|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00591
1 Section of Gene Function and Regulation, Institute of Cancer Research, 237
Fulham Road, London SW3 6JB, UK
2 Duke University Medical Center, Durham, NC 27710, USA
* Author for correspondence (e-mail: amanda.swain{at}icr.ac.uk)
Accepted 12 May 2003
| SUMMARY |
|---|
|
|
|---|
Key words: WNT, Gonad, Endothelial, Mouse
| INTRODUCTION |
|---|
|
|
|---|
The development of vasculature within the mouse gonad initiates in the
genital ridge in both males and females before the action of Sry at
around 11 days post coitum (dpc) (Brennan
et al., 2002
). After sex determination, however, the mechanism of
vascular formation is different between the sexes. Further development of the
vasculature in the ovary occurs through proliferation of cells already present
within the organ. In the testis, development of vasculature occurs through the
recruitment of additional cells from the mesonephros. This difference gives
rise to the sex-specific vascular pattern of the gonad. In the testis, a large
artery is formed at the coelomic surface through which the blood flow is
rerouted at around 12 dpc. It has been suggested that this male-specific
vascular system is required for the export of testosterone from the testis to
the rest of the embryo to ensure masculinisation. The ovary has no coelomic
blood vessel. Instead, the main ovarian artery is found at the
mesonephros-gonad boundary.
The migration of mesonephric cells into the developing gonad is a
male-specific event that begins by 11.5 dpc in the mouse and is critical to
the development of the testis (Buehr et
al., 1993
; Martineau et al.,
1997
; Tilmann and Capel,
1999
). Studies using in vitro organ co-culture systems have shown
that a population of these migrating cells surround the Sertoli cells within
the gonad and have characteristics of peritubular myoid cells
(Martineau et al., 1997
).
Sertoli cells and peritubular myoid cells interact to form testicular cords,
an event that is coincident with the activation of male-specific gene
expression. A second group of migrating cells were found in locations
characteristic of developing vasculature and were positive for endothelial
cell markers such as Pecam, Flt-1 and Tie-2
(Brennan et al., 2002
;
Martineau et al., 1997
).
Additional migrating cells negative for endothelial markers were found
associated with the endothelium and had characteristics of myoepithelial
cells.
Steroidogenic cell differentiation in the gonad is poorly understood. The
action of Sry in the XY gonad is thought to trigger the
differentiation of Sertoli cells and these cells in turn are thought to direct
the differentiation of the rest of the testis
(Swain and Lovell-Badge,
2002
). Differentiated mouse Leydig cells are seen at 12.5 dpc
following the appearance of testis cords and male-specific vasculature. Little
is known about how Leydig cells arise and how their development is controlled.
The signalling molecule Desert hedgehog (DHH), which is produced by Sertoli
cells, has been implicated in Leydig cell development
(Yao et al., 2002
). Embryos
mutant for Dhh showed a reduced number of Leydig cells in the XY
gonad whereas other processes such as mesonephric cell migration were not
affected, suggesting a direct role for this factor in the induction of Leydig
cell differentiation.
The signalling molecule WNT4 has been associated with female sexual
development in the mouse (Vainio et al.,
1999
). In the developing gonad, the Wnt4 gene is
expressed in both sexes prior to 11.5 dpc. After sex determination, expression
persists in the XX gonad but is downregulated in the XY gonad. XX embryos that
are mutant for Wnt4 showed failure of Müllerian duct formation
and differentiation of the Wolffian duct into the male ductal system. The
mutant embryonic Wnt4 ovary showed a loss of oocytes and ectopic
expression of enzymes involved in steroid hormone biosynthesis. This latter
phenotype led Vainio et al. to propose that WNT4 was suppressing Leydig cell
development in the XX gonad (Vainio et
al., 1999
). Our studies show a novel role for WNT4 in the gonad
that provides an alternative explanation for the masculinisation phenotype
observed in the Wnt4 mutant animals. We show that WNT4 represses
endothelial and steroidogenic cell migration into the developing XX gonad,
preventing both the formation of a male-specific coelomic blood vessel and
ectopic steroid production. In addition, we show that misexpression of
Wnt4 in the XY gonad does not inhibit Leydig cell differentiation but
does affect the pattern of the developing coelomic blood vessel.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Whole-mount immunohistochemistry
The tissues to be analysed were dissected and fixed overnight in 4%
paraformaldehyde at 4°C. After rinsing in PBS, the samples were incubated
for 3 hours at 4°C in 50 mM ammonium chloride in PBS and then left
overnight at 4°C in a solution containing 0.1% hydrogen peroxide, 10% goat
serum and 1% triton in PBS. Primary antibody staining was done overnight at
4°C in a PBS solution containing 10% goat serum, 1% triton and the Pecam
antibody (Pharmingen, 1/50 dilution). After rinsing five times with a wash
solution containing PBS, 10% goat serum and 10% triton, the samples were
incubated overnight at 4°C in wash solution containing a secondary
antibody conjugated with peroxidase (Pierce, 1/300 dilution). Samples were
then rinsed five times in wash solution and revealed with 4-chloro-1-naphtol
as a substrate (SIGMA). The Cy5-conjugated secondary antibody in
Fig. 2 was used as described
(Brennan et al., 2002
).
|
In vitro organ co-culture assay
In vitro co-culture assays were done as described previously
(Martineau et al., 1997
).
Briefly, mesonephroi and gonads were dissected from different animals and were
combined on agar blocks and cultured for 48 to 96 hours. The samples were then
washed in PBS, fixed in 2% paraformaldehyde/0.1% glutaraldehyde and stained
for ß-galactosidase activity as described. The sex of the mesonephroi had
no effect on our migration studies as shown previously
(Martineau et al., 1997
).
BAC constructs
The Cyp11a1 and Sf1 BAC clones were obtained from a 129SV
mouse library (Research Genetics, USA). The Cyp11a1:LacZ construct was made
using the method described by Carvajal et al.
(Carvajal et al., 2001
) and an
improved version described elsewhere (Cox
et al., 2002
). The ßgeo gene with a polyadenylation site
derived from SV40 was obtained from Rosa Beddington (National Institute for
Medical Research) and was introduced at the first KpnI site in the
Cyp11a1 coding sequence such that a fusion protein was made. A
fragment was created that had the ßgeo gene flanked by 2.5 kb of upstream
Cyp11a1 sequence (from SpeI to KpnI) and 2.2 kb of downstream
Cyp11a1 sequence (the next KpnI fragment). This fragment was
introduced into the shuttle vector for homologous recombination. The modified
BACs were characterised by Southern analysis using Cyp11a1- and
lacZ-specific probes.
The Sf1:Wnt4 construct was created using the method described by
Swaminathan et al. (Swaminathan et al.,
2001
). The DY380 cells were obtained from Neal Copeland
(Lee et al., 2001
). The
Wnt4 cDNA was obtained from Andy McMahon (Harvard University). A
BamHI to SphI 700 bp genomic fragment containing the first and second exon of
the Sf1 gene was cloned into puc18. A fragment containing the Wnt4
cDNA and the rabbit ß-globin intron and polyadenyation signal sequences
(Swain et al., 1998
) was
inserted at the SacII site of this construct, which is found in the 5'
untranslated region of the Sf1 gene. This construct was used as a source of
fragment to introduce into DY380 cells containing the unmodified Sf1 BAC,
which were induced at 42C and made electrocompetent. The modified BACs were
characterised by Southern analysis using Sf1- and
Wnt4-specific probes.
For making transgenic mice with the modified BAC constructs, DNA was prepared using the Qiagen maxiprep kit (Qiagen, UK) and dialysed against microinjection buffer (10 mM Tris H-Cl pH 7.5, 0.1 mM EDTA pH 8.0 and 100 mM NaCl) and injected as circular DNA at different concentrations.
Cyp11a1:lacZ transgenic animals were typed by PCR using a Cyp11a1-specific primer (GCTCAGTGCTGGTATTGCTG) and a lacZ-specific primer (AGATGGGCGCATCGTAACCG). The Sf1:Wnt4 transgenic animals were typed by PCR using primers that were specific to the rabbit ß-globin intron and polyadenylation sequences (GGAGACAATGGTTGTCAACAG and GCTAGAGCTGAGAACTTCAG).
RTPCR on Sf1:Wnt4 transgenic tissues
RTPCR was performed as described previously
(Capel et al., 1993
). RNA was
extracted from various tissues from transgenic animals, the RNA was reverse
transcribed and PCR was performed. To identify transgenic-specific transcripts
we used primers that spanned the rabbit ß-globin intron sequences
(GCTAGAGCTGAGAACTTCAG and CAAGGGGCTTCATGATGTCC). HPRT was used as a control
for the presence of RNA in the samples
(Capel et al., 1993
).
| RESULTS |
|---|
|
|
|---|
|
Most vascular markers such as Pecam label endothelial cells in both XX and
XY gonads. However, sex-specific markers such as Jag1 and
platelet-derived growth factor receptor alpha (Pdgfr
) are
normally associated with the coelomic blood vessel in the XY gonad but are not
found in the XX gonad (Brennan et al.,
2002
; Brennan et al.,
2003
). We performed whole-mount in situ hybridisation for
Jag1 and Pdfgr
expression and found both were
present near the ectopic vasculature in XX gonads from
Wnt4-/- embryos, but were not present in gonads from
wild-type (+/+) or heterozygous (+/-) XX embryos
(Fig. 2). Jag1 is
expressed in both the coelomic vessel region and the interstitium of the
developing testis. However, in the Wnt4-/- XX gonad
Jag1 expression was only associated with the blood vessel and not
other interstitial regions of the gonad.
Studies have shown that a large proportion of the testis vasculature,
including the male-specific coelomic blood vessel, is formed from endothelial
cells that migrate from the mesonephros
(Brennan et al., 2002
). This
migration is a male-specific event and does not occur in the XX gonad. To
investigate whether the coelomic blood vessel observed in the
Wnt4-/- ovary was formed by mesonephric cell migration we
used an in vitro organ co-culture system. Mesonephroi from 11.5 dpc and 12.5
dpc embryos where the lacZ gene was expressed ubiquitously (ROSA26
line) were incubated next to XX and XY gonads derived from 11.5 dpc and 12.5
dpc embryos which were homozygous, heterozygous and wild-type for the mutant
Wnt4 allele. After incubation the samples were stained for
ß-galactosidase activity and, as shown previously, mesonephric cells
expressing the lacZ gene were found within the wild-type XY gonad but
not within the XX gonad (Fig.
3A). However, when a Wnt4-/- XX gonad was
cultured apposed to a wild-type mesonephros, lacZ-expressing cells
were found within the gonad (all 13 Wnt4-/- XX gonads that
were assayed showed this phenotype, 8 from 11.5 dpc embryos and 5 from 12.5
dpc embryos) (Fig. 3A). These
results show that migration of mesonephric cells into the XX gonad is
inhibited by the presence of WNT4.
|
The Wnt4 gene is also expressed in the developing mesonephros. We therefore wanted to investigate whether mesonephroi from Wnt4-/- embryos had a role in mesonephric migration into the gonad. For this, we bred mice with the mutant Wnt4 allele with the ROSA26 line. Using mice from this cross, we incubated wild-type 11.5 dpc XX and XY gonads with mesonephroi from 11.5 dpc embryos that were homozygous for the mutant Wnt4 allele and were also expressing lacZ ubiquitously. Analysis of these cultures showed that mesonephric cell migration patterns were normal: migration into the XY gonad was still observed but did not occur exogenously into XX gonads (data not shown; all 16 mutant mesonephroi, 10 were assayed with XX gonads and 6 with XY gonads, showed this phenotype). These results indicate that the repressive role of WNT4 on mesonephric cell migration is driven primarily by WNT4 protein produced in the XX gonad.
WNT4 represses steroidogenic cell migration
Vainio et al. reported the presence of ectopic cells expressing
steroidogenic cell markers such as Cyp17 and 3ß-HSD in the
mutant Wnt4 XX gonads (Vainio et
al., 1999
). These markers are usually found in adrenals and
testicular Leydig cells but are not present in the ovary at early stages of
gonad development. We performed a detailed analysis of the expression pattern
of the gonad and adrenal steroidogenic marker 3ß-HSD in
Wnt4-/- embryos during early stages of gonad development.
Our analysis revealed that the ectopic cells expressing this marker were few
and tended to cluster around the anterior region of the gonad of both sexes,
close to the region where the adrenal was forming at early stages of gonad
development in both sexes (Morohashi,
1997
) (Fig. 4). As
development proceeded the ectopic cells were found in other regions of the
gonad. This pattern was also found for other steroidogenic markers such as
Cyp11a1 and Cyp17. Heikkila et al. recently extended this
study to include a marker specific to steroidogenic adrenal cells,
Cyp21, which they found ectopically expressed within the
Wnt4-/- XX gonad
(Heikkila et al., 2002
). This
pattern of expression suggested that the ectopic steroidogenic cells in the
Wnt4-/- XX gonad had migrated from the mesonephros during
development.
|
|
The role of Wnt4 in testicular vascular formation and
steroidogenic cell differentiation
Our detailed analysis of the expression of the Wnt4 gene at early
stages of gonad development showed that it is expressed in the early gonad and
mesonephros of both sexes before sex determination takes place. After
Sry expression in the male gonad, Wnt4 is downregulated in
the testis whereas it is upregulated in the ovary. Mesonephric expression
continues in both sexes (data not shown). These results are consistent with
those of Vainio et al. (Vainio et al.,
1999
). Our results show that at early stages of gonad development
in both sexes the role of WNT4 is to repress the formation of the coelomic
blood vessel and prevent the presence of ectopic steroidogenic cells in the
gonad. The downregulation of Wnt4 in the XY gonad after the action of
Sry suggested that ectopic expression of WNT4 might have a repressive
role in vascular formation and steroidogenic cell differentiation in the XY
gonad. To investigate this possibility we sought to misexpress WNT4 in the
developing testis. For this we used a BAC construct containing the
Sf1 gene. We chose Sf1 because it is expressed continuously
at high levels in the genital ridge throughout early gonadogenesis and in the
Sertoli and Leydig cells of the developing testis
(Ikeda et al., 1994
). We
inserted the Wnt4 cDNA into the 5' untranslated region of the
Sf1 gene by homologous recombination and made transgenic mice that
contained this BAC construct (called Sf1:Wnt4).
Expression analysis of the animals containing the Sf1:Wnt4 BAC construct showed that sequences from the transgenic construct were expressed during development in a pattern similar to that of the Sf1 gene. Whole-mount in situ hybridisation for Wnt4 expression on testes from transgenic embryos revealed ectopic expression of Wnt4 in the gonad, which resembled the Sf1 pattern of expression (Fig. 6) (transgenic embryos from four different integration events were analysed in this way and showed this phenotype). RTPCR analysis showed that transgenic-specific sequences were expressed in the adrenal but not in the kidney (transgenic embryos from nine different integration events were analysed) and in the urogenital ridge but not in limb at 11.5 dpc, the stage when Wnt4 is downregulated in XY gonads (transgenic embryos from two integration events were analysed) (data not shown).
|
|
| DISCUSSION |
|---|
|
|
|---|
Marker analysis in the Wnt4-/- XX gonad showed that
male-specific genes associated with the coelomic blood vessel in the normal
testis were expressed, suggesting that a male-specific pathway had been
initiated in the female gonad. However, in agreement with Vainio et al.
(Vainio et al., 1999
), we did
not find any Sertoli cell-specific markers or any sign of testis cord
formation at early stages of gonad development. This suggests that the
signalling molecules required for endothelial cell migration are different
from those required for cord formation. Endothelial cells have been shown to
promote differentiation of organs such as the pancreas and liver
(Lammert et al., 2001
;
Matsumoto et al., 2001
).
However, in this case endothelial cell migration did not induce
differentiation of male somatic cells or morphological development of the
testis such as testis cord formation, suggesting that other male-specific
factors are required.
Our studies of Wnt4-/- XX gonads indicated that WNT4 represses endothelial cell migration and coelomic blood vessel formation during gonad development. These findings suggested that downregulation of Wnt4 expression seen in the XY gonad after the action of SRY was a required step to ensure coelomic vessel formation in the testis. Our misexpression studies showed that WNT4 does not inhibit the initiation of coelomic blood vessel formation in the testis. However, the pattern of the coelomic blood vessel in the Sf1:Wnt4 transgenic XY animals was found to be disorganised, showing that a high level of WNT4 interfered with vascular patterning in the testis.
Our results suggest that repression by WNT4 is inefficient in the
transgenic embryos. One explanation for our results is that two different
signalling systems contribute to coelomic blood vessel formation in the
testis, only one of which is repressed by WNT4. In the Sf1:Wnt4 transgenic XY
embryos, the alternative operative signalling system may partially rescue some
coelomic vessel patterning. An alternative and simpler explanation is that the
molecular environment in the XY gonad is different to that of the XX gonad and
that WNT4 is prevented from acting efficiently in the testis. For example, a
testis-specific factor produced as a consequence of SRY action in the
Sertoli cell lineage could inhibit WNT4 action in the transgenic XY gonad. A
reasonable candidate for this factor is the TGFß-family member,
anti-Müllerian hormone (AMH). Amh expression in the XY gonad
begins around 11.5 dpc (Hacker et al.,
1995
; Munsterberg and
Lovell-Badge, 1991
). Moreover, an association between AMH
signalling and ß-catenin, an element of the canonical WNT signalling
pathway, has been previously reported
(Allard et al., 2000
). After
11.5 dpc, AMH could antagonise the activity of the ectopic WNT4 and limit its
disruptive effect on vessel pattern formation to a brief period during testis
development. The variability seen in the phenotype of the Sf1:Wnt4 transgenic
embryos could then be explained by subtle differences in the timing of
expression of the transgene with respect to that of the antagonist.
The role of WNT4 in steroidogenic cell recruitment
Production of steroids during gonad development is highly regulated in a
sex-specific manner. WNT4 is part of the signalling pathway that ensures that
the XX gonad does not produce sex hormones that masculinise the developing
embryo (Vainio et al., 1999
).
Our results show that the role of WNT4 in this process is to repress the
migration of steroidogenic cells from the mesonephros into the XX gonad during
early gonad development. Various observations indicated that the migrating
steroidogenic cells in the Wnt4-/- embryos were adrenal
cell precursors. The expression pattern of steroidogenic cell markers,
including the adrenal-specific marker Cyp21, at early stages of gonad
development in Wnt4-/- XX embryos showed that the ectopic
steroidogenic cells clustered in the area of the gonad that was closest to the
developing adrenal (Heikkila et al.,
2002
). Also, our in vitro co-culture experiments using mesonephroi
from Cyp11a1:lacZ embryos showed that lacZ-positive cells
were found in the XX Wnt4-/- gonad only when the region of
the mesonephros where the adrenal gland normally forms was included.
Our analysis of the Sf1:Wnt4 transgenic embryos showed that WNT4 has a
disruptive effect on vascular pattern formation in the testis. However, the
presence of WNT4 in the XY gonad had no effect on Leydig cell differentiation.
These results are therefore consistent with our view obtained from the
Wnt4 mutant embryos, that WNT4 acts to repress the migration of a few
steroidogenic adrenal cells into the gonad. However, in contrast to the
proposal of Vainio et al. (Vainio et al.,
1999
), it is not required to repress the differentiation of Leydig
cell precursors already present within the gonad. It is most probable that the
latter differentiate in situ in response to signals from the Sertoli cells,
which may include DHH (Yao et al.,
2002
). Perhaps Wnt4 expression in the ovary can be
considered a `safety factor' to help ensure the adrenal precursors do not
enter and give inappropriate expression of steroids in the female.
The data presented here shows that WNT4 represses the molecular pathway
that controls the process of migration of at least two different cell types
from the mesonephros into the gonad. Our data is consistent with the model
that WNT4 is preventing the action of the cell migration signal produced by
the gonad, either by repressing the expression of the gene encoding the signal
or by directly inhibiting the diffusion of the (long-range) signal to the
mesonephros. Candidate factors for the cell migration signal include vascular
endothelial growth factor (VEGFA), endocrine gland vascular endothelial growth
factor (EG-VEGF) and fibroblast growth factor 9 (FGF), which are found in the
developing gonad (Ferrara,
1999
; Colvin et al.,
2001
; LeCouter et al.,
2002
). We have analysed the expression of FGF9, EG-VEGF
and the different isoforms encoded by the VEGFA gene in the
Wnt4-/- XX gonad but find no evidence of repression of the
expression of these genes by WNT4 action (data not shown). We have obtained
recent data that shows that the ovary-specific gene follistatin is not
expressed in the XX Wnt4 mutant gonad (H. Yao and B.C., unpublished).
This suggests an unexpected mechanism of action of WNT4 that involves the
activation of expression of an antagonist of molecules from the TGFß
superfamily. Further studies will reveal how this pathway is involved in this
process. Interestingly, Shu et al. have shown that another member of the WNT
family, WNT7b, is implicated in vascular development in the lung
(Shu et al., 2002
). However,
in contrast to the work presented here there is no direct effect of WNT7b on
endothelial development. Instead, their results show a defect in the
development of vascular smooth muscle cells in mice lacking this factor.
The precise nature of the molecular pathways involved in cell movements within the developing gonad need to be established and this will be the focus of future work. However, our results clarify the role of WNT4 in this process as well as providing a new hypothesis of how cell movements are controlled in a sex-specific manner such that they lead to the appropriate morphogenesis of either an ovary or a testis.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Allard, S., Adin, P., Gouedard, L., di Clemente, N., Josso, N., Orgebin- Crist, M. C., Picard, J. Y. and Xavier, F. (2000). Molecular mechanisms of hormone-mediated Müllerian duct regression: involvement of beta-catenin. Development 127,3349 -3360.[Abstract]
Brennan, J., Karl, J. and Capel, B. (2002). Divergent vascular mechanisms downstream of Sry establish the arterial system in the XY gonad. Dev. Biol. 244,418 -428.[CrossRef][Medline]
Brennan, J., Tilmann, C., Capel, B., Brennan, J., Karl, J. and
Capel, B. (2003). Pdgfr-
mediates testis cord
organization and fetal Leydig cell development in the XY gonad.
Genes Dev. 17,800
-810.
Buehr, M., Gu, S. and McLaren, A. (1993).
Mesonephric contribution to testis differentiation in the fetal mouse.
Development 117,273
-281.
Capel, B., Albrecht, K. H., Washburn, L. L. and Eicher, E. M. (1999). Migration of mesonephric cells into the mammalian gonad depends on Sry. Mech. Dev. 84,127 -131.[CrossRef][Medline]
Capel, B., Swain, A., Nicolis, S., Hacker, A., Walter, M., Koopman, P., Goodfellow, P. and Lovell-Badge, R. (1993). Circular transcripts of the testis-determining gene Sry in adult mouse testis. Cell 73,1019 -1030.[CrossRef][Medline]
Carvajal, J. J., Cox, D., Summerbell, D. and Rigby, P. W. (2001). A BAC transgenic analysis of the Mrf4/Myf5 locus reveals interdigitated elements that control activation and maintenance of gene expression during muscle development. Development 128,1857 -1868.[Abstract]
Colvin, J. S., Green, R. P., Schmahl, J., Capel, B. and Ornitz, D. M. (2001). Male-to-female sex reversal in mice lacking fibroblast growth factor 9. Cell 104,875 -889.[CrossRef][Medline]
Cox, H. D., Carvajal, J. and Rigby, P. W. (2002). Enhanced efficiency of pSV1-RecA-based BAC recombineering. BioTechniques 33,1206 -1209.[Medline]
Ferrara, N. (1999). Molecular and biological properties of vascular endothelial growth factor. Mol. Med. 77,527 -543.[CrossRef][Medline]
Friedrich, G. and Soriano, P. (1991). Promoter
traps in embryonic stem cells: a genetic screen to identify and mutate
developmental genes in mice. Genes Dev.
5,1513
-1523.
Hacker, A., Capel, B., Goodfellow, P. and Lovell-Badge, R. (1995). Expression of Sry, the mouse sex determining gene. Development 121,1603 -1614.[Abstract]
Hadjantonakis, A. K., Gertsenstein, M., Ikawa, M., Okabe, M. and Nagy, A. (1998). Generating green fluorescent mice by germline transmission of green fluorescent ES cells. Mech. Dev. 76,79 -90.[CrossRef][Medline]
Heikkila, M., Peltoketo, H., Leppaluoto, J., Ilves, M.,
Vuolteenaho, O. and Vainio, S. (2002). Wnt-4
deficiency alters mouse adrenal cortex function, reducing aldosterone
production. Endocrinology
143,4358
-4365.
Ikeda, Y., Shen, W. H., Ingraham, H. A. and Parker, K. L.
(1994). Developmental expression of mouse steroidogenic factor-1,
an essential regulator of the steroid hydroxylases. Mol.
Endocrinol. 8,654
-662.
Lammert, E., Cleaver, O. and Melton, D. (2001).
Induction of pancreatic differentiation by signals from blood vessels.
Science 294,564
-567.
LeCouter, J., Lin, R. and Ferrara, N. (2002). Endocrine gland-derived VEGF and the emerging hypothesis of organ-specific regulation of angiogenesis. Nat. Med. 8, 913-917.[CrossRef][Medline]
Lee, E. C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D. A., Court, D. L., Jenkins, N. A. and Copeland, N. G. (2001). A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73, 56-65.[CrossRef][Medline]
Martineau, J., Nordqvist, K., Tilmann, C., Lovell-Badge, R. and Capel, B. (1997). Male-specific cell migration into the developing gonad. Curr. Biol. 7, 958-968.[CrossRef][Medline]
Matsumoto, K., Yoshitomi, H., Rossant, J. and Zaret, K. S.
(2001). Liver organogenesis promoted by endothelial cells prior
to vascular function. Science
294,559
-563.
Morohashi, K. (1997). The ontogenesis of the steroidogenic tissues. Genes Cells 2, 95-106.[Abstract]
Munsterberg, A. and Lovell-Badge, R. (1991). Expression of the mouse anti-Müllerian hormone gene suggests a role in both male and female sexual differentiation. Development 113,613 -624.[Abstract]
Schmahl, J., Eicher, E. M., Washburn, L. L. and Capel, B. (2000). Sry induces cell proliferation in the mouse gonad. Development 127,65 -73.[Abstract]
Shu, W., Jiang, Y. Q., Lu, M. M. and Morrisey, E. E. (2002). Wnt7b regulates mesenchymal proliferation and vascular development in the lung. Development 129,4831 -4842.
Stark, K., Vainio, S., Vassileva, G. and McMahon, A. P. (1994). Epithelial transformation of metanephric mesenchyme in the developing kidney regulated by Wnt-4. Nature 372,679 -683.[CrossRef][Medline]
Swain, A., Narvaez, V., Burgoyne, P., Camerino, G. and Lovell-Badge, R. (1998). Dax1 antagonizes Sry action in mammalian sex determination. Nature 391,761 -767.[CrossRef][Medline]
Swain, A. and Lovell-Badge, R. (2002). Sex determination and differentiation. In Mouse Development (ed. J. Rossant and P. Tam), pp.371 -393. London: Academic Press.
Swaminathan, S., Ellis, H. M., Waters, L. S., Yu, D., Lee, E. C., Court, D. L. and Sharan, S. K. (2001). Rapid engineering of bacterial artificial chromosomes using oligonucleotides. Genesis 29,14 -21.[CrossRef][Medline]
Tilmann, C. and Capel, B. (1999). Mesonephric cell migration induces testis cord formation and Sertoli cell differentiation in the mammalian gonad. Development 126,2883 -2890.[Abstract]
Vainio, S., Heikkila, M., Kispert, A., Chin, N. and McMahon, A. P. (1999). Female development in mammals is regulated by Wnt-4 signalling. Nature 397,405 -409.[CrossRef][Medline]
Wilkinson, D. G. and Nieto, M. A. (1993). Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Methods Enzymol. 225,361 -373.[Medline]
Yao, H. H., Whoriskey, W. and Capel, B. (2002).
Desert Hedgehog/Patched 1 signaling specifies fetal Leydig cell fate in testis
organogenesis. Genes Dev.
16,1433
-1440.
This article has been cited by other articles:
![]() |
N. Golestaneh, E. Beauchamp, S. Fallen, M. Kokkinaki, A. Uren, and M. Dym Wnt signaling promotes proliferation and stemness regulation of spermatogonial stem/progenitor cells Reproduction, July 1, 2009; 138(1): 151 - 162. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Kim, F. M. Barlaskar, J. H. Heaton, T. Else, V. R. Kelly, K. T. Krill, J. O. Scheys, D. P. Simon, A. Trovato, W.-H. Yang, et al. In Search of Adrenocortical Stem and Progenitor Cells Endocr. Rev., May 1, 2009; 30(3): 241 - 263. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bielinska, H. Parviainen, S. Kiiveri, M. Heikinheimo, and D. B. Wilson REVIEW PAPER: Origin and Molecular Pathology of Adrenocortical Neoplasms Vet. Pathol., March 1, 2009; 46(2): 194 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-F. Liu, N. Bingham, K. Parker, and H. H.-C. Yao Sex-specific roles of {beta}-catenin in mouse gonadal development Hum. Mol. Genet., February 1, 2009; 18(3): 405 - 417. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Daneman, D. Agalliu, L. Zhou, F. Kuhnert, C. J. Kuo, and B. A. Barres Wnt/{beta}-catenin signaling is required for CNS, but not non-CNS, angiogenesis PNAS, January 13, 2009; 106(2): 641 - 646. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zubair, K. L. Parker, and K.-i. Morohashi Developmental Links between the Fetal and Adult Zones of the Adrenal Cortex Revealed by Lineage Tracing Mol. Cell. Biol., December 1, 2008; 28(23): 7030 - 7040. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Schmahl, K. Rizzolo, and P. Soriano The PDGF signaling pathway controls multiple steroid-producing lineages Genes & Dev., December 1, 2008; 22(23): 3255 - 3267. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Kazanskaya, B. Ohkawara, M. Heroult, W. Wu, N. Maltry, H. G. Augustin, and C. Niehrs The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development Development, November 15, 2008; 135(22): 3655 - 3664. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Manuylov, F. O. Smagulova, L. Leach, and S. G. Tevosian Ovarian development in mice requires the GATA4-FOG2 transcription complex Development, November 15, 2008; 135(22): 3731 - 3743. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tang, J. Brennan, J. Karl, Y. Hamada, L. Raetzman, and B. Capel Notch signaling maintains Leydig progenitor cells in the mouse testis Development, November 15, 2008; 135(22): 3745 - 3753. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Maatouk, L. DiNapoli, A. Alvers, K. L. Parker, M. M. Taketo, and B. Capel Stabilization of {beta}-catenin in XY gonads causes male-to-female sex-reversal Hum. Mol. Genet., October 1, 2008; 17(19): 2949 - 2955. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Boyer, L. Hermo, M. Paquet, B. Robaire, and D. Boerboom Seminiferous Tubule Degeneration and Infertility in Mice with Sustained Activation of WNT/CTNNB1 Signaling in Sertoli Cells Biol Reprod, September 1, 2008; 79(3): 475 - 485. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Kim, A. L. Reuter, M. Zubair, T. Else, K. Serecky, N. C. Bingham, G. G. Lavery, K. L. Parker, and G. D. Hammer Targeted disruption of {beta}-catenin in Sf1-expressing cells impairs development and maintenance of the adrenal cortex Development, August 1, 2008; 135(15): 2593 - 2602. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H Brennan, A. Chittka, S. Barker, and G. P Vinson Eph receptors and zonation in the rat adrenal cortex J. Endocrinol., July 1, 2008; 198(1): 185 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tomizuka, K. Horikoshi, R. Kitada, Y. Sugawara, Y. Iba, A. Kojima, A. Yoshitome, K. Yamawaki, M. Amagai, A. Inoue, et al. R-spondin1 plays an essential role in ovarian development through positively regulating Wnt-4 signaling Hum. Mol. Genet., May 1, 2008; 17(9): 1278 - 1291. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-A. Chassot, F. Ranc, E. P. Gregoire, H. L. Roepers-Gajadien, M. M. Taketo, G. Camerino, D. G. de Rooij, A. Schedl, and M.-C. Chaboissier Activation of {beta}-catenin signaling by Rspo1 controls differentiation of the mammalian ovary Hum. Mol. Genet., May 1, 2008; 17(9): 1264 - 1277. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Philibert, A. Biason-Lauber, R. Rouzier, C. Pienkowski, F. Paris, D. Konrad, E. Schoenle, and C. Sultan Identification and Functional Analysis of a New WNT4 Gene Mutation among 28 Adolescent Girls with Primary Amenorrhea and Mullerian Duct Abnormalities: A French Collaborative Study J. Clin. Endocrinol. Metab., March 1, 2008; 93(3): 895 - 900. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. DiNapoli and B. Capel SRY and the Standoff in Sex Determination Mol. Endocrinol., January 1, 2008; 22(1): 1 - 9. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ottolenghi, E. Pelosi, J. Tran, M. Colombino, E. Douglass, T. Nedorezov, A. Cao, A. Forabosco, and D. Schlessinger Loss of Wnt4 and Foxl2 leads to female-to-male sex reversal extending to germ cells Hum. Mol. Genet., December 1, 2007; 16(23): 2795 - 2804. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. O'Shaughnessy, P. J. Baker, A. Monteiro, S. Cassie, S. Bhattacharya, and P. A. Fowler Developmental Changes in Human Fetal Testicular Cell Numbers and Messenger Ribonucleic Acid Levels during the Second Trimester J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4792 - 4801. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Shoemaker, J. Queen, and D. Crews Response of Candidate Sex-Determining Genes to Changes in Temperature Reveals Their Involvement in the Molecular Network Underlying Temperature-Dependent Sex Determination Mol. Endocrinol., November 1, 2007; 21(11): 2750 - 2763. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hu, A. Monteiro, H. Johnston, P. King, and P. J O'Shaughnessy Expression of Cyp21a1 and Cyp11b1 in the fetal mouse testis Reproduction, October 1, 2007; 134(4): 585 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wilhelm, S. Palmer, and P. Koopman Sex Determination and Gonadal Development in Mammals Physiol Rev, January 1, 2007; 87(1): 1 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Biason-Lauber, G. De Filippo, D. Konrad, G. Scarano, A. Nazzaro, and E.J. Schoenle WNT4 deficiency--a clinical phenotype distinct from the classic Mayer-Rokitansky-Kuster-Hauser syndrome: A Case Report Hum. Reprod., January 1, 2007; 22(1): 224 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
G Ricci, A Catizone, and M Galdieri Expression and functional role of hepatocyte growth factor and its receptor (c-met) during fetal mouse testis development J. Endocrinol., December 1, 2006; 191(3): 559 - 570. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.R. Barnett, C. Schilling, C.R. Greenfeld, D. Tomic, and J.A. Flaws Ovarian follicle development and transgenic mouse models Hum. Reprod. Update, September 1, 2006; 12(5): 537 - 555. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Bott, R. M. McFee, D. T. Clopton, C. Toombs, and A. S. Cupp Vascular Endothelial Growth Factor and Kinase Domain Region Receptor Are Involved in Both Seminiferous Cord Formation and Vascular Development During Testis Morphogenesis in the Rat Biol Reprod, July 1, 2006; 75(1): 56 - 67. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. N. H. Masckauchan and J. Kitajewski Wnt/Frizzled Signaling in the Vasculature: New Angiogenic Factors in Sight Physiology, June 1, 2006; 21(3): 181 - 188. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H.-C. Yao, J. Aardema, and K. Holthusen Sexually Dimorphic Regulation of Inhibin Beta B in Establishing Gonadal Vasculature in Mice Biol Reprod, May 1, 2006; 74(5): 978 - 983. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bielinska, S. Kiiveri, H. Parviainen, S. Mannisto, M. Heikinheimo, and D. B. Wilson Gonadectomy-induced Adrenocortical Neoplasia in the Domestic Ferret (Mustela putorius furo) and Laboratory Mouse. Vet. Pathol., February 1, 2006; 43(2): 97 - 117. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Barrionuevo, S. Bagheri-Fam, J. Klattig, R. Kist, M. M. Taketo, C. Englert, and G. Scherer Homozygous Inactivation of Sox9 Causes Complete XY Sex Reversal in Mice Biol Reprod, January 1, 2006; 74(1): 195 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hsieh, D. Boerboom, M. Shimada, Y. Lo, A. F. Parlow, U. F.O. Luhmann, W. Berger, and J. S. Richards Mice Null for Frizzled4 (Fzd4-/-) Are Infertile and Exhibit Impaired Corpora Lutea Formation and Function Biol Reprod, December 1, 2005; 73(6): 1135 - 1146. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Sullivan, T. H. Teal, I. P. Luttrell, K. B. Tran, M. A. Peters, and H. Wessells Microarray analysis reveals novel gene expression changes associated with erectile dysfunction in diabetic rats Physiol Genomics, October 17, 2005; 23(2): 192 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Boerboom, M. Paquet, M. Hsieh, J. Liu, S. P. Jamin, R. R. Behringer, J. Sirois, M. M. Taketo, and J. S. Richards Misregulated Wnt/{beta}-Catenin Signaling Leads to Ovarian Granulosa Cell Tumor Development Cancer Res., October 15, 2005; 65(20): 9206 - 9215. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Heikkila, R. Prunskaite, F. Naillat, P. Itaranta, J. Vuoristo, J. Leppaluoto, H. Peltoketo, and S. Vainio The Partial Female to Male Sex Reversal in Wnt-4-Deficient Females Involves Induced Expression of Testosterone Biosynthetic Genes and Testosterone Production, and Depends on Androgen Action Endocrinology, September 1, 2005; 146(9): 4016 - 4023. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H-C Yao and B. Capel Temperature, Genes, and Sex: a Comparative View of Sex Determination in Trachemys scripta and Mus musculus J. Biochem., July 1, 2005; 138(1): 5 - 12. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kanai, R. Hiramatsu, S. Matoba, and T. Kidokoro From SRY to SOX9: Mammalian Testis Differentiation J. Biochem., July 1, 2005; 138(1): 13 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Bouma, K. H. Albrecht, L. L. Washburn, A. K. Recknagel, G. A. Churchill, and E. M. Eicher Gonadal sex reversal in mutant Dax1 XY mice: a failure to upregulate Sox9 in pre-Sertoli cells Development, July 1, 2005; 132(13): 3045 - 3054. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Qin and C. E. Bishop Sox9 is sufficient for functional testis development producing fertile male mice in the absence of Sry Hum. Mol. Genet., May 1, 2005; 14(9): 1221 - 1229. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matsuyama, H. Mizusaki, A. Shimono, T. Mukai, K. Okumura, K. Abe, K. Shimada, and K.-i. Morohashi A novel isoform of Vinexin, Vinexin {gamma}, regulates Sox9 gene expression through activation of MAPK cascade in mouse fetal gonad Genes Cells, May 1, 2005; 10(5): 421 - 434. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Park and J. L. Jameson Minireview: Transcriptional Regulation of Gonadal Development and Differentiation Endocrinology, March 1, 2005; 146(3): 1035 - 1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. D. Hammer, K. L. Parker, and B. P. Schimmer Minireview: Transcriptional Regulation of Adrenocortical Development Endocrinology, March 1, 2005; 146(3): 1018 - 1024. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Eguchi, M. Eguchi-Ishimae, A. Green, T. Enver, and M. Greaves Directing oncogenic fusion genes into stem cells via an SCL enhancer PNAS, January 25, 2005; 102(4): 1133 - 1138. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Biason-Lauber, D. Konrad, F. Navratil, and E. J. Schoenle A WNT4 Mutation Associated with Mullerian-Duct Regression and Virilization in a 46,XX Woman N. Engl. J. Med., August 19, 2004; 351(8): 792 - 798. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Bland, R. C. Fowkes, and H. A. Ingraham Differential Requirement for Steroidogenic Factor-1 Gene Dosage in Adrenal Development Versus Endocrine Function Mol. Endocrinol., April 1, 2004; 18(4): 941 - 952. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Weiss, J. J. Meeks, L. Hurley, G. Raverot, A. Frassetto, and J. L. Jameson Sox3 Is Required for Gonadal Function, but Not Sex Determination, in Males and Females Mol. Cell. Biol., November 15, 2003; 23(22): 8084 - 8091. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||