|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00580

CNRS URA 2578, Département de Biologie du Développement, Institut Pasteur, 25-28 rue du Dr Roux, 75724 Paris Cedex 15, France
Author for correspondence (e-mail:
margab{at}pasteur.fr)
Accepted 2 May 2003
| SUMMARY |
|---|
|
|
|---|
-cardiac
actin gene. A rare intragenic recombination event leads to a clone of
ß-galactosidase-positive myocardial cells. Analysis of clones at
different developmental stages demonstrates that myocardial cells and their
precursors follow a proliferative mode of growth, rather than a stem cell
mode, with an initial dispersive phase, followed by coherent cell growth.
Clusters of cells are dispersed along the venous-arterial axis of the heart
tube. Coherent growth is oriented locally, with a main axis, which corresponds
to the elongation of the cluster, and rows of cells, which form secondary
axes. The angle between the primary and secondary axes varies, indicating
independent events of growth orientation. At later stages, as the ventricular
wall thickens, wedge shaped clusters traverse the wall and contain rows of
cells at a progressive angle to each other. The cellular organisation of the
myocardium appears to prefigure myofibre architecture. We discuss how the
characteristics of myocardial cell growth, which we describe, underlie the
formation of the heart tube and its subsequent regionalised expansion.
Key words: Mouse heart morphogenesis, Myocardium, Clonal cell growth, laacZ
| INTRODUCTION |
|---|
|
|
|---|
Most cell labelling experiments of myocardial precursor cells have been
carried out on avian embryos. They have provided detailed fate maps for the
heart (e.g. Rawles, 1943
;
Stalsberg and De Haan, 1969
;
de la Cruz et al., 1989
;
Redkar et al., 2001
). Based on
grafting and DiI labelling experiments, it has been proposed that the
organisation of myocardial cells in the linear heart tube reflects their
rostrocaudal origin in the primitive streak
(Rosenquist and De Haan, 1966
;
Garcia-Martinez and Schoenwolf,
1993
), and that cardiac precursor cells move from their location
in the primitive streak to the more rostral position, under the head folds, as
a coherent sheet (Rosenquist and De Haan,
1966
; Stalsberg and De Haan,
1969
). By contrast, aggregates of 10-50 cells had been observed
migrating independently from one another in the cardiogenic region of chick
splanchnic mesoderm (DeHaan,
1963a
; DeHaan,
1963b
). More recent DiI labelling experiments have indicated that
there is intermingling of cells during their migration from the primitive
streak, such that the organisation of cells with a pattern that reflects their
position later in the heart only emerges clearly at the cardiac crescent stage
(Redkar et al., 2001
). At
later stages, some degree of intermingling of myocytes, as monitored by
retroviral labelling, has been observed across the ventricular wall after
chamber formation (Mikawa et al.,
1992b
). In these experiments, the organisation of cells was
examined and their orientation in spindle-like patterns described
(Mikawa et al., 1992a
).
In the mammalian heart, cell labelling and cell transplantation experiments
have identified the position of cardiac precursors in the epiblast
(Lawson et al., 1991
) and
primitive streak (Tam et al.,
1997
; Kinder et al.,
1999
), and have documented their displacement rostrally. However,
little is known about cell behaviour and growth of cardiac precursors. Prior
to gastrulation, cell labelling (Lawson et
al., 1991
) and cell transplantation
(Gardner and Cockroft, 1998
)
experiments have shown extensive intermingling of growing cells in the mouse
epiblast. As a step towards understanding the cellular basis of cardiac
morphogenesis, we have examined the distribution at different developmental
stages of clonally related cells in the mouse myocardium, which is the major
tissue of the developing heart. We have adopted a retrospective clonal
approach based on the use of an nlaacZ reporter gene, which is
inactive unless it undergoes a rare event of spontaneous intragenic
recombination, leading to the generation of a ß-galactosidase-positive
clone (Bonnerot and Nicolas,
1993
). Because of its genetic nature, the method is non-invasive
and the label, nlacZ, is stable. Appearance of the label is random
and permits a systematic retrospective analysis, without any preconception as
to the spatiotemporal localisation of the labelled precursor, which is not the
case with prospective techniques such as dye labelling or grafting.
In this report, the nlaacZ reporter gene was targeted to an allele
of the endogenous
-cardiac actin gene, which is expressed throughout
the myocardium (Sassoon et al.,
1988
) and therefore permits a retrospective clonal analysis of
myocardial cells in all regions of the mouse heart. Systematic analysis of the
frequency, size and distribution of myocardial clones at different
developmental stages demonstrates that these cells undergo two growth phases,
which follow a proliferative rather than a stem cell mode. At earlier stages,
growth is dispersive and oriented along the venous-arterial axis of the heart
tube. Before embryonic day (E) 8.5, a second phase of coherent growth begins
to emerge and subsequently characterises myocardial cell proliferation, both
on the surface of the heart and through the thickness of the ventricular walls
in an oriented way. The number and organisation of cells within clones provide
new insight into how cellular growth patterns underlie the morphogenesis of
the mammalian heart.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Sac is a SacI-EcoRI
fragment of nlacZ-pUC19, which has been ligated to a DNA fragment
obtained by annealing SBE1
(5'-CCTTCGAAGCGCGCGTTCGAAGATATCCTTCGAAAGATCTGTCGACCTCGAGG) to SBE2
(5'-AATTCCTCGAGGTCGACAGATCTTTCGAAGGATATCTTCGAACGCGCGCTTCGAAGGAGCT)
oligonucleotides to introduce appropriate restriction sites. It was then cut
with BstBI and BglII and ligated to a
ClaI-BamHI fragment of nlacZ-pUC19.
|
-cardiac actin flanking sequences were isolated by long range
PCR on mouse genomic DNA from HM1 ES cells [129/OlaHsd-derived]
(Selfridge et al., 1992
-cardiac actin are repeated at the end of the 5' and the
beginning of the 3' flanking sequences. The nlaacZ1.1 reporter
sequence was introduced after the first seven codons of
-cardiac actin
to create a fusion protein: a NcoI-SalI fragment of
nlaacZ1.1 was ligated to a 5'
-cardiac actin (AC55-AC53)
fragment obtained by NotI and partial NcoI digestion and
introduced into an NcoI-SalI pSKT modified vector (gift from
S. Tajbakhsh), to generate the construct 5'nlaacZ1.1.
A positive neomycin selection cassette, flanked by two parallel loxP sites,
was inserted after nlaacZ1.1 in the same transcriptional orientation.
A SalI-NotI fragment of
loxP-PGK-NeoR-pA-loxP (gift from S. Tajbakhsh) (see
Thomas et al., 1986
) was
ligated to a 3'
-cardiac actin (AC35-AC33) fragment obtained by
NotI-PacI digestion and introduced into a
PacI-SalI pSKT modified vector, to generate the construct
Neo3'. SalI-KpnI Neo3' was ligated to
SalI-KpnI 5'nlaacZ1.1. A negative selection
cassette encoding the A subunit of diphtheria toxin was introduced at the end
of the 3' flanking sequence. PGK-DTA-pA (gift from F. Relaix)
(see Soriano, 1997
) was
inserted into a KpnI site after the 3' flanking sequence in a
5'-3' transcription orientation. This resulted in a 700 bp
deletion at the 3' end of the AC35-AC33 fragment, permitting its use as
an external 3' probe.
The final replacement targeting vector was verified by sequencing the
junctions and tested for recombination by transient transfection into C2 cells
(data not shown): occasional ß-galactosidase-positive nuclei were
observed as a result of intragenic recombination, showing that the recombined
fusion protein has functional ß-galactosidase activity (see
Biben et al., 1996
) and that
the truncated ß-galactosidase molecule produced from the
nlaacZ1.1 allele is inactive.
Generation of
c-actin+/nlaacZ1.1
targeted mice
The targeting vector was linearised by digestion with SacII and
electroporated into HM1 ES cells
(Selfridge et al., 1992
) as
described previously (Tajbakhsh et al.,
1996b
), but with 15% foetal calf serum in the culture medium.
Targeted cells were selected as neomycin positive by G418 resistance and as
DTA negative by their survival. 115 G418-resistant ES clones were screened by
Southern blotting using 32P-probes
(Fig. 1A), internal (300 bp of
ClaI-EcoRV digested nlacZ, hybridising to the
duplication of nlaacZ) and external (5' a 450 bp
fragment at -5.4 kb from the transcription initiation site of
-cardiac
actin, digested with HindIII-XbaI, a gift from M. Lemonnier;
3' a 700 bp
-cardiac actin fragment from AC33-AC35
digested with KpnI) to the targeting vector. Two ES clones with a
correctly targeted
-cardiac actin allele were identified
(Fig. 1B-D) and injected into
blastocysts [C57BL/6]. Germline transmission was obtained for one of the
clones (
c-actin+/nlaacZ1.1Neo
line). In order to avoid undesirable genomic interactions at the locus
(Olson et al., 1996
),
heterozygous
c-actin+/nlaacZ1.1Neo males
were crossed with homozygous PGK-Cre transgenic females
(Lallemand et al., 1998
) to
remove the selectable marker gene
(
c-actin+/nlaacZ1.1
line).
c-actin+/nlaacZ1.1
mice are indistinguishable from the
c-actin+/nlaacZ1.1Neo mice, and
both were used in the analysis and together referred to as
c-actin+/nlaacZ1.1.
The targeted mice were genotyped by PCR on DNA preparations from the tail,
with a sense primer (Ol384) from the
-cardiac actin proximal promoter
(5'-GCTGCTCCAACTGACCCCGTCCATCAGAGAG) and an antisense primer (Ol387)
from nlacZ (5'-CGCATCGTAACCGTGCATCTGCCAGTTTGAG) at an annealing
temperature of 57°C, or with a sense primer (GEN) from the neomycin
resistance sequence (5'-ATCGCCTTCTATCGCCTTCTTGACGAGTTC) and an antisense
primer (ACEX2-2) from
-cardiac actin exon 2
(5'-ACAGCTCTGGGGGCGTCATC) at an annealing temperature of 60°C.
In situ hybridisation
A 1.1 kb nlacZ antisense probe corresponding to nucleotides
870-1985 of the lacZ sequence was transcribed with T7 polymerase from
a 5'nlacZ
Sac pSKT modified plasmid, linearised with
ClaI. The 5'nlacZ
Sac construct was generated by
the ligation of ClaI-SalI 5'nlaacZ1.1 and
ClaI-SalI nlacZ
Sac. A 130 bp
-cardiac
actin-specific probe was transcribed with T3 polymerase from the 5'
noncoding sequence of the mRNA (Sassoon et
al., 1988
). Whole mount in situ hybridisation was performed as
previously described (Zammit et al.,
2000
).
Production and description of clones
The nlaacZ sequence produces a truncated ß-galactosidase
protein, which is deprived of enzymatic activity (see cloning of targeting
vector above). It will only give rise to a ß-galactosidase-positive cell
if it undergoes an internal recombination event, which removes the duplication
and eliminates the STOP codon in the sequence. This is a spontaneous event,
which occurs during mitosis at a low frequency
(Bonnerot and Nicolas, 1993
).
Descendants of a cell in which this has occurred will be detected provided
that they express the
-cardiac actin gene. Thus, clones of cells can be
observed directly in the heart of embryos from the
actin+/nlaacZ1.1 line.
As homozygous
c-actin-/-
mice are not viable (Kumar et al.,
1997
), heterozygous
c-actin+/nlaacZ1.1 males were
crossed with superovulated wild-type females ([C57BL/6JxSJL]F1). The
litters contained 50% of
c-actin+/nlaacZ1.1 embryos, as
controlled by PCR of head genomic DNA from 100 E10.5 embryos (data not shown),
showing the Mendelian inheritance of nlaacZ1.1. Embryos were staged
taking E0.5 as the day after crossing (E, embryonic day of development; P,
postnatal day of development). They were dissected in PBS, fixed in 4%
paraformaldehyde, rinsed twice in PBS, stained in X-gal solution to reveal
ß-galactosidase activity (Tajbakhsh
et al., 1996a
) at 37°C for 12-48 hours, rinsed twice in PBS
and postfixed in 4% paraformaldehyde. For better penetration of the solutions,
the ventral pericardial wall was removed at E8.5 and E10.5. Hearts were
isolated from the embryo after Xgal staining at E10.5 and E14.5. Before
addition of X-gal, the thorax was ventrally incised at E14.5. At P7, the heart
was isolated and transversally sectioned prior to X-gal staining.
Clones were observed under an Olympus binocular microscope, and photographed with a 3-CCD camera on a LEICA binocular microscope coupled to LIDA software.
Statistical analysis
The intragenic recombination of nlaacZ into nlacZ is a
spontaneous, heritably transmitted and random event. The frequency of its
occurrence can therefore be analysed by the fluctuation test of Luria and
Delbrück (Luria and Delbrück,
1943
). The number of independent recombinations that have occurred
during the expansion of the pool of myocardial cells follows a Poisson
distribution with the parameter µNt (µ is the rate of recombination and
Nt is the total number of myocardial cells at the time of dissection). µ
can be estimated to equal -ln(p0)/Nt with p0 the
fraction of embryos with no recombined myocardial cells. The parameter of the
Poisson distribution can thus be estimated to be -ln(p0). The
expected number of embryos having undergone N independent recombination events
per heart (Table 2) is
N0(ln(Ne/N0))n/(N!), with N0 the
observed number of embryos with no recombined myocardial cells (N=0) and Ne
the total number of dissected embryos at the stage under consideration
(Table 1).
|
|
(s12/n1+s22/n2),
where x is the mean, s the standard deviation and n the size of the
sample.
Estimation of heart cell numbers by DNA quantitation
Hearts of E8.5 and E10.5 embryos were dissected and pools of 1 to 10 hearts
analysed at a given stage. The pericardium was removed. Other cell types such
as endocardial cells represent a minor contribution to the early embryonic
heart, such that the preparation is largely derived from myocardium. DNA was
extracted and purified from RNA using the DNeasyTM kit (Qiagen).
The quantity of DNA was measured at 260 nm using a Quartz microcuve (150
µl) with a Perkin Elmer Lambda Bio 20 spectrometer. Given the amount of DNA
per diploid nucleus (
6 pg), the number of cells (nuclei) per heart was
estimated using the following equation: cell number per
heart=ODx5x10-2x dilutionxvolume
(µl)/number of hearts/6x10-6. As a control, the total
number of cells from a whole E10.5 embryo using this method was estimated to
be in the range of 3x106 cells, which is similar to reported
values using another method (Burns and
Hassan, 2001
).
Estimation of growth rate
For cells dividing exponentially, their growth rate (
) can be
calculated such that N=No2n with N the number of cells
at time point T, No the number of cells at time point t0
and n the number of divisions where n=t/
(t=T-t0 is the duration of growth, i.e. 48 hours between E10.5 and
E8.5).
| RESULTS |
|---|
|
|
|---|
-cardiac actin gene
Clonal analysis of myocardial cells in the embryonic heart requires that an
appropriate nlaacZ reporter sequence be placed under the
transcriptional control of a gene expressed throughout the myocardium. The
-cardiac actin gene fulfils this requirement
(Sassoon et al., 1988
). In
order to avoid position effects due to the site of transgene integration and
other anomalies in expression due to the nature of transgene regulatory
sequences, we chose to integrate the nlaacZ reporter sequence into
the endogenous
-cardiac actin gene by homologous recombination (see
Materials and Methods and Fig.
1A-D). Heterozygous progeny are viable, fertile and
indistinguishable from wild type, with normal hearts, as previously shown for
heterozygote
-cardiac actin+/- mice
(Kumar et al., 1997
). We
conclude that the modified allele does not affect the development or
functioning of the heart.
The nlaacZ1.1 expression profile was verified by whole-mount in
situ hybridisation with an antisense probe to detect nlaacZ
transcripts on
c-actin+/nlaacZ1.1 embryos at
embryonic day (E) 10.5 (Fig.
1E1-E2), and compared with hybridisation with an antisense
-cardiac actin probe on wild-type E10.5 embryos
(Fig. 1F1-F2). As expected from
the transcription profile of the
-cardiac actin gene
(Sassoon et al., 1988
),
nlaacZ1.1 is expressed throughout the myocardium and in the skeletal
muscle of the myotomes at this stage. Observation of X-gal-positive clones
throughout the myocardium at E8.5, as well as in the skeletal muscles at E14.5
and seven days after birth (P7), confirmed the correct expression of the
reporter gene at other stages. The
c-actin+/nlaacZ1.1 mice that we
have generated are thus suitable for clonal analysis of developing cardiac
muscle cells.
Production of embryos with clones in the myocardium
For systematic analysis of cardiac precursor cells, a large number of
random clones is required. Clones were compared at different developmental
stages, as illustrated in Fig.
2: at E8.5, an early stage of cardiogenesis when the heart is a
looped tube (Fig. 2A), at
E10.5, when the heart is still a non-septated tube, but when the different
cardiac chambers can be identified morphologically
(Fig. 2B), at E14.5, when
ventricular septation is complete and trabecular remodelling is under way
(Fig. 2C) and at P7, when
morphogenesis of the heart is complete
(Fig. 2D). One thousand four
hundred and thirty three embryos or neonates, dissected at these developmental
stages, had ß-galactosidase-positive cells in the heart and are described
here (Table 1).
|
-cardiac
actin-expressing cells and their precursors, and hence the number of cell
divisions during which the nlaacZ1.1 allele can undergo intragenic
recombination. At E14.5 and P7, because of the thickness of the tissue, it was not possible to obtain an accurate count of the number of labelled cells, but their organisation was documented. At E8.5 and E10.5, positive hearts were analysed for the number of ß-galactosidase-positive cells and their distribution in clusters.
Clonal relationship between ß-galactosidase-positive cells
As cell labelling is a random event of intragenic recombination of
nlaacZ into nlacZ, the clonality between
ß-galactosidase-positive cells can be statistically assessed. We have
calculated the expected number of embryos containing independent recombination
events in the heart, at E8.5 and E10.5
(Table 2), based on the
fluctuation test of Luria and Delbrück
(Luria and Delbrück,
1943
). A common feature of positive hearts at every stage studied
is the organisation of ß-galactosidase-positive cells into clusters (Figs
2,
3). To assess whether these
clusters resulted from independent events of recombination, we have compared
the observed distribution of the number of clusters per heart with the
calculated distribution of the number of independent events of recombination
per heart.
|
At E10.5, the observed and expected distributions differ significantly as N increases (Table 2), demonstrating that clusters of ß-galactosidase-positive cells may be clonally related. Two independent labelling events will more probably be located in different regions and have a disparate organisation. In addition, they will more probably lead to smaller clusters as 90% of the positive hearts at E10.5 contain less than 17 labelled cells. Therefore, large clusters, which are closely associated (two clusters of 18 and 32 cells in the outflow tract Fig. 3E) or aligned (seven clusters of more than 20 cells Fig. 3G; this alignment was found in two hearts) are considered to be clonally related.
Similarly, at E14.5 and P7, small clusters are more frequent. Therefore, large clusters closely associated (Fig. 3F) or reproducibly aligned are considered to be clonally related.
Myocardial cells undergo two growth phases
The distribution of ß-galactosidase-positive cells is not homogenous
and cells tend to be organised into clusters. This is a common feature of
positive hearts at every stage studied and in all cardiac subregions. They are
classified into two categories: hearts with a single cluster
(Fig. 2) or with multiple
(>1) clusters (Fig. 3). The
organisation into clonally related clusters shows that myocardial cells
undergo two growth phases, one that is characterised by cell dispersion,
leading to the separation of the clusters, and another that is coherent, i.e.
cells remain close to one another after division, leading to the formation of
a cluster.
Timing of the growth phases
To understand the timing of the growth phases, the simplest model is to
consider that dispersion precedes coherence. In this way, hearts with multiple
clusters reflect a recombination event in an early precursor and hearts with a
single cluster in a recent precursor. Alternatively, if coherence precedes
dispersion, the existence of hearts with a single cluster can only be
explained if the precursors of these clones have not undergone the second
(dispersive) phase, because they have different growth properties (quiescence
or a single growth phase). Furthermore, if dispersion is late, we would expect
that in hearts with multiple clusters, clusters would have a smaller size at
E10.5 than at E8.5. In fact, this is not the case. Hearts with a large number
of cells colonising several cardiac subregions were detected (two hearts at
E8.5 and five at E10.5). In these hearts, the size of the clusters as well as
the distance between the clusters increases significantly between E8.5 and
E10.5 (Fig. 3D at E8.5 and
Fig. 3G at E10.5). Furthermore,
the distinction between clusters at E8.5 is not always clearly evident (in
eight hearts), whereas it is evident at E10.5, indicating that even in these
E8.5 hearts, clusters are in fact distinct, although this only becomes obvious
later. Other examples in the same cardiac region at different stages
(Fig. 3A at E8.5,
Fig. 3E at E10.5 and
Fig. 3F at E14.5) also
illustrate the increase in the size of the clusters. Quantitatively, the
average number of cells per cluster significantly increases from E8.5 to E10.5
in hearts with multiple clusters (5.2±s.e.m. 0.5, n=69 versus
8.3±s.e.m. 1.1, n=587: u=2.65, P<0.01), in spite
of the underestimation at E10.5, which is due to independent events of
recombination resulting in additional small clusters (see discussion of clonal
relationship and Table 2).
Together, these observations suggest that clones with multiple clusters
develop coherently (increase in the size of the clusters), so that coherent
growth predominates after E8.5.
Geometry of clones during the dispersive growth phase
Characterisation of the dispersive growth phase was performed by analysing
clones with multiple clusters. At E8.5, dispersion between clusters is
observed in the different cardiac subregions, arterial pole (n=5,
Fig. 3A), primitive ventricle
(n=8, Fig. 3B) and
venous pole (n=8, Fig.
3C), as well as between them (n=12,
Fig. 3D). The direction of
dispersion can be assessed by analysing the spatial relationship between
clusters. In 26/33 (80%) of E8.5 hearts with multiple clusters, these are
aligned along the venous-arterial axis of the cardiac tube, which initially
has a rostrocaudal orientation (broken red lines
Fig. 3A). This remains true at
later stages, as shown for adjacent clusters in the outflow region
(Fig. 3E at E10.5 and
Fig. 3F at E14.5, compared with
Fig. 3A at E8.5).
The direction of dispersion can also be assessed by analysing the full extension of a clone. In embryonic hearts with a large number of ß-galactosidase-positive cells (Fig. 3D at E8.5 and Fig. 3G at E10.5), the staining extends all along the venous-arterial axis of the tube whereas there is only partial extension along the perpendicular circumferential axis. This shows that myocardial cell growth is anisotropic and that clonally related myocardial cells are distributed along the venous-arterial axis of the tube.
Geometry of clones during the coherent growth phase
Characterisation of the coherent growth phase was performed by analysing
individual clusters. Coherent clusters are found in every cardiac subregion:
in the outflow tract (Fig. 4H),
the ventricles (Fig.
4A,C,F,I,L,M,O), the venous pole or atria
(Fig. 4B,D,K,N), the
atrioventricular canal, which is best seen at E10.5 between ventricles and
atria (Fig. 4E), and the inflow
tract or sinus venosus (Fig.
4G,J).
|
On the transmural axis
Thickening of the myocardium, particularly in the ventricles, is observed
morphologically from E10.5 to birth. Hearts with large ventricular clusters of
ß-galactosidase-positive cells were bisected transversally through the
cluster (Fig. 5A2-E2 and
5C3-D3). As at the surface, ß-galactosidase-positive cells
are, most often, immediately adjacent within a transmural cluster
(Fig. 5E2) or, less frequently,
separated by a few intercalated negative cells
(Fig. 5B2) showing that a low
level of intermingling between clonally unrelated myocardial cells also takes
place on the transmural axis. Clusters colonising the whole depth of the
ventricle were observed from E10.5 to P7
(Fig. 5A at E10.5,
Fig. 5B-D at E14.5 and
Fig. 5E at P7), traversing both
compact and trabeculated myocardium (Fig.
5B-D), indicating that both these layers of the myocardium are
clonally related. Such clusters are wedge shaped, with a wider outer (towards
the epicardium) side and a narrower inner (towards the endocardium) side
(Fig. 5E2). Interestingly, the
tip of the wedge was sometimes observed to extend into the muscular region of
the interventricular septum, traversing the ventricular cavity, which appears
as a discontinuity in the labelling (Fig.
5A2-B2). This observation suggests that the muscular region of the
interventricular septum and the trabeculations are clonally related. The
overall orientation of the clusters in the transmural axis is oblique relative
to the plane of the surface (Fig.
5C1), showing that the direction of transmural growth is not
perpendicular to the plane of the surface. Moreover, the orientation of the
axes of the rows of cells within a cluster often appears to be staggered
between more superficial rows and deeper rows
(Fig. 5F-G), indicating that
the orientation of the rows of cells within a cluster is not necessarily
constant between layers of cells within the ventricular wall.
|
|
Given the proliferative mode of growth of myocardial cells and their precursors, as well as the timing of the phases, we predict that labelling of an earlier precursor will result in a clone with a higher number of cells and a higher number of clusters. Indeed at E8.5, hearts with a higher number of ß-galactosidase-positive cells tend to have a higher number of clusters (compare Fig. 3D with 3A). Conversely, 39/56 (70%) of hearts at E8.5 with a low number of ß-galactosidase-positive cells (2-16 cells) have a single cluster [Fig. 2A and Fig. 4A (clones of one cell are not considered because they can only have one cluster)].
We have also examined the contribution of the different precursors of the clusters. Clusters born at the same time were considered, i.e. those from hearts with multiple clusters. Because labelling in these hearts dates back to the dispersive growth phase, their clusters must have been born at the time of coherent growth initiation. If precursors of the clusters had similar growth properties (i.e. underwent the growth transition synchronously and had the same coherent growth rate), we would expect the size of clusters from hearts with multiple clusters to be constant (inset Fig. 6C). This is not the case at E8.5 (Fig. 6C); therefore we conclude that myocardial precursor cells have heterogeneous growth properties, either different growth rates or different timing for the growth transition. Consistently, hearts at E8.5 with a low number of ß-galactosidase-positive cells (2-16) show coherent growth (39/56 have a single cluster, see the 16 cells in Fig. 4B) or dispersive growth (17/56 have multiple clusters, see the 11 cells in Fig. 3C) and this difference is seen between hearts with the same total number of labelled cells, indicating that precursors of clones, which have undergone the same number of cell divisions, have heterogeneous growth properties.
Quantitatively, the apparent growth rate of myocardial cells was estimated
between E8.5 and E10.5, when growth is proliferative. With the approximation
that the rate is constant, it was calculated on the basis of the exponential
increase in total myocardial cell number (see Materials and Methods). The
total number of cells in the myocardium was estimated by DNA quantitation to
be 19,000 cells±s.d. 4,000 at E8.5 and 180,000±s.d. 25,000 at
E10.5. This gives an apparent growth rate for myocardial cells of about 15
hours±2 per cell cycle. This is only an approximation, as growth rates
are lower in some areas of the looping heart such as the inner curvature, as
shown in the chick embryos by Thompson et al.
(Thompson et al., 1990
). The
9.5-fold increase in the total number of myocardial cells is confirmed in our
clonal analysis by the similar increase in the maximum size of clusters from
hearts with multiple clusters (27 at E8.5 and 270 at E10.5) and in the
frequency of ß-galactosidase-positive embryos from E8.5 to E10.5
(Table 1). This latter
observation also confirms that nlaacZ intragenic recombination is a
random, non-biased, event.
| DISCUSSION |
|---|
|
|
|---|
-cardiac actin gene, expressed throughout the myocardium, it is this
major component of the heart which is monitored. The frequency of
recombination, which leads to a functional nlacZ gene, is crucial in
determining clonality. Because it is a random event, the clonality of a
pattern of cell distribution can be statistically assessed. In this study, we
show that most clusters of ß-galactosidase-positive cells in the heart
are clonally related at E8.5; this is also the case for large clusters, which
are adjacent or aligned, at later stages. Our analysis demonstrates that
myocardial cells and their precursors in the mouse embryo follow a
proliferative mode of growth, rather than a stem cell mode, with two distinct
behaviours: an earlier phase of extensive cell intermingling, when clusters of
cells are dispersed along the venous-arterial axis of the cardiac tube (which
initially has a rostrocaudal orientation), followed by oriented coherent cell
growth, which is characterised by a low level of intermingling.
Early rostrocaudal dispersion of myocardial cell precursors
The growth properties of myocardial cell precursors during the dispersive
growth phase underlie the cellular basis of heart tube formation. We have not
detected characteristic stem cell growth during this early phase. The heart
tube is a polyclonal structure, in which rearrangement of clones occurs along
the venous-arterial axis, probably because of intercalation.
Rostrocaudal dispersion is observed in clones derived from an earlier
precursor, because rare and very large clones at E8.5 colonise the entire
length of the cardiac tube. This suggests that dispersive growth is
continuous, and is initiated early, such that clones derived from an earlier
precursor are widely distributed. A high level of intermingling has been
reported to occur between mouse epiblast cells, shortly before and during
gastrulation (Lawson et al.,
1991
; Gardner and Cockroft,
1998
), suggesting that dispersion between myocardial precursor
cells may be initiated in the epiblast, between E6 and E7. Cardiac precursor
cells ingress through the primitive streak at E7
(Kinder et al., 1999
). Later,
as these cells migrate rostrally, they may also intermingle. Although this is
controversial, it has been observed in chick
(DeHaan, 1963a
;
Redkar et al., 2001
) and is
compatible with studies of chick gastrulation movements
(Yang et al., 2002
).
Rostrocaudal dispersion was indeed observed in four hearts at E8.5 containing
six to eight labelled cells, indicating that dispersive growth is still
operational three divisions earlier than E8.5, and suggesting that it
continues after gastrulation. Therefore, the idea that myocardial precursor
cells grow and move as a coherent sheet from the primitive streak to the heart
tube (Rosenquist and De Haan,
1966
; Stalsberg and De Haan,
1969
) is not compatible with our results.
A similar process of early rostrocaudal dispersion has been reported in
several other epithelial structures in the mouse embryo, including endoderm
(Lawson and Pedersen, 1987
),
notochord (Lawson and Pedersen,
1992
; Beddington,
1994
), myotome (Nicolas et
al., 1996
; Eloy-Trinquet and
Nicolas, 2002
) and neuroepithelium
(Lawson and Pedersen, 1992
;
Mathis and Nicolas, 2000
;
Mathis et al., 1999
). It is
therefore possible that the early rostrocaudal dispersive phase of myocardial
precursor cell growth is regulated by a general organising signal, such as
that emanating from the node or the primitive streak, leading to the
rostrocaudal elongation of structures in the developing embryo.
Growth transition at the time of heart tube formation
The coherent growth phase of myocardial cells has already been initiated at
E8.5 as 64% of the hearts at this stage contain coherent clones (single
cluster). Our analysis at E8.5 shows that there is heterogeneity in the growth
properties of the precursors of the clusters. This may be due to differential
growth rates. However, previous reports in chick embryos, based on tritiated
thymidine incorporation, did not detect differences in the rate of
proliferation of cardiac cells in the early cardiac tube
(Sissman, 1966
). The
heterogeneity may instead be due to an asynchronous transition from dispersive
to coherent growth. Indeed, during the early phases of cardiogenesis, new
cardiac precursor cells are being continuously added to the myocardium,
rostrally and caudally to both poles of the heart
(Viragh and Challice, 1973
;
Kelly and Buckingham, 2002
).
Heterogeneity in the sizes of clusters from hearts with multiple clusters at
E8.5 is observed in the different cardiac subregions (data not shown).
However, the maximum size of these clusters is significantly higher in the
primitive ventricle (27) than at the arterial (15) or venous (13) poles,
suggesting that the first cells that undergo the transition to coherent growth
are ventricular precursor cells. This is in agreement with previous in vivo
labelling studies in the chick embryo, which have shown that the cardiac tube
is initially mostly composed of ventricular precursor cells
(de la Cruz et al., 1989
).
Thus, the progressive increase in differentiated myocardial cells, which
occurs during the same time period, is likely to be linked with the growth
phase transition.
One can only speculate at present about the molecular signals that induce
this major transition in cell behaviour, which is characterised by reduced
intermingling and a change in growth orientation. In addition to extrinsic
signals, major cardiac transcription factors such as Nkx2.5
(Lyons et al., 1995
;
Tanaka et al., 1999
) may be
implicated in this process. It is only after formation of the cardiac tube
that null mutations in this gene and in those encoding factors such as Hand1
or Hand2 (Srivastava et al.,
1997
; Firulli et al.,
1998
; Riley et al.,
1998
), or Tbx5 (Bruneau et al.,
2001
), which are only expressed in a subset of cardiac cells,
interfere with the formation of a specific cardiac chamber. These factors may
affect myocardial cell growth. Indeed, Tbx5
(Hatcher et al., 2001
), Hand2
(Yamagishi et al., 2001
) and
HOP, a recently discovered downstream effector of Nkx2.5
(Shin et al., 2002
;
Chen et al., 2002
) have been
shown to be directly involved in cell proliferation and survival.
Coherent growth of myocardial cells at the time of chamber
formation
Our results show that coherent growth predominates after E8.5, at the time
of chamber formation. Indeed, between E8.5 and E10.5, the number of cells per
cluster in hearts with multiple clusters increases. This is consistent with
previous observations of chick ventricular cell growth, based on retroviral
labelling at different developmental stages
(Mikawa et al., 1992a
).
However, coherent growth is not confined to the cardiac chambers and is
therefore not a specific characteristic of the proliferative (`working')
myocardium which has been proposed to balloon out from the outer curvature of
the primitive cardiac tube (Christoffels
et al., 2000
). Nor is it confined to myocardial cells derived from
the primary, as distinct from the anterior or secondary heart field, which
provides myocardial precursors for the outflow tract region of the heart
during this period (Kelly et al.,
2001
). Coherent growth is observed at E10.5 and at later stages in
all regions of the heart.
We show that myocardial cells follow a proliferative mode of growth with an
apparent growth rate of 15 hours per cell cycle between E8.5 and E10.5. This
growth rate is not significantly different from that proposed in chick
(Mikawa et al., 1992a
;
Mima et al., 1995
) and is
higher than that calculated previously in the mouse heart at E9 and E10, based
on tritiated thymidine incorporation (10 hours) (see
Rumyantsev, 1977
). This is
only an approximation, as BrdU labelling showed similar levels of
proliferation in the primitive chambers but lower levels in the inner
curvature of the tubular heart as it loops. The atrioventricular canal and
distal truncus have fewer dividing cells, but it is only later, as septation
takes place, that major changes occur in the chick
(Thompson et al., 1990
) and
mouse (see Rumyantsev, 1977
)
hearts. Selective cell death, during remodelling of the outflow tract for
example, is again a later phenomenon. At early stages of cardiogenesis
apoptosis is confined to small areas, along the midline of the fusing heart
tube and at the poles when the tube detaches from the body
(van den Hoff et al., 2000
;
Cheng et al., 2002
). We find
that clone size and numbers increase between E8.5 and E10.5 throughout the
heart and we therefore do not detect a major impact of cell cycle withdrawal
or apoptosis during this period. Together, these observations indicate that
differential rates of proliferation and selective cell death may modulate
growth parameters locally in rare clones but are unlikely to introduce a major
bias in the overall growth characteristics that we describe here at embryonic
stages.
As in the case of the chick heart
(Mikawa et al., 1992a
), we
observe wedge-shaped clusters across the ventricular wall. This would imply
that cells have proliferated more in the peripheral layer of the myocardium,
which is supported by the distribution of BrdU negative quiescent cells
(Thompson et al., 1990
) (see
Mikawa et al., 1992a
), and
would be important in shaping the ventricular chambers. In considering how the
ventricles grow, it is notable that clones of labelled cells extend from
compact to trabeculated myocardium and also from the trabeculae to the
muscular part of the interventricular septum, implying that this is a clonal
continuum.
In most clusters, as early as E10.5, coherent growth is characterised by an
elongated geometry and a suborganisation into rows of cells, both on the
surface of the heart and traversing the ventricular wall. There is some degree
of intermingling with occasional non-labelled cells within the
ß-galactosidase-positive clone. These observations are in accordance with
those of Mikawa et al. (Mikawa et al.,
1992a
) who described similar growth characteristics across the
adult chick ventricular wall. They found that secondary rows of cells or
`minispindles' were orientated at 20-40° to the main axis of elongation,
or `masterspindle', of the cluster. By contrast, in the mouse heart, where we
document this phenomenon throughout the myocardium, the axis of the rows of
cells appears to be random in relation to the main axis of the cluster. This
would suggest that two independent events of orientation are occurring
simultaneously during the growth of a cluster. Indeed, no large single row of
cells was observed. The local signals responsible for the orientation of the
rows and for the elongation of the clusters remain to be determined but this
organisation of cell growth within a cluster is no doubt an important,
characteristic aspect of cardiac morphogenesis. In clusters at P7, the
orientation of the rows of cells appears to correlate with that of cardiac
myofibres. This is compatible with our observation of a progressive shift in
their orientation across the ventricular wall and consistent with the
description of `minispindles' in chick
(Mikawa et al., 1992a
). Our
results in the mouse imply that a myofibre is polyclonal and that architecture
is prefigured in the embryonic heart as early as E10.5, by the orientation of
cell division, reflected by the arrays of nuclei seen in a cluster. This is in
contrast to the later appearance of a supracellular organisation of the
sarcomeres at E15 described for the rat embryo
(Wenink et al., 1996
). A
possible signal for the orientation of the rows of cells may originate from
mechanical forces, created by tissue contraction and blood pressure, that are
thought to influence myocardial architecture (see
Taber, 1998
;
Sedmera et al., 2000
). Such
signals would be independent from molecular signals regulating cardiomyocyte
proliferation. Relevant to this, missense mutations in sarcomeric genes such
as
-cardiac actin, have been shown to lead to hypertrophic
cardiomyopathies characterised by myocardial fibre disarray and cell
disorganisation (Bonne et al.,
1998
).
Conclusions
Clonal analysis of myocardial cells in the mouse heart has revealed two
growth phases with an asyonchronous transition between different myocardial
cell precursors, during the period of cardiac tube formation and of
progressive cardiac cell differentiation. The first dispersive phase marks the
early stages of cardiogenesis. The second coherent phase of cell growth
characterises all regions of the myocardium and coincides with the major
remodelling of the cardiac tube and subsequent growth of the four-chambered
heart. Notably, the myofibre architecture of the mouse heart would appear to
be prefigured at E10.5, by oriented cell proliferation, and this has potential
implications for cardiomyopathies. Comparison with observations on the chick
heart would suggest that characteristics of coherent growth are well conserved
in amniotes. It will be of major interest to assess the extent of conservation
of the dispersive growth phase in the chick and other vertebrates. One can
speculate about its importance in hearts, like that of the zebrafish, which
remains as a tube with a single ventricle and atrium, and in which mutations
in genes such as tbx5 (Garrity et
al., 2002
) or hand2
(Yelon et al., 2000
) have a
much more severe phenotype. Indeed single cell injection into the early
blastula of zebrafish resulted in clones of 2-22 cells distributed
rostrocaudally along the extent of the heart tube at 36 hpf
(Stainier et al., 1993
). These
observations point to the interest of pursuing the characterisation of cell
growth modes in order to understand the mechanisms underlying heart
morphogenesis and evolution.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Beddington, R. S. (1994). Induction of a second
neural axis by the mouse node. Development
120,613
-620.[Abstract]
Biben, C., Hadchouel, J., Tajbakhsh, S. and Buckingham, M.
(1996). Developmental and tissue-specific regulation of the
murine cardiac actin gene in vivo depends on distinct skeletal and cardiac
muscle-specific enhancer elements in addition to the proximal promoter.
Dev. Biol. 173,200
-212.[CrossRef][Medline]
Bonne, G., Carrier, L., Richard, P., Hainque, B. and Schwartz,
K. (1998). Familial hypertrophic cardiomyopathy: from
mutations to functional defects. Circ. Res.
83,580
-593.
Bonnerot, C. and Nicolas, J. F. (1993). Clonal
analysis in the intact mouse embryo by intragenic homologous recombination.
C. R. Acad. Sci. III
316,1207
-1217.[Medline]
Bruneau, B. G., Nemer, G., Schmitt, J. P., Charron, F.,
Robitaille, L., Caron, S., Conner, D. A., Gessler, M., Nemer, M., Seidman, C.
E. et al. (2001). A murine model of Holt-Oram syndrome
defines roles of the T-box transcription factor Tbx5 in cardiogenesis and
disease. Cell 106,709
-721.[CrossRef][Medline]
Burns, J. L. and Hassan, A. B. (2001). Cell
survival and proliferation are modified by insulin-like growth factor 2
between days 9 and 10 of mouse gestation. Development
128,3819
-3830.
Capdevila, J., Vogan, K. J., Tabin, C. J. and Izpisua Belmonte,
J. C. (2000). Mechanisms of left-right determination in
vertebrates. Cell 101,9
-21.[CrossRef][Medline]
Chen, F., Kook, H., Milewski, R., Gitler, A., Lu, M., Li, J.,
Nazarian, R., Schnepp, R., Jen, K., Biben, C. et al. (2002).
Hop is an unusual homeobox gene that modulates cardiac development.
Cell 110,713
.[CrossRef][Medline]
Cheng, G., Wessels, A., Gourdie, R. G. and Thompson, R. P.
(2002). Spatiotemporal and tissue specific distribution of
apoptosis in the developing chick heart. Dev. Dyn.
223,119
-133.[CrossRef][Medline]
Christoffels, V. M., Habets, P. E., Franco, D., Campione, M., de
Jong, F., Lamers, W. H., Bao, Z. Z., Palmer, S., Biben, C., Harvey, R. P. et
al. (2000). Chamber formation and morphogenesis in the
developing mammalian heart. Dev. Biol.
223,266
-278.[CrossRef][Medline]
Cripps, R. M. and Olson, E. N. (2002). Control
of cardiac development by an evolutionarily conserved transcriptional network.
Dev. Biol. 246,14
-28.[CrossRef][Medline]
de la Cruz, M., Sanchez-Gomez, C. and Palomino, M.
(1989). The primitive cardiac regions in the straight heart tube
(stage 9-) and their anatomical expression in the mature heart: an
experimental study in the chick embryo. J. Anat.
165,121
-131.[Medline]
DeHaan, R. L. (1963a). Migration patterns of
the precardiac mesoderm in the early chick embryo. Exp. Cell
Res. 29,544
-560.[CrossRef][Medline]
DeHaan, R. L. (1963b). Organization of the
cardiogenic plate in the early chick embryo. Acta Embryol.
Morphol. Exp. 6,26
-38.
Eloy-Trinquet, S. and Nicolas, J. F. (2002).
Cell coherence during production of the presomitic mesoderm and somitogenesis
in the mouse embryo. Development
129,3609
-3619.
Firulli, A. B., McFadden, D. G., Lin, Q., Srivastava, D. and
Olson, E. N. (1998). Heart and extra-embryonic mesodermal
defects in mouse embryos lacking the bHLH transcription factor Hand1.
Nat. Genet. 18,266
-270.[CrossRef][Medline]
Fishman, M. and Olson, E. (1997). Parsing the
heart: genetic modules for organ assembly. Cell
91,153
-156.[CrossRef][Medline]
Garcia-Martinez, V. and Schoenwolf, G. C.
(1993). Primitive-streak origin of the cardiovascular system in
avian embryos. Dev. Biol.
159,706
-719.[CrossRef][Medline]
Gardner, R. L. and Cockroft, D. L. (1998).
Complete dissipation of coherent clonal growth occurs before gastrulation in
mouse epiblast. Development
125,2397
-2402.[Abstract]
Garrity, D. M., Childs, S. and Fishman, M. C.
(2002). The heartstrings mutation in zebrafish causes heart/fin
Tbx5 deficiency syndrome. Development
129,4635
-4645.
Harvey, R. P. (2002). Organogenesis: Patterning
the vertebrate heart. Nat. Rev. Genet.
3, 544-556.[CrossRef][Medline]
Hatcher, C. J., Kim, M. S., Mah, C. S., Goldstein, M. M., Wong,
B., Mikawa, T. and Basson, C. T. (2001). TBX5 transcription
factor regulates cell proliferation during cardiogenesis. Dev.
Biol. 230,177
-188.[CrossRef][Medline]
Kelly, R. G., Brown, N. A. and Buckingham, M. E.
(2001). The arterial pole of the mouse heart forms from
Fgf10-expressing cells in pharyngeal mesoderm. Dev.
Cell 1,435
-440.[CrossRef][Medline]
Kelly, R. G. and Buckingham, M. E. (2002). The
anterior heart-forming field: voyage to the arterial pole of the heart.
Trends Genet. 18,210
-216.[CrossRef][Medline]
Kinder, S. J., Tsang, T. E., Quinlan, G. A., Hadjantonakis, A.
K., Nagy, A. and Tam, P. P. (1999). The orderly allocation of
mesodermal cells to the extraembryonic structures and the anteroposterior axis
during gastrulation of the mouse embryo. Development
126,4691
-4701.[Abstract]
Kumar, A., Crawford, K., Close, L., Madison, M., Lorenz, J.,
Doetschman, T., Pawlowski, S., Duffy, J., Neumann, J., Robbins, J. et al.
(1997). Rescue of cardiac alpha-actin-deficient mice by enteric
smooth muscle gamma-actin. Proc. Natl. Acad. Sci. USA
94,4406
-4411.
Lallemand, Y., Luria, V., Haffner-Krausz, R. and Lonai, P.
(1998). Maternally expressed PGK-Cre transgene as a tool for
early and uniform activation of the Cre site-specific recombinase.
Transgenic Res. 7,105
-112.[CrossRef][Medline]
Lawson, K. A. and Pedersen, R. A. (1987). Cell
fate, morphogenetic movement and population kinetics of embryonic endoderm at
the time of germ layer formation in the mouse.
Development 101,627
-652.[Abstract]
Lawson, K. A. and Pedersen, R. A. (1992).
Clonal analysis of cell fate during gastrulation and early neurulation in the
mouse. Ciba Found. Symp.
165, 3-26.[Medline]
Lawson, K. A., Meneses, J. J. and Pedersen, R. A.
(1991). Clonal analysis of epiblast fate during germ layer
formation in the mouse embryo. Development
113,891
-911.[Abstract]
Luria, S. and Delbrück, M. (1943).
Mutations of bacteria from virus sensitivity to virus resistance.
Genetics 28,491
-511.
Lyons, I., Parsons, L. M., Hartley, L., Li, R., Andrews, J. E.,
Robb, L. and Harvey, R. P. (1995). Myogenic and morphogenetic
defects in the heart tubes of murine embryos lacking the homeo box gene
Nkx2-5. Genes Dev. 9,1654
-1666.
Mathis, L. and Nicolas, J. F. (2000). Different
clonal dispersion in the rostral and caudal mouse central nervous system.
Development 127,1277
-1290.[Abstract]
Mathis, L. and Nicolas, J. F. (2002). Cellular
patterning of the vertebrate embryo. Trends Genet.
18,627
-635.[CrossRef][Medline]
Mathis, L., Sieur, J., Voiculescu, O., Charnay, P. and Nicolas,
J. F. (1999). Successive patterns of clonal cell dispersion
in relation to neuromeric subdivision in the mouse neuroepithelium.
Development 126,4095
-4106.[Abstract]
Mikawa, T., Borisov, A., Brown, A. M. and Fischman, D. A.
(1992a). Clonal analysis of cardiac morphogenesis in the chicken
embryo using a replication-defective retrovirus: I. Formation of the
ventricular myocardium. Dev. Dyn.
193, 11-23.[Medline]
Mikawa, T., Cohen-Gould, L. and Fischman, D. A.
(1992b). Clonal analysis of cardiac morphogenesis in the chicken
embryo using a replication-defective retrovirus. III: Polyclonal origin of
adjacent ventricular myocytes. Dev. Dyn.
195,133
-141.[Medline]
Mima, T., Ueno, H., Fischman, D. A., Williams, L. T. and Mikawa,
T. (1995). Fibroblast growth factor receptor is required for
in vivo cardiac myocyte proliferation at early embryonic stages of heart
development. Proc. Natl. Acad. Sci. USA
92,467
-471.
Mjaatvedt, C. H., Nakaoka, T., Moreno-Rodriguez, R., Norris, R.
A., Kern, M. J., Eisenberg, C. A., Turner, D. and Markwald, R. R.
(2001). The outflow tract of the heart is recruited from a novel
heart-forming field. Dev. Biol.
238,97
-109.[CrossRef][Medline]
Nicolas, J. F., Mathis, L., Bonnerot, C. and Saurin, W.
(1996). Evidence in the mouse for self-renewing stem cells in the
formation of a segmented longitudinal structure, the myotome.
Development 122,2933
-2946.[Abstract]
Olson, E., Arnold, H., Rigby, P. and Wold, B.
(1996). Know your neighbors: three phenotypes in null mutants of
the myogenic bHLH gene MRF4. Cell
85, 1-4.[CrossRef][Medline]
Rawles, M. E. (1943). The heart-forming areas
of the early chick blastoderm. Physiol. Zool.
16, 22-42.
Redkar, A., Montgomery, M. and Litvin, J.
(2001). Fate map of early avian cardiac progenitor cells.
Development 128,2269
-2279.
Riley, P., Anson-Cartwright, L. and Cross, J. C.
(1998). The Hand1 bHLH transcription factor is essential for
placentation and cardiac morphogenesis. Nat. Genet.
18,271
-275.[CrossRef][Medline]
Rosenquist, G. C. and De Haan, R. L. (1966).
Migration of precardiac cells in the chick embryo: a radioautographic study.
Contribut. Embryol. 263,111
-121.
Rumyantsev, P. P. (1977). Interrelations of the
proliferation and differentiation processes during cardiact myogenesis and
regeneration. Int. Rev. Cytol.
51,186
-273.[Medline]
Sassoon, D. A., Garner, I. and Buckingham, M.
(1988). Transcripts of alpha-cardiac and alpha-skeletal actins
are early markers for myogenesis in the mouse embryo.
Development 104,155
-164.[Abstract]
Sedmera, D., Pexieder, T., Vuillemin, M., Thompson, R. P. and
Anderson, R. H. (2000). Developmental patterning of the
myocardium. Anat. Rec.
258,319
-337.[CrossRef][Medline]
Selfridge, J., Pow, A. M., McWhir, J., Magin, T. M. and Melton,
D. W. (1992). Gene targeting using a mouse HPRT
minigene/HPRT-deficient embryonic stem cell system: inactivation of the mouse
ERCC-1 gene. Somat. Cell Mol. Genet.
18,325
-336.[CrossRef][Medline]
Shin, C., Liu, Z., Passier, R., Zhang, C., Wang, D., Harris, T.,
Yamagishi, H., Richardson, J., Childs, G. and Olson, E.
(2002). Modulation of cardiac growth and development by HOP, an
unusual homeodomain protein. Cell
110, 725.[CrossRef][Medline]
Sissman, N. J. (1966). Cell multiplication
rates during development of the primitive cardiac tube in the chick embryo.
Nature 210,504
-507.[CrossRef][Medline]
Soriano, P. (1997). The PDGF alpha receptor is
required for neural crest cell development and for normal patterning of the
somites. Development
124,2691
-2700.[Abstract]
Srivastava, D., Thomas, T., Lin, Q., Kirby, M. L., Brown, D. and
Olson, E. N. (1997). Regulation of cardiac mesodermal and
neural crest development by the bHLH transcription factor dHAND.
Nat. Genet. 16,154
-160.[CrossRef][Medline]
Stainier, D. Y., Lee, R. K. and Fishman, M. C.
(1993). Cardiovascular development in the zebrafish. I.
Myocardial fate map and heart tube formation.
Development 119,31
-40.[Abstract]
Stalsberg, H. and De Haan, R. L. (1969). The
precardiac areas and formation of the tubular heart in the chick embryo.
Dev. Biol. 19,128
-159.[CrossRef][Medline]
Stent, G. S. (1985). The role of cell lineage
in development. Philos. Trans. R. Soc. Lond. B. Biol.
Sci. 312,3
-19.
Taber, L. A. (1998). Mechanical aspects of
cardiac development. Prog. Biophys. Mol. Biol.
69,237
-255.[CrossRef][Medline]
Tajbakhsh, S., Bober, E., Babinet, C., Pournin, S., Arnold, H.
and Buckingham, M. (1996a). Gene targeting the myf-5 locus
with nlacZ reveals expression of this myogenic factor in mature skeletal
muscle fibres as well as early embryonic muscle. Dev.
Dyn. 206,291
-300.[CrossRef][Medline]
Tajbakhsh, S., Rocancourt, D. and Buckingham, M.
(1996b). Muscle progenitor cells failing to respond to positional
cues adopt non-myogenic fates in myf-5 null mice.
Nature 384,266
-270.[CrossRef][Medline]
Tam, P. P., Parameswaran, M., Kinder, S. J. and Weinberger, R.
P. (1997). The allocation of epiblast cells to the embryonic
heart and other mesodermal lineages: the role of ingression and tissue
movement during gastrulation. Development
124,1631
-1642.[Abstract]
Tanaka, M., Chen, Z., Bartunkova, S., Yamasaki, N. and Izumo,
S. (1999). The cardiac homeobox gene Csx/Nkx2.5 lies
genetically upstream of multiple genes essential for heart development.
Development 126,1269
-1280.[Abstract]
Thomas, K. R., Folger, K. R. and Capecchi, M. R.
(1986). High frequency targeting of genes to specific sites in
the mammalian genome. Cell
44,419
-428.[CrossRef][Medline]
Thompson, R. P., Lindroth, J. R. and Wong, Y. M. M.
(1990). Regional differences in DNA-synthetic activity in the
preseptation myocardium of the chick. In Developmental Cardiology:
Morphogenesis and Function (ed. E. B. Clark and A. Takao), pp.219
-234. Mount Kisco, NY: Futura
Publishing.
van den Hoff, M. J., van den Eijnde, S. M., Viragh, S. and
Moorman, A. F. (2000). Programmed cell death in the
developing heart. Cardiovasc. Res.
45,603
-620.
Viragh, S. and Challice, C. E. (1973). Origin
and differentiation of cardiac muscle cells in the mouse. J.
Ultrastruct. Res. 42,1
-24.[CrossRef][Medline]
Waldo, K. L., Kumiski, D. H., Wallis, K. T., Stadt, H. A.,
Hutson, M. R., Platt, D. H. and Kirby, M. L. (2001).
Conotruncal myocardium arises from a secondary heart field.
Development 128,3179
-3188.
Wenink, A. C., Knaapen, M. W., Vrolijk, B. C. and VanGroningen,
J. P. (1996). Development of myocardial fiber organization in
the rat heart. Anat. Embryol.
193,559
-567.[Medline]
Yamagishi, H., Yamagishi, C., Nakagawa, O., Harvey, R. P.,
Olson, E. N. and Srivastava, D. (2001). The combinatorial
activities of Nkx2.5 and dHAND are essential for cardiac ventricle formation.
Dev. Biol. 239,190
-203.[CrossRef][Medline]
Yang, X., Dormann, D., Munsterberg, A. E. and Weijer, C. J.
(2002). Cell movement patterns during gastrulation in the chick
are controlled by positive and negative chemotaxis mediated by FGF4 and FGF8.
Dev. Cell 3,425
-437.[CrossRef][Medline]
Yelon, D., Ticho, B., Halpern, M. E., Ruvinsky, I., Ho, R. K.,
Silver, L. M. and Stainier, D. Y. (2000). The bHLH
transcription factor hand2 plays parallel roles in zebrafish heart and
pectoral fin development. Development
127,2573
-2582.[Abstract]
Zaffran, S. and Frasch, M. (2002). Early
signals in cardiac development. Circ. Res.
91,457
-469.
Zammit, P. S., Kelly, R. G., Franco, D., Brown, N., Moorman, A.
F. and Buckingham, M. E. (2000). Suppression of atrial myosin
gene expression occurs independently in the left and right ventricles of the
developing mouse heart. Dev. Dyn.
217, 75-85.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. A. Wills, J. E. Holdway, R. J. Major, and K. D. Poss Regulated addition of new myocardial and epicardial cells fosters homeostatic cardiac growth and maintenance in adult zebrafish Development, January 1, 2008; 135(1): 183 - 192. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Arques, R. Doohan, J. Sharpe, and M. Torres Cell tracing reveals a dorsoventral lineage restriction plane in the mouse limb bud mesenchyme Development, October 15, 2007; 134(20): 3713 - 3722. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bajard, F. Relaix, M. Lagha, D. Rocancourt, P. Daubas, and M. E. Buckingham A novel genetic hierarchy functions during hypaxial myogenesis: Pax3 directly activates Myf5 in muscle progenitor cells in the limb Genes & Dev., September 1, 2006; 20(17): 2450 - 2464. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bajolle, S. Zaffran, R. G. Kelly, J. Hadchouel, D. Bonnet, N. A. Brown, and M. E. Buckingham Rotation of the Myocardial Wall of the Outflow Tract Is Implicated in the Normal Positioning of the Great Arteries Circ. Res., February 17, 2006; 98(3): 421 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Esner, S. M. Meilhac, F. Relaix, J.-F. Nicolas, G. Cossu, and M. E. Buckingham Smooth muscle of the dorsal aorta shares a common clonal origin with skeletal muscle of the myotome Development, February 15, 2006; 133(4): 737 - 749. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Leri, J. Kajstura, and P. Anversa Cardiac Stem Cells and Mechanisms of Myocardial Regeneration Physiol Rev, October 1, 2005; 85(4): 1373 - 1416. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zaffran, R. G. Kelly, S. M. Meilhac, M. E. Buckingham, and N. A. Brown Right Ventricular Myocardium Derives From the Anterior Heart Field Circ. Res., August 6, 2004; 95(3): 261 - 268. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Relaix, D. Rocancourt, A. Mansouri, and M. Buckingham Divergent functions of murine Pax3 and Pax7 in limb muscle development Genes & Dev., May 1, 2004; 18(9): 1088 - 1105. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Meilhac, M. Esner, M. Kerszberg, J. E. Moss, and M. E. Buckingham Oriented clonal cell growth in the developing mouse myocardium underlies cardiac morphogenesis J. Cell Biol., January 5, 2004; 164(1): 97 - 109. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Relaix, M. Polimeni, D. Rocancourt, C. Ponzetto, B. W. Schafer, and M. Buckingham The transcriptional activator PAX3-FKHR rescues the defects of Pax3 mutant mice but induces a myogenic gain-of-function phenotype with ligand-independent activation of Met signaling in vivo Genes & Dev., December 1, 2003; 17(23): 2950 - 2965. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||