spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online July 21, 2003
doi: 10.1242/10.1242/dev.00620


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Byrne, M. E.
Right arrow Articles by Martienssen, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Byrne, M. E.
Right arrow Articles by Martienssen, R. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 130, 3941-3950 (2003)
Copyright © 2003 The Company of Biologists Limited

Phyllotactic pattern and stem cell fate are determined by the Arabidopsis homeobox gene BELLRINGER

Mary E. Byrne1,*, Andrew T. Groover2,*, Joseph R. Fontana2 and Robert A. Martienssen1,{dagger}

1 Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA
2 Institute of Forest Genetics, Davis, California 95616, USA

{dagger} Author for correspondence (e-mail: martiens{at}cshl.org)

Accepted 21 May 2003


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Lateral organs in plants arise from the meristem in a stereotypical pattern known as phyllotaxy. Spiral patterns result from initiation of successive organs at a fixed angle of divergence but variable patterns of physical contact. Such patterns ultimately give rise to individual leaves and flowers at positions related to each other by consecutive terms in the mathematical series first described by Leonardo Fibonacci. We demonstrate that a BELL1 related homeodomain protein in Arabidopsis, BELLRINGER, maintains the spiral phyllotactic pattern. In the absence of BELLRINGER, the regular pattern of organ initiation is disturbed and lateral organs are initiated more frequently. BELLRINGER is also required for maintenance of stem cell fate in the absence of the regulatory genes SHOOT MERISTEMLESS and ASYMMETRIC LEAVES1. We propose a model whereby BELLRINGER coordinates the maintenance of stem cells with differentiation of daughter cells in stem cell lineages.

Key words: Phyllotaxy, Homeobox, Shoot apical meristem, KNOX, BELLRINGER, BREVIPEDICELLUS, SHOOT MERISTEMLESS, ASYMMETRIC LEAVES1


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The plant shoot is derived from a group of undifferentiated stem cells within the shoot apical meristem (SAM). Lateral organs such as leaves arise on the flanks of the SAM by the coordinated repression of stem cell fate, determination of founder cells, and elaboration of the incipient primordium. Early events specify the spatial and temporal positioning of leaf and flower primordia and ultimately establish shoot phyllotaxy (Greek, `leaf order'). Later events define organ patterning along proximodistal, dorsoventral and mediolateral axes (reviewed by Kidner et al., 2002Go).

Initiation of successive lateral organs on the flanks of the SAM proceeds in predictable patterns generating a phyllotaxy. Spiral phyllotaxy observed in the vast majority of plants derives from the regular initiation of successive lateral organ primordia at a constant divergence angle approximating 137.5°. This pattern can be described in terms of two sets of opposing intersecting spirals or `contact parastichies' that connect adjacent primordia (Richards, 1951Go; Steeves and Sussex, 1989Go). The number of clockwise and counterclockwise spirals in each set is characteristic of a species, and corresponds to successive numbers in the Fibonacci series (3+5, 5+8, 8+13 etc.) (reviewed by Richards, 1951Go). Inter-specific and developmental variation in the number of contact parastichies is thought to reflect relative rates of primordia initiation and growth (Richards, 1951Go).

Genetic pathways that establish and maintain phyllotaxy are yet to be identified. Potentially the site of primordium initiation is established by molecular inhibitory signals from preexisting primordia or from biophysical stresses within the shoot apex (reviewed in Green, 1999Go). Consistent with both of these models alterations in phyllotaxy are often associated with changes in the dimensions and organization of the SAM. For example, in the Arabidopsis mutants fasciata1 (fas1) and fasciata2 (fas2) meristem shape and patterning is irregular and phyllotaxy is disrupted (Kaya et al., 2001Go; Leyser and Furner, 1992Go). The pattern of organ initiation is also irregular in the serrate (se) mutant where the meristem is enlarged compared with wild type (Clarke et al., 1999Go; Ori et al., 2000Go; Prigge and Wagner, 2001Go). Reduced meristem size is associated with phyllotaxy defects in the DNA topoisomerase mutant top1{alpha} (Takahashi et al., 2002Go). Alternatively, the abphyl1 mutant in maize has a phyllotaxy defect associated with an enlarged meristem. Additional leaves are formed in a decussate pattern rather than the normal alternate, distichous arrangement (Jackson and Hake, 1999Go). In contrast to these examples, terminal ear (te1) mutations in maize alter the rate of leaf initiation and phyllotaxy, but have relatively minor effects on the geometry of the shoot apex (Veit et al., 1998Go). te1 encodes a protein related to the RNA binding protein Mei2 from Schizosaccharomyces pombe. te1 is expressed in the presumptive internode in a region around the meristem excluding the site of organ initiation. This expression pattern suggests te1 may inhibit lateral organ differentiation.

One genetic pathway required for SAM function involves class 1 KNOX homeobox transcription factors. Recessive mutations in the Arabidopsis KNOX gene SHOOT MERISTEMLESS (STM) and in the closely related maize gene knotted1 have defects in meristem function indicating a requirement for SAM initiation and/or maintenance (Barton and Poethig, 1993Go; Long et al., 1996Go; Vollbrecht et al., 2000Go; Vollbrecht et al., 1991Go). Consistent with a role in SAM function both STM and kn1 are expressed in vegetative and reproductive SAMs but are down-regulated in founder cells and lateral organ primordia (Jackson et al., 1994Go; Long et al., 1996Go). STM maintains stem cell fate by negative regulation of the myb domain transcription factor ASYMMETRIC LEAVES1 (AS1) and a member of the LOB-like transcription factor family ASYMMETRIC LEAVES2 (AS2) (Byrne et al., 2000Go; Byrne et al., 2002Go; Iwakawa et al., 2002Go; Shuai et al., 2002Go). AS1 is related to rough sheath2 in maize and PHANTASTICA in Antirrhinum. All three genes are expressed in lateral organ primordia where they function as negative regulators of KNOX genes (Byrne et al., 2000Go; Ori et al., 2000Go; Semiarti et al., 2001Go; Timmermans et al., 1999Go; Tsiantis et al., 1999Go).

Arabidopsis has three additional class I KNOX genes, BREVIPEDICELLUS (BP, formerly KNAT1), KNAT2 and KNAT6. Like STM, these genes are expressed in SAMs and downregulated in lateral organs, although the pattern and timing of expression differs from that of STM (Byrne et al., 2002Go; Dockx et al., 1995Go; Lincoln et al., 1994Go; Pautot et al., 2001Go; Semiarti et al., 2001Go). Mutations in BP alone do not cause meristem defects (Byrne et al., 2002Go; Douglas et al., 2002Go; Venglat et al., 2002Go). BP is, however, redundant with STM and has a role in SAM function in as1 stm and as2 stm mutant backgrounds (Byrne et al., 2002Go). Disruption of KNAT2 gene expression has no phenotypic effect, probably because of redundancy with the duplicate gene KNAT6 (Byrne et al., 2002Go).

We have isolated several insertion alleles of BELLRINGER (BLR), a BELL1-like homeobox gene. Prominent defects in blr mutants include an increase in the number of leaves and disruption to the normal spiral pattern of primordia initiation. Genetic interactions also demonstrate that BLR is required for stem cell maintenance. Previously we reported that BP plays a role in meristem function in the absence of AS1 and STM (Byrne et al., 2002Go). BLR is also necessary for meristem function in the absence of AS1 and STM. BLR probably interacts directly with STM and BP in meristem function.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plant material and growth conditions
Mutant alleles, blr-1 (GT7797) and blr-2 (ET6411), were obtained from gene trap and enhancer trap lines generated as previously described (Springer et al., 1995Go; Sundaresan et al., 1995Go). The blr-3 allele was obtained from the The Salk Institute Genomic Analysis Laboratory (SIGnAL) collection. bel1-1, wus-1, clv1-1 and clv3-2 were obtained from the Arabidopsis Biological Resource Center (ABRC). Other mutants (as1-1, stm-1, stm-11, stm-2, and bp-2) were obtained as described previously (Byrne et al., 2002Go). All mutants other than blr-3 were in a Landsberg erecta background. Plants were grown either on soil or on MS medium supplemented with sucrose, with a minimum day length of 16 hours.

Plant genetics
Tests for allelism were carried out by crossing plants homozygous for blr-2 and blr-3 to plants homozygous for blr-1. F1 plants from both crosses displayed the blr mutant phenotype. All other genetic interactions and phenotypic studies were carried out with the blr-1 allele in a Landsberg erecta background. To generate double mutants, plants homozygous for bp, as1, bel1, clv1 or clv3 were crossed to plants homozygous for blr. All double mutants segregated in the F2 progeny in a 1:15 ratio. Double blr wus, blr stm-11 and blr stm-2 mutants were generated by crossing plants homozygous for blr to plants heterozygous for wus, stm-11 or stm-2. Double blr wus mutants segregated 1:3 in F3 seed from blr mutant plants. In lines carrying either stm-11 or stm-2 F3 seed from homozygous blr plants segregated 1:3 stm mutants.

Triple blr as1 stm-11 mutants were generated by crossing double homozygous blr as1 plants to as1/as1 stm-11/+ plants. F2 seed from blr/blr as1/as1 stm11/+ plants segregated a meristemless phenotype in a 1:3 ratio. Triple bel1 as1 stm-11 mutants were generated by crossing as1/as1 stm-11/+ plants with bel1/bel1. F3 seed from plants homozygous for as1 and heterozygous for stm11 and bel1 segregated only wild type, as1 stm11 and as1 bel1 phenotypes in a 9:4:3 ratio.

Molecular biology
DNA extraction and manipulation were carried out using standard protocols (Sambrook et al., 1989Go). The Ds element copy number in lines carrying blr-1 and blr-2 was determined using Southern gel blot analysis as described previously (Vongs et al., 1993Go). The Ds-specific hybridization probe was obtained by PCR amplification of the Ds element using the primers agcccatgtaagaaatacctagcg and tgctgtactgctaagtgctgtgag. Identification of the tagged gene in blr-1 and blr-2 was carried out by thermal asymmetric interlaced-PCR (Liu et al., 1995Go). To confirm the Ds element insertion sites in blr-1 and blr-2, PCR products were generated using Ds and gene-specific primers. Ds primers were acccgaccggatcgtatcggt and acggtcgggaaactagctctac. blr-1 primers were ctgctggtcaaagacatggat and tgcatgcttaattagcaagaaat. blr-2 primers were atcgtgcttcaaaaagacacc and gcagagaagaatcatcgtcgt. PCR products were sequenced using dye terminator cycle sequencing (Applied Biosystems).

Total RNA for northern and RT-PCR analysis was purified using Trizol reagent (Life Technologies). For northern hybridization, 20 µg of RNA was separated on a 1.4% gyloxal/DMSO denaturing gel. RNA was transferred to a membrane and hybridized using Ultrahyb buffer (Ambion). The BLR probe for northern analysis was a PCR product synthesized with the primers taatgtgggtcgtgggattta and aggagcatgatgatcaggaaa. RT-PCR was carried out as previously described (Byrne et al., 2002Go). Following DNase treatment and synthesis of complementary DNA with M-MuLV reverse transcriptase (New England Biolab) PCR reactions were performed with genespecific primers. BLR primers were as above. RBC primers were gaacaatggcttcctctatgc and cacaaggaatccacttgttgc. PCR products were subject to Southern hybridization using gene-specific probes.

The BLR::GUS construct was derived as follows. A 3.9 kb genomic fragment containing the BLR promoter was amplified from Landsberg erecta using the primers ttggcacgattctgaaacacg and ctcgccggctttgttgaaga. The product was cloned into pRITA, which contains the GUS reporter gene and NOS terminator sequences (a gift from John Bowman). The resulting plasmid, pRIP3, contains an in frame fusion of the start codon of BLR with GUS. This gene fusion fragment was cloned into a binary vector and introduced into plants using Agrobacterium transformation.

Histology and microscopy
Inflorescences were prepared for sectioning by fixation in glutaraldehyde (2.5% in 0.1 M sodium phosphate buffer pH 7.0), dehydration through an ethanol series and infiltration with Histoclear prior to embedding in paraffin wax. All sections were 8 µm thick. Sections were cleared of paraffin wax using Histoclear, rehydrated to 50% ethanol, stained for 20 minutes in 0.1% safranin in 50% ethanol, rinsed in 70% ethanol, then stained for 3 minutes in 0.1% Fast Green in 95% ethanol. The sections were then dehydrated in 100% ethanol, and moved to Histoclear. For meristem size comparisons measurement were taken from longitudinal sections of 8 wild-type and 9 blr plants that were 23 days old.

GUS staining was carried out as previously described (Gu et al., 1998Go) using a substrate solution containing 100 mM sodium phosphate pH 7, 10 mM EDTA, 0.1% Triton X-100, 0.5 mg/ml 5-bromo-4-chloro-3-indolyl ß-D glucuronic acid (X-Gluc), 100 µg/ml chloramphenicol, and either 2 mM or 5 mM each of potassium ferricyanide and potassium ferrocyanide. After 24-48 hours at 37°C samples were cleared in 70% ethanol at room temperature. Samples were viewed with a Leica MZ8 microscope and images captured with a Spot RT digital camera (Diagnostic instruments).

For scanning electron microscopy (SEM) inflorescences from wild-type and blr plants were first fixed overnight in 2.5% glutaraldehyde, then rinsed in 0.1 M sodium phosphate buffer and dehydrated through an ethanol series (30%, 50%, 70%, 80%, 95%, 100%) prior to critical point drying using a Tousimis Auotsamdri-815. Samples were subsequently mounted on silver tape and sputter coated with gold (Emitech K550) before viewing with an Hitachi S-3500N SEM under high vacuum and with a beam accelerating voltage of 3-5 kV. Measurements of meristem radius and organ divergence angle were derived from SEM images of 16 wild-type and 16 blr mutant that were 18 days old. Plastochron ratios were measured from 7 wild-type and 7 blr plants.

In situ hybridization
In situ hybridizations were performed using digoxigenin-labeled probes (Long and Barton, 1998Go; Long et al., 1996Go). Antisense and control sense BLR transcripts were synthesized from the plasmid pBlue028, which carries a 531 bp fragment, encompassing the 3' end of BLR, in pBluescript. Antisense STM transcripts were synthesized from the plasmid Meri HB1 (a gift from Kathy Barton). All sections were 8 µm thick.

Yeast 2-hybrid assay
Full-length BLR cDNA was amplified with the primers ggtcgacgggctgatgcatacgagcct and agcggccgcatttcaattcccccatatc. The PCR product was digested with SalI and NotI cloned into the GAL4 transcriptional activation domain (TA) vector pBI-771 (Kohalmi et al., 1997Go) forming the plasmid TA-BLR. STM cDNA was amplified with the primers acgcgtcgacgtatggagagtggttccaac and ataagaatgcggccgcccaagtataccgagaacc. The PCR product was digested with SalI and NotI and cloned into the GAL4 DNA-binding domain (DB) vector pBI-770. Other constructs, DB-BP, DB-KNAT4 and TABEL 1 were kindly provided by George Haughn and are as previously described (Bellaoui et al., 2001Go). All plasmids were transformed into the yeast strain pJ69A using a lithium acetate/polyethylene glycol protocol (Schiestl et al., 1993Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Average number of leaves and flowers in wild type and blr mutants

 

    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
bellringer affects shoot architecture
In a screen for mutants affecting shoot architecture, we recovered gene and enhancer trap insertions in a gene we named BELLRINGER. A third allele carrying a T-DNA insertion was also identified. All three alleles produced comparable phenotypes. Compared to wild type, blr mutants are reduced in stature and have a bushy appearance due to precocious growth of axillary branch meristems (Fig. 1A,B). There is an increase in the number of leaves and flowers (Table 1) although time to flowering is not significantly delayed (average of 16 days in wild type compared with 18 days in blr-1). In addition phyllotaxy is disrupted in these mutants such that the regular spiral arrangement of flowers on the inflorescence shoot is not strictly maintained (Fig. 1C,D). This is reflected in the relative displacement of flowers along both the radial and longitudinal axis of the stem. In the radial dimension, flowers can occur both closer together and further apart than in wild type. Inflorescence internodes are variable so that flowers occur at irregular intervals along the stem. blr mutants also have shorter siliques and ovary septum fusion defects (data not shown). The severity of these phenotypes is dependent on the genetic background and growth conditions. Principally the reduction in stature and loss of apical dominance are less severe under low light conditions and in a Columbia background.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 1. blr mutant phenotype. (A) Wild-type Landsberg erecta and (B) blr-1 mutant plants. blr has additional leaves and flowers, is reduced in stature and has precocious outgrowth of axillary meristems. Phyllotaxy is also disturbed. (C) In the wild-type inflorescence siliques are arranged in a regular spiral phyllotactic pattern. (D) In blr mutant inflorescences siliques occur in aberrant positions and internodes are irregular.

 
Since phyllotaxy is often associated with changes in meristem size or shape, we compared meristems in wild type and blr mutants. In longitudinal section the size and shape of blr inflorescence meristems is comparable to that of wild type (Fig. 2A,B). Furthermore, the radius of blr mutant inflorescence meristems, estimated from SEM images of 18-day-old plants, was not significantly different from that of wild type. The average radius of wild-type meristems was 24.8 µm (range 22.6-28.1 µm) while that of blr mutants was 23.6 µm (range 20.5-27.0 µm).



View larger version (114K):
[in this window]
[in a new window]
 
Fig. 2. Phyllotaxy defect in blr mutants. (A,C,E,G) Wild-type inflorescence apex; (B,D,F,H) blr mutant inflorescence apex. (A,B) Longitudinal sections of 23-day-old plants showing comparable size and shape of wild-type (A) and blr (B) inflorescence meristems. The width of the stem is also similar in wild type and blr. (C-F) 18-day-old plants. In wild type (C,E) organs are initiated on average 137.5° apart forming a continuous spiral. In wild type (C) the divergence angle between primordia 2 and 3 is 130.6°. In blr mutants (D,F) flowers can initiate in aberrant positions as in primordia 3 in D and 5 in F. In D the divergence angle between primordia 2 and 3 is 79.3°. (G,H) Inflorescence apex from 23-day-old plants. Clockwise (red) and counterclockwise (yellow) contact parastichies connecting floral primordia in a 3+5 phyllotactic pattern. Additional organs in blr mutants result in contact parastichies forming a tighter curve than in wild type. Numbering of each inflorescence starts at the youngest visible primordium. Scale bars: 0.5 mm (A,B), 50 µm (C,D), 200 µm (E,F) and 500 µm (G,H).

 
Spiral phyllotaxy can be described by two parameters, the plastochron ratio and the divergence angle (Richards, 1951Go). The plastochron ratio can be used to predict the number of contact parastiches and reflects alterations in the packing of lateral organs. This parameter is derived by calculating the ratio of the distance of two successive primordia from the meristem, where distances are measured from the center of the meristem to the center of each primordium. To compare initiation patterns in wild type and mutant we measured the plastochron ratio for the youngest 4-6 primordia on inflorescence apices from 18-day-old plants. Average plastochron ratios between initiating floral primordia on blr mutant inflorescence apices were not significantly different from wild type (1.1481 versus 1.1465). In plants with spiral phyllotaxy the divergence angle between successive primordia, measured from the center of the meristem to the middle of two successive organs, is approximately 137.5°. The average divergence angle between successive primordia in wild-type inflorescence apices was 136.72° (range 121.49°-152.31°), which was comparable with most blr mutant inflorescence apices at 137.52° (range 127.54°-154.91°). However, 2 out of 16 blr mutants had significantly reduced divergence angles between successive primordia (range 79.35°-112.13°) indicating abnormal sites of floral meristem initiation (Fig. 2C,D). This was consistent with the irregular phyllotaxy observed in mature plants (Fig. 2E-H). In agreement with these quantitative parameters, the number of clockwise and counterclockwise contact parastichies was unchanged. However, the angle between spiral parastichies was increased, accommodating the extra organs in a tighter spiral than normal (Fig. 2G,H).

BELLRINGER is related to the homeodomain transcription factor BELL1
The recessive blr-1 mutation was found to cosegregate with a single Ds element inserted into a homeobox gene, At5g02030, located on chromosome 5 (http://cshl.genetrap.org) (The Arabidopsis Genome Initiative, 2000Go). This gene encodes a protein most closely related to members of the BELL1 (BEL1) subclass of homeodomain transcription factors, of which there are 12 members in Arabidopsis (Becker et al., 2002Go). BLR comprises 4 exons and 3 introns (Fig. 3A). The Ds insertion in blr-1 is located in the second intron whereas blr-2 has a Ds insertion 2 bp upstream of the BLR ATG initiation codon. In both alleles the insertion does not activate the GUS reporter on the Ds element. The third allele, blr-3, carries a T-DNA insertion in the first intron of the gene. For all three alleles full-length BLR transcripts were not detected in homozygous mutant plants (Fig. 3B).



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3. blr mutant alleles. (A) Diagram of the BLR gene is with locations of Ds insertions in blr-1 and blr-2, and the T-DNA insertion in blr-3 indicated. (B) RT-PCR amplification using gene-specific primers and hybridization of products with gene-specific probes. BLR transcripts are detected in wild type but not in the three mutants (top panel). RBC transcripts were amplified as a control (bottom panel). (C) Northern hybridization detects low levels of BLR transcript in wild-type seedling and leaf tissue and much higher levels in the inflorescence and flowers. No wild-type transcript is detected in the blr-1 mutant. Lower panel shows an ethidium bromide-stained gel reflecting relative amounts of RNA.

 
BELLRINGER expression pattern
The expression pattern of BLR in wild-type plants was examined by northern hybridization. Low levels of BLR transcript were detected in 8-day-old seedlings and in leaf tissue (Fig. 3C). Higher transcript levels were detected in inflorescence shoots, including the inflorescence meristem and flower buds.

BLR expression was further examined by driving GUS reporter gene expression from the BLR promoter. In the embryo, BLR expression was confined to the SAM (Fig. 4A) but weak expression could also be detected in the root tip (data not shown). In young seedlings, BLR was highly expressed in the SAM and could be detected in cotyledon and leaf vasculature (Fig. 4B). In the inflorescence, BLR was expressed in the inflorescence meristem, stem, flower pedicel and in developing flowers (data not shown).



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 4. BLR expression pattern. (A,B) Whole mounts showing GUS expression pattern from the BLR::GUS reporter gene. GUS activity is detected in the SAM of the embryo (A) and 8-day-old seedling (B). Weak expression is also in the vasculature of cotyledons and leaves. (C,D) In situ hybridization of wild-type embryos probed with BLR antisense (C), and STM antisense (D). BLR and STM transcripts are detected in the SAM (E,F) In situ hybridization of wild-type inflorescences probed with BLR antisense (E) and STM antisense (F). (G-I) Three consecutive serial sections of an inflorescence apex probed with BLR antisense. BLR is expressed in the SAM, in a pattern similar to that of STM. In initiating floral primordia BLR is first downregulated (arrowheads in G-I) but is subsequently detected in the central region of developing floral primordia and flowers (arrows in E). A low level of BLR expression is also detected at the base of developing flowers, in the pedicel and in the inflorescence stem. Scale bars: 50 µm (A,C-I).

 
In situ hybridization was carried out to confirm the authenticity of the BLR::GUS expression pattern. BLR expression in late heart stage embryos was confined to the SAM region between the two developing cotyledons (Fig. 4C). The expression pattern is similar to that of STM (Fig. 4D) (Long et al., 1996Go). In addition, BLR is expressed in the inflorescence SAM in a region similar to that of STM (Fig. 4E,F). BLR expression is initially downregulated in incipient floral primordia (Fig. 4G-I). Strong expression is subsequently detected in the central region of young floral primordia and the inner whorl of developing flowers (Fig. 4E,G-I). A low level of expression is also detected at the base of the developing flowers, in the pedicel and in subepidermal and core cells of the inflorescence stem. A BLR sense probe used as a negative control did not show a signal in embryo or inflorescence tissue (data not shown).

Genetic interactions between bellringer and KNOX genes
BELL-like proteins belong to a class of homeodomain transcription factors that can interact directly with KNOX class homeodomain transcription factors (Bellaoui et al., 2001Go; Müller et al., 2001Go; Smith et al., 2002Go). Since protein-protein interactions between heterologous homeodomain transcription factors are required in animals (Mann and Chan, 1996Go) it is likely that such interactions are functionally significant in plants. We therefore investigated genetic interactions between BLR and the class 1 KNOX genes STM, KNAT1 and KNAT2.

Embryos homozygous for strong stm alleles, including stm-1 and stm-11 (Fig. 5A), lack a SAM and develop cotyledons that are fused at their base (Barton and Poethig, 1993Go; Clark et al., 1996Go; Long et al., 1996Go). Double blr stm-11 mutants are similar to stm-11 mutants (Fig. 5B). However, blr enhances the phenotype of the weak allele stm-2. Single stm-2 mutants germinate with slight fusion at the base of the cotyledons (Clark et al., 1996Go; Endrizzi et al., 1996Go). After a brief delay, vegetative shoot development is initiated (Fig. 5C). In contrast, blr stm-2 double mutants do not form any vegetative shoot and resemble mutants of strong alleles of stm (Fig. 5D). This genetic interaction indicates BLR is required for SAM function when there is reduced STM activity.



View larger version (94K):
[in this window]
[in a new window]
 
Fig. 5. blr enhances a weak allele of stm. Twelve-day-old seedlings of stm-11 (A), blr stm-11 (B), stm-2 (C) and blr stm-2 (D). blr stm-11 double mutants are similar to stm-11 single mutants. No vegetative shoot is produced and the base of the cotyledons are fused. Plants homozygous for the weak stm-2 allele show limited fusion at the base of the cotyledons and initiate a vegetative shoot. The meristem defect is enhanced in blr stm-2 double mutants which do not develop vegetative shoot structures and there is significant fusion of the cotyledons.

 
The blr mutant phenotype shares some characteristics with bp mutants including reduced stature and precocious outgrowth of axillary meristems (Fig. 6A). In addition, in bp mutants differentiation of subepidermal chlorenchyma extending from the abaxial side of the pedicel into the adjacent stem is disrupted (Douglas et al., 2002Go; Venglat et al., 2002Go). We analyzed blr bp double mutants to determine if there is any interaction between these two genes. Plants homozygous for both blr and bp were much reduced in stature compared with either single mutant (Fig. 6B). In other respects the double mutant has features of both blr and bp single mutants. The number of rosette and cauline leaves in blr bp mutants is comparable to that of blr (data not shown) while flower pedicels and siliques are reduced in length and generally point downward as in bp (Fig. 6A,B), and subepidermal chlorenchyma below the flower is pale relative to surrounding tissue. The phenotype of the blr bp double mutant therefore appears additive. blr knat2 double mutants are indistinguishable from blr mutants indicating that the blr phenotype is not influenced by loss of KNAT2 expression (data not shown).



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 6. blr interacts with as stm1 but not with bel1. (A,B,F,G,H) Whole plants and (C-E) seedlings of bp (A), blr bp (B), blr as1 (C), blr as1 stm-11 (D-F), bel1 (G) blr bel1 (H). (A) The bp mutant is reduced in stature, pedicels are short and flowers hang down. (B) The blr bp double mutant is much reduced in stature compared with either single mutant. Double mutants also have additional leaves, pedicels are short and siliques tend to hang down (inset in B). (C) Twelve-day-old emerging shoot of blr as1 seedling compared with (D) blr as1 stm-11 sibling, with only a single vegetative leaf. (E,F) Occasionally vegetative shoot growth is resumed in blr as1 stm-11 triple mutants. Leaves in the double and triple mutant have an as1 phenotype. (G) The phenotype of the bel1 mutant is confined to the ovule. Siliques do not elongate as plants fail to set seed. (H) The double blr bel1 mutant fails to set seed as in bel1 single mutants. The phyllotaxy is disturbed and stature is reduced as in blr single mutants. Scale bars: 2.5 cm (A,B,F-H).

 
To further explore the possibility of genetic interactions between BLR and BP we took advantage of the conditional role of BP in SAM function. BP maintains the SAM in as1 stm double mutants (Byrne et al., 2002Go). Vegetative development in these double mutants resembles that of as1, whereas bp as1 stm mutants lack a SAM, fail to form a vegetative shoot, and are indistinguishable from stm single mutants (Byrne et al., 2000Go; Byrne et al., 2002Go). The phenotype of blr as1 double mutants is additive in all respects (Fig. 6C). However, blr as1 stm triple mutants have severely reduced SAM function. Following germination only one or two leaves are produced (Fig. 6D). Occasionally development is resumed to form a disorganized vegetative shoot (Fig. 6E,F). BLR is therefore required for SAM function in the absence of STM and AS1.

In contrast to blr mutants where phenotypic effects are evident in the shoot, mutations in the related gene bel1 only affect ovule development (Modrusan et al., 1994Go; Reiser et al., 1995Go; Robinson-Beers et al., 1992Go). blr bel1 double mutants display a blr shoot phenotype and are sterile as is bel1 (Fig. 6G,H). This demonstrates that BEL1 is not redundant with BLR in shoot development. Since BEL1 protein directly interacts with BP we also investigated whether BEL1 is required for SAM function in an as1 stm background. In contrast to blr as1 stm mutants, the triple bel1 as1 stm mutants form a vegetative shoot similar to as1 stm double mutants (data not shown). Furthermore no novel phenotype is detected in progeny of blr as1 plants also segregating bel1 and stm. Therefore BEL1 is not required for SAM function in these contexts.

SAM function is also regulated by WUSCHEL (WUS) and the CLAVATA (CLV) genes, acting independently of KNOX genes. WUS is a homeodomain protein expressed in inner central zone stem cells of the SAM. Mutations in WUS result in loss of meristem function. CLV1 and CLV2 are transmembrane receptors and CLV3 encodes a secreted peptide. Mutations in all three CLV genes result in a much enlarged meristem. CLV genes maintain meristem homeostasis by limiting WUS function (reviewed by Brand et al., 2001Go; Clark, 2001Go; Fletcher, 2002Go). We found blr wus, blr clv1 and blr clv3 double mutants are additive (not shown). Therefore, BLR appears to affect meristem function via a KNOX genespecific pathway.

BELLRINGER interacts directly with KNOX proteins
Genetic analysis demonstrated that blr enhances a weak allele of stm and is required for SAM function in the as1 stm background. Since BELL class proteins are known to interact directly with KNOX proteins (Bellaoui et al., 2001Go; Müller et al., 2001Go; Smith et al., 2002Go) one possibility is that BLR directly interacts with and affects the activity of STM and BP. To test this possibility a yeast two-hybrid assay was carried out (Fig. 7). Yeast strains carrying the plasmids TA-BLR and DBBP or DB-STM were viable in the absence of histidine. In contrast, yeast carrying TA-BRL and DB-KNAT4 failed to grow in the absence of histidine. Therefore in this system BLR interacts with the class1 KNOX proteins STM and BP but not with the class 2 KNOX protein KNAT4. The negative control yeast strain carrying the plasmid TA-BLR in the presence of the DB vector showed no growth in the absence of histidine.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 7. BLR interacts directly with class 1 KNOX proteins. Yeast two-hybrid assay demonstrating interaction between BLR and KNOX proteins inferred through selective growth on medium lacking leucine, tryptophan and histidine (-leu -;trp -;his) compared with medium lacking leucine and tryptophan (-;leu, -;trp). All yeast strains grow on -;leu -;trp medium. Growth on -;leu, -;trp, -;his medium is detected for strains carrying TA-BLR and DB-BP or DB-STM but not for strains carrying TABLR and DB-KNAT4 or the DB vector. Growth of a strain carrying TA-BEL1 and DB-BP is shown as a positive control.

 

    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
BLR is a BELL class gene which, like KNOX genes, are members of the TALE homeobox transcription factor family. TALE homeodomain proteins have an atypical homeodomain, characterized by three additional amino acids between the first and second helix. Several features distinguish BELL and KNOX proteins (Becker et al., 2002Go; Bharathan et al., 1999Go; Bürglin, 1997Go; Reiser et al., 2000Go). The 12 members of the BELL class share 54% amino acid identity in the homeodomain. Likewise, the 8 KNOX proteins share 54% amino acid identity in the homeodomain. However, between these two classes amino acid conservation in the homeodomain is 32%. In addition, BELL proteins have conserved SKY and BELL domains upstream of the homeodomain, whereas KNOX proteins are defined by conserved MEINOX, ELK and GSE domains upstream of the homeodomain (Bellaoui et al., 2001Go; Bürglin, 1997Go; Kerstetter et al., 1994Go).

BLR is strongly expressed in the embryonic SAM, and has a conditional role in SAM function as revealed by genetic interactions. Whereas as1 stm mutants form a vegetative shoot indistinguishable from that of as1 single mutants, shoot development is greatly reduced in the triple blr as1 stm mutant. This triple mutant strongly resembles pinhead/zwille mutants where a solitary vegetative organ appears to consume the meristem (Lynn et al., 1999Go; Moussian et al., 1998Go). BLR is therefore required to maintain the SAM in the as1 stm background. Meristem function in as1 stm mutants is dependent on BP (Byrne et al., 2002Go), so that it is probable that BP activity is compromised in blr. We tested this possibility by making bp blr double mutants, which were additive in all respects. Thus BP is still functional in a blr mutant, meaning that loss of bp function cannot completely explain the blr phenotype.

Strong alleles of stm are formally epistatic to blr, although the blr phenotype is difficult to observe in strong stm. However, a weak allele of stm is greatly enhanced by blr. This effect is far stronger than that of bp, which also enhances weak stm-2 (Byrne et al., 2002Go). Thus it is possible that BLR is required for STM function, consistent with its expression pattern in the embryo. However, BLR must also have an STM-independent role, revealed by the strong phenotype of blr as1 stm triple mutants. A likely explanation is that BLR is required for both BP and STM function. Consistent with this possibility, yeast two-hybrid assay demonstrates the BLR protein interacts directly with both STM and BP. The requirement for BLR must be only partial, as blr has a much milder phenotype than either bp or stm, and, as noted above, BP is still functional in a blr mutant. One explanation is that BLR is itself partially redundant. A strong candidate would be the BELL class gene (At2g27990) most closely related to BLR. Conservation between these two genes is 90% within the homeodomain and 48% overall.

BLR is more distantly related to the BELL class gene BEL1. The blr bel1 double mutant phenotype indicates a lack of functional overlap between these two genes. The phenotype of bel1 mutants is restricted to the ovule where the morphology of the outer integument is abnormal while the inner integument is completely absent (Modrusan et al., 1994Go; Robinson-Beers et al., 1992Go). Consistent with this phenotype BEL1 expression in the ovule is restricted to the region where integuments initiate (Reiser et al., 1995Go). However, BEL1 is also expressed in vegetative tissues and roots. The lack of other plant phenotypes suggests BEL1 shares genetic redundancy. Similarly, BEL1 interacts physically with BP, yet the bel1 phenotype indicates that it is not required for BP function in the inflorescence. We have demonstrated that BEL1 is not required for SAM function in as1 stm, indicating it has no effect on BP activity in the embryonic or vegetative SAM. Again the apparent lack of BEL1 genetic interactions with BP is possibly the result of redundancy. Candidates for such redundancy are two genes, BLH2 and BLH4, most closely related to BEL1 (Becker et al., 2002Go).

Mutations in BLR result in phyllotaxy defects including both an increase in the number of lateral organs and displacement of organs along the stem. Although mechanisms governing phyllotactic patterning are still to be elucidated, early surgical experiments have shown that leaf primordia are positioned in response to preexisting primordia (Snow and Snow, 1931Go). This influence may be mediated by production of a diffusible inhibitor or may be biophysical in nature. A model where biophysical forces regulate phyllotaxy is supported by studies demonstrating induction of leaf formation by local concentration of the cell wall protein expansin (Fleming et al., 1997Go; Pien et al., 2001Go; Reinhardt et al., 1998Go). However, organ positioning can also be influenced by auxin. Chemical inhibition of polar auxin transport and mutations affecting auxin transport, including pinformed and pinoid in Arabidopsis, result in failure to initiate lateral organ outgrowth (Benjamins et al., 2001Go; Christensen et al., 2000Go; Vernoux et al., 2000Go). Primordial outgrowth in such cases can be induced at sites of localized auxin concentration increase (Reinhardt et al., 2000Go; Vernoux et al., 2000Go). Organs can be induced at any position around the circumference of the meristem, and also within a restricted region along the apical-basal axis of the SAM.

The phenotypic defects in blr, including aberrant organ initiation patterns may in part due to disruption in auxin signalling. Consistent with this proposal, blr mutants display reduced stature and loss of apical dominance typical of reduced auxin signalling (Lincoln et al., 1990Go). Interestingly, phyllotaxy defects are also observed in plants expressing a constitutively active form of a RHO GTPase that may be involved in mediating plant responses to hormones such as auxin (Li et al., 2001Go). The inflorescence phenotype in this case resembles that of bp mutants.

The increase in organ number and organ displacement indicates blr mutants are no longer fully responsive to inhibitory signals from preexisting organs such that distances between organs are not maintained. Aberrant initiation along the apical-basal axis of the SAM potentially contributes to variable internode lengths. Alternatively, regular partitioning of cells between organs and internodes is affected. In this respect blr resembles te1 in maize, which has also been interpreted as a phyllotaxy mutant (Veit et al., 1998Go).

Despite the phyllotactic defects in blr there is no appreciable difference in the size of the SAM compared with wild type. This may be coincident with more peripheral zone cells being specified as organ founder cells. Alternatively, in blr mutants an increase in recruitment of cells into lateral organs is offset by an increase in the number of stem cells, together maintaining SAM size. In this case BLR normally delays differentiation of stem cells in the SAM and slows their propagation. In each case, the function of BLR in delaying specification of lateral organs is consistent with BLR expression in peripheral cells of the inflorescence meristem, but not in initiating primordia.

Stem cell lineages expand according to the Fibonacci series when daughter cells are delayed from acquiring stem cell fate, raising the possibility that stem cells are responsible for phyllotactic patterns (Klar, 2002Go). In this respect, BLR fulfills a postulated stem cell function required for Fibonacci progression (Klar, 2002Go), in that BLR dictates how long daughter cells require to differentiate in the stem cell lineage. However, this model remains controversial and is yet to be substantiated (Fleming, 2002Go). For example, stem cell lineages are multicellular in higher plants, such that extensive coordination in the meristem would be required for stem cell lineages to regulate organ initiation in this way. The effects of the blr mutation on phyllotactic pattern are intriguing in this context and will be examined further.


    ACKNOWLEDGMENTS
 
We thank George Haughn for providing yeast two-hybrid constructs, John Bowman for the GUS expression vector, Julie Thomas for advice on yeast transformation, Marja Timmermans and members of Rob Martienssen's lab for helpful discussion. We also thank Tim Mulligan for plant care, and Rulan Shen, Uma Umamaheswari, Amy Tang-Qui and the CSHL gene trap team for helping with plants and generating the blr line. This work was supported by USDA-NRI grant 2003-00967 to M.E.B. and R.A.M., and by NIH Postdoctoral Fellowship GM19974 and USDA-NRI 35301-10878 to A.T.G.


    Footnotes
 
* These authors contributed equally to this work Back


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Barton, M. K. and Poethig, R. S. (1993). Formation of the shoot apical meristem in Arabidopsis thaliana — an analysis of development in the wild type and in the shoot meristemless mutant. Development 119,823 -831.[Abstract]

Becker, A., Bey, M., Bürglin, T. R., Saedler, H. and Theissen, G. (2002). Ancestry and diversity of BEL1-like homeobox genes revealed by gymnosperm (Gnetum gnemon) homologs. Dev. Genet. Evol. 212,452 -457.

Bellaoui, M., Pidkowich, M. S., Samach, A., Kushalappa, K., Kohalmi, S. E., Modrusan, Z., Crosby, W. L. and Haughn, G. W. (2001). The Arabidopsis BELL1 and KNOX TALE homeodomain proteins interact through a domain conserved between plants and animals. Plant Cell 13,2455 -2470.[Abstract/Free Full Text]

Benjamins, R., Quint, A., Weijers, D., Hooykaas, P. and Offringa, R. (2001). The PINOID protein kinase regulates organ development in Arabidopsis by enhancing polar auxin transport. Development 128,4057 -4067.

Bharathan, G., Janssen, B. J., Kellogg, E. A. and Sinha, N. (1999). Phylogenetic relationships and evolution of the KNOTTED class of plant homeodomain proteins. Mol. Biol. Evol. 16,553 -563.[Abstract]

Brand, U., Hobe, M. and Simon, R. (2001). Functional domains in plant shoot mersitems. BioEssays 23,134 -141.[CrossRef][Medline]

Bürglin, T. R. (1997). Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals. Nucleic Acids Res. 25,4173 -4180.[Abstract/Free Full Text]

Byrne, M. E., Barley, R., Curtis, M., Arroyo, J. M., Dunham, M., Hudson, A. and Martienssen, R. A. (2000). Asymmetric leaves1 mediates leaf patterning and stem cell function in Arabidopsis. Nature 408,967 -971.[CrossRef][Medline]

Byrne, M. E., Simorowski, J. and Martienssen, R. A. (2002). ASYMMETRIC LEAVES1 reveals knox gene redundancy. Development 129,1957 -1965.

Christensen, S. K., Dagenais, N., Chory, J. and Weigel, D. (2000). Regulation of auxin response by the protein kinase PINOID. Cell 100,469 -478.[CrossRef][Medline]

Clark, S. E. (2001). Meristems: start your signaling. Curr. Opin. Plant Biol. 4, 28-32.[CrossRef][Medline]

Clark, S. E., Jacobsen, S. E., Levin, J. Z. and Meyerowitz, E. M. (1996). The CLAVATA and SHOOT MERISTEMLESS loci competitively regulate meristem activity in Arabidopsis. Development 122,1567 -1575.[Abstract]

Clarke, J. H., Tack, D., Findlay, K., van Montagu, M. and van Lijsebettens, M. (1999). The SERRATE locus controls the formation of the early juvenile leaves and phase length in Arabidopsis. Plant J. 20,493 -501.[CrossRef][Medline]

Dockx, J., Quaedvlieg, N., Keultjes, G., Kock, P., Weisbeek, P. and Smeekens, S. (1995). The homeobox gene ATK1 of Arabidopsis thaliana is expressed in the shoot apex of the seedling and in flowers and inflorescence stems of mature plants. Plant Mol. Biol. 28,723 -737.[CrossRef][Medline]

Douglas, S. J., Chuck, G., Dengler, R. E., Pelecanda, L. and Riggs, C. D. (2002). KNAT1 and ERECTA regulate inflorescence architecture in Arabidopsis. Plant Cell 14,547 -558.[Abstract/Free Full Text]

Endrizzi, K., Moussian, B., Haecker, A., Levin, J. Z. and Laux, T. (1996). The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE. Plant J. 10,101 -113.

Fleming, A. J. (2002). Plant mathematics and Fibonacci's flowers. Nature 418, 7 23.[CrossRef][Medline]

Fleming, A. J., McQueen-Mason, S., Mandel, T. and Kuhlemeier, C. (1997). Induction of leaf primordia by the cell wall protein expansin. Science 276,1415 -1418.[Abstract/Free Full Text]

Fletcher, J. C. (2002). Shoot and floral meristem maintenance in Arabidopsis. Ann. Rev. Plant Physiol. Plant Mol. Biol. 53,45 -66.[CrossRef][Medline]

Green, P. B. (1999). Expression of pattern in plants: combining molecular and calculus-based biophysical paradigms. Am. J. Bot. 86,1059 -1076.[Abstract/Free Full Text]

Gu, Q., Ferrándiz, C., Yanofsky, M. F. and Martienssen, R. (1998). The FRUITFULL MADS-box gene mediates cell differentiation during Arabidopsis fruit development. Development 125,1509 -1517.[Abstract]

Iwakawa, H., Ueno, Y., Semiarti, E., Onouchi, H., Kojima, S., Tsukaya, H., Hasebe, M., Soma, T., Ikezaki, M., Machida, C. et al. (2002). The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana, required for formation of a symmetric flat leaf lamina, encodes a member of a novel family of proteins characterized by cysteine repeats and a leucine zipper. Plant Cell Physiol. 43,467 -478.[Abstract/Free Full Text]

Jackson, D. and Hake, S. (1999). Control of phyllotaxy in maize by the abphyl1 gene. Development 126,315 -323.[Abstract]

Jackson, D., Veit, B. and Hake, S. (1994). Expression of maize KNOTTED1 related homeobox genes in the shoot apical meristem predicts patterns of morphogenesis in the vegetative shoot. Development 120,405 -413.[Abstract]

Kaya, H., Shibahara, K., Taoka, K., Iwabuchi, M., Stillman, B. and Araki, T. (2001). FASCIATA genes for chromatin assembly factor-1 in Arabidopsis maintain the cellular organization of apical meristems. Cell 104,131 -142.[CrossRef][Medline]

Kerstetter, R., Vollbrecht, E., Lowe, B., Veit, B., Yamaguchi, J. and Hake, S. (1994). Sequence analysis and expression patterns divide the maize knotted1-like homeobox genes into two classes. Plant Cell 6,1877 -1887.[Abstract/Free Full Text]

Kidner, C. A., Timmermans, M. C. P., Byrne, M. E. and Martienssen, R. A. (2002). Developmental genetics of the angiosperm leaf. In Advances in Botanical Research: Volume 38 (ed. J. A. Callow), pp. 191-234. London: Academic Press.

Klar, A. J. S. (2002). Fibonacci's flowers. Nature 417,595 .[CrossRef][Medline]

Kohalmi, S. E., Nowak, J. and Crosby, W. L. (1997). A practical guide to using the yeast 2-hybrid system. In Differentially Expressed Genes in Plants: A Bench Manual (ed. E. Hansen and G. Harper), pp.63 -82. London: Taylor and Francis.

Leyser, H. M. O. and Furner, I. J. (1992). Characterisation of three shoot apical meristem mutants of Arabidopsis thaliana. Development 116,397 -403.

Li, H., Shen, J.-J., Zheng, Z.-L., Lin, Y. and Yang, Z. (2001). The Rop GTPase switch controls multiple developmental processes in Arabidopsis. Plant Physiol. 126,670 -684.[Abstract/Free Full Text]

Lincoln, C., Britton, J. H. and Estelle, M. (1990). Growth and development of the axr1 mutants of Arabidopsis. Plant Cell 2,1071 -1080.[Abstract/Free Full Text]

Lincoln, C., Long, J., Yamaguchi, J., Serikawa, K. and Hake, S. (1994). A knotted1-like homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants. Plant Cell 6,1859 -1876.[Abstract/Free Full Text]

Liu, Y. G., Mitsukawa, N., Oosumi, T. and Whittier, R. F. (1995). Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J. 8,457 -463.[CrossRef][Medline]

Long, J. A. and Barton, M. K. (1998). The development of apical embryonic pattern in Arabidopsis. Development 125,3027 -3035.[Abstract]

Long, J. A., Moan, E. I., Medford, J. I. and Barton, M. K. (1996). A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379,66 -69.[CrossRef][Medline]

Lynn, K., Fernandez, A., Aida, M., Sedbrook, J., Tasaka, M., Masson, P. and Barton, M. K. (1999). The PINHEAD/ZWILLE gene acts pleiotropically in Arabidopsis development and has overlapping functions with the ARGONAUTE1 gene. Development 126,469 -481.[Abstract]

Mann, R. S. and Chan, S.-K. (1996). Extra specificity from extradenticle: the partnership between HOX and PBX/EXD homeodomain proteins. Trends Genet. 12,258 -262.[CrossRef][Medline]

Modrusan, Z., Reiser, L., Feldmann, K. A., Fischer, R. L. and Haughn, G. W. (1994). Homeotic transformation of ovules into carpel-like structures in Arabidopsis. Plant Cell 6, 333-349.[Abstract]

Moussian, B., Schoof, H., Haecker, A., Jurgens, G. and Laux, T. (1998). Role of the ZWILLE gene in the regulation of central shoot meristem cell fate during Arabidopsis embryogenesis. EMBO J. 17,1799 -1809.[CrossRef][Medline]

Müller, J., Wang, Y., Franzen, R., Santi, L., Salamini, F. and Rohde, W. (2001). In vitro interactions between barley TALE homeodomain proteins suggest a role for protein-protein associations in the regulation of Knox gene function. Plant J. 27,13 -23.[CrossRef][Medline]

Ori, N., Eshed, Y., Chuck, G., Bowman, J. L. and Hake, S. (2000). Mechanisms that control knox gene expression in the Arabidopsis shoot. Development 127,5523 -5532.[Abstract]

Pautot, V., Dockx, J., Hamanta, O., Kronenbergera, J., Grandjeanc, O., Jublota, D. and Traas, J. (2001). KNAT2: Evidence for a link between Knotted-like genes and carpel development. Plant Cell 13,1719 -1734.[Abstract/Free Full Text]

Pien, S., Wyrzykowska, J., McQueen-Mason, S., Smart, C. and Fleming, A. (2001). Local expression of expansin induces the entire process of leaf development and modifies leaf shape. Proc. Natl. Acad. Sci. USA 98,11812 -11817.[Abstract/Free Full Text]

Prigge, M. J. and Wagner, D. R. (2001). The Arabidopsis SERRATE gene encodes a zinc-finger protein required for normal shoot development. Plant Cell 13,1263 -1279.[Abstract/Free Full Text]

Reinhardt, D., Mandel, T. and Kuhlemeier, C. (2000). Auxin regulates the initiation and radial position of plant lateral organs. Plant Cell 12,507 -518.[Abstract/Free Full Text]

Reinhardt, D., Witter, F., Mandel, T. and Kuhlemeier, C. (1998). Localized upregulation of a new expansin gene predicts the site of leaf formation in the tomato meristem. Plant Cell 10,1427 -1437.[Abstract/Free Full Text]

Reiser, L., Modrusan, Z., Margossian, L., Samach, A., Ohad, N., Haughn, G. W. and Fischer, R. L. (1995). The BELL1 gene encodes a homeodomain protein involved in pattern formation in the Arabidopsis ovule primordium. Cell 83,735 -742.[CrossRef][Medline]

Reiser, L., Sanchez-Baracaldo, P. and Hake, S. (2000). Knots in the family tree: evolutionary relationships and functions of knox homeobox genes. Plant Mol. Biol. 42,151 -166.[CrossRef][Medline]

Richards, F. J. (1951). Phyllotaxis: its quantitative expression and relation to growth in the apex. Philos. Trans. R. Soc. Lond. 235,509 -564.

Robinson-Beers, K., Pruitt, R. E. and Gasser, C. S. (1992). Ovule development in wild-type Arabidopsis and two female-sterile mutants. Plant Cell 4,1237 -1249.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Press.

Schiestl, R. H., Manivasakam, P., Woods, R. A. and Gietz, R. D. (1993). Introducing DNA into yeast by transformation. Methods: A companion to methods in enzymology 5, 7 9-85.

Semiarti, E., Ueno, Y., Tsukaya, H., Iwakawa, H., Machida, C. and Machida, Y. (2001). The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana regulates formation of a symmetric lamina, establishment of venation and repression of meristem-related homeobox genes in leaves. Development 128,1771 -1783.[Abstract]

Shuai, B., Reynaga-Pena, C. G. and Springer, P. S. (2002). The LATERAL ORGAN BOUNDARIES gene defines a novel, plant-specific gene family. Plant Physiol. 129,747 -761.[Abstract/Free Full Text]

Smith, H. M., Boschke, I. and Hake, S. (2002). Selective interaction of plant homeodomain proteins mediates high DNA-binding affinity. Proc. Natl. Acad. Sci. USA 99,9579 -9584.[Abstract/Free Full Text]

Snow, M. and Snow, R. (1931). Experiments on phyllotaxis I. The effect of isolating a primordium. Philos. Trans. R. Soc. Lond. B221,1 -43.

Springer, P. S., McCombie, W. R., Sundaresan, V. and Martienssen, R. A. (1995). Gene trap tagging of PROLIFERA, an essential MCM2-3-5-like gene in Arabidopsis. Science 268,877 -880.[Abstract/Free Full Text]

Steeves, T. A. and Sussex, I. M. (1989). Patterns in Plant Development. Cambridge: Cambridge University Press.

Sundaresan, V., Springer, P., Volpe, T., Haward, S., Jones, J. D. G., Dean, C., Ma, H. and Martienssen, R. (1995). Patterns of gene action in plant development revealed by enhancer trap and gene trap transposable elements. Genes Dev. 9,1797 -1810.[Abstract/Free Full Text]

Takahashi, T., Matsuhara, S., Abe, M. and Komeda, Y. (2002). Disruption of a DNA topoisomerase I gene affects morphogenesis in Arabidopsis. Plant Cell 14,2085 -2093.[Abstract/Free Full Text]

The Arabidopsis Genome Initiative (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408,796 -815.[CrossRef][Medline]

Timmermans, M. C., Hudson, A., Becraft, P. W. and Nelson, T. (1999). ROUGH SHEATH2: a Myb protein that represses knox homeobox genes in maize lateral organ primordia. Science 284,151 -153.[Abstract/Free Full Text]

Tsiantis, M., Schneeberger, R., Golz, J. F., Freeling, M. and Langdale, J. A. (1999). The maize rough sheath2 gene and leaf development programs in monocot and dicot plants. Science 284,154 -156.[Abstract/Free Full Text]

Veit, B., Briggs, S. P., Schmidt, R. J., Yanofsky, M. F. and Hake, S. (1998). Regulation of leaf initiation by the terminal ear 1 gene of maize. Nature 393,166 -168.[CrossRef][Medline]

Venglat, P., Dumonceaux, T., Parnell, L., Rozwadowski, K., Babic, V., Keller, W., Martienssen, R. A., Selvaraj, G. and Datla, R. (2002). The Arabidopsis BREVIPEDICELLUS gene is an important regulator of pedicel and internode development. Proc. Natl. Acad. Sci. USA 99,4730 -4735.[Abstract/Free Full Text]

Vernoux, T., Kronenberger, J., Grandjean, O., Laufs, P. and Traas, J. (2000). PIN-FORMED 1 regulates cell fate at the periphery of the shoot apical meristem. Development 127,5157 -5165.[Abstract]

Vollbrecht, E., Reiser, L. and Hake, S. (2000). Shoot meristem size is dependent on inbred background and presence of the maize homeobox gene, knotted1. Development 127,3161 -3172.[Abstract]

Vollbrecht, E., Veit, B., Sinha, N. and Hake, S. (1991). The developmental gene Knotted-1 is a member of a maize homeobox gene family. Nature 350,241 -243.[CrossRef][Medline]

Vongs, A., Kakutani, T., Martienssen, R. A. and Richards, E. J. (1993). Arabidopsis thaliana DNA methylation mutants. Science 260,1926 -1928.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J Exp BotHome page
T. Girin, K. Sorefan, and L. Ostergaard
Meristematic sculpting in fruit development
J. Exp. Bot., April 1, 2009; 60(5): 1493 - 1502.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
C. Gomez-Mena and R. Sablowski
ARABIDOPSIS THALIANA HOMEOBOX GENE1 Establishes the Basal Boundaries of Shoot Organs and Controls Stem Growth
PLANT CELL, August 1, 2008; 20(8): 2059 - 2072.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
Y. Zhang, S. Feng, F. Chen, H. Chen, J. Wang, C. McCall, Y. Xiong, and X. W. Deng
Arabidopsis DDB1-CUL4 ASSOCIATED FACTOR1 Forms a Nuclear E3 Ubiquitin Ligase with DDB1 and CUL4 That Is Involved in Multiple Plant Developmental Processes
PLANT CELL, June 1, 2008; 20(6): 1437 - 1455.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
V. Pinon, J. P. Etchells, P. Rossignol, S. A. Collier, J. M. Arroyo, R. A. Martienssen, and M. E. Byrne
Three PIGGYBACK genes that specifically influence leaf patterning encode ribosomal proteins
Development, April 1, 2008; 135(7): 1315 - 1324.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
L. Ragni, E. Belles-Boix, M. Gunl, and V. Pautot
Interaction of KNAT6 and KNAT2 with BREVIPEDICELLUS and PENNYWISE in Arabidopsis Inflorescences
PLANT CELL, April 1, 2008; 20(4): 888 - 900.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
E. Magnani and S. Hake
KNOX Lost the OX: The Arabidopsis KNATM Gene Defines a Novel Class of KNOX Transcriptional Regulators Missing the Homeodomain
PLANT CELL, April 1, 2008; 20(4): 875 - 887.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
P. Soucek, P. Klima, A. Rekova, and B. Brzobohaty
Involvement of hormones and KNOXI genes in early Arabidopsis seedling development
J. Exp. Bot., October 20, 2007; (2007) erm236v1.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
R. Kumar, K. Kushalappa, D. Godt, M. S. Pidkowich, S. Pastorelli, S. R. Hepworth, and G. W. Haughn
The Arabidopsis BEL1-LIKE HOMEODOMAIN Proteins SAW1 and SAW2 Act Redundantly to Regulate KNOX Expression Spatially in Leaf Margins
PLANT CELL, September 1, 2007; 19(9): 2719 - 2735.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. Alonso-Cantabrana, J. J. Ripoll, I. Ochando, A. Vera, C. Ferrandiz, and A. Martinez-Laborda
Common regulatory networks in leaf and fruit patterning revealed by mutations in the Arabidopsis ASYMMETRIC LEAVES1 gene
Development, July 15, 2007; 134(14): 2663 - 2671.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. Peaucelle, H. Morin, J. Traas, and P. Laufs
Plants expressing a miR164-resistant CUC2 gene reveal the importance of post-meristematic maintenance of phyllotaxy in Arabidopsis
Development, March 15, 2007; 134(6): 1045 - 1050.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. Hay, M. Barkoulas, and M. Tsiantis
ASYMMETRIC LEAVES1 and auxin activities converge to repress BREVIPEDICELLUS expression and promote leaf development in Arabidopsis
Development, October 15, 2006; 133(20): 3955 - 3961.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
V. Balanza, M. Navarrete, M. Trigueros, and C. Ferrandiz
Patterning the female side of Arabidopsis: the importance of hormones
J. Exp. Bot., October 1, 2006; 57(13): 3457 - 3469.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
E. Belles-Boix, O. Hamant, S. M. Witiak, H. Morin, J. Traas, and V. Pautot
KNAT6: An Arabidopsis Homeobox Gene Involved in Meristem Activity and Organ Separation
PLANT CELL, August 1, 2006; 18(8): 1900 - 1907.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Cole, C. Nolte, and W. Werr
Nuclear import of the transcription factor SHOOT MERISTEMLESS depends on heterodimerization with BLH proteins expressed in discrete sub-domains of the shoot apical meristem of Arabidopsis thaliana
Nucleic Acids Res., March 2, 2006; 34(4): 1281 - 1292.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. R. Dinneny, D. Weigel, and M. F. Yanofsky
A genetic framework for fruit patterning in Arabidopsis thaliana
Development, November 1, 2005; 132(21): 4687 - 4696.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
H. Luo, F. Song, and Z. Zheng
Overexpression in transgenic tobacco reveals different roles for the rice homeodomain gene OsBIHD1 in biotic and abiotic stress responses
J. Exp. Bot., October 1, 2005; 56(420): 2673 - 2682.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. Hay and M. Tsiantis
From genes to plants via meristems
Development, June 15, 2005; 132(12): 2679 - 2684.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Norberg, M. Holmlund, and O. Nilsson
The BLADE ON PETIOLE genes act redundantly to control the growth and development of lateral organs
Development, May 1, 2005; 132(9): 2203 - 2213.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J.-Y. Kim, Y. Rim, J. Wang, and D. Jackson
A novel cell-to-cell trafficking assay indicates that the KNOX homeodomain is necessary and sufficient for intercellular protein and mRNA trafficking
Genes & Dev., April 1, 2005; 19(7): 788 - 793.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
X. Bao, R. G. Franks, J. Z. Levin, and Z. Liu
Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems
PLANT CELL, June 1, 2004; 16(6): 1478 - 1489.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
I. Weir, J. Lu, H. Cook, B. Causier, Z. Schwarz-Sommer, and B. Davies
CUPULIFORMIS establishes lateral organ boundaries in Antirrhinum
Development, February 15, 2004; 131(4): 915 - 922.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Byrne, M. E.
Right arrow Articles by Martienssen, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Byrne, M. E.
Right arrow Articles by Martienssen, R. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?