|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online July 21, 2003
doi: 10.1242/10.1242/dev.00600

1 Cardiovascular Research Center, Department of Medicine, Massachusetts General
Hospital and Harvard Medical School, Charlestown, MA 02129, USA
2 Pediatric Gastroenterology Unit, Deptartment of Pediatrics, Massachusetts
General Hospital and Harvard Medical School, Charlestown, MA 02129, USA
* Author for correspondence (e-mail: mayer{at}cvrc.mgh.harvard.edu)
Accepted 14 May 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Zebrafish, Genetics, Intestine, Digestive system, Embryology, RNA-binding proteins
| INTRODUCTION |
|---|
|
|
|---|
Organogenesis is conventionally framed by morphogenetic events, and as
molecular insight accrues, the morphogenetic framework is annotated with
details of expression patterns and gene activities. For the intestine,
morphogenesis of the adult form begins with aggregations of mesenchyme beneath
the epithelium to create the beginnings of intestinal villi. These changes are
accompanied by epithelial cytodifferentiation, marked by the acquisition of
apical-basal cell polarity and the initiation of lineage-specific gene
expression programs (Montgomery et al.,
1999
; Roberts,
1999
). Individual aspects of the anlage-to-organ transition have
been linked to single genes. For example, genetic control has been
demonstrated for villus number (Karlsson
et al., 2000
) or form
(Kaestner et al., 1997
),
goblet cell differentiation (Katz et al.,
2002
) or secretory cell specification
(Yang et al., 2001
). Yet to
our knowledge, there are no reports of mutations that arrest development after
primitive gut tube morphogenesis but before the initiation of villi formation.
Thus it is not known whether global regulation of this step exists, or whether
such regulation might be genetically dissectible.
A similar question can be formulated for the pancreas and liver. These
anlage bud from the primitive gut tube, expressing both endoderm-specific and,
progressively, organ-specific genes. The pancreatic anlage expresses Pdx1,
then matures through cell fate decisions that lead to islet cells and exocrine
cells (Edlund, 1999
). The
exocrine pancreas then grows and differentiates under the influence of factors
produced by the adjacent mesenchyme
(Wessells and Cohen, 1967
).
The logic of pancreas development has become clearer in recent years, as
genetic and embryologic studies have related specific signaling pathways to
discrete steps of the developmental sequence
(Kim and Hebrok, 2001
). The
liver is distinguished by expression of organ-specific genes even before the
anlage becomes morphologically detectable, but its subsequent outgrowth is
also controlled by interactions with surrounding tissues
(Zaret, 2000
).
Classic genetic studies of development have proven their utility in creating a molecular underpinning for the metazoan body plan, but the model organisms exploited to create that framework, Drosophila and C. elegans, lack many of the organs found in vertebrates. Taking our cue from this powerful approach, we sought to discover whether there are genes that, when mutated, would freeze the developing vertebrate digestive tract in an undifferentiated state. We therefore conducted a genetic screen in zebrafish. Here, we describe the positional cloning and characterization of npo (nil per os, Latin for `nothing by mouth'). We show that npo encodes a conserved RNA recognition motif protein that is dynamically expressed in the embryonic digestive tract, the requirement for which defines a novel control point during organogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mutagenesis and screening
Males of the TL line were treated with ENU as described previously
(Haffter et al., 1996
), bred
with wild-type females for at least two generations, then in-crossed to drive
recessive mutations to homozygosity. Live inbred progeny were examined at 4
days postfertilization (dpf) using a Wild M10 dissecting microscope.
Histologic methods
Fixation of embryos for histology, embedding in JB-4 (Polysciences) and
plastic sectioning was performed as described previously
(Pack et al., 1996
). Embryos
for electron microscopy were fixed in 2% glutaraldehyde in 0.1 M sodium
cacodylate buffer (pH 7.4) overnight at 4°C. Embryos were rinsed in
buffer, post-fixed in 1% osmium tetroxide in cacodylate buffer for 1 hour at
room temperature, rinsed again in buffer, then in distilled water and stained,
en bloc, in an aqueous solution of 2% uranyl acetate for 1 hour at room
temperature. They were rinsed in distilled water and dehydrated through a
graded series of ethanol to 100%. They were further dehydrated in 100%
propylene oxide and then infiltrated with Epon resin (Electron Microscopy
Sciences, Fort Washington, PA) in a 1:1 solution of Epon:propylene oxide. The
following day they were placed in fresh Epon for several hours and then
embedded in Epon overnight at 60°C. Thin sections were cut on a Reichert
Ultracut E ultramicrotome, collected on formvar-coated slot grids, stained
with uranyl acetate and lead citrate, and examined using a Philips CM 10
transmission electron microscope at 80 kV.
Cartilage staining
Jaw and brachial arch structures were visualized using Alcian Blue as
described (Schilling et al.,
1996
).
Immunofluorescence
Embryos for Zo1 and ATPase antibody staining were fixed in Dent's solution
[80% methanol, 20% DMSO (v/v)] overnight at 4°C, and then stored in
methanol at -20°C. Whole embryos were stained as described previously
(Westerfield, 1995
) and
embedded in JB-4 for sectioning. Slides were mounted with Gel-mount (Fisher)
and photographed using a Zeiss Axiophot. For Npo immunostaining of embryos,
paraffin sections were permeabilized by digesting with 10 mg/ml proteinase K
for 20 minutes, then post-fixed with 4% paraformaldehyde for 20 minutes at
room temperature. After washing several times with phosphate buffered saline
containing 0.1% Tween-20 (PBT), the tissue was blocked with PBT containing 1%
bovine serum albumin (BSA) and 10% sheep serum (Sigma). Blocking solution was
replaced with anti-Npo at a concentration of 1 µg/ml in blocking solution.
The sections were incubated for 2 hours at room temperature, then washed six
times in PBT-1% BSA before incubation with secondary antibody (Cy-3-conjugated
sheep anti-rabbit; Rockland). Controls containing no primary antibody were
included with all experiments. Antibodies were obtained as follows: mouse
monoclonal anti-zo1 (S. Tsukita); mouse monoclonal anti-ATPase-
5f
subunit (Developmental Studies Hybridoma Bank). Polyclonal antipeptide
antibodies to the Zebrafish Npo protein were generated by immunizing rabbits
with a peptide of amino acids 122-137 (CLNVLGDLEKDESFQEF) (antibody 4151),
followed by affinity purification (QCB/Biosource International). Conjugated
secondary antibodies were from Sigma or Rockland Immunochemicals.
Positional cloning
The npofW07-g (TL background) mutation was
mapped by out-crossing into the polymorphic wild-type strain WIK, followed by
inbreeding of heterozygous progeny. We scanned the genome for linkage by
bulked-segregant analysis (Shimoda et al.,
1999
), which placed the npo mutation on linkage group 6.
Fine mapping identified marker z8532 to be 0.03 cM (1/2971) from the
npo locus. A chromosome walk was performed from z8532, and the
genetic interval covered with 2 BACs, 37b12 and 90p3 from the BAC library
distributed by Incyte Genomics (Amemiya et
al., 1999
). These were subjected to shotgun sequencing, and the
assembled sequence encoded a single contig 129 kb in length, which contained
four open reading frames predicted by both homology to GenBank sequences
(blastx) and by the exon prediction program GENESCAN from the MIT website
(http://genes.mit.edu/GENSCAN.html).
Internal genetic markers were generated from simple-sequence repeats found
within the contig and used to narrow the genetic interval further. The two
remaining candidates were analyzed by complete sequencing of cDNAs isolated by
RT-PCR from mutant and wild-type embryos. The candidate epha2 cDNA
did not contain any detectable mutations, whereas the RRM-encoding cDNA was
found to have a nonsense mutation at codon 221 of the 926 codon reading frame.
This result was substantiated by sequencing PCR products from genomic DNA
derived from 12 mutants, 12 phenotypically wild-type siblings and 12 wild
types. The GenBank Accession Number for zebrafish npo is
AY299514.
In vitro transcription/translation
Total RNA was isolated from
50 npo-mutant and 50 wild-type
embryos at 4 dpf using Trizol reagent (Life Technologies) according to
manufacturer's instructions. We used a combination of dT and randomly primed
cDNA as a template for two rounds of nested PCR to amplify the full-length
cDNAs. The DNA polymerase used was Pfu-Turbo (Stratagene), and Taq polymerase
was used to add a 3' adenine for cloning into pCRII (Topo-TA kit,
Invitrogen). We isolated 12 independent clones and sequenced these completely.
The in vitro coupled transcription/translation was performed using the T7 TNT
system (Promega). [35S]-methionine-labeled protein was
electrophoresed on a 10% SDS-polyacrylamide gel, followed by
autoradiography.
RNA binding assays
Npo protein sythesized as above was assayed for RNA homopolymer binding
activity essentially as described previously
(Swanson and Dreyfuss, 1988
).
Briefly, homopolymeric RNA bound to solid agarose support was purchased from
commercial sources (poly C and poly U from Sigma; poly G and poly A from
Pharmacia). The beads were suspended and washed extensively in binding buffer
[10 mM Tris HCl (pH 7.3), 50 mM NaCl, 2.5 mM MgCl2, 0.1% Tween 20].
In vitro translation products of Npo wild-type, mutant and luciferase control
(20 µl, about 100,000 cpm of acid insoluble radioactivity) were added to
100 µg of beads in 1 ml of binding buffer, and incubated with rocking
at room temperature for 10 minutes. The beads were washed six times with
binding buffer, then boiled in 25 ml SDS-PAGE sample buffer
(Chantry and Glynn, 1986
) for 5
minutes and loaded onto a 10% SDS-polyacrylamide gel. After electrophoresis
and autoradiography the resulting bands were quantitated by using the program
NIH Image 1.62. Percent bound was calculated from the ratio of bound to input
radioactivity migrating at the expected molecular weights. Three separate
measurements were performed from which the average bound fraction was
calculated.
Embryo microinjections
We microinjected 1-cell-stage embryos essentially as described
(Westerfield, 1995
). The
embryos were first dechorionated in pronase and maintained in
0.3xDanieu's medium. The indicated BACs were prepared using Qiagen
columns, as instructed by the manufacturer followed by an additional
phenol/chloroform extraction and ethanol precipitation. BAC DNA was diluted
into Danieu's medium/0.1% Phenol Red (as a tracer) to a final concentration of
100 ng/µl. BAC linearized with NotI gave similar results to
circular DNA. We monitored cleavage of BAC 37b12 by SnaBI by
pulsed-field gel electrophoresis and by PCR across the restriction site.
Morpholino antisense oligonucleotides were designed corresponding to the start site and splice junctions of the zebrafish genomic npo sequence. The sequences were as follows:
-15/+9, CCTTGACATTTTTCTGAGCCAAGT;
+25/int1, ATGAATACTTACCCCATTCGGGAG;
int1/+37, TCCTTCATCTGGAGACACAACATG; and
+909/int, CATTTTATTACAGATTGAGCCAAC.
Concentrations ranged from 0.1 to 0.5 mM, with 0.5 mM giving the most profound effect. Control injections included the sense strand and an oligonucleotide of unrelated sequence, all of which led to no intestinal defects by criteria of histology and ifabp expression. Above 0.5 mM we noted a non-specific toxicity based on early abnormalities in control-injected embryos (i.e. sense morpholinos).
In situ hybridization
We carried out probe synthesis and whole-mount RNA in situ hybridization as
described (Jowett, 1999
). The
digoxigenin-labeled RNA probes were generated from the following templates:
ifabp was generated by RT-PCR from adult zebrafish intestinal mRNA,
using primers designed from the published sequence
(Andre et al., 2000
); the
insulin probe was generated by RT-PCR of 4 dpf embryonic RNA, using
primers designed from published sequence
(Milewski et al., 1998
); and
zebrafish npo probes, corresponding to the full-length coding
sequence, were generated by NotI digestion of pCRII (Invitrogen)
containing the npo cDNA, followed by in vitro transcription with SP6
RNA polymerase for the antisense probe, and SpeI and T7 polymerase
for the sense control. sonic hedgehog (shh), patched1 and
patched2 probes were generously provided by P. Ingham. foxa2
was described previously (Chen et al.,
2001
).
Embryos were genotyped subsequent to in situ hybridization for purposes of scoring rescue, or for determining genotype of embryos before 96 hours postfertilization (hpf), when the mutants and wild types can be clearly distinguished. This was done by sectioning a small portion of the tail, placing it into methanol, evaporating the methanol, then digesting the tail in 5 µl of lysis buffer at 50°C overnight to release the DNA. We performed genotyping using either z8532 or, in the case of the injection/rescue, sequence from the SP6 end of BAC 90p3.
Mosaic analysis
Embryos were dechorionated using pronase, and donors were injected with
rhodamine-dextran biotin (lysine fixable) from Molecular Probes. From
4-6
hpf (mid blastula to early epiboly), 5-10 cells were removed from the blastula
margin of donors and inserted into the blastula margin of recipients. The
embryos were then cultured in the presence of 1:100 penicillin-streptomycin
and allowed to develop to 4 dpf. Survival was about 50%. Live recipient
embryos were then screened for the presence of red fluorescence in the
vicinity of the intestine. Ultimately, less than 10% of the embryos contained
label associated with the intestine. In the mutant recipients (in which gut is
hard to discern), many of the initial positives were later found to have only
pronephric duct staining by histologic analysis. The embryos were then fixed
and processed for in situ hybridization to detect ifabp expression.
To enhance detection of the lineage tracer, the embryos were incubated with
Cy-3 streptavidin before embedding and sectioning.
| RESULTS |
|---|
|
|
|---|
|
|
After the gut tube forms, the endodermal cells re-organize into a simple
columnar epithelium and begin to express organ-specific genes. For the gut,
this is the key distinguishing step that marks the transition to mature organ,
and it has been previously termed the `endoderm-intestine transition'
(Traber and Wu, 1995
). In the
zebrafish, this transition occurs between 60 and 72 hpf, when the intestinal
epithelial cells begin to express alkaline phosphatase. Histochemical
localization to the apical aspect of the epithelial cell reflects
establishment of apical-basal polarity
(Pack et al., 1996
). Alkaline
phosphatase staining is absent from the apical aspect of the mutant gut
epithelium at 96 hpf, and appears to be basally localized
(Fig. 2G,H). Immunofluorescence
detection of the Na/K ATPase-
6f subunit, which is normally localized to
the basolateral surface of wild-type epithelial cells, reveals no clear
localization in the mutant. Expression of the enterocyte-specific gene
encoding intestinal fatty acid binding protein (ifabp) becomes
detectable in the foregut of the wild-type embryo between 72 and 84 hpf, and
expression expands caudally (Andre et al.,
2000
); however, no expression is detected in the mutant intestine
by 96 hpf (Fig. 2E,F). Taken
together, these data point to a step early in gut cytodifferentiation for
which npo is essential.
npo is required for liver and exocrine pancreas
development
In wild-type and mutant embryos, the pancreatic bud forms from the
primitive gut tube at the proper location, as shown in Figs
2,
3. But histological sectioning
of the mutant embryos at 96 hpf shows a pancreatic islet surrounded by only a
rim of flat cells, rather than distinct acinar cells of the exocrine pancreas
(Fig. 1G,H). trypsin
gene expression and immunoreactive carboxypeptidase are not detected in the
mutant, which is consistent with a failure to form the exocrine pancreas
(Fig. 3). By contrast, the
pancreatic islet does form in the mutant, as seen by histological examination
(Fig. 1G,H), and based on
presence of insulin expression (Fig.
3E-H).
|
In summary, the unifying feature of the organ-specific defects we observe in the npo mutant is the arrest of development just after the appearance of the endodermal organ primordia, the `anlage', but prior to growth and specific cellular distinction into mature epithelial cells of the gut, liver and exocrine pancreas. This suggests that npo is crucial in traversing a key epithelial maturation step in these endodermal derivatives.
Positional cloning of npo
We identified the npo gene by positional cloning
(Fig. 4). We mapped
npo to a 0.06 cM genetic interval, within which we identified two
genes. One of these encodes Epha2, in which we did not identify any coding
mutations, and the overexpression of which by cDNA and BAC injection does not
rescue the phenotype. The other gene, npo, encodes a hypothetical
RNA-recognition motif (RRM) protein. The mutant allele has a T to A mutation,
which results in a premature termination codon at position 221 of the
predicted 926 amino acid sequence. In vitro coupled transcription/translation
of npo cDNA obtained from wild-type and mutant embryonic RNA conforms
to this size prediction (104 kDa and 25 kDa, respectively), which is
consistent with truncation of the protein in the mutant.
|
|
In the course of the rescue experiments, we noted that the expression domain for ifabp and trypsin in many of the BAC 37b12-injected embryos seemed expanded relative to uninjected wild type and the other controls (Fig. 5). Indeed, in many cases the BAC 37b12-injected embryos contain an exuberant overproduction of differentiated intestinal or exocrine pancreatic epithelium. The individual epithelial cells do not appear abnormal, but the overall size of the gut tube, the number of epithelial infoldings and the size of the exocrine pancreas is dramatically increased. Thus it appears that the increased copy number resulting from BAC injection can overwhelm the normal control of npo gene expression, and this leads to increased amounts of mature organ tissue.
npo encodes a conserved RRM protein
Conceptual translation of the cDNA indicates that Npo is related to a
protein conserved through evolution (Fig.
6). In all metazoans, the gene for this protein encodes six
consensus RNA recognition motifs (RRMs). In yeast and plants, the orthologous
gene encodes five RRMs (without domain 2, which is the least conserved among
metazoans). As shown in Fig. 6,
domain order and spacing are generally conserved. The highest amino acid
homology between species occurs within the RRM domains, ranging from 30% to
75% identity. The biochemical function of the related yeast protein Mrd1p has
recently been reported to mediate processing of pre-ribosomal RNA
(Jin et al., 2002
).
|
npo is expressed transiently in the digestive tract
epithelium
npo is expressed ubiquitously in the early embryo. At about 24
hpf, expression becomes restricted to the brain and anterior digestive tract
(Fig. 7E). Expression then
increases in an anterior to posterior wave, first in the branchial arches and
liver, then spreading posteriorly, until by 72 hpf it is expressed in a
uniform manner throughout the digestive organs
(Fig. 7). Between 72 and 84
hpf, npo expression declines rapidly, from anterior to posterior,
leaving a residual stippled pattern of expression in the intestine. Expression
of npo in the pancreas is excluded from the islet
(Fig. 7C), consistent with a
lack of effect on this structure in the mutant.
|
|
npo functions cell autonomously during gastrointestinal
development
The data suggesting that npo is expressed in both the mesenchyme
and in the epithelium raises the question of what cell type requires
npo function for epithelial cytodifferentiation. To address this we
performed mosaic analysis, transplanting wild-type blastomere cells into an
npo-mutant host (Fig.
8D). Out of the 11 single wild-type cells incorporated into the
mutant gut epithelium, eight were found to express ifabp, indicating
that enterocyte-specific transcription had been activated in these cells.
Wild-type mesenchymal cells did not appear to rescue subjacent mutant
epithelium (0/28). The converse experiment, transplanting mutant cells into
wild-type host could not be scored because of a lack of mosaic generation,
suggesting a selection against mutant epithelial cells in the wild-type host.
These data, taken together with the expression pattern, are consistent with a
cell-autonomous requirement for npo during gut development.
| DISCUSSION |
|---|
|
|
|---|
The requirement for npo reveals a control point during
organogenesis
There are many component steps in the formation of the digestive organs,
including endoderm formation, primitive gut tube patterning, organ primordium
formation, organ cytodifferentiation and organotypic growth
(Grapin-Botton and Melton,
2000
; Montgomery et al.,
1999
). The formation of the endoderm depends on the Gata, forkhead
and Sox transcription factors (Kikuchi et
al., 2001
; Reiter et al.,
2001
), as well as mediators and targets of the TGFß and WNT
signaling pathways (Feldman et al.,
2000
). Germline mutation of these genes typically leads to early
embryonic lethality, precluding the assessment of their function at later
stages. As the npo mutation does not significantly perturb early
endoderm development, and endodermal markers are expressed normally in the
mutant, npo probably functions subsequent to activity of the
endodermal and early organ patterning genes.
After the specification and budding of the anlage, the intestine normally
grows and differentiates (Roberts,
1999
). This phase is marked by a concerted cell differentiation
and rearrangement of the epithelia. Organ-specific programs are then activated
to form basic functional units, such as villi or pancreatic acini. Very little
is known about the molecular control of the individual processes, or whether
their concerted activation reflects a unitary step. In fact, evidence suggests
that the patterns of growth unique to each region arise from previous
specification events and permissive external cues from the local surrounding
mesenchymal tissues (Roberts,
1999
). In the npo-mutant intestine, the histological
appearance of the epithelia remains that of the organ primordium, apical basal
cell polarity is not well established and villi do not form. To our knowledge,
there are no genetic mutations in vertebrates displaying this combined
phenotype, with both arrested growth and differentiation. For example, the
mutation in mice of TCF4 disrupts epithelial stem cell renewal, yet TCF4 is
not required for initial villus morphogenesis
(Korinek et al., 1998
).
Disruption of genes required for mesenchymal function, such as
forkhead6 (Kaestner et al.,
1997
) and Pdgfa
(Karlsson et al., 2000
), lead
to derangement of villus achitecture, but enterocyte differentiation still
occurs. The timing of the npo phenotype thus implicates the essential
role of npo in initiating organ-specific morphogenetic and
cytodifferentiation programs.
npo expression in the gastrointestinal tract is dynamic, foreshadowing the anterior to posterior wave of rapid organ growth and cytodifferentiation. Overexpression of npo causes formation of hyperplastic intestinal and pancreatic epithelium. This result complements the hypoplastic organs seen when npo activity is reduced, either by `knockdown' or germline mutation. Taken together, these data suggest that organ growth and maturation is controlled by npo expression in a dose-dependent manner. One possible mechanism by which this could occur is by controlling a specification step common to endoderm-derived epithelia. According to this model, npo would promote the adoption of a progenitor phenotype among a subset of organ anlage cells. These cells would then possess the capacity to respond to organ-specific signals that direct their morphogenetic movements and differentiation programs. Perhaps the cell-to-cell variability of npo expression in the developing gut (Fig. 8A) reflects the possibility that only a subset of cells are capacitated to form the mature organ. Npo overexpression could thus lead to organ hyperplasia by increasing the number of organ progenitors responding to local signals. In the absence of npo function, progenitor cell capacitation would be blocked, leaving the incipient organ arrested as a primordium. That npo is needed to specify a gut progenitor cell type is also suggested by its expression in the crpyts of Lieberkuhn of adult mouse intestine (A.N.M. and R. Palmer, unpublished).
Npo is an RRM protein
The npo gene encodes a conserved, 926-amino acid protein with six
RRM domains. The mutant allele encodes a truncated protein containing only the
N-terminal domain, indicating that the remainder of the molecule is necessary
for its function in organogenesis. Immunoreactive Npo is localized to the cell
cytoplasm. Although we do not yet know a specific RNA target, it binds RNA
with base sequence preference, as do other RRM proteins
(Varani and Nagai, 1998
).
The role of the Npo protein is not known in metazoans. In yeast, the
npo ortholog Mrd1p was recently shown to be involved in pre-ribosomal
RNA processing (Jin et al.,
2002
). Mrd1p is detected in complexes containing other proteins
known to participate in RNA processing
(Gavin et al., 2002
). RNA
binding proteins have been implicated in numerous developmental processes
governed at the RNA level (Curtis et al.,
1995
). For example, RNA binding may offer a means to rapidly
coordinate expression of a diverse subset of target genes that may be
functionally related (Keene,
2001
; Keene and Tenenbaum,
2002
). Accordingly, npo might regulate and coordinate the
activity of target RNAs important for digestive organ development and
homeostasis. For example, some gene products required for epithelial
morphogenesis or organ homeostasis are known to occur in multiple splice
isoforms. Examples include fibronectin
(Huerta et al., 2001
;
Inoue et al., 2001
),
epimorphin (Hirai, 2001
;
Lehnert et al., 2001
) and TCF4
(Cho and Dressler, 1998
;
Young et al., 2002
). Given
that the Npo-related protein in yeast functions in splicing, it is plausible
that, in metazoans, Npo could function by modulating isoform expression of
developmentally important targets.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Novartis Institutes for Biomedical Research, 400 Tech
Square, 7th floor, Cambridge, MA 02139, USA | REFERENCES |
|---|
|
|
|---|
Allende, M. L., Amsterdam, A., Becker, T., Kawakami, K., Gaiano,
N. and Hopkins, N. (1996). Insertional mutagenesis in
zebrafish identifies two novel genes, pescadillo and dead eye, essential for
embryonic development. Genes Dev.
10,3141
-3155.
Amemiya, C. T., Zhong, T. P., Silverman, G. A., Fishman, M. C. and Zon, L. I. (1999). Zebrafish YAC, BAC, and PAC genomic libraries. Methods Cell Biol. 60,235 -258.[Medline]
Andre, M., Ando, S., Ballagny, C., Durliat, M., Poupard, G., Briancon, C. and Babin, P. J. (2000). Intestinal fatty acid binding protein gene expression reveals the cephalocaudal patterning during zebrafish gut morphogenesis. Int. J. Dev. Biol. 44,249 -252.[Medline]
Chantry, A. and Glynn, P. (1986). Two-dimensional electrophoretic characterization of microheterogeneous myelin basic protein fragments. Anal. Biochem. 159, 29-34.[CrossRef][Medline]
Chen, J. N., van Eeden, F. J., Warren, K. S., Chin, A., Nusslein-Volhard, C., Haffter, P. and Fishman, M. C. (1997). Left-right pattern of cardiac BMP4 may drive asymmetry of the heart in zebrafish. Development 124,4373 -4382.[Abstract]
Chen, J.-N., van Bebber, F., Goldstein, A. M., Serluca, F. C., Jackson, D., Childs, S., Serbedzija, G., Warren, K. S., Mably, J. D., Lindahl, P. et al. (2001). Genetic steps to organ laterality in zebrafish. Comp. Funct. Genomics 2, 60-68.[CrossRef]
Cho, E. A. and Dressler, G. R. (1998). TCF-4 binds beta-catenin and is expressed in distinct regions of the embryonic brain and limbs. Mech. Dev. 77, 9-18.[CrossRef][Medline]
Curtis, D., Lehmann, R. and Zamore, P. D. (1995). Translational regulation in development. Cell 81,171 -178.[CrossRef][Medline]
Dorsky, R. I., Snyder, A., Cretekos, C. J., Grunwald, D. J., Geisler, R., Haffter, P., Moon, R. T. and Raible, D. W. (1999). Maternal and embryonic expression of zebrafish lef1. Mech. Dev. 86,147 -150.[CrossRef][Medline]
Edlund, H. (1999). Pancreas: how to get there from the gut? Curr. Opin. Cell Biol. 11,663 -668.[CrossRef][Medline]
Feldman, B., Dougan, S. T., Schier, A. F. and Talbot, W. S. (2000). Nodal-related signals establish mesendodermal fate and trunk neural identity in zebrafish. Curr. Biol. 10,531 -534.[CrossRef][Medline]
Gavin, A. C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J., Rick, J. M., Michon, A. M., Cruciat, C. M. et al. (2002). Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415,141 -147.[CrossRef][Medline]
Grapin-Botton, A. and Melton, D. A. (2000). Endoderm development: from patterning to organogenesis. Trends Genet. 16,124 -130.[CrossRef][Medline]
Haffter, P., Granato, M., Brand, M., Mullins, M. C., Hammerschmidt, M., Kane, D. A., Odenthal, J., van Eeden, F. J., Jiang, Y. J., Heisenberg, C. P. et al. (1996). The identification of genes with unique and essential functions in the development of the zebrafish, Danio rerio. Development 123,1 -36.[Abstract]
Hirai, Y. (2001). Epimorphin as a morphogen: does a protein for intracellular vesicular targeting act as an extracellular signaling molecule? Cell Biol. Int. 25,193 -195.[CrossRef][Medline]
Horne-Badovinac, S., Lin, D., Waldron, S., Schwarz, M., Mbamalu, G., Pawson, T., Jan, Y., Stainier, D. Y. and Abdelilah-Seyfried, S. (2001). Positional cloning of heart and soul reveals multiple roles for PKClambda in zebrafish organogenesis. Curr. Biol. 11,1492 -1502.[CrossRef][Medline]
Huerta, S., Srivatsan, E. S., Venkatesan, N., Peters, J., Moatamed, F., Renner, S. and Livingston, E. H. (2001). Alternative mRNA splicing in colon cancer causes loss of expression of neural cell adhesion molecule. Surgery 130,834 -843.[CrossRef][Medline]
Inoue, T., Nabeshima, K., Shimao, Y., Meng, J. Y. and Koono, M. (2001). Regulation of fibronectin expression and splicing in migrating epithelial cells: migrating MDCK cells produce a lesser amount of, but more active, fibronectin. Biochem. Biophys. Res. Commun. 280,1262 -1268.[CrossRef][Medline]
Jin, S. B., Zhao, J., Bjork, P., Schmekel, K., Ljungdahl, P. O.
and Wieslander, L. (2002). Mrd1p is required for processing
of pre-rRNA and for maintenance of steady-state levels of 40 S ribosomal
subunits in yeast. J. Biol. Chem.
277,18431
-18439.
Jowett, T. (1999). Analysis of protein and gene expression. Methods Cell Biol. 59, 63-84.[Medline]
Kaestner, K. H., Silberg, D. G., Traber, P. G. and Schutz,
G. (1997). The mesenchymal winged helix transcription factor
Fkh6 is required for the control of gastrointestinal proliferation and
differentiation. Genes Dev.
11,1583
-1595.
Karlsson, L., Lindahl, P., Heath, J. K. and Betsholtz, C. (2000). Abnormal gastrointestinal development in PDGF-A and PDGFR-(alpha) deficient mice implicates a novel mesenchymal structure with putative instructive properties in villus morphogenesis. Development 127,3457 -3466.[Abstract]
Katz, J. P., Perreault, N., Goldstein, B. G., Lee, C. S.,
Labosky, P. A., Yang, V. W. and Kaestner, K. H. (2002). The
zinc-finger transcription factor Klf4 is required for terminal differentiation
of goblet cells in the colon. Development
129,2619
-2628.
Keene, J. D. (2001). Ribonucleoprotein
infrastructure regulating the flow of genetic information between the genome
and the proteome. Proc. Natl. Acad. Sci. USA
98,7018
-7024.
Keene, J. D. and Tenenbaum, S. A. (2002). Eukaryotic mRNPs may represent posttranscriptional operons. Mol. Cell 9,1161 -1167.[CrossRef][Medline]
Kikuchi, Y., Agathon, A., Alexander, J., Thisse, C., Waldron,
S., Yelon, D., Thisse, B. and Stainier, D. Y. (2001).
casanova encodes a novel Sox-related protein necessary and sufficient for
early endoderm formation in zebrafish. Genes Dev.
15,1493
-1505.
Kim, S. K. and Hebrok, M. (2001). Intercellular
signals regulating pancreas development and function. Genes
Dev. 15,111
-127.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Korinek, V., Barker, N., Moerer, P., van Donselaar, E., Huls, G., Peters, P. J. and Clevers, H. (1998). Depletion of epithelial stem-cell compartments in the small intestine of mice lacking Tcf-4. Nat. Genet. 19,379 -383.[CrossRef][Medline]
Lehnert, L., Lerch, M. M., Hirai, Y., Kruse, M. L., Schmiegel,
W. and Kalthoff, H. (2001). Autocrine stimulation of human
pancreatic duct-like development by soluble isoforms of epimorphin in vitro.
J. Cell Biol. 152,911
-922.
Lewis, K. E., Concordet, J. P. and Ingham, P. W. (1999). Characterisation of a second patched gene in the zebrafish Danio rerio and the differential response of patched genes to Hedgehog signalling. Dev. Biol. 208, 14-29.[CrossRef][Medline]
Milewski, W. M., Duguay, S. J., Chan, S. J. and Steiner, D.
F. (1998). Conservation of PDX-1 structure, function, and
expression in zebrafish. Endocrinology
139,1440
-1449.
Montgomery, R. K., Mulberg, A. E. and Grand, R. J. (1999). Development of the human gastrointestinal tract: twenty years of progress. Gastroenterology 116,702 -731.[CrossRef][Medline]
Odenthal, J. and Nusslein-Volhard, C. (1998). fork head domain genes in zebrafish. Dev. Genes Evol. 208,245 -258.[CrossRef][Medline]
Pack, M., Solnica-Krezel, L., Malicki, J., Neuhauss, S. C. F., Schier, A. F., Stemple, D. L., Driever, W. and Fishman, M. C. (1996). Mutations affecting development of zebrafish digestive organs. Development 123,321 -328.[Abstract]
Reiter, J. F., Kikuchi, Y. and Stainier, D. Y. (2001). Multiple roles for Gata5 in zebrafish endoderm formation. Development 128,125 -135.[Abstract]
Roberts, D. (1999). Embryology of the Gastrointestinal Tract. In Development of the Gastrointestinal Tract (ed. I. A. Sanderson and W. A. Walker), pp.1 -12. Hamilton: B. C. Decker.
Schilling, T. F., Piotrowski, T., Grandel, H., Brand, M., Heisenberg, C. P., Jiang, Y. J., Beuchle, D., Hammerschmidt, M., Kane, D. A., Mullins, M. C. et al. (1996). Jaw and branchial arch mutants in zebrafish I: branchial arches. Development 123,329 -344.[Abstract]
Shimoda, N., Knapik, E. W., Ziniti, J., Sim, C., Yamada, E., Kaplan, S., Jackson, D., de Sauvage, F., Jacob, H. and Fishman, M. C. (1999). Zebrafish genetic map with 2000 microsatellite markers. Genomics 58,219 -232.[CrossRef][Medline]
Swanson, M. S. and Dreyfuss, G. (1988).
Classification and purification of proteins of heterogeneous nuclear
ribonucleoprotein particles by RNA-binding specificities. Mol.
Cell. Biol. 8,2237
-2241.
Traber, P. G. and Wu, G. D. (1995). Intestinal Development and Differentiation. In Gastrointestinal Cancers: Biology, Diagnosis and Therapy (ed. A. K. Rustgi), pp.21 -43. Philadelphia: Lippincott-Raven.
Varani, G. and Nagai, K. (1998). RNA recognition by RNP proteins during RNA processing. Annu. Rev. Biophys. Biomol. Struct. 27,407 -445.[CrossRef][Medline]
Wessells, N. K. and Cohen, J. H. (1967). Early pancreas organogenesis: morphogenesis, tissue interactions, and mass effects. Dev. Biol. 15,237 -270.[CrossRef]
Westerfield, M. (1995). The Zebrafish Book. Eugene: The University of Oregon Press.
Yang, Q., Bermingham, N. A., Finegold, M. J. and Zoghbi, H.
Y. (2001). Requirement of Math1 for secretory cell lineage
commitment in the mouse intestine. Science
294,2155
-2158.
Young, R. M., Reyes, A. E. and Allende, M. L. (2002). Expression and splice variant analysis of the zebrafish tcf4 transcription factor. Mech. Dev. 117,269 -273.[CrossRef][Medline]
Zaret, K. S. (2000). Liver specification and early morphogenesis. Mech. Dev. 92, 83-88.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. Makky, P. Duvnjak, K. Pramanik, R. Ramchandran, and A. N. Mayer A Whole-Animal Microplate Assay for Metabolic Rate Using Zebrafish J Biomol Screen, December 1, 2008; 13(10): 960 - 967. [Abstract] [PDF] |
||||
![]() |
H. Huang, H. Ruan, M. Y. Aw, A. Hussain, L. Guo, C. Gao, F. Qian, T. Leung, H. Song, D. Kimelman, et al. Mypt1-mediated spatial positioning of Bmp2-producing cells is essential for liver organogenesis Development, October 1, 2008; 135(19): 3209 - 3218. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pietsch, J.-M. Delalande, B. Jakaitis, J. D. Stensby, S. Dohle, W. S. Talbot, D. W. Raible, and I. T. Shepherd lessen encodes a zebrafish trap100 required for enteric nervous system development Development, February 1, 2006; 133(3): 395 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, H. Ruan, S. M. Ng, C. Gao, H. M. Soo, W. Wu, Z. Zhang, Z. Wen, D. P. Lane, and J. Peng Loss of function of def selectively up-regulates {Delta}113p53 expression to arrest expansion growth of digestive organs in zebrafish Genes & Dev., December 1, 2005; 19(23): 2900 - 2911. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Crosnier, N. Vargesson, S. Gschmeissner, L. Ariza-McNaughton, A. Morrison, and J. Lewis Delta-Notch signalling controls commitment to a secretory fate in the zebrafish intestine Development, March 1, 2005; 132(5): 1093 - 1104. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Rawls, B. S. Samuel, and J. I. Gordon From The Cover: Gnotobiotic zebrafish reveal evolutionarily conserved responses to the gut microbiota PNAS, March 30, 2004; 101(13): 4596 - 4601. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Saijou, T. Fujiwara, T. Suzaki, K. Inoue, and H. Sakamoto RBD-1, a nucleolar RNA-binding protein, is essential for Caenorhabditis elegans early development through 18S ribosomal RNA processing Nucleic Acids Res., February 10, 2004; 32(3): 1028 - 1036. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||