Hagstrom, K., Muller, M., Schedl, P., Sipos, L., Gausz, J., Gyurkovics, H. and Karch, F. (1998). Chromatin domain boundaries in the Bithorax complex. Cell Mol. Life Sci. 54, 60-70.[CrossRef][Medline]
Modolell, J. and Campuzano, S. (1998). The achaete-scute complex as an integrating device. Int. J. Dev. Biol. 42,275 -282.[Medline]
Mongelard, F. and Corces, V. G. (2001). Two insulators are not better than one. Nat. Struct. Biol. 8, 192-194.[CrossRef][Medline]
Muravyova, E., Golovnin, A., Gracheva, E., Parshikov, P., Belenkaya, T., Pirrotta, V. and Georgiev, P. (2001). Loss of insulator activity by paired Su(Hw) chromatin insulators. Science 291,495 -497.[Abstract/Free Full Text]
Qian, S., Varjavand, B. and Pirrotta, V. (1992). Molecular analysis of the zeste-white interaction reveals a promoter-proximal element essential for distant enhancer-promoter communication. Genetics 131, 79-90.[Abstract]
Roseman, R. R., Pirrotta, V. and Geyer, P. K. (1993). The su(Hw) protein insulates expression of the Drosophila melanogaster white gene from chromosomal position-effects. EMBO J. 12,435 -442.[Medline]
Roseman, R. R., Johnson, E. A., Rodesch, C. K., Bjerke, M., Nagoshi, R. N. and Geyer, P. (1995). A P element containing suppressor of Hairy-wing binding region has novel properties for mutagenesis in Drosophila melanogaster.Genetics 141,1061 -1074.[Abstract]
Rubin, G. M. and Spradling, A. C. (1982). Genetic transformation of Drosophila with transposable element vectors. Science 218,348 -353.[Abstract/Free Full Text]
Ruiz-Gomez, M. and Modolell, J. (1987). Deletion analysis of the achaete-scute locus of Drosophila melanogaster. Genes Dev. 1,1238 -1246.[Abstract/Free Full Text]
Scott, K. S. and Geyer, P. K. (1995). Effects of the su(Hw) insulator protein on the expression of the divergently transcribed Drosophila yolk protein genes. EMBO J. 14,6258 -6279.[Medline]
Scott, K. S., Taubman, A. D. and Geyer, P. K. (1999). Enhancer blocking by the Drosophila gypsy insulator depends upon insulator anatomy and enhancer strength. Genetics 153,787 -798.[Abstract/Free Full Text]
Siegal, M. L. and Hartl, D. L. (2000). Application of Cre/loxP in Drosophila. Site-specific recombination and transgene coplacement. Methods Mol. Biol. 136,487 -495.[Medline]
Sigrist, C. J. A. and Pirrotta, V. (1997). Chromatin insulator elements block the silencing of a target gene by the Drosophila Polycomb Response Element (PRE) but allow trans interactions between PREs on different chromosomes.Genetics 147,209 -221.[Abstract]
Smith, P. A. and Corces, V. G. (1992). The suppressor of Hairy-wing binding region is required for gypsy mutagenesis. Mol Gen Genet. 233,65 -70.[CrossRef][Medline]
Spana, C., Harrison, D. A. and Corces, V. G. (1988). The Drosophila melanogaster supressor of Hairy-wing protein binds to specific sequences of the gypsy retrotransposon. Genes Dev. 2,1414 -1423.[Abstract/Free Full Text]
Spana, C. and Corces, V. G. (1990). DNA bending is a determinant of binding specificity for a Drosophila zinc finger protein. Genes Dev. 4,1505 -1515.[Abstract/Free Full Text]
Spradling, A. C. and Rubin, G. M. (1982). Transposition of cloned P elements into germline chromosomes.Science 218,341 -347.[Abstract/Free Full Text]
Udvardy, A. (1999). Dividing the empire: boundary chromatin elements delimit the territory of enhancers. EMBO J. 18,1 -8.[CrossRef][Medline]
West, A. G., Gaszner, M. and Felsenfeld, G. (2002). Insulators: many functions, many mechanisms. Genes Dev. 16,271 -288.[Free Full Text]
Zhou, J., Barolo, S., Szymanski, P. and Levine, M. (1996). The Fab-7 element of the bithorax complex attenuates enhancer-promoter interactions in the Drosophila embryo. Genes Dev. 10,3195 -3201.[Abstract/Free Full Text]
Zhou, J., Ashe, H., Burks, C. and Levine, M. (1999). Characterization of the transvection mediating region of the Abdominal-B locus in Drosophila.Development 126,3057 -3065.[Abstract]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
P. Majumder, S. Roy, V. E. Belozerov, D. Bosu, M. Puppali, and H. N. Cai
Diverse transcription influences can be insulated by the Drosophila SF1 chromatin boundary
Nucleic Acids Res., July 1, 2009; 37(13): 4227 - 4233.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. M. Bushey, E. Ramos, and V. G. Corces
Three subclasses of a Drosophila insulator show distinct and cell type-specific genomic distributions
Genes & Dev., June 1, 2009; 23(11): 1338 - 1350.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
O. Kyrchanova, D. Chetverina, O. Maksimenko, A. Kullyev, and P. Georgiev
Orientation-dependent interaction between Drosophila insulators is a property of this class of regulatory elements
Nucleic Acids Res., December 1, 2008; 36(22): 7019 - 7028.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
O. Maksimenko, A. Golovnin, and P. Georgiev
Enhancer-Promoter Communication Is Regulated by Insulator Pairing in a Drosophila Model Bigenic Locus
Mol. Cell. Biol., September 1, 2008; 28(17): 5469 - 5477.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. J. Kuhn-Parnell, C. Helou, D. J. Marion, B. L. Gilmore, T. J. Parnell, M. S. Wold, and P. K. Geyer
Investigation of the Properties of Non-gypsy Suppressor of Hairy-wing-Binding Sites
Genetics, July 1, 2008; 179(3): 1263 - 1273.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. Chetverina, E. Savitskaya, O. Maksimenko, L. Melnikova, O. Zaytseva, A. Parshikov, A. V. Galkin, and P. Georgiev
Red flag on the white reporter: a versatile insulator abuts the white gene in Drosophila and is omnipresent in mini-white constructs
Nucleic Acids Res., February 11, 2008; 36(3): 929 - 937.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Aoki, S. Schweinsberg, J. Manasson, and P. Schedl
A Stage-Specific Factor Confers Fab-7 Boundary Activity during Early Embryogenesis in Drosophila
Mol. Cell. Biol., February 1, 2008; 28(3): 1047 - 1060.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. Gohl, M. Muller, V. Pirrotta, M. Affolter, and P. Schedl
Enhancer Blocking and Transvection at the Drosophila apterous Locus
Genetics, January 1, 2008; 178(1): 127 - 143.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Golovnin, A. Mazur, M. Kopantseva, M. Kurshakova, P. V. Gulak, B. Gilmore, W. G. F. Whitfield, P. Geyer, V. Pirrotta, and P. Georgiev
Integrity of the Mod(mdg4)-67.2 BTB Domain Is Critical to Insulator Function in Drosophila melanogaster
Mol. Cell. Biol., February 1, 2007; 27(3): 963 - 974.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. J. Parnell, E. J. Kuhn, B. L. Gilmore, C. Helou, M. S. Wold, and P. K. Geyer
Identification of Genomic Sites That Bind the Drosophila Suppressor of Hairy-wing Insulator Protein.
Mol. Cell. Biol., August 1, 2006; 26(16): 5983 - 5993.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. Pomerantseva, I. Biryukova, R. Silicheva, E. Savitskaya, A. Golovnin, and P. Georgiev
Transposition of Regulatory Elements by P-Element-Mediated Rearrangements in Drosophila melanogaster
Genetics, April 1, 2006; 172(4): 2283 - 2291.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. Ramos, D. Ghosh, E. Baxter, and V. G. Corces
Genomic Organization of gypsy Chromatin Insulators in Drosophila melanogaster
Genetics, April 1, 2006; 172(4): 2337 - 2349.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. Savitskaya, L. Melnikova, M. Kostuchenko, E. Kravchenko, E. Pomerantseva, T. Boikova, D. Chetverina, A. Parshikov, P. Zobacheva, E. Gracheva, et al.
Study of Long-Distance Functional Interactions between Su(Hw) Insulators That Can Regulate Enhancer-Promoter Communication in Drosophila melanogaster
Mol. Cell. Biol., February 1, 2006; 26(3): 754 - 761.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. Kravchenko, E. Savitskaya, O. Kravchuk, A. Parshikov, P. Georgiev, and M. Savitsky
Pairing between gypsy Insulators Facilitates the Enhancer Action in trans throughout the Drosophila Genome
Mol. Cell. Biol., November 1, 2005; 25(21): 9283 - 9291.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
S. SCHOENFELDER and R. PARO
Drosophila Su(Hw) Regulates an Evolutionarily Conserved Silencer from the Mouse H19 Imprinting Control Region
Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 47 - 54.
[Abstract] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. J. Parnell, M. M. Viering, A. Skjesol, C. Helou, E. J. Kuhn, and P. K. Geyer
An endogenous Suppressor of Hairy-wing insulator separates regulatory domains in Drosophila
PNAS, November 11, 2003; 100(23): 13436 - 13441.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Golovnin, A.
Right arrow Articles by Georgiev, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Golovnin, A.
Right arrow Articles by Georgiev, P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?