|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00551

1 Division of Cell Biology, Biozentrum, University of Basel, Klingelbergstrasse
70, CH-4056 Basel, Switzerland
2 Department of Molecular Biology, Massachusetts General Hospital and Department
of Genetics, Harvard Medical School, Wellman 8, 50 Blossom Street, Boston, MA
02114, USA
3 Department of Biosciences at Novum, and Center for Genomics and
Bioinformatics, Karolinska Institutet, Södertörns Högskola,
Alfred Nobels Allé 7, SE-141 89 Huddinge, Sweden
Author for correspondence (e-mail:
thomas.burglin{at}biosci.ki.se)
Accepted 15 April 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Caenorhabditis elegans, Homeobox, Pharynx, ceh-2, empty spiracles, Evolution, Cross-species rescue
| INTRODUCTION |
|---|
|
|
|---|
Homeobox genes of the ems/Emx class have been characterized from
fruit fly, amphioxus, several vertebrates and a hydrozoan. Fly ems
mutant embryos lack two brain segments and other head structures that normally
develop from the ems expression domain
(Dalton et al., 1989
;
Hartmann et al., 2000
;
Hirth et al., 1995
;
Jürgens et al., 1984
;
Walldorf and Gehring, 1992
).
Comparable with the expression of Drosophila ems, orthologs from
several vertebrates are expressed in the developing cortex
(Kastury et al., 1994
;
Morita et al., 1995
;
Pannese et al., 1998
;
Simeone et al., 1992
). Mouse
Emx1 and Emx2 define the identity of their cortical
expression domains and are necessary for formation and migration of specific
neurons (Bishop et al., 2000
;
Mallamaci et al., 2000
;
Tole et al., 2000
;
Shinozaki et al., 2002
).
Expression of a hydrozoan ems homolog in endodermal cells around the
mouth opening suggests that ems genes have played a role in head
development since very early in metazoan evolution
(Mokady et al., 1998
;
Meinhardt, 2002
). Other
ems/Emx functions are apparently unrelated to head development. An
amphioxus ems ortholog is expressed only in trunk and tail epidermis
(Oda and Saiga, 2001
).
ems and Emx2 later act in the development of fly tracheae
(Dalton et al., 1989
;
Walldorf and Gehring, 1992
)
and formation of the mouse urogenital system
(Miyamoto et al., 1997
),
respectively. Thus, it is of interest to understand the molecular role of
ems genes at the cellular level in different phyla.
In the nematode Caenorhabditis elegans, we have the opportunity to
study gene function at the level of single cells. Furthermore, head
development of this nematode is still poorly understood. Nematodes have
recently been proposed to be a sister group to arthropods based on molecular
data (Aguinaldo et al., 1997
),
but they have a simple body plan with fewer cell types. The main head
structures of nematodes are the head ganglia, with sensory organs and
interneurons, and the pharynx, a muscular feeding organ, around which the
ganglia are arranged. We have now identified and studied the C. elegans
ems/Emx ortholog to understand its role in nematode head development.
Additional sequencing of the previously identified homeobox gene
ceh-2 (Bürglin et al.,
1989
) confirmed that this is an ems/Emx
ortholog. We find that ceh-2 is expressed in a few cells of the
pharynx. This organ rhythmically pumps suspended bacteria, grinds them and
passes them on to the intestine. Pharynx muscle activity is modulated by a
small independent nervous system that consists of 20 neuron types
(Avery and Horvitz, 1989
). We
characterized defects in some of the ceh-2-expressing neurons in a
ceh-2 mutation that we generated. Unlike in other animals, the C.
elegans ems ortholog is not required for the formation or morphological
differentiation of the cells expressing it. Given the apparent discrepancy in
the biological roles of ceh-2 and ems between nematodes and
flies, we were interested to see if cross-species rescue would be possible.
Thus, we examined the degree of functional conservation between the
Drosophila and C. elegans ems orthologs by rescuing the fly
ems mutant brain phenotype with ceh-2.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning ceh-2 cDNA, reporter and rescue constructs
A C. elegans embryonic stage cDNA library (a gift from Peter
Okkema) (Okkema and Fire,
1994
) was hybridized according to standard techniques with a
labeled 5' fragment of the ceh-2 cDNA that had been obtained by
PCR from the same library. We isolated two different clones with identical
open reading frames. Accession Numbers are AY246428 and AY246429.
ceh-2 reporter constructs were cloned in vectors pPD95.79
(gfp) or pPD95.07 (lacZ) (kind gifts from A. Fire, S. Xu, J.
Ahnn and G. Seydoux). For pTRB201, genomic DNA was amplified with primers
PCR2-10
(tgcttctcttgtcgacaaaactggcatg)/PCR2-7(cgcggatccccttctcactatccaccagtcgttccaccg),
cloned SalI-BamHI into pPD95.79, and shortened to 1.6 kb by
HindIII digestion and religation. pTRB202 is a PCR subclone amplified
with primers PCR2-10/PCR2-9 (cgcggatccgattttgaaaccaaacttttacctga) and cloned
SalI-BamHI into pPD95.79.
For rescue, we subcloned an SphI-SalI fragment from
cosmid C27A12 (AF003137) (The C.
elegans Sequencing Consortium, 1998
) and excised the
EcoRV fragment, which leaves only the ceh-2 gene with
surrounding sequences up to the next upstream and downstream open reading
frames (pTRB203; Fig. 1B).
pTRB204, a SacI deletion subclone of pTRB203 lacking most of
ceh-2 served as negative control and showed no rescuing activity in
transgenic animals. Constructs were injected into the gonads of wild-type or
mutant animals to obtain transgenic lines and the dominant co-injection marker
rol-6 was used (Mello and Fire,
1995
).
|
Electrophysiology and behavioral assays
Electropharyngeograms were recorded from isolated heads as described
(Avery et al., 1995
). The tip
of the head was sealed by suction into fire-polished borosilicate glass
electrodes of about 3 µm outer diameter. Bath and electrode were filled
with Dent's saline (140 mM NaCl, 6 mM KCl, 3 mM CaCl2, 1 mM
MgCl2, 5 mM HEPES, pH ad 7.4) containing about 1 µM serotonin
hydrochloride (Sigma) to stimulate moderate pumping. EPGs were recorded with
an AxoClamp microelectrode amplifier (Axon) connected to a Gould RS3200 pen
recorder.
Locomotion rate assays were performed according to Sawin et al.
(Sawin et al., 2000
). Staged
populations of young adult worms were deprived of food for 30 minutes on
standard agar plates with or without 75 µg/ml fluoxetine hydrochloride
(Sigma) and transferred to assay plates covered with a thin lawn of E.
coli OP50 or with no E. coli. Worms were transferred between
plates in a drop of buffer, washed before each transfer, and assayed five
minutes after transfer. Control and experimental worms as well as plates were
prepared in parallel and treated exactly the same to ensure constant
conditions. At least 30 animals were assayed under each condition.
Ectopic expression of ceh-2 in Drosophila
The ceh-2-coding sequence was amplified by PCR from ceh-2
cDNA clones, verified by sequencing and cloned into plasmid pCaSpeR-hs
(Thummel and Pirrotta, 1992
).
Transgenic flies were prepared by P element transformation in a
white- mutant background. Induction of ceh-2
transcription by heat-shock was verified by RT-PCR of total RNA isolated from
heat-shocked hs-ceh-2/hs-ceh-2 embryos. No RT-PCR band was
obtained from embryos that were not heat-shocked. One hs-ceh-2 and
one hs-ems line (the latter a gift from Uwe Walldorf) were marked on
chromosome III with TM3 Sb Ubx-lacZ/TM6 hm and crossed into
ems9H83/TM3 sb Ubx-lacZ (a gift from Markus
Affolter) to produce fly strains of the genotype
hs-ceh-2/hs-ceh-2 [II]; ems9H83/TM3
sb Ubx-lacZ[III] and hs-ems/hs-ems[II];
ems9H83/TM3 sb Ubx-lacZ[III]. Stage 11 embryos
from these lines were heat-shocked for 45 minutes at 37°C, raised to stage
15, fixed and stained. FITC-conjugated goat-antihorseradish-peroxidase
antibody (Jackson) was used to stain the central nervous system. Absence of
anti-ß-galactosidase staining (mouse monoclonal, anti-mouse TRITC;
Promega) identified homozygous ems mutant animals.
| RESULTS |
|---|
|
|
|---|
ceh-2 is expressed in five cell types of the anterior pharynx
We determined the ceh-2 expression pattern using an antiserum
raised against a peptide located C terminally to the homeodomain, as well as
gfp and lacZ reporter fusions
(Fig. 1B). Antibody staining is
nuclear as expected for a transcription factor
(Fig. 2). We find
ceh-2 expression restricted to eleven cells (fourteen nuclei) of five
types in the anterior pharynx (corpus) of larvae and adults: the I3 neuron
that lies embedded in the dorsal sector of the pharynx muscle; the pairs of
NSM and M3 motoneurons in the left and right subventral sectors; the three m2
muscle cells, each possessing two nuclei resulting from cell fusion during
development; and the three e2 epithelial cells with the anterior-most pharynx
nuclei (Fig. 2A).
|
The transcription factor PHA-4 specifies organ identity during pharynx
development; embryos lacking pha-4 activity produce no pharyngeal
cells (Azzaria et al., 1996
;
Horner et al., 1998
;
Mango et al., 1994
). Thus,
pha-4 is expected to be upstream of ceh-2, and we find that
ceh-2 reporter constructs are not expressed in pha-4 mutants
(data not shown).
A ceh-2 deletion mutation causes starvation and larval growth
retardation
To investigate the function of ceh-2 we isolated a deletion
allele, ceh-2(ch4), from an EMS mutant screen (see Materials and
Methods). The 2.5 kb deletion in ceh-2(ch4) joins exon 2 to intron 4,
thus eliminating exonic sequences that encode the complete hexapeptide and
homeodomain (Fig. 1B). We
sequenced several RT-PCR clones from ceh-2(ch4) animals and found two
almost identical splice variants stemming from the remaining exons of
ceh-2 (Fig. 1B); in
both cases, the 5' end of exon 5 is spliced to a cryptic splice donor
site within exon 2, which creates a functional open reading frame. Thus the
ceh-2(ch4) allele encodes at least two peptides of about 100 amino
acids that consist essentially of the ceh-2 regions located N- and
C-terminally to the hexapeptide and homeodomain. With 27% glutamate and
aspartate residues these peptides are very acidic. As ceh-2(ch4)
lacks both the potential DNA binding and protein binding domains, it is
presumably a null allele; no deficiency is available to confirm this
assumption. The M3 neuron phenotype described below is recessive, supporting
the notion that ceh-2(ch4) is a loss-of-function allele.
Homozygous ceh-2(ch4) mutant worms are viable and fertile. About 20% of them are obviously starved: they are shorter and thinner at all stages and pale, and severely affected adults bear only a few eggs. Homozygous mutants proliferate slightly more slowly than wild type. Single mutant animals and their offspring take a day longer to exhaust food on a standard agar plate, even when the parent animal does not appear starved. We found that slow proliferation is due to both retarded larval development (Fig. 3) and reduced brood size (not shown). Worms that took longest to develop into adulthood also laid fewest eggs and appeared most starved. The mean larval development time in ceh-2(ch4) mutants was 54±7 hours (n=57) compared with 48±2 hours in wild type; single worms took up to 75 hours to develop into adults. A few homozygous ch4 mutants arrested as L1 larvae (<5%). Timing of embryonic development was not affected, which is consistent with a feeding defect. However, we did not observe reliable differences in feeding behavior or pharynx pumping between mutant and wild-type animals under the light microscope.
|
The two glutamatergic M3 motoneurons are essential for effective feeding
(Avery, 1993
). Raizen and Avery
(Raizen and Avery, 1994
) have
developed an external recording technique that allows visualization of M3
action. During each pharynx pump, changes in the membrane potential of pharynx
muscle are recorded as stereotyped pattern of spikes called an
electropharyngeogram (EPG). An EPG, formally the time derivative of a pharynx
muscle action potential, consists of large spikes in the depolarizing and
repolarizing direction at the start and the end of a contraction, respectively
(Raizen and Avery, 1994
)
(Fig. 4A). In the plateau phase
between the large depolarization and repolarization spikes, several smaller
spikes in the inhibitory direction exist. M3 neurons are necessary and
sufficient to generate these plateau phase spikes
(Raizen and Avery, 1994
).
|
M3 activity shortens pump duration and speeds up relaxation of the
contracted pharynx (Avery,
1993
; Raizen and Avery,
1994
). This is reflected in the duration of electropharyngeograms,
which is considerably longer in ceh-2(ch4) than in wild-type EPGs. We
measured lengths of EPGs from the peak of the depolarization spike to the peak
of the repolarization spike in the first four or five EPGs recorded from each
of six to eight animals. In ceh-2(ch4), pump duration was extended to
210±20 ms compared with 130±10 ms in wild type. A rescue
transgene shortened the average pump duration of ceh-2(ch4) to
160±30 ms, compared with 220±20 ms for the non-rescue control.
Errors are standard errors of the mean.
We assayed the ceh-2(ch4) mutants also for possible defects of NSM
neuron function, but found only minor abnormalities that may not be related to
NSM. The two NSM motoneurons contain serotonin (5-hydroxytryptamine, 5-HT)
(Horvitz et al., 1982
) and are
able to take up exogenous serotonin via a serotonin reuptake transporter
(Ranganathan et al., 2001
).
ceh-2(ch4) mutants both possess serotonin and are the same as wild
type in terms of serotonin uptake. This was determined by antibody staining
against serotonin in a wild-type or serotonin-deficient (tph-1)
(Sze et al., 2000
) background
(data not shown). We tested for NSM function using NSM-dependent behavioral
assays developed by Sawin et al. (Sawin et
al., 2000
): C. elegans moves less actively in the
presence of food; worms that have been starved for half an hour will slow down
even more when they encounter food again. This 'enhanced slowing response' is
potentiated by the serotonin reuptake inhibitor fluoxetine. The enhanced
slowing response depends in part on the presence of NSM neurons; its
potentiation by fluoxetine is completely abolished upon NSM ablation
(Sawin et al., 2000
).
ceh-2(ch4) homozygous mutants showed both responses
(Fig. 5), which indicates that
the NSM neurons are still functional.
|
ceh-2 can substitute for ems in Drosophila ems mutants
Although similarities in orthologous protein sequences are often restricted
to domains, many orthologous genes are functionally exchangeable between
organisms. For example, the mouse Pax6 gene can substitute for the
eyeless gene in Drosophila eye development
(Halder et al., 1995
), and
defects in the brain of ems mutant Drosophila embryos can be
rescued by expression of the human EMX2 gene
(Hartmann et al., 2000
). We
were interested to see whether ceh-2 could function in place of the
fly ems gene in a similar manner.
All homozygous ems mutant fly embryos lack neuromeres b2 and b3,
this is visible as a distinct gap between the anteriormost neuromere b1 and
the ventral nerve cord in antibody stainings for endogenous horseradish
peroxidase crossreactivity (Hirth et al.,
1995
) (Fig. 6A). In
addition, the frontal connectives that usually emerge laterally from the
frontal ganglion and project into the b3 neuromere on both sides
(Nassif et al., 1998
)
ectopically project into neuromere b1 in ems mutants
(Hartmann et al., 2000
)
(Fig. 6B). The fly ems
gene is able to restore neuromeres b2 and b3 as well as the frontal connective
projections when expressed ubiquitously at embryonic stage 11 under the
control of a heatshock promoter. The mouse Emx2 gene is able to
restore the missing neuromeres but not the frontal connective projections in
the brain (Hartmann et al.,
2000
).
|
| DISCUSSION |
|---|
|
|
|---|
eat-4 is the only other gene known to be expressed in M3 and
required for its function (Lee et al.,
1999
). eat-4 is necessary for the function of several
neurons considered glutamatergic, and may therefore be a general glutamatergic
factor (Lee et al., 1999
). Its
vertebrate ortholog, a vesicular glutamate transporter, is sufficient to
induce glutamate-mediated synaptic transmission in GABAergic hippocampal
neurons (Bellocchio et al.,
2000
; Takamori et al.,
2000
). It is therefore possible that the glutamatergic phenotype
of a neuron is largely defined by the uptake of this abundant amino acid into
synaptic vesicles. eat-4 may thus be the major factor needed for M3
function, perhaps apart from enhanced glutamate synthesis activity. Like
ceh-2, eat-4 is expressed in NSM as well as M3 but is not required
for NSM function (Lee et al.,
1999
). ceh-2 may thus positively regulate eat-4
expression in M3 and NSM neurons, and may be deficient in glutamate uptake
into presynaptic vesicles. We have examined the expression of an
eat-4::lacZ reporter in ceh-2(ch4) mutants, but found no
obvious regulation of eat-4 by ceh-2 (G.A. and T.R.B.,
unpublished); nevertheless, a regulation that is more difficult to detect may
exist. Alternatively, ceh-2 may regulate other, as yet unidentified
components necessary for M3 function.
ceh-2(ch4) mutants seem to have normal NSM function as far as we can tell from presently available tests, and the only defect we see in these assays may be due to starvation, a consequence of the M3 failure. The role of ceh-2 in I3 could not yet be determined, as no function has been described for this neuron. Furthermore, we did not observe any obvious morphologically defects in the m2 muscle and e2 epithelial cells. Thus, any function of ceh-2 in these cells appears to be very subtle.
Apart from being located in the anterior pharynx, the cells expressing
ceh-2 are unrelated by cell type or lineage. ceh-2
expressing cells have muscular, neuronal and epithelial identities and descend
from all pharynx lineages, the ABara, ABalp and MS blastomeres. Most closely
related by lineage are the M3 and NSM neurons, granddaughter and
great-granddaughter of ABaraap(a/p)pp, respectively
(Sulston et al., 1983
). Thus,
the ceh-2 expression/function domain is most probably not regulated
at the level of lineage, but rather positional/regional cues trigger
expression of ceh-2 during embryogenesis, when the cells are closely
clustered.
ceh-2 in ems/Emx evolution
ceh-2 is the only clear ems/Emx ortholog in the sequenced
C. elegans genome. It shares the features of ems class genes from
Drosophila, amphioxus, a hydrozoan, and several vertebrate species;
the degree of sequence conservation between the vertebrate and invertebrate
ems genes is similar. Besides the homeodomain (with a conserved intron
position) and the hexapeptide, there is little detectable sequence similarity
between ems class genes from different phyla, except for general
proline-rich and acidic regions.
We showed by cross-species rescue experiments that ceh-2 can
functionally replace the fly ems gene in the brain to a comparable
extent to the fly ems gene. Thus, CEH-2 protein can presumably
associate with the same co-factors as fly Ems and bind to the same enhancer
elements. The identities of these co-factors and enhancer elements are not
known, but because this function has been conserved, it is likely that similar
interactions are used in C. elegans to regulate target genes. The
human EMX2 gene, for example, is able to rescue the missing
Drosophila prosomeres but never the axonal pathfinding defect of the
frontal nerve (Hartmann et al.,
2000
), and therefore might have lost some functions needed in the
fly.
The evolutionary origin of the C. elegans pharynx nervous system
is not clear. The posterior part of the pharynx itself has physiological and
molecular similarities to vertebrate and fly hearts and is derived mainly from
the MS blast cell (Haun et al.,
1998
; Okkema and Fire,
1994
). Most of the anterior part of the pharynx is derived from
the anterior AB.a blast cell from which many ring ganglia neurons are also
derived, thus two rather separate cell lineages contribute to the pharynx.
However, pharynx identity is conferred by a single gene, the fork
head/winged-helix class transcription factor pha-4
(Azzaria et al., 1996
;
Horner et al., 1998
;
Mango et al., 1994
).
pha-4 mutants possess cells of the pharynx lineages, but do not
develop a pharynx. ceh-2 reporter constructs are not expressed in
pha-4 mutants so that ceh-2 is downstream of pha-4.
The Drosophila ortholog of pha-4, the gene fork
head, is expressed in the terminal regions of the embryo and functions in
anterior gut development and has been shown to play a role in brain patterning
through inductive events (Page,
2002
). Hence, both ceh-2 and pha-4 may have an
evolutionary origin in the development of anterior structures.
The common theme between ceh-2 and its hydrozoan, fly and chordate
orthologs is that they are expressed at the anterior. As a sister phylum of
arthropods and other molting animals (ecdysozoa)
(Aguinaldo et al., 1997
), one
could expect nematode genes to be similar to fly genes and thus have a CNS
function, in particular given that both fly ems and vertebrate
Emx genes function in the brain
(Reichert and Simeone, 1999
).
However, an ascidian ems/Emx ortholog is expressed in the anterior
trunk and lateral tail epidermis and, like ceh-2, not in the CNS.
This observation lead to the proposal that ems/Emx gene functions in
the CNS may have been acquired independently in Drosophila and
vertebrates (Oda and Saiga,
2001
). Likewise in Hydractinia, an ems homolog is
expressed in the anterior digestive tract and not in neurons
(Mokady et al., 1998
). Thus,
although the orientation of the anterior/posterior axis in cnidarians is being
discussed (Meinhardt, 2002
),
the more basic role of ems class genes may have been in anterior
patterning, and the notion that they always play a role in the CNS may have to
be revised. A possible hypothesis is that in some animal phyla, cells
contributing to the CNS are derived from the ems/Emx expression
domain, but in others not, depending on how the ems/Emx domain
overlaps with the fate map in embryos of different phyla.
A second conclusion we can draw from our cross-species experiments is that
an orthologous gene does not necessarily have the same function, even if it
can substitute for its ortholog in a cross-species rescue experiment. For
example, the fact that mouse Pax6 can substitute for its fly
counterpart and generate ectopic eyes has been taken as an indicator that
these two genes have the same function in development (for a review, see
Gehring and Ikeo, 1999
). By
contrast, ceh-2 can rescue fly ems brain defects, even
though it plays no role in the development of the C. elegans ring
ganglia: the 'brain'. ceh-2 does have a function in pharynx neurons,
which may have a common function with neurons in the CNS. We suggest that the
primary reason for cross-species rescue lies in appropriate sequence
conservation, and is not necessarily related to particular functions in the
ontogeny of an animal.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Aguinaldo, A. M., Turbeville, J. M., Linford, L. S., Rivera, M.
C., Garey, J. R., Raff, R. A. and Lake, J. A. (1997).
Evidence for a clade of nematodes, arthropods and other moulting animals.
Nature 387,489
-493.[CrossRef][Medline]
Avery, L. (1993). Motor neuron M3 controls
pharyngeal muscle relaxation timing in Caenorhabditis elegans.
J. Exp. Biol. 175,283
-297.[Abstract]
Avery, L. and Horvitz, H. R. (1989). Pharyngeal
pumping continues after laser killing of the pharyngeal nervous system of
C. elegans. Neuron
3, 473-485.[CrossRef][Medline]
Avery, L., Raizen, D. and Lockery, S. (1995).
Electrophysiological methods. Methods Cell Biol.
48,251
-269.[Medline]
Azzaria, M., Goszczynski, B., Chung, M. A., Kalb, J. M. and
McGhee, J. D. (1996). A fork head/HNF-3 homolog expressed in
the pharynx and intestine of the Caenorhabditis elegans embryo.
Dev. Biol. 178,289
-303.[CrossRef][Medline]
Beauchemin, M., del Rio-Tsonis, K., Tsonis, P. A., Tremblay, M.
and Savard, P. (1998). Graded expression of Emx-2 in
the adult newt limb and its corresponding regeneration blastema. J.
Mol. Biol. 279,501
-511.[CrossRef][Medline]
Bishop, K. M., Goudreau, G. and O'Leary, D. D.
(2000). Regulation of area identity in the mammalian neocortex by
Emx2 and Pax6. Science
288,344
-349.
Bellocchio, E. E., Reimer, R. J., Fremeau, R. T., Jr and
Edwards, R. H. (2000). Uptake of glutamate into synaptic
vesicles by an inorganic phosphate transporter.
Science 289,957
-960.
Bürglin, T. R. (1994). A comprehensive
classification of homeobox genes. In Guidebook to the Homeobox
Genes (ed. D. Duboule), pp. 25-71.
Oxford: Oxford University Press.
Bürglin, T. R. (1995). The evolution of
homeobox genes. In Biodiversity and Evolution (ed. R.
Arai, M. Kato and Y. Doi), pp. 291-336. Tokyo: The
National Science Museum Foundation.
Bürglin, T. R. (1997). Analysis of TALE
superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel
domain conserved between plants and animals. Nucleic Acids
Res. 25,4173
-4180.
Bürglin, T. R. and Ruvkun, G. (1992). New
motif in PBX genes. Nat. Genet.
1, 319-320.[CrossRef][Medline]
Bürglin, T. R., Finney, M., Coulson, A. and Ruvkun, G.
(1989). Caenorhabditis elegans has scores of
homoeobox-containing genes. Nature
341,239
-243.[CrossRef][Medline]
Dalton, D., Chadwick, R. and McGinnis, W.
(1989). Expression and embryonic function of empty
spiracles: a Drosophila homeo box gene with two patterning
functions on the anterior-posterior axis of the embryo. Genes
Dev. 3,1940
-1956.
Finney, M. and Ruvkun, G. (1990). The
unc-86 gene product couples cell lineage and cell identity in C.
elegans. Cell 63,895
-905.[CrossRef][Medline]
Gehring, W. J. and Ikeo, K. (1999). Pax
6: mastering eye morphogenesis and eye evolution. Trends
Genet. 15,371
-377.[CrossRef][Medline]
Halder, G., Callaerts, P. and Gehring, W. J.
(1995). Induction of ectopic eyes by targeted expression of the
eyeless gene in Drosophila. Science
267,1788
-1792.
Hartmann, B., Hirth, F., Walldorf, U. and Reichert, H.
(2000). Expression, regulation and function of the homeobox gene
empty spiracles in brain and ventral nerve cord development of
Drosophila. Mech. Dev.
90,143
-153.[CrossRef][Medline]
Haun, C., Alexander, J., Stainier, D. Y. and Okkema, P. G.
(1998). Rescue of Caenorhabditis elegans pharyngeal
development by a vertebrate heart specification gene. Proc. Natl.
Acad. Sci. USA 95,5072
-5075.
Hirth, F., Therianos, S., Loop, T., Gehring, W. J., Reichert, H.
and Furukubo-Tokunaga, K. (1995). Developmental defects in
brain segmentation caused by mutation of the homeobox genes
orthodenticle and empty spiracles in Drosophila.
Neuron 15,769
-778.[CrossRef][Medline]
Horner, M. A., Quintin, S., Domeier, M. E., Kimble, J.,
Labouesse, M. and Mango, S. E. (1998). pha-4, an
HNF-3 homolog, specifies pharyngeal organ identity in Caenorhabditis
elegans. Genes Dev.
12,1947
-1952.
Horvitz, H. R., Chalfie, M., Trent, C., Sulston, J. E. and
Evans, P. D. (1982). Serotonin and octopamine in the nematode
Caenorhabditis elegans. Science
216,1012
-1014.
Inoue, T., Sherwood, D. R., Aspöck, G., Butler, J. A.,
Gupta, B. P., Kirouac, M., Wang, M., Lee, P.-Y., Kramer, J. M., Hope, I. et
al. (2002). Gene expression markers for C. elegans
vulval cells. Gene Expr. Patt.
2, 235-241.
Janke, D. L., Schein, J. E., Ha, T., Franz, N. W., O'Neil, N.
J., Vatcher, G. P., Stewart, H. I., Kuervers, L. M., Baillie, D. L. and Rose,
A. M. (1997). Interpreting a sequenced genome: toward a
cosmid transgenic library of Caenorhabditis elegans.
Genome Res. 7,974
-985.
Jansen, G., Hazendonk, E., Thijssen, K. L. and Plasterk, R.
H. (1997). Reverse genetics by chemical mutagenesis in
Caenorhabditis elegans. Nat. Genet.
17,119
-121.[CrossRef][Medline]
Jürgens, G., Wieschaus, E., Nüsslein-Volhard, C. and
Kluding, H. (1984). Mutations affecting the pattern of the
larval cuticle in Drosophila melanogaster. II. Zygotic loci on the
third Chromosome. Roux's Arch. Dev. Biol.
193,283
-295.[CrossRef]
Kastury, K., Druck, T., Huebner, K., Barletta, C., Acampora, D.,
Simeone, A., Faiella, A. and Boncinelli, E. (1994).
Chromosome locations of human EMX and OTX genes.
Genomics 22,41
-45.[CrossRef][Medline]
Lee, R. Y. N., Sawin, E. R., Chalfie, M., Horvitz, H. R. and
Avery, L. (1999). EAT-4, a homolog of a mammalian
sodium-dependent inorganic phosphate cotransporter, is necessary for
glutamatergic neurotransmission in Caenorhabditis elegans.
J. Neurosci. 19,159
-167.
Lee, T. I. and Young, R. A. (2000).
Transcription of eukaryotic protein-coding genes. Annu. Rev.
Genet. 34,77
-137.[CrossRef][Medline]
Liu, J. and Fire, A. (2000). Overlapping roles
of two Hox genes and the exd ortholog ceh-20 in diversification of
the C. elegans postembryonic mesoderm.
Development 127,5179
-5190.[Abstract]
Mallamaci, A., Muzio, L., Chan, C. H., Parnavelas, J. and
Boncinelli, E. (2000). Area identity shifts in the early
cerebral cortex of Emx2-/- mutant mice. Nat.
Neurosci. 3,679
-686.[CrossRef][Medline]
Mango, S. E., Lambie, E. J. and Kimble, J.
(1994). The pha-4 gene is required to generate the
pharyngeal primordium of Caenorhabditis elegans.
Development 120,3019
-3031.[Abstract]
Mann, R. S. and Affolter, M. (1998). Hox
proteins meet more partners. Curr. Opin. Genet. Dev.
8, 423-429.[CrossRef][Medline]
Mello, C. and Fire, A. (1995). DNA
transformation. Methods Cell Biol.
48,451
-482.[Medline]
Meinhardt, H. (2002). The radial-symmetric
hydra and the evolution of the bilateral body plan: an old body became a young
brain. BioEssays 24,185
-191.[CrossRef][Medline]
Miller, D. M. I., Ortiz, I., Berliner, G. C. and Epstein, H.
F. (1983). Differential localization of two myosins within
nematode thick filaments. Cell
34,477
-790.[CrossRef][Medline]
Miyamoto, N., Yoshida, M., Kuratani, S., Matsuo, I. and Aizawa,
S. (1997). Defects of urogenital development in mice lacking
Emx2. Development 124,1653
-1664.[Abstract]
Mokady, O., Dick, M. H., Lackschewitz, D., Schierwater, B. and
Buss, L. (1998). Over one-half bilion years of head
conservation? Expression of an ems class gene in Hydractinia
symbiolongicarpus (Cnidaria: Hydrozoa). Proc. Natl. Acad. Sci.
USA 95,3673
-3678.
Morita, T., Nitta, H., Kiyama, Y., Mori, H. and Mishina, M.
(1995). Differential expression of two zebrafish emx homeoprotein
mRNAs in the developing brain. Neurosci. Lett.
198,131
-134.[CrossRef][Medline]
Nassif, C., Noveen, A. and Hartenstein, V.
(1998). Embryonic development of the Drosophila brain.
I. Pattern of pioneer tracts. J. Comp. Neurol.
402, 10-31.[CrossRef][Medline]
Oda, I. and Saiga, H. (2001). Hremx,
the ascidian homologue of ems/emx, is expressed in the anterior and
posterior-lateral epidermis but not in the central nervous system during
embryogenesis. Dev. Genes Evol.
211,291
-298.[CrossRef][Medline]
Okkema, P. G. and Fire, A. (1994). The
Caenorhabditis elegans NK-2 class homeoprotein CEH-22 is involved in
combinatorial activation of gene expression in pharyngeal muscle.
Development 120,2175
-2186.[Abstract]
Page, D. T. (2002). Inductive patterning of the
embryonic brain in Drosophila. Development
129,2121
-2128.
Pannese, M., Lupo, G., Kablar, B., Boncinelli, E., Barsacchi, G.
and Vignali, R. (1998). The Xenopus Emx genes
identify presumptive dorsal telencephalon and are induced by head organizer
signals. Mech. Dev. 73,73
-83.[CrossRef][Medline]
Raizen, D. M. and Avery, L. (1994). Electrical
activity and behavior in the pharynx of Caenorhabditis elegans.
Neuron 12,483
-495.[CrossRef][Medline]
Ranganathan, R., Sawin, E. R., Trent, C., Horvitz, H. R.
(2001). Mutations in the Caenorhabditis elegans serotonin
reuptake transporter MOD-5 reveal serotonin-dependent and -independent
activities of fluoxetine. J. Neurosci.
21,5871
-5884.
Reichert, H. and Simeone, A. (1999). Conserved
usage of gap and homeotic genes in patterning the CNS. Curr. Opin.
Neurobiol. 9,589
-595.[CrossRef][Medline]
Sawin, E. R., Ranganathan, R. and Horvitz, H. R.
(2000). C. elegans locomotory rate is modulated by the
environment through a dopaminergic pathway and by experience through a
serotonergic pathway. Neuron
26,619
-631.[CrossRef][Medline]
Schnabel, R., Hutter, H., Moerman, D. and Schnabel, H.
(1997). Assessing normal embryogenesis in
Caenorhabditiselegans using a 4D microscope: variability of
development and regional specification. Dev. Biol.
184,234
-265.[CrossRef][Medline]
Simeone, A., Acampora, D., Gulisano, M., Stornaiuolo, A. and
Boncinelli, E. (1992). Nested expression domains of four
homeobox genes in developing rostral brain. Nature
358,687
-690.[CrossRef][Medline]
Shinozaki, K., Miyagi, T., Yoshida, M., Miyata, T., Ogawa, M.,
Aizawa, S., Suda, Y. (2002). Absence of Cajal-Retzius cells
and subplate neurons associated with defects of tangential cell migration from
ganglionic eminence in Emx1/2 double mutant cerebral cortex.
Development 129,3479
-3492.
Sulston, J. E., Schierenberg, E., White, J. G. and Thomson, J.
N. (1983). The embryonic cell lineage of the nematode
Caenorhabditis elegans. Dev. Biol.
100,64
-119.[CrossRef][Medline]
Sze, J. Y., Victor, M., Loer, C., Shi, Y. and Ruvkun, G.
(2000). Food and metabolic signalling defects in a Caenorhabditis
elegans serotonin-synthesis mutant. Nature
403,560
-564.[CrossRef][Medline]
Takamori, S., Rhee, J. S., Rosenmund, C. and Jahn, R.
(2000). Identification of a vesicular glutamate transporter that
defines a glutamatergic phenotype in neurons. Nature
407,189
-194.[CrossRef][Medline]
The C. elegans Sequencing Consortium
(1998). Genome sequence of the nematode C. elegans: a
platform for investigating biology. Science
282,2012
-2018.
Thummel, C. S. and Pirrotta, V. (1992). New
pCaSpeR P element vectors. Drosophila Inf. Serv.
71, 150.
Tole, S., Goudreau, G., Assimacopoulos, S. and Grove, E. A.
(2000). Emx2 is required for growth of the hippocampus but not
for hippocampal field specification. J. Neurosci.
20,2618
-2625.
Van Auken, K., Weaver, D., Robertson, B., Sundaram, M., Saldi,
T., Edgar, L., Elling, U., Lee, M., Boese, Q. and Wood, W. B.
(2002). Roles of the Homothorax/Meis/Prep homolog UNC-62 and the
Exd/Pbx homologs CEH-20 and CEH-40 in C. elegans embryogenesis.
Development 129,5255
-5268.
Walldorf, U. and Gehring, W. J. (1992).
Empty spiracles, a gap gene containing a homeobox involved in
Drosophila head development. EMBO J.
11,2247
-2259.[Medline]
Williams, N. A. and Holland, P. W. (2000). An
amphioxus emx homeobox gene reveals duplication during vertebrate
evolution. Mol. Biol. Evol.
17,1520
-1528.
This article has been cited by other articles:
![]() |
R. Jovelin Rapid Sequence Evolution of Transcription Factors Controlling Neuron Differentiation in Caenorhabditis Mol. Biol. Evol., October 1, 2009; 26(10): 2373 - 2386. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||