|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00558

1 Developmental Biology, Institute Biology 1, University of Freiburg,
Hauptstrasse 1, D-79104 Freiburg, Germany
2 Max-Planck-Institute für Biophysikalische Chemie, Abt. Molekulare
Entwicklungsbiologie, Am Fassberg 11, 37077 Göttingen, Germany
3 Department of Developmental Biology, Children's Hospital Research Foundation,
3333 Burnet Avenue, Cincinnati, OH 45229, USA
Author for correspondence (e-mail:
driever{at}biologie.uni-freiburg.de)
Accepted 23 April 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Zebrafish, Bmp, bozozok, Gastrula organizer, Dorsoventral pattern, Transcription repression
| INTRODUCTION |
|---|
|
|
|---|
Mutations in bozozok (boz) affect proper establishment of
the zebrafish gastrula organizer. boz mutant embryos lack axial
mesoderm and have severe patterning defects in the anterior neuroectoderm
(Solnica-Krezel et al., 1996
;
Solnica-Krezel and Driever,
2001
). boz encodes a homeodomain protein also known as
Dharma and Nieuwkoid (Koos and Ho,
1998
; Yamanaka et al.,
1998
; Fekany et al.,
1999
). It is transcribed in dorsal blastomeres and in the dorsal
yolk syncytial layer from the earliest zygotic gene expression until early
gastrula (Yamanaka et al.,
1998
). Hyperdorsalization of zebrafish embryos by incubation in
lithium chloride, which activates ß-catenin signaling, results in
expression of boz around the margin
(Yamanaka et al., 1998
).
Active components of ß-catenin signaling are required for boz
expression (Shimizu et al.,
2000
), which is mediated through TCF/LEF binding sites in the
boz promoter (Ryu et al.,
2001
). The function of boz is required for expression of
gsc and many other organizer-specific genes
(Fekany et al., 1999
). Thus,
boz might be directly activated by Wnt/ß-catenin signaling and
might directly mediate some activities of the Nieuwkoop center to establish
the organizer. boz encodes a homeodomain protein and has been
suggested to be involved in regulating expression of zygotic patterning genes
acting both in the Nieuwkoop center and in the gastrula organizer. Recent
studies indicate that boz is required for downregulation of
bmp2b expression on the dorsal side
(Koos and Ho, 1999
) and it has
also been suggested to interfere with Wnt signaling
(Fekany-Lee et al., 2000
) and
Nodal signaling (Shimizu et al.,
2000
). However, the mechanism by which boz exerts its
function at the crossroads of anterioposterior and dorsoventral patterning is
not yet understood.
In this study, we investigate the role of boz in establishing dorsoventral polarity at the molecular level. We show that Boz acts as a transcriptional repressor, because fusion proteins containing the Boz homeodomain and the Drosophila Engrailed repressor domain can rescue the boz mutant phenotype. By contrast, a fusion of Boz with the VP16 transcriptional activator domain acts as a Boz antimorph, phenocopying the boz mutant phenotype and ventralizing the embryo. Repression of bmp2b does not require translation of zygotic gene products and thus must be a direct effect of Boz. We identify two high-affinity binding sites for Boz in the first intron of bmp2b and demonstrate by deletion analysis that the Boz-binding sites mediate bmp2b repression. We suggest a molecular pathway for initiation of dorsoventral asymmetry of bmp2b expression in which ß-catenin signaling activates boz, which, in turn, represses bmp2b transcription in the prospective organizer.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
-eh1) was
generated by recombinant PCR to delete the eh1 motif (amino acids 9-15).
Boz(HD) was generated by subcloning the C-terminal amino acids 105-192 with
the homeodomain into pCS2+. Capped sense RNA was synthesized using SP6 RNA
polymerase and the mMESSAGE mMACHINE system (Ambion) after NotI
digestion in pCS2+.
For CHX treatment (modified from Gard
et al., 1990
), embryos were injected with mRNA at the early
one-cell stage, subsequently dechorionated using pronaseE (Sigma, 1 mg
ml-1) and incubated in 0.3x Danieau's medium. At 1.5 hours
post-fertilization (hpf), the medium was replaced with 0.3x Danieau's
medium containing 10 µg ml-1 CHX (Calbiochem, diluted from 100
mg ml-1 stock in ethanol). Embryos were maintained in CHX until
control embryos had reached sphere stage and then fixed for whole-mount in
situ hybridization.
bmp2b regulatory region
Genomic PAC clones containing bmp2b were isolated by filter
hybridization of a zebrafish genomic library (RZPD, Berlin) with a
bmp2b cDNA probe. The 3.5 kb upstream of the bmp2b coding
region, including the first intron, were sequenced by primer walking. The
transcription start site was determined by primer extension analysis (MMLV
reverse transcriptase, Ambion. bmp2b primer:
5'-TTCCCGTCGTCTCCTAAGTTC-3').
Electrophoretic mobility shift assay
The Boz bacterial expression construct was generated by subcloning the
boz full-length cDNA into the 6xHis-tagged bacterial expression
vector pET15b (Novagen), followed by transformation into BL21(DE3pLysS) strain
bacteria. Bacterial recombinant Boz protein was induced by IPTG at 25°C
for 4 hours and then isolated and purified over a Talon (Clontech) affinity
column according to the manufacturer's instructions.
For each of the double-stranded oligonucleotides used, one of the two
strands was 32P end-labeled by the T4 kinase reaction or by Klenow
fill-in reaction. Probe (10,000 cpm per 10 fmoles) was incubated with 0.1
µg of purified Boz protein in the presence of 0.76 µg of poly d(I-C) in
binding buffer (20 mM HEPES, 50 mM EDTA, 5 mM MgCl2, 5% glycerol, 1
mM DTT, pH 8) in a total volume of 10 µl as described
(Brannon et al., 1997
). Samples
were incubated on ice for 20 minutes, followed by a further 20-minute
incubation with the radiolabeled probe at room temperature. Electrophoresis
was performed in 4% polyacrylamide gel with 0.25x TBE buffer at room
temperature.
For the analysis of the bmp2b promoter, 3.5 kb of upstream region
was sequenced and seven 32P end-labeled DNA fragments (F1, -807 to
-445; F2, -466 to -124; F3, -151 to +214; F4, +280 to +901; F5, +880 to +1494;
F6, +1470 to +1741; F7, +1723 to +2343) were generated by PCR to cover almost
the entire region. The fragments F7 and F4 were each digested by two separate
sets of enzymes to generate overlapping sets of smaller fragments: (1)
AluI (for F7) or MboI and Sau3AI (for F4), followed
by radiolabeling with Klenow; (2) MseI digestion, ligation of
MseI adapters to the fragments and amplification of the ligated
fragments by PCR using end-labeled MseI adapter oligonucleotides. The
radiolabeled MseI PCR fragments were confirmed by electrophoretic
mobility shift assay (data not shown). Double-stranded oligonucleotides were
synthesized to verify binding sites: B1 (+1980 to +2033:
5'-GGTAAGTAAAATAATCTTATTTCAAACTAAAAGCAAGATTATTTTACTCACCAA),
B2 (+1470 to +1494: 5'-AAAGCAAGATTAGTTTACTGGCTTG), B3 (+537
to +565: 5'-GCGTGCCTGCATGTAATGTGTGAGGTCAG), B4 (+430 to +467:
5'-GCATTCAATTACGTGCTTGATATTACGTATTAGCAAAC),
B5 (+343 to +369: 5'-TCGCTTGTGGATTAAAACACGAATTCA), B6 (-151
to -124: 5'-GTATTGCGTATACATTACATTCTCGTTC) and B7 (-786 to
-759: 5'-GATGTAAAGTCAGAATTATTAGCCCCCT). Bicoid binding site
double-stranded oligonucleotide:
(5'-GTCACCTCTGCCCATCTAATCCCTTGACGC) from the
hunchback gene (Driever et al.,
1989
). Underlined nucleotides indicate potential Bicoid-type
homeodomain binding sites.
Luciferase assay of promoter activity
The Bmp2b-pLUC promoter fusion (bmp2b -806 to +2538) was generated
by subcloning the bmp2b fragment at the BamHI and
HindIII sites into the pLUC vector (a luciferase derivative of
pBLCAT6 provided by J. Altschmied, Würzburg)
(Boshart et al., 1992
).
Promoter fusions that have the binding sites B1 and /or B4 deleted were
constructed by PCR-based subcloning. Bmp
1pLUC has a deletion (basepairs
+1983 to +2030) spanning site B1, Bmp
4pLUC has a deletion (basepairs
+432 to +490) spanning site B4 and Bmp
1,4pLUC has both of these sites
deleted but still contains the sequence +491 to +1982 of the first intron.
Embryos were harvested within 5 minutes of fertilization and the chorions were removed with pronase E (Sigma, 1 mg/ml). The embryos were co-injected with linearized pLUC reporter DNA derivatives and mRNA during early one-cell stage. The embryos were then incubated at 28.5°C for 5 hours. Ten microfuge tubes of ten embryos were collected for each experimental condition, the supernatant was aspirated and the embryos were frozen at -80°C immediately after addition of 80 µl lysis buffer (0.1 M sodium phosphate buffer pH 7.3, 1 mM DTT, 0.2% Triton-X100, 0.2 mM AEBSF [4-(2-aminoethyl)benzenesulfonylfluoride hydrochloride; Sigma]. For the luciferase assays, embryos were thawed and dissolved by repeated pipetting, and the lysate cleared by centrifuging 10 minutes at 16,000 g (4°C). 60 µl of supernatant were transferred to 96-well microtiter plates on ice. 350 µl of reaction buffer (22.5 mM glycylglycin pH 7.8, 2 mM ATP, 10 mM MgSO4) were mixed (vortex) with 50 µl embryo extract in luminometer tubes and the reaction was started by injection of 0.2 mM D-luciferin in 20 mM glyclglycin pH 7.8. Measurements were recorded using a Lumat LB9501 (Berthold). Each experiment (ten measurements of ten embryos each) was performed at least in triplicate and the standard deviation was calculated.
| RESULTS |
|---|
|
|
|---|
To determine whether Boz functions as a transcriptional repressor in
zebrafish, we analysed the effects of repressor and activator fusion
constructs on embryonic axis formation. We created a fusion of the Engrailed
(En) repressor domain (amino acids 1-296)
(Han and Manley, 1993
) and the
homeodomain of Boz (amino acids 105-192)
(Fig. 1). Overexpression by
microinjection of 2 pg En-boz synthetic mRNA at the one-cell stage
induced dorsalization (Fig.
1A-D), which, at 24 hpf, is similar to that resulting from
overexpression of wild-type boz
(Yamanaka et al., 1998
).
Injection of 0.05-0.25 pg of En-boz mRNA into progeny of boz
heterozygous parents provides some phenotypic rescue, shifting the
distribution of boz phenotypic classes from severe class I and II
mutant phenotypes to the less severe classes IV and V
(Table 1). We observed a
reduction in the penetrance of the mutant phenotype, indicating complete
rescue in some cases. In addition, at the higher concentration, a large
proportion of embryos become dorsalized, resembling snailhouse or
piggytail phenotypes (Mullins et
al., 1996
). This dorsalizing activity occurs during early
patterning. Overexpression of either En-boz
(Fig. 2E,F,M,N) or boz
mRNA (Fig. 2C,D,K,L) induced
ectopic chd and gsc expression in 50% epiboly stage
wild-type embryos. Thus, the En-Boz fusion protein has activities similar to
wild-type Boz: overexpression of either Enboz or boz mRNA
can rescue boz mutant phenotypes and hyperdorsalize wild-type
embryos.
|
|
-eh1). When injected into
one-cell stage embryos, boz(
-eh1) mRNA lacks
dorsalizing activity, even when as much as 25 pg mRNA were injected (data not
shown). Thus, the eh1 motif is essential for the dorsalizing activity of Boz
in zebrafish embryos. A Boz derivative lacking the homeodomain,
Boz(
-HD), has been reported to show no biological activity in zebrafish
embryos (Koos and Ho, 1999
VP16-Boz fusion protein functions as a Boz antimorph
We created the transcriptional activator fusion construct VP16-boz
by fusing the VP16 activator domain (C-terminal 72 amino acids;
Sadowski et al., 1988
) to the
Boz homeodomain (amino acids 105-192; Fig.
1). Injection of 5 pg VP16-boz mRNA into one-cell-stage
embryos produced the full range of boz mutant phenotypes
(Fig. 1G,H). Increasing amounts
of injected VP16-boz mRNA resulted in a gradual increase in the
incidence of severe boz mutant phenotypes
(Table 2). In addition, some
embryos were ventralized, showing an expansion of ventral fates such as the
blood-forming region and enlarged ventral tail fins. Consistent with the
morphological defects, expression of the organizer specific genes gsc
and chd was reduced in VP16-boz injected wild-type embryos
at 50% epiboly (Fig. 2G,H,O,P). Taken together, these data suggest that the VP16-Boz fusion protein acts like
a boz antimorph, induces ventralization and phenocopies the
boz mutant phenotype. As VP16 fusion proteins cause increased levels
of transcription of target genes, our finding of diminished expression of
chd and gsc indicates that VP16-Boz only indirectly affects
these genes. We postulate that VP16-Boz activates expression of ventral
factors, which in turn repress chd and gsc
transcription.
|
|
The complexity of dorsoventral patterning interactions could still make the interaction between boz and bmp2b an indirect one, by Boz repressing an activator of zygotic bmp2b transcription. To investigate whether other early zygotic genes contribute to the effect of Boz on bmp2b transcription, we inhibited translation of zygotically expressed mRNAs with CHX by incubating embryos from 1.5 hpf onwards in 10 µg ml-1 CHX. In this experiment, maternal and injected mRNAs are translated during the first 90 minutes before CHX is added but zygotic transcripts generated after the mid-blastula transition are not translated in the presence of CHX. At this CHX concentration, we find that gsc expression is not detectable and thus depends on the presence of other zygotic gene products (Fig. 4B,H). bmp2b is not affected by CHX and is thus activated by maternal factors (Fig. 4A,G). Repression of bmp2b transcription by overexpression of boz is not affected by CHX (Fig. 4C,I). Similarly, activation of bmp2b expression by overexpression of boz-VP16 also occurs in the presence of CHX (Fig. 4E,K). This demonstrates that zygotic gene products are not required to mediate the repressive effect of Boz on bmp2b transcription. Further, our data on gsc expression (Fig. 4D,J,F,L) demonstrate that the effect of Boz on gsc requires the expression of zygotic proteins.
|
|
1pLUC; 4.6-times
repression) or B4 (Bmp
4pLUC; 4.5-times repression) each reduced the
repression observed with BmppLUC (10.2-times repression) by more than half
(Fig. 6B). Deletion of both B1
and B4 (Bmp
1,4pLUC; 1.6-times repression) reduced the repression six
times to levels within the error margin of control injections. Thus, we show
that Boz can repress bmp2b transcription directly by binding to sites
B1 and B4 within the first intron of bmp2b.
|
| DISCUSSION |
|---|
|
|
|---|
Transcriptional repression of bmp2b in the nascent organizer
by Boz
Bmp2 and Bmp4 function as instructive signals that determine positional
identities along the dorsoventral axis
(Dosch et al., 1997
). Zebrafish
swirl/bmp2b mutants
(Kishimoto et al., 1997
;
Nguyen et al., 1998
) share
common phenotypic features with bmp4 mutant mice
(Winnier et al., 1995
) and the
Swirl/bmp2b expression pattern is similar to that of
Xenopus bmp4 (Nikaido et al.,
1997
). Thus, zebrafish bmp2b seems to be similar in
function to mouse or Xenopus bmp4, playing essential roles in the
establishment of the dorsoventral axis in these organisms. In zebrafish,
bmp2b is initially ubiquitously expressed at sphere stage. Only a
small domain at the dorsal margin is devoid of bmp2b expression.
bmp2b expression becomes progressively restricted to the ventral
region during late blastula and early gastrula stages to form the Bmp gradient
(Nikaido et al., 1997
).
Expression in the yolk syncytial layer (YSL) is maintained during
gastrulation. Although the initiation of bmp2b expression does not
depend on its function, the maintenance of bmp2b expression from
shield stage on requires functional Bmp2b protein and its downstream effector
Somitabun/Smad5 (Kishimoto et
al., 1997
; Hild et al.,
1999
; Kramer et al.,
2002
). Although the Bmp antagonist Chordin is required to form and
maintain the dorsoventral gradient of bmp2b expression during
gastrulation, bmp2b expression at sphere stage is normal in
chd mutant embryos
(Miller-Bertoglio et al.,
1997
). Likewise, chd expression is normal through early
shield stage in the dorsalizing mutants swr, sbn and snh. In
these mutants, chd expression expands in lateral and ventral
directions only as epiboly proceeds
(Miller-Bertoglio et al.,
1997
). The initiation of the dorsoventral asymmetry of
bmp2b expression at sphere stage is thought to depend on dorsally
localized factor(s), but the exact mechanism by which bmp2b
expression is initially blocked on the dorsal side was previously unclear.
Our data provide five lines of evidence that the earliest repression of bmp2b in the presumptive organizer is a direct activity of Boz at sphere stage.
Model for the role of boz during initiation of the
organizer
Our data show that dorsoventral asymmetry of bmp2b expression is
initiated at the level of transcription
(Fig. 7). In the absence of
boz, maternal factors like Smad5/Sbn
(Kramer et al., 2002
) lead to
ubiquitous zygotic expression of bmp2b. The presence of
bmp2b in the organizer region of boz mutants interferes with
the establishment of the organizer because Bmp2b mediates repression of
chd and other organizer genes. In the presence of Boz, a
bmp2b-free dorsal marginal zone is generated, which promotes proper
organizer formation through other targets of ß-catenin/Tcf/Lef signaling.
The variable expressivity of the boz mutant phenotype can be
understood as the result of the competition between Nieuwkoop-center signaling
activity to establish the organizer and Bmp2b-mediated repression of organizer
genes. This competition might have a variable outcome, as reflected by the
variable penetrance and expressivity of the boz mutant phenotype
(Fekany et al., 1999
):
occasionally, ß-catenin signaling is strong enough to induce a
near-normal organizer even in the absence of functional Boz. More often,
bmp2b repression by Boz is required to permit the formation of a
potent organizer. Thus, the Nieuwkoop center itself is involved in two
activities: (1) induction of organizer genes (e.g. chd, noggin and
gsc); and (2) direct repression of ventralizing signals at the dorsal
margin.
|
Several questions remain. How can transcriptional repression of
bmp2b by overexpression of boz explain the concurrent
expansion of gsc and chd expression? Interestingly,
following boz overexpression, gsc and chd
expression expand to marginal and dorso-animal positions, but not to
ventro-animal positions. We suggest that this ventrolateral expansion of
gsc and chd is not a consequence of repressed bmp2b
expression, because gsc and chd expression are normal in
bmp2b/swr mutants during late blastula and early gastrula stages
(Miller-Bertoglio et al.,
1997
; Mullins et al.,
1996
). Instead, we postulate that the expansion of gsc
and chd results from the repression of additional boz target
genes like vega1 (vox) and vega2 (vent),
which are ventrolaterally expressed and can repress gsc and
chd (Imai et al.,
2001
). In the zebrafish Dfst7 mutant,
which lacks both vox and vent loci, chd and
gsc expression are ventrolaterally expanded
(Imai et al., 2001
). Following
boz-mediated repression of vox and vent, and the
elimination of their repressive effect on chd and gsc,
ß-catenin or its effectors might induce chd and gsc
expression around the margin. The accumulation of ß-catenin even at
ventrolateral positions has been reported for late blastula and early gastrula
stage zebrafish (R. Warga, Origin and specification of the endoderm in the
zebrafish, Danio rerio. PhD thesis, Eberhardt-Karls-Universität
Tübingen, Germany, 1996). Similarly, enhanced levels of nuclear
translocation of ß-catenin have been observed in Xenopus early
gastrulae in a region extending to more lateral positions than those of
gsc or chd expression
(Schneider et al., 1996
).
Homologs of Siamois (Lemaire et
al., 1995
) and Twin
(Laurent et al., 1997
), which
mediate the effect of ß-catenin signaling to cause activation of
organizer genes like gsc (Cho et
al., 1991
; Laurent et al.,
1997
) in Xenopus, have not yet been described for
zebrafish.
Our findings correlate with data obtained from experiments in
Xenopus, which indicate that inhibition of Bmp and Nodal, Bmp and Wnt
signaling, or of Bmp, Nodal and Wnt pathways is sufficient for head induction
(Glinka et al., 1997
;
Piccolo et al., 1999
).
Induction of neurectoderm in Xenopus can be promoted by
Wnt/ß-catenin signaling (Baker et al.,
1999
). This suggests that, in zebrafish, boz might serve
as a downstream effector of Wnt signaling in this process. Early expression of
ß-catenin induces the expression of neural-specific markers and
inhibits the expression of bmp4 in Xenopus ectoderm.
Further, Wnt, but not the Bmp antagonist Noggin, can inhibit bmp4
expression at early gastrula stages. Boz could be the functional homolog of an
as-yet-unidentified gene in Xenopus that mediates
Wnt-signaling-dependent repression of bmp4 expression.
The alteration in bmp2b expression in boz mutants from
that of the wild type is not sufficient to explain the observed degree of
anterioposterior and dorsoventral patterning defects. The boz mutants
have less severe expansion of bmp2b expression than do chd
mutants, but more severe dorsoventral patterning defects. Further,
overexpression of zebrafish dkk1, a Wnt antagonist, can rescue
anterior neural plate and axial mesoderm defects in boz mutant
embryos (Hashimoto et al.,
2000
). Our finding that Boz acts as a repressor suggests that Boz
might also directly interact with some component of the zygotic Wnt signaling
pathway, that functions in the dorsal blastula and early gastrula.
From an evolutionary viewpoint, our findings point at potential similarities in the initiation of dorsoventral Bmp/Dpp asymmetry in both vertebrates and invertebrates. In Drosophila, transcriptional repression by Dorsal initiates dorsally restricted expression of the potent Dpp morphogen and our data show that an analogous strategy is applied to restrict the early source of Bmp2b locally in zebrafish. The later Dpp/Bmp2b Sog/Chd antagonism then fine tunes and maintains the activity of the Dpp/Bmp2b morphogen on the appropriate side of the embryo. The requirement for a combination of initial restriction by transcriptional control and later inhibition of protein function by antagonists to mediate the initiation, establishment and maintenance of the Dpp/Bmp2b morphogen gradient is thus a feature found in both arthropods and vertebrates.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Baker, J. C., Beddington, R. S. and Harland, R. M.
(1999). Wnt signaling in Xenopus embryos inhibits
bmp4 expression and activates neural development. Genes
Dev. 13,3149
-3159.
Brannon, M., Gomperts, M., Sumoy, L., Moon, R. T. and Kimelman,
D. (1997). A ß-catenin/XTcf-3 complex binds to the
Siamois promotor to regulate dorsal axis specification in
Xenopus. Genes Dev.
11,2359
-2370.
Boshart, M., Kluppel, M., Schmidt, A., Schütz, G. and
Luckow, B. (1992). Reporter constructs with low background
activity utilizing the cat gene. Gene
110,129
-130.[CrossRef][Medline]
Cho, K. W. Y., Blumberg, B., Steinbeisser, H. and De Robertis,
E. M. (1991). Molecular nature of Spemann's organizer: the
role of the Xenopus homeobox gene Goosecoid.
Cell 67,1111
-1120.[CrossRef][Medline]
Dick, A., Hild, M., Bauer, H., Imai, Y., Maifeld, H., Schier, A.
F., Talbot, W. S., Bouwmeester, T. and Hammerschmidt, M.
(2000). Essential role of Bmp7 (snailhouse) and its
prodomain in dorsoventral patterning of the zebrafish embryo.
Development 127,343
-354.[Abstract]
Dosch, R., Gawantka, V., Delius, H., Blumenstock, C. and Niehrs,
C. (1997). Bmp-4 acts as a morphogen in dorsoventral mesoderm
patterning in Xenopus. Development
124,2325
-2334.[Abstract]
Driever, W., Thoma, G. and Nüsslein-Volhard, C.
(1989). Determination of spatial domains of zygotic gene
expression in the Drosophila embryo by the affinity of binding sites
for the bicoid morphogen. Nature
340,363
-367.[CrossRef][Medline]
Ermakova, G. V., Alexandrova, E. M., Kazanskaya, O. V.,
Vasiliev, O. L., Smith, M. W. and Zaraisky, A. G. (1999). The
homeobox gene, Xanf-1, can control both neural differentiation and
patterning in the presumptive anterior neurectoderm of the Xenopus
laevis embryo. Development
126,4513
-4523.[Abstract]
Fekany, K., Yamanaka, Y., Leung, T., Sirotkin, H. I.,
Topczewski, J., Gates, M. A., Hibi, M., Renucci, A., Stemple, D., Radbill, A.
et al. (1999). The zebrafish bozozok locus encodes
Dharma, a homeodomain protein essential for induction of gastrula organizer
and dorsoanterior embryonic structures. Development
126,1427
-1438.[Abstract]
Fekany-Lee, K., Gonzalez, E., Miller-Bertoglio, V. and
Solnica-Krezel, L. (2000). The homeobox gene bozozok
promotes anterior neuroectoderm formation in zebrafish through negative
regulation of BMP2/4 and Wnt pathways. Development
127,2333
-2345.[Abstract]
Ferreiro, B., Artinger, M., Cho, K. and Niehrs, C.
(1998). Antimorphic goosecoids.
Development 125,1347
-1359.[Abstract]
Friedle, H., Rastegar, S., Paul, H., Kaufmann, E. and
Knöchel, W. (1998). Xvent-1 mediates BMP-4-induced
suppression of the dorsal-lip-specific early response gene
XFD-1' in Xenopus embryos. EMBO
J. 17,2298
-2307.[CrossRef][Medline]
Gard, D. L., Hafezi, S, Zhang, T. and Doxsey, S. J.
(1990). Centrosome duplication continues in cycloheximide-treated
Xenopus blastulae in the absence of a detectable cell cycle.
J. Cell Biol. 110,2033
-2042.
Glinka, A., Wu, W., Onichtchouk, D., Blumenstock, C. and Niehrs,
C. (1997). head induction by simultaneous repression of Bmp
and Wnt signalling in Xenopus. Nature
389,517
-519.[CrossRef][Medline]
Han, K. and Manley, J. L. (1993). Functional
domains of the Drosophila Engrailed protein. EMBO
J. 12,2723
-2733.[Medline]
Hashimoto, H., Itoh, M., Yamanaka, Y., Yamashita, S., Shimizu,
T., Solnica-Krezel, L., Hibi, M. and Hirano, T. (2000).
Zebrafish Dkk1 functions in forebrain specification and axial mesendoderm
formation. Dev. Biol.
217,138
-152.[CrossRef][Medline]
Hauptmann, G. (1999). Two-color detection of
mRNA transcript localizations in fish and fly embryos using alkaline
phosphatase and ß-galactosidase conjugated antibodies. Dev.
Genes Evol. 209,317
-321.[CrossRef][Medline]
Hemmati-Brivanlou, A. and Thomsen, G. H.
(1995). Ventral mesodermal patterning in Xenopus
embryos: expression patterns and activities of BMP-2 and BMP-4.
Dev. Genet. 17,78
-89.[CrossRef][Medline]
Hild, M., Dick, A., Rauch, G.-J., Meier, A., Bouwmeester, T.,
Haffter, P. and Hammerschmidt, M. (1999). The smad5
mutation somitabun blocks Bmp2b signaling during early dorsoventral
patterning of the zebrafish embryo. Development
126,2149
-2159.[Abstract]
Ho, C. Y., Houart, C., Wilson, S. W. and Stainier, D. Y.
(1999). A role for the extraembryonic yolk syncytial layer in
patterning the zebrafish embryo suggested by properties of the hex
gene. Curr. Biol. 9,1131
-1134.[CrossRef][Medline]
Holley, S. A., Jackson, P. D., Sasai, Y., De Robertis, E. M.,
Hoffmann, F. M. and Ferguson, E. L. (1995). A conserved
system for dorsal-ventral patterning in insects and vertebrates involving
Sog and Chordin. Nature
376,249
-253.[CrossRef][Medline]
Imai, Y., Gates, M. A., Melby, A. E., Kimelman, D., Schier, A.
F. and Talbot, W. S. (2001). The homeobox genes vox
and vent are redundant repressors of dorsal fates in zebrafish.
Development 128,2407
-2420.
Kawahara, A., Wilm, T., Solnica-Krezel, L. and Dawid, I. B.
(2000a). Antagonistic role of Vega1 and
bozozok/dharma homeobox genes in organizer formation.
Proc. Natl. Acad. Sci. USA
97,12121
-12126.
Kawahara, A., Wilm, T., Solnica-Krezel, L. and Dawid, I. B.
(2000b). Functional interaction of Vega2 and
Goosecoid homeobox genes in zebrafish.
Genesis 28,58
-67.[CrossRef][Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and
Schilling, T. F. (1995). Stages of embryonic development of
the zebrafish. Dev. Dyn.
203,253
-310.[Medline]
Kishimoto, Y., Lee, K. H., Zon, L., Hammerschmidt, M. and
Schulte-Merker, S. (1997). The molecular nature of zebrafish
swirl: BMP2 function is essential during early dorsoventral patterning.
Development 124,4457
-4466.[Abstract]
Koos, D. S. and Ho, R. K. (1998). The
Nieuwkoid gene characterizes and mediates a Nieuwkoop-center-like
activity in the zebrafish. Curr. Biol.
8,1199
-1206.[CrossRef][Medline]
Koos, D. S. and Ho, R. K. (1999). The
Nieuwkoid/dharma homeobox gene is essential for bmp2b
repression in the zebrafish pregastrula. Dev. Biol.
215,190
-207.[CrossRef][Medline]
Kramer, C., Mayr, T., Nowak, M., Schuhmacher, J., Runke, G.,
Bauer, H., Wagner, D. S., Schmid, B., Imai, Y., Talbot, W. S., Mullins, M. C.
and Hammerschmidt, M. (2002). Maternally supplied Smad5 is
required for ventral specification in zebrafish embryos prior to zygotic Bmp
signaling. Dev. Biol.
250,263
-279.[CrossRef][Medline]
Laurent, M. N., Blitz, I., Hashimoto, C., Rothbächer, U.
and Cho, K. W. Y. (1997). The Xenopus homeobox gene
Twin mediates Wnt induction of Goosecoid in establishment of
Spemann's organizer. Development
124,4905
-4516.[Abstract]
Lemaire, P., Garrett, N. and Gurdon, J. B.
(1995). Expression cloning of Siamois, a
Xenopus homeobox gene expressed in dorsal-vegetal cells of blastulae
and able to induce a complete secondary axis. Cell
81, 85-94.[CrossRef][Medline]
Marqués, G., Musacchio, M., Shimell, M. J.,
Wünnenberg-Stapleton, K., Cho, K. W. Y. and O'Connor, M. B.
(1997). Production of a DPP activity gradient in the early
Drosophila embryo through the opposing actions of the SOG and TLD
proteins. Cell 91,417
-426.[CrossRef][Medline]
Martinez-Barbera, J. P., Toresson, H., Da Rocha, S. and Krauss,
S. (1997). Cloning and Expression of three members of the
zebrafish Bmp family Bmp2a, Bmp2b and Bmp4.
Gene 198,53
-59.[CrossRef][Medline]
Melby, A. E., Clements, W. K. and Kimelman, D.
(1999). Regulation of dorsal gene expression in Xenopus
by the ventralizing homeodomain gene Vox. Dev.
Biol. 211,293
-305.[CrossRef][Medline]
Melby, A. E., Beach, C., Mullins, M. and Kimelman, D.
(2000). Patterning the early zebrafish by the opposing actions of
bozozok and vox/vent. Dev. Biol.
224,275
-285.[CrossRef][Medline]
Miller-Bertoglio, V. E., Fisher, S., Sanchez, A., Mullins, M. C.
and Halpern, M. E. (1997). Differential regulation of
Chordin expression domains in mutant zebrafish.
Developmental Biology
192,537
-550.[CrossRef][Medline]
Mullins, M. C., Hammerschmidt, M., Kane, D. A., Odenthal, J.,
Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Haffter, P.,
Heisenberg, C. P. et al. (1996). Genes establishing
dorsoventral pattern formation in the zebrafish embryo: the ventral specifying
genes. Development 123,81
-93.[Abstract]
Nguyen, V. H., Schmid, B., Trout, J., Connors, S. A., Ekker, M.
and Mullins, M. C. (1998). Ventral and lateral regions of the
zebrafish gastrula, including the neural crest progenitors, are established by
a bmp2b/Swirl pathway of genes. Dev. Biol.
199,93
-110.[CrossRef][Medline]
Nikaido, M., Tada, M., Saji, T. and Ueno, N.
(1997). Conservation of BMP signaling in zebrafish mesoderm
patterning. Mech. Dev.
61, 75-88.[CrossRef][Medline]
Onichtchouk, D., Gawantka, V., Dosch, R., Delius, H.,
Hirschfeld, K., Blumenstock, C. and Niehrs, C. (1996). The
Xvent-2 homeobox gene is part of the BMP-4 signalling pathway
controlling dorsoventral patterning of Xenopus mesoderm.
Development 122,3045
-3063.[Abstract]
Piccolo, S., Agius, E., Leyns, L., Bhattacharyya, S., Grunz, H.,
Bouwmeester, T. and De Robertis, E. M. (1999). The head
inducer Cerberus is a multifunctional antagonist of Nodal, MBP and Wnt
signals. Nature 397,707
-710.[CrossRef][Medline]
Pogoda, H.-M., Solnica-Krezel, L., Driever, W. and Meyer, D.
(2000). The zebrafish forkhead transcription factor FoxH1/Fast1
is a modulator of Nodal signaling required for organizer formation.
Curr. Biol 10,1041
-1049.[CrossRef][Medline]
Rastegar, S., Friedle, H., Frommer, G. and Knöchel, W.
(1999). Transcriptional regulation of Xvent homeobox
genes. Mech. Dev. 81,139
-149.[CrossRef][Medline]
Ryu, S. L., Fujii, R., Yamanaka, Y., Shimizu, T., Yabe, T.,
Hirata, T., Hibi, M. and Hirano, T. (2001). Regulation of
dharma/bozozok by the Wnt pathway. Dev. Biol.
231,397
-409.[CrossRef][Medline]
Sadowski, I., Ma, J., Triezenberg, S. and Ptashne, M.
(1988). GAL4-VP16 is an unusually potent transcriptional
activator. Nature 335,563
-564.[CrossRef][Medline]
Sasai, Y., Lu, B., Steinbeisser, H. and De, R. E.
(1995). Regulation of neural induction by the Chd and Bmp-4
antagonistic patterning signals in Xenopus.
Nature 376,333
-336.[CrossRef][Medline]
Schmid, B., Furthauer, M., Connors, S. A., Trout, J., Thisse,
B., Thisse, C. and Mullins, M. C. (2000). Equivalent genetic
roles for bmp7/Snailhouse and bmp2b/Swirl in dorsoventral
pattern formation. Development
127,957
-967.[Abstract]
Schneider, S., Steinbeisser, H., Warga, R. M. and Hausen, P.
(1996). ß-Catenin translocation into nuclei demarcates the
dorsalizing centers in frog and fish embryos. Mech.
Dev. 57,191
-198.[CrossRef][Medline]
Schulte-Merker, S., Lee, K. J., McMahon, A. P. and
Hammerschmidt, M. (1997). The zebrafish organizer requires
chordino. Nature
387,862
-863.[CrossRef][Medline]
Shimizu, T., Yamanaka, Y., Ryu, S.-L., Hashimoto, H., Yabe, T.,
Hirata, T., Bae, Y.-k., Hibi, M. and Hirano, T. (2000).
Cooperative roles of Bozozok/Dharma and Nodal-related proteins in the
formation of the dorsal organizer in zebrafish. Mech.
Dev. 91,293
-303.[CrossRef][Medline]
Shimizu, T., Yamanaka, Y., Nojima, H., Yabe, T., Hibi, M. and
Hirano, T. (2002). A novel repressor-type homeobox gene,
Ved, is involved in dharma/bozozok mediated dorsal organizer
formation in zebrafish. Mech. Dev.
118,125
-138.[CrossRef][Medline]
Smith, S. T. and Jaynes, J. B. (1996). A
conserved region of engrailed, shared among all En-, Gsc-, Nk1-, Nk2- and
Msh-class homeoproteins, mediates active transcriptional repression in vivo.
Development 122,3141
-3150.[Abstract]
Solnica-Krezel, L. and Driever, W. (2001). The
role of the homeodomain protein Bozozok in zebrafish axis formation.
Int. J. Dev. Biol. 45,299
-310.[Medline]
Solnica-Krezel, L., Stemple, D. L., Mountcastle-Shah, E.,
Rangini, Z., Neuhauss, S. C., Malicki, J., Schier, A. F., Stainier, D. Y.,
Zwartkruis, F., Abdelilah, S. et al. (1996). Mutations
affecting cell fates and cellular rearrangements during gastrulation in
zebrafish. Development
123, 67-80.[Abstract]
Trindade, M., Tada, M. and Smith, J. C. (1999).
DNA-binding specificity and embryological function of Xom (Xvent-2).
Dev. Biol. 216,442
-456.[CrossRef][Medline]
Winnier, G., Blessing, M., Labosky, P. A. and Hogan, B. L.
(1995). Bone morphogenetic protein-4 is required for mesoderm
formation and patterning in the mouse. Genes Dev.
9,2105
-2116.
Yamanaka, Y., Mizuno, T., Sasai, Y., Kishi, M., Takeda, H., Kim,
C. H., Hibi, M. and Hirano, T. (1998). A novel homeobox gene,
dharma, can induce the organizer in a non-cell-autonomous manner.
Genes Dev. 12,2345
-2353.
This article has been cited by other articles:
![]() |
M. Dixon Fox and A. E. E. Bruce Short- and long-range functions of Goosecoid in zebrafish axis formation are independent of Chordin, Noggin 1 and Follistatin-like 1b Development, May 15, 2009; 136(10): 1675 - 1685. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Maegawa, M. Varga, and E. S. Weinberg FGF signaling is required for {beta}-catenin-mediated induction of the zebrafish organizer Development, August 15, 2006; 133(16): 3265 - 3276. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Reim and M. Brand Maternal control of vertebrate dorsoventral axis formation and epiboly by the POU domain protein Spg/Pou2/Oct4 Development, July 15, 2006; 133(14): 2757 - 2770. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Leung, H. Chen, A. M. Stauffer, K. E. Giger, S. Sinha, E. J. Horstick, J. E. Humbert, C. A. Hansen, and J. D. Robishaw Zebrafish G protein {gamma}2 is required for VEGF signaling during angiogenesis Blood, July 1, 2006; 108(1): 160 - 166. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Fong, A. Emelyanov, C. Teh, and V. Korzh Wnt signalling mediated by Tbx2b regulates cell migration during formation of the neural plate Development, August 15, 2005; 132(16): 3587 - 3596. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. P. Wilm and L. Solnica-Krezel Essential roles of a zebrafish prdm1/blimp1 homolog in embryo patterning and organogenesis Development, January 15, 2005; 132(2): 393 - 404. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Ramel and A. C. Lekven Repression of the vertebrate organizer by Wnt8 is mediated by Vent and Vox Development, August 15, 2004; 131(16): 3991 - 4000. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Furthauer, J. Van Celst, C. Thisse, and B. Thisse Fgf signalling controls the dorsoventral patterning of the zebrafish embryo Development, June 15, 2004; 131(12): 2853 - 2864. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||