|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online July 21, 2003
doi: 10.1242/10.1242/dev.00620

1 Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA
2 Institute of Forest Genetics, Davis, California 95616, USA
Author for correspondence (e-mail:
martiens{at}cshl.org)
Accepted 21 May 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Phyllotaxy, Homeobox, Shoot apical meristem, KNOX, BELLRINGER, BREVIPEDICELLUS, SHOOT MERISTEMLESS, ASYMMETRIC LEAVES1
| INTRODUCTION |
|---|
|
|
|---|
Initiation of successive lateral organs on the flanks of the SAM proceeds
in predictable patterns generating a phyllotaxy. Spiral phyllotaxy observed in
the vast majority of plants derives from the regular initiation of successive
lateral organ primordia at a constant divergence angle approximating
137.5°. This pattern can be described in terms of two sets of opposing
intersecting spirals or `contact parastichies' that connect adjacent primordia
(Richards, 1951
;
Steeves and Sussex, 1989
). The
number of clockwise and counterclockwise spirals in each set is characteristic
of a species, and corresponds to successive numbers in the Fibonacci series
(3+5, 5+8, 8+13 etc.) (reviewed by
Richards, 1951
).
Inter-specific and developmental variation in the number of contact
parastichies is thought to reflect relative rates of primordia initiation and
growth (Richards, 1951
).
Genetic pathways that establish and maintain phyllotaxy are yet to be
identified. Potentially the site of primordium initiation is established by
molecular inhibitory signals from preexisting primordia or from biophysical
stresses within the shoot apex (reviewed in
Green, 1999
). Consistent with
both of these models alterations in phyllotaxy are often associated with
changes in the dimensions and organization of the SAM. For example, in the
Arabidopsis mutants fasciata1 (fas1) and
fasciata2 (fas2) meristem shape and patterning is irregular
and phyllotaxy is disrupted (Kaya et al.,
2001
; Leyser and Furner,
1992
). The pattern of organ initiation is also irregular in the
serrate (se) mutant where the meristem is enlarged compared
with wild type (Clarke et al.,
1999
; Ori et al.,
2000
; Prigge and Wagner,
2001
). Reduced meristem size is associated with phyllotaxy defects
in the DNA topoisomerase mutant top1
(Takahashi et al., 2002
).
Alternatively, the abphyl1 mutant in maize has a phyllotaxy defect
associated with an enlarged meristem. Additional leaves are formed in a
decussate pattern rather than the normal alternate, distichous arrangement
(Jackson and Hake, 1999
). In
contrast to these examples, terminal ear (te1) mutations in maize
alter the rate of leaf initiation and phyllotaxy, but have relatively minor
effects on the geometry of the shoot apex
(Veit et al., 1998
).
te1 encodes a protein related to the RNA binding protein Mei2 from
Schizosaccharomyces pombe. te1 is expressed in the presumptive
internode in a region around the meristem excluding the site of organ
initiation. This expression pattern suggests te1 may inhibit lateral
organ differentiation.
One genetic pathway required for SAM function involves class 1 KNOX
homeobox transcription factors. Recessive mutations in the
Arabidopsis KNOX gene SHOOT MERISTEMLESS (STM) and
in the closely related maize gene knotted1 have defects in meristem
function indicating a requirement for SAM initiation and/or maintenance
(Barton and Poethig, 1993
;
Long et al., 1996
;
Vollbrecht et al., 2000
;
Vollbrecht et al., 1991
).
Consistent with a role in SAM function both STM and kn1 are
expressed in vegetative and reproductive SAMs but are down-regulated in
founder cells and lateral organ primordia
(Jackson et al., 1994
;
Long et al., 1996
).
STM maintains stem cell fate by negative regulation of the myb domain
transcription factor ASYMMETRIC LEAVES1 (AS1) and a member
of the LOB-like transcription factor family ASYMMETRIC LEAVES2
(AS2) (Byrne et al.,
2000
; Byrne et al.,
2002
; Iwakawa et al.,
2002
; Shuai et al.,
2002
). AS1 is related to rough sheath2 in maize
and PHANTASTICA in Antirrhinum. All three genes are
expressed in lateral organ primordia where they function as negative
regulators of KNOX genes (Byrne et al.,
2000
; Ori et al.,
2000
; Semiarti et al.,
2001
; Timmermans et al.,
1999
; Tsiantis et al.,
1999
).
Arabidopsis has three additional class I KNOX genes,
BREVIPEDICELLUS (BP, formerly KNAT1),
KNAT2 and KNAT6. Like STM, these genes are
expressed in SAMs and downregulated in lateral organs, although the pattern
and timing of expression differs from that of STM
(Byrne et al., 2002
;
Dockx et al., 1995
;
Lincoln et al., 1994
;
Pautot et al., 2001
;
Semiarti et al., 2001
).
Mutations in BP alone do not cause meristem defects
(Byrne et al., 2002
;
Douglas et al., 2002
;
Venglat et al., 2002
).
BP is, however, redundant with STM and has a role in SAM
function in as1 stm and as2 stm mutant backgrounds
(Byrne et al., 2002
).
Disruption of KNAT2 gene expression has no phenotypic effect,
probably because of redundancy with the duplicate gene KNAT6
(Byrne et al., 2002
).
We have isolated several insertion alleles of BELLRINGER (BLR), a
BELL1-like homeobox gene. Prominent defects in blr mutants
include an increase in the number of leaves and disruption to the normal
spiral pattern of primordia initiation. Genetic interactions also demonstrate
that BLR is required for stem cell maintenance. Previously we
reported that BP plays a role in meristem function in the absence of
AS1 and STM (Byrne et
al., 2002
). BLR is also necessary for meristem function
in the absence of AS1 and STM. BLR probably interacts
directly with STM and BP in meristem function.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plant genetics
Tests for allelism were carried out by crossing plants homozygous for
blr-2 and blr-3 to plants homozygous for blr-1.
F1 plants from both crosses displayed the blr mutant
phenotype. All other genetic interactions and phenotypic studies were carried
out with the blr-1 allele in a Landsberg erecta background.
To generate double mutants, plants homozygous for bp, as1, bel1, clv1
or clv3 were crossed to plants homozygous for blr. All
double mutants segregated in the F2 progeny in a 1:15 ratio. Double
blr wus, blr stm-11 and blr stm-2 mutants were generated by
crossing plants homozygous for blr to plants heterozygous for
wus, stm-11 or stm-2. Double blr wus mutants
segregated 1:3 in F3 seed from blr mutant plants. In lines
carrying either stm-11 or stm-2 F3 seed from
homozygous blr plants segregated 1:3 stm mutants.
Triple blr as1 stm-11 mutants were generated by crossing double homozygous blr as1 plants to as1/as1 stm-11/+ plants. F2 seed from blr/blr as1/as1 stm11/+ plants segregated a meristemless phenotype in a 1:3 ratio. Triple bel1 as1 stm-11 mutants were generated by crossing as1/as1 stm-11/+ plants with bel1/bel1. F3 seed from plants homozygous for as1 and heterozygous for stm11 and bel1 segregated only wild type, as1 stm11 and as1 bel1 phenotypes in a 9:4:3 ratio.
Molecular biology
DNA extraction and manipulation were carried out using standard protocols
(Sambrook et al., 1989
). The
Ds element copy number in lines carrying blr-1 and blr-2 was
determined using Southern gel blot analysis as described previously
(Vongs et al., 1993
). The
Ds-specific hybridization probe was obtained by PCR amplification of the Ds
element using the primers agcccatgtaagaaatacctagcg and
tgctgtactgctaagtgctgtgag. Identification of the tagged gene in blr-1
and blr-2 was carried out by thermal asymmetric interlaced-PCR
(Liu et al., 1995
). To confirm
the Ds element insertion sites in blr-1 and blr-2, PCR
products were generated using Ds and gene-specific primers. Ds primers were
acccgaccggatcgtatcggt and acggtcgggaaactagctctac. blr-1 primers were
ctgctggtcaaagacatggat and tgcatgcttaattagcaagaaat. blr-2 primers were
atcgtgcttcaaaaagacacc and gcagagaagaatcatcgtcgt. PCR products were sequenced
using dye terminator cycle sequencing (Applied Biosystems).
Total RNA for northern and RT-PCR analysis was purified using Trizol
reagent (Life Technologies). For northern hybridization, 20 µg of RNA was
separated on a 1.4% gyloxal/DMSO denaturing gel. RNA was transferred to a
membrane and hybridized using Ultrahyb buffer (Ambion). The BLR probe
for northern analysis was a PCR product synthesized with the primers
taatgtgggtcgtgggattta and aggagcatgatgatcaggaaa. RT-PCR was carried out as
previously described (Byrne et al.,
2002
). Following DNase treatment and synthesis of complementary
DNA with M-MuLV reverse transcriptase (New England Biolab) PCR reactions were
performed with genespecific primers. BLR primers were as above.
RBC primers were gaacaatggcttcctctatgc and cacaaggaatccacttgttgc. PCR
products were subject to Southern hybridization using gene-specific
probes.
The BLR::GUS construct was derived as follows. A 3.9 kb genomic fragment containing the BLR promoter was amplified from Landsberg erecta using the primers ttggcacgattctgaaacacg and ctcgccggctttgttgaaga. The product was cloned into pRITA, which contains the GUS reporter gene and NOS terminator sequences (a gift from John Bowman). The resulting plasmid, pRIP3, contains an in frame fusion of the start codon of BLR with GUS. This gene fusion fragment was cloned into a binary vector and introduced into plants using Agrobacterium transformation.
Histology and microscopy
Inflorescences were prepared for sectioning by fixation in glutaraldehyde
(2.5% in 0.1 M sodium phosphate buffer pH 7.0), dehydration through an ethanol
series and infiltration with Histoclear prior to embedding in paraffin wax.
All sections were 8 µm thick. Sections were cleared of paraffin wax using
Histoclear, rehydrated to 50% ethanol, stained for 20 minutes in 0.1% safranin
in 50% ethanol, rinsed in 70% ethanol, then stained for 3 minutes in 0.1% Fast
Green in 95% ethanol. The sections were then dehydrated in 100% ethanol, and
moved to Histoclear. For meristem size comparisons measurement were taken from
longitudinal sections of 8 wild-type and 9 blr plants that were 23
days old.
GUS staining was carried out as previously described
(Gu et al., 1998
) using a
substrate solution containing 100 mM sodium phosphate pH 7, 10 mM EDTA, 0.1%
Triton X-100, 0.5 mg/ml 5-bromo-4-chloro-3-indolyl ß-D glucuronic acid
(X-Gluc), 100 µg/ml chloramphenicol, and either 2 mM or 5 mM each of
potassium ferricyanide and potassium ferrocyanide. After 24-48 hours at
37°C samples were cleared in 70% ethanol at room temperature. Samples were
viewed with a Leica MZ8 microscope and images captured with a Spot RT digital
camera (Diagnostic instruments).
For scanning electron microscopy (SEM) inflorescences from wild-type and blr plants were first fixed overnight in 2.5% glutaraldehyde, then rinsed in 0.1 M sodium phosphate buffer and dehydrated through an ethanol series (30%, 50%, 70%, 80%, 95%, 100%) prior to critical point drying using a Tousimis Auotsamdri-815. Samples were subsequently mounted on silver tape and sputter coated with gold (Emitech K550) before viewing with an Hitachi S-3500N SEM under high vacuum and with a beam accelerating voltage of 3-5 kV. Measurements of meristem radius and organ divergence angle were derived from SEM images of 16 wild-type and 16 blr mutant that were 18 days old. Plastochron ratios were measured from 7 wild-type and 7 blr plants.
In situ hybridization
In situ hybridizations were performed using digoxigenin-labeled probes
(Long and Barton, 1998
;
Long et al., 1996
). Antisense
and control sense BLR transcripts were synthesized from the plasmid
pBlue028, which carries a 531 bp fragment, encompassing the 3' end of
BLR, in pBluescript. Antisense STM transcripts were
synthesized from the plasmid Meri HB1 (a gift from Kathy Barton). All sections
were 8 µm thick.
Yeast 2-hybrid assay
Full-length BLR cDNA was amplified with the primers
ggtcgacgggctgatgcatacgagcct and agcggccgcatttcaattcccccatatc. The PCR product
was digested with SalI and NotI cloned into the GAL4
transcriptional activation domain (TA) vector pBI-771
(Kohalmi et al., 1997
) forming
the plasmid TA-BLR. STM cDNA was amplified with the primers
acgcgtcgacgtatggagagtggttccaac and ataagaatgcggccgcccaagtataccgagaacc. The PCR
product was digested with SalI and NotI and cloned into the
GAL4 DNA-binding domain (DB) vector pBI-770. Other constructs, DB-BP, DB-KNAT4
and TABEL 1 were kindly
provided by George Haughn and are as previously described
(Bellaoui et al., 2001
). All
plasmids were transformed into the yeast strain pJ69A using a lithium
acetate/polyethylene glycol protocol
(Schiestl et al., 1993
).
|
| RESULTS |
|---|
|
|
|---|
|
|
BELLRINGER is related to the homeodomain transcription
factor BELL1
The recessive blr-1 mutation was found to cosegregate with a
single Ds element inserted into a homeobox gene, At5g02030, located on
chromosome 5
(http://cshl.genetrap.org)
(The Arabidopsis Genome Initiative,
2000
). This gene encodes a protein most closely related to members
of the BELL1 (BEL1) subclass of homeodomain transcription
factors, of which there are 12 members in Arabidopsis
(Becker et al., 2002
).
BLR comprises 4 exons and 3 introns
(Fig. 3A). The Ds insertion in
blr-1 is located in the second intron whereas blr-2 has a Ds
insertion 2 bp upstream of the BLR ATG initiation codon. In both
alleles the insertion does not activate the GUS reporter on the Ds element.
The third allele, blr-3, carries a T-DNA insertion in the first
intron of the gene. For all three alleles full-length BLR transcripts
were not detected in homozygous mutant plants
(Fig. 3B).
|
BLR expression was further examined by driving GUS reporter gene expression from the BLR promoter. In the embryo, BLR expression was confined to the SAM (Fig. 4A) but weak expression could also be detected in the root tip (data not shown). In young seedlings, BLR was highly expressed in the SAM and could be detected in cotyledon and leaf vasculature (Fig. 4B). In the inflorescence, BLR was expressed in the inflorescence meristem, stem, flower pedicel and in developing flowers (data not shown).
|
Genetic interactions between bellringer and KNOX genes
BELL-like proteins belong to a class of homeodomain transcription factors
that can interact directly with KNOX class homeodomain transcription factors
(Bellaoui et al., 2001
;
Müller et al., 2001
;
Smith et al., 2002
). Since
protein-protein interactions between heterologous homeodomain transcription
factors are required in animals (Mann and
Chan, 1996
) it is likely that such interactions are functionally
significant in plants. We therefore investigated genetic interactions between
BLR and the class 1 KNOX genes STM, KNAT1 and
KNAT2.
Embryos homozygous for strong stm alleles, including
stm-1 and stm-11 (Fig.
5A), lack a SAM and develop cotyledons that are fused at their
base (Barton and Poethig, 1993
;
Clark et al., 1996
;
Long et al., 1996
). Double
blr stm-11 mutants are similar to stm-11 mutants
(Fig. 5B). However,
blr enhances the phenotype of the weak allele stm-2. Single
stm-2 mutants germinate with slight fusion at the base of the
cotyledons (Clark et al.,
1996
; Endrizzi et al.,
1996
). After a brief delay, vegetative shoot development is
initiated (Fig. 5C). In
contrast, blr stm-2 double mutants do not form any vegetative shoot
and resemble mutants of strong alleles of stm
(Fig. 5D). This genetic
interaction indicates BLR is required for SAM function when there is
reduced STM activity.
|
|
In contrast to blr mutants where phenotypic effects are evident in
the shoot, mutations in the related gene bel1 only affect ovule
development (Modrusan et al.,
1994
; Reiser et al.,
1995
; Robinson-Beers et al.,
1992
). blr bel1 double mutants display a blr
shoot phenotype and are sterile as is bel1
(Fig. 6G,H). This demonstrates
that BEL1 is not redundant with BLR in shoot development.
Since BEL1 protein directly interacts with BP we also investigated whether
BEL1 is required for SAM function in an as1 stm background.
In contrast to blr as1 stm mutants, the triple bel1 as1 stm
mutants form a vegetative shoot similar to as1 stm double mutants
(data not shown). Furthermore no novel phenotype is detected in progeny of
blr as1 plants also segregating bel1 and stm.
Therefore BEL1 is not required for SAM function in these
contexts.
SAM function is also regulated by WUSCHEL (WUS) and the
CLAVATA (CLV) genes, acting independently of KNOX genes.
WUS is a homeodomain protein expressed in inner central zone stem
cells of the SAM. Mutations in WUS result in loss of meristem
function. CLV1 and CLV2 are transmembrane receptors and
CLV3 encodes a secreted peptide. Mutations in all three CLV
genes result in a much enlarged meristem. CLV genes maintain meristem
homeostasis by limiting WUS function (reviewed by
Brand et al., 2001
;
Clark, 2001
;
Fletcher, 2002
). We found
blr wus, blr clv1 and blr clv3 double mutants are additive
(not shown). Therefore, BLR appears to affect meristem function via a
KNOX genespecific pathway.
BELLRINGER interacts directly with KNOX proteins
Genetic analysis demonstrated that blr enhances a weak allele of
stm and is required for SAM function in the as1 stm
background. Since BELL class proteins are known to interact directly with KNOX
proteins (Bellaoui et al.,
2001
; Müller et al.,
2001
; Smith et al.,
2002
) one possibility is that BLR directly interacts with and
affects the activity of STM and BP. To test this possibility a yeast
two-hybrid assay was carried out (Fig.
7). Yeast strains carrying the plasmids TA-BLR and DBBP or DB-STM
were viable in the absence of histidine. In contrast, yeast carrying TA-BRL
and DB-KNAT4 failed to grow in the absence of histidine. Therefore in this
system BLR interacts with the class1 KNOX proteins STM and BP but not with the
class 2 KNOX protein KNAT4. The negative control yeast strain carrying the
plasmid TA-BLR in the presence of the DB vector showed no growth in the
absence of histidine.
|
| DISCUSSION |
|---|
|
|
|---|
BLR is strongly expressed in the embryonic SAM, and has a
conditional role in SAM function as revealed by genetic interactions. Whereas
as1 stm mutants form a vegetative shoot indistinguishable from that
of as1 single mutants, shoot development is greatly reduced in the
triple blr as1 stm mutant. This triple mutant strongly resembles
pinhead/zwille mutants where a solitary vegetative organ appears to
consume the meristem (Lynn et al.,
1999
; Moussian et al.,
1998
). BLR is therefore required to maintain the SAM in
the as1 stm background. Meristem function in as1 stm mutants
is dependent on BP (Byrne et al.,
2002
), so that it is probable that BP activity is
compromised in blr. We tested this possibility by making bp
blr double mutants, which were additive in all respects. Thus BP
is still functional in a blr mutant, meaning that loss of bp
function cannot completely explain the blr phenotype.
Strong alleles of stm are formally epistatic to blr,
although the blr phenotype is difficult to observe in strong
stm. However, a weak allele of stm is greatly enhanced by
blr. This effect is far stronger than that of bp, which also
enhances weak stm-2 (Byrne et al.,
2002
). Thus it is possible that BLR is required for
STM function, consistent with its expression pattern in the embryo.
However, BLR must also have an STM-independent role,
revealed by the strong phenotype of blr as1 stm triple mutants. A
likely explanation is that BLR is required for both BP and
STM function. Consistent with this possibility, yeast two-hybrid
assay demonstrates the BLR protein interacts directly with both STM and BP.
The requirement for BLR must be only partial, as blr has a
much milder phenotype than either bp or stm, and, as noted
above, BP is still functional in a blr mutant. One
explanation is that BLR is itself partially redundant. A strong
candidate would be the BELL class gene (At2g27990) most closely related to
BLR. Conservation between these two genes is 90% within the
homeodomain and 48% overall.
BLR is more distantly related to the BELL class gene
BEL1. The blr bel1 double mutant phenotype indicates a lack
of functional overlap between these two genes. The phenotype of bel1
mutants is restricted to the ovule where the morphology of the outer
integument is abnormal while the inner integument is completely absent
(Modrusan et al., 1994
;
Robinson-Beers et al., 1992
).
Consistent with this phenotype BEL1 expression in the ovule is
restricted to the region where integuments initiate
(Reiser et al., 1995
).
However, BEL1 is also expressed in vegetative tissues and roots. The
lack of other plant phenotypes suggests BEL1 shares genetic
redundancy. Similarly, BEL1 interacts physically with BP, yet the
bel1 phenotype indicates that it is not required for BP function in
the inflorescence. We have demonstrated that BEL1 is not required for
SAM function in as1 stm, indicating it has no effect on BP activity
in the embryonic or vegetative SAM. Again the apparent lack of BEL1
genetic interactions with BP is possibly the result of redundancy.
Candidates for such redundancy are two genes, BLH2 and BLH4,
most closely related to BEL1
(Becker et al., 2002
).
Mutations in BLR result in phyllotaxy defects including both an
increase in the number of lateral organs and displacement of organs along the
stem. Although mechanisms governing phyllotactic patterning are still to be
elucidated, early surgical experiments have shown that leaf primordia are
positioned in response to preexisting primordia
(Snow and Snow, 1931
). This
influence may be mediated by production of a diffusible inhibitor or may be
biophysical in nature. A model where biophysical forces regulate phyllotaxy is
supported by studies demonstrating induction of leaf formation by local
concentration of the cell wall protein expansin
(Fleming et al., 1997
;
Pien et al., 2001
;
Reinhardt et al., 1998
).
However, organ positioning can also be influenced by auxin. Chemical
inhibition of polar auxin transport and mutations affecting auxin transport,
including pinformed and pinoid in Arabidopsis,
result in failure to initiate lateral organ outgrowth
(Benjamins et al., 2001
;
Christensen et al., 2000
;
Vernoux et al., 2000
).
Primordial outgrowth in such cases can be induced at sites of localized auxin
concentration increase (Reinhardt et al.,
2000
; Vernoux et al.,
2000
). Organs can be induced at any position around the
circumference of the meristem, and also within a restricted region along the
apical-basal axis of the SAM.
The phenotypic defects in blr, including aberrant organ initiation
patterns may in part due to disruption in auxin signalling. Consistent with
this proposal, blr mutants display reduced stature and loss of apical
dominance typical of reduced auxin signalling
(Lincoln et al., 1990
).
Interestingly, phyllotaxy defects are also observed in plants expressing a
constitutively active form of a RHO GTPase that may be involved in mediating
plant responses to hormones such as auxin
(Li et al., 2001
). The
inflorescence phenotype in this case resembles that of bp
mutants.
The increase in organ number and organ displacement indicates blr
mutants are no longer fully responsive to inhibitory signals from preexisting
organs such that distances between organs are not maintained. Aberrant
initiation along the apical-basal axis of the SAM potentially contributes to
variable internode lengths. Alternatively, regular partitioning of cells
between organs and internodes is affected. In this respect blr
resembles te1 in maize, which has also been interpreted as a
phyllotaxy mutant (Veit et al.,
1998
).
Despite the phyllotactic defects in blr there is no appreciable difference in the size of the SAM compared with wild type. This may be coincident with more peripheral zone cells being specified as organ founder cells. Alternatively, in blr mutants an increase in recruitment of cells into lateral organs is offset by an increase in the number of stem cells, together maintaining SAM size. In this case BLR normally delays differentiation of stem cells in the SAM and slows their propagation. In each case, the function of BLR in delaying specification of lateral organs is consistent with BLR expression in peripheral cells of the inflorescence meristem, but not in initiating primordia.
Stem cell lineages expand according to the Fibonacci series when daughter
cells are delayed from acquiring stem cell fate, raising the possibility that
stem cells are responsible for phyllotactic patterns
(Klar, 2002
). In this respect,
BLR fulfills a postulated stem cell function required for Fibonacci
progression (Klar, 2002
), in
that BLR dictates how long daughter cells require to differentiate in
the stem cell lineage. However, this model remains controversial and is yet to
be substantiated (Fleming,
2002
). For example, stem cell lineages are multicellular in higher
plants, such that extensive coordination in the meristem would be required for
stem cell lineages to regulate organ initiation in this way. The effects of
the blr mutation on phyllotactic pattern are intriguing in this
context and will be examined further.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Barton, M. K. and Poethig, R. S. (1993). Formation of the shoot apical meristem in Arabidopsis thaliana an analysis of development in the wild type and in the shoot meristemless mutant. Development 119,823 -831.[Abstract]
Becker, A., Bey, M., Bürglin, T. R., Saedler, H. and Theissen, G. (2002). Ancestry and diversity of BEL1-like homeobox genes revealed by gymnosperm (Gnetum gnemon) homologs. Dev. Genet. Evol. 212,452 -457.
Bellaoui, M., Pidkowich, M. S., Samach, A., Kushalappa, K.,
Kohalmi, S. E., Modrusan, Z., Crosby, W. L. and Haughn, G. W.
(2001). The Arabidopsis BELL1 and KNOX TALE homeodomain proteins
interact through a domain conserved between plants and animals.
Plant Cell 13,2455
-2470.
Benjamins, R., Quint, A., Weijers, D., Hooykaas, P. and Offringa, R. (2001). The PINOID protein kinase regulates organ development in Arabidopsis by enhancing polar auxin transport. Development 128,4057 -4067.
Bharathan, G., Janssen, B. J., Kellogg, E. A. and Sinha, N. (1999). Phylogenetic relationships and evolution of the KNOTTED class of plant homeodomain proteins. Mol. Biol. Evol. 16,553 -563.[Abstract]
Brand, U., Hobe, M. and Simon, R. (2001). Functional domains in plant shoot mersitems. BioEssays 23,134 -141.[CrossRef][Medline]
Bürglin, T. R. (1997). Analysis of TALE
superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel
domain conserved between plants and animals. Nucleic Acids
Res. 25,4173
-4180.
Byrne, M. E., Barley, R., Curtis, M., Arroyo, J. M., Dunham, M., Hudson, A. and Martienssen, R. A. (2000). Asymmetric leaves1 mediates leaf patterning and stem cell function in Arabidopsis. Nature 408,967 -971.[CrossRef][Medline]
Byrne, M. E., Simorowski, J. and Martienssen, R. A. (2002). ASYMMETRIC LEAVES1 reveals knox gene redundancy. Development 129,1957 -1965.
Christensen, S. K., Dagenais, N., Chory, J. and Weigel, D. (2000). Regulation of auxin response by the protein kinase PINOID. Cell 100,469 -478.[CrossRef][Medline]
Clark, S. E. (2001). Meristems: start your signaling. Curr. Opin. Plant Biol. 4, 28-32.[CrossRef][Medline]
Clark, S. E., Jacobsen, S. E., Levin, J. Z. and Meyerowitz, E. M. (1996). The CLAVATA and SHOOT MERISTEMLESS loci competitively regulate meristem activity in Arabidopsis. Development 122,1567 -1575.[Abstract]
Clarke, J. H., Tack, D., Findlay, K., van Montagu, M. and van Lijsebettens, M. (1999). The SERRATE locus controls the formation of the early juvenile leaves and phase length in Arabidopsis. Plant J. 20,493 -501.[CrossRef][Medline]
Dockx, J., Quaedvlieg, N., Keultjes, G., Kock, P., Weisbeek, P. and Smeekens, S. (1995). The homeobox gene ATK1 of Arabidopsis thaliana is expressed in the shoot apex of the seedling and in flowers and inflorescence stems of mature plants. Plant Mol. Biol. 28,723 -737.[CrossRef][Medline]
Douglas, S. J., Chuck, G., Dengler, R. E., Pelecanda, L. and
Riggs, C. D. (2002). KNAT1 and ERECTA
regulate inflorescence architecture in Arabidopsis. Plant
Cell 14,547
-558.
Endrizzi, K., Moussian, B., Haecker, A., Levin, J. Z. and Laux, T. (1996). The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE. Plant J. 10,101 -113.
Fleming, A. J. (2002). Plant mathematics and Fibonacci's flowers. Nature 418, 7 23.[CrossRef][Medline]
Fleming, A. J., McQueen-Mason, S., Mandel, T. and Kuhlemeier,
C. (1997). Induction of leaf primordia by the cell wall
protein expansin. Science
276,1415
-1418.
Fletcher, J. C. (2002). Shoot and floral meristem maintenance in Arabidopsis. Ann. Rev. Plant Physiol. Plant Mol. Biol. 53,45 -66.[CrossRef][Medline]
Green, P. B. (1999). Expression of pattern in
plants: combining molecular and calculus-based biophysical paradigms.
Am. J. Bot. 86,1059
-1076.
Gu, Q., Ferrándiz, C., Yanofsky, M. F. and Martienssen, R. (1998). The FRUITFULL MADS-box gene mediates cell differentiation during Arabidopsis fruit development. Development 125,1509 -1517.[Abstract]
Iwakawa, H., Ueno, Y., Semiarti, E., Onouchi, H., Kojima, S.,
Tsukaya, H., Hasebe, M., Soma, T., Ikezaki, M., Machida, C. et al.
(2002). The ASYMMETRIC LEAVES2 gene of Arabidopsis
thaliana, required for formation of a symmetric flat leaf lamina, encodes
a member of a novel family of proteins characterized by cysteine repeats and a
leucine zipper. Plant Cell Physiol.
43,467
-478.
Jackson, D. and Hake, S. (1999). Control of phyllotaxy in maize by the abphyl1 gene. Development 126,315 -323.[Abstract]
Jackson, D., Veit, B. and Hake, S. (1994). Expression of maize KNOTTED1 related homeobox genes in the shoot apical meristem predicts patterns of morphogenesis in the vegetative shoot. Development 120,405 -413.[Abstract]
Kaya, H., Shibahara, K., Taoka, K., Iwabuchi, M., Stillman, B. and Araki, T. (2001). FASCIATA genes for chromatin assembly factor-1 in Arabidopsis maintain the cellular organization of apical meristems. Cell 104,131 -142.[CrossRef][Medline]
Kerstetter, R., Vollbrecht, E., Lowe, B., Veit, B., Yamaguchi,
J. and Hake, S. (1994). Sequence analysis and expression
patterns divide the maize knotted1-like homeobox genes into two
classes. Plant Cell 6,1877
-1887.
Kidner, C. A., Timmermans, M. C. P., Byrne, M. E. and Martienssen, R. A. (2002). Developmental genetics of the angiosperm leaf. In Advances in Botanical Research: Volume 38 (ed. J. A. Callow), pp. 191-234. London: Academic Press.
Klar, A. J. S. (2002). Fibonacci's flowers. Nature 417,595 .[CrossRef][Medline]
Kohalmi, S. E., Nowak, J. and Crosby, W. L. (1997). A practical guide to using the yeast 2-hybrid system. In Differentially Expressed Genes in Plants: A Bench Manual (ed. E. Hansen and G. Harper), pp.63 -82. London: Taylor and Francis.
Leyser, H. M. O. and Furner, I. J. (1992). Characterisation of three shoot apical meristem mutants of Arabidopsis thaliana. Development 116,397 -403.
Li, H., Shen, J.-J., Zheng, Z.-L., Lin, Y. and Yang, Z.
(2001). The Rop GTPase switch controls multiple developmental
processes in Arabidopsis. Plant Physiol.
126,670
-684.
Lincoln, C., Britton, J. H. and Estelle, M.
(1990). Growth and development of the axr1 mutants of
Arabidopsis. Plant Cell
2,1071
-1080.
Lincoln, C., Long, J., Yamaguchi, J., Serikawa, K. and Hake,
S. (1994). A knotted1-like homeobox gene in
Arabidopsis is expressed in the vegetative meristem and dramatically alters
leaf morphology when overexpressed in transgenic plants. Plant
Cell 6,1859
-1876.
Liu, Y. G., Mitsukawa, N., Oosumi, T. and Whittier, R. F. (1995). Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J. 8,457 -463.[CrossRef][Medline]
Long, J. A. and Barton, M. K. (1998). The development of apical embryonic pattern in Arabidopsis. Development 125,3027 -3035.[Abstract]
Long, J. A., Moan, E. I., Medford, J. I. and Barton, M. K. (1996). A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379,66 -69.[CrossRef][Medline]
Lynn, K., Fernandez, A., Aida, M., Sedbrook, J., Tasaka, M., Masson, P. and Barton, M. K. (1999). The PINHEAD/ZWILLE gene acts pleiotropically in Arabidopsis development and has overlapping functions with the ARGONAUTE1 gene. Development 126,469 -481.[Abstract]
Mann, R. S. and Chan, S.-K. (1996). Extra specificity from extradenticle: the partnership between HOX and PBX/EXD homeodomain proteins. Trends Genet. 12,258 -262.[CrossRef][Medline]
Modrusan, Z., Reiser, L., Feldmann, K. A., Fischer, R. L. and Haughn, G. W. (1994). Homeotic transformation of ovules into carpel-like structures in Arabidopsis. Plant Cell 6, 333-349.[Abstract]
Moussian, B., Schoof, H., Haecker, A., Jurgens, G. and Laux, T. (1998). Role of the ZWILLE gene in the regulation of central shoot meristem cell fate during Arabidopsis embryogenesis. EMBO J. 17,1799 -1809.[CrossRef][Medline]
Müller, J., Wang, Y., Franzen, R., Santi, L., Salamini, F. and Rohde, W. (2001). In vitro interactions between barley TALE homeodomain proteins suggest a role for protein-protein associations in the regulation of Knox gene function. Plant J. 27,13 -23.[CrossRef][Medline]
Ori, N., Eshed, Y., Chuck, G., Bowman, J. L. and Hake, S. (2000). Mechanisms that control knox gene expression in the Arabidopsis shoot. Development 127,5523 -5532.[Abstract]
Pautot, V., Dockx, J., Hamanta, O., Kronenbergera, J.,
Grandjeanc, O., Jublota, D. and Traas, J. (2001).
KNAT2: Evidence for a link between Knotted-like genes and carpel
development. Plant Cell
13,1719
-1734.
Pien, S., Wyrzykowska, J., McQueen-Mason, S., Smart, C. and
Fleming, A. (2001). Local expression of expansin induces the
entire process of leaf development and modifies leaf shape. Proc.
Natl. Acad. Sci. USA 98,11812
-11817.
Prigge, M. J. and Wagner, D. R. (2001). The
Arabidopsis SERRATE gene encodes a zinc-finger protein required for
normal shoot development. Plant Cell
13,1263
-1279.
Reinhardt, D., Mandel, T. and Kuhlemeier, C.
(2000). Auxin regulates the initiation and radial position of
plant lateral organs. Plant Cell
12,507
-518.
Reinhardt, D., Witter, F., Mandel, T. and Kuhlemeier, C.
(1998). Localized upregulation of a new expansin gene predicts
the site of leaf formation in the tomato meristem. Plant
Cell 10,1427
-1437.
Reiser, L., Modrusan, Z., Margossian, L., Samach, A., Ohad, N., Haughn, G. W. and Fischer, R. L. (1995). The BELL1 gene encodes a homeodomain protein involved in pattern formation in the Arabidopsis ovule primordium. Cell 83,735 -742.[CrossRef][Medline]
Reiser, L., Sanchez-Baracaldo, P. and Hake, S. (2000). Knots in the family tree: evolutionary relationships and functions of knox homeobox genes. Plant Mol. Biol. 42,151 -166.[CrossRef][Medline]
Richards, F. J. (1951). Phyllotaxis: its quantitative expression and relation to growth in the apex. Philos. Trans. R. Soc. Lond. 235,509 -564.
Robinson-Beers, K., Pruitt, R. E. and Gasser, C. S.
(1992). Ovule development in wild-type Arabidopsis and two
female-sterile mutants. Plant Cell
4,1237
-1249.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Press.
Schiestl, R. H., Manivasakam, P., Woods, R. A. and Gietz, R. D. (1993). Introducing DNA into yeast by transformation. Methods: A companion to methods in enzymology 5, 7 9-85.
Semiarti, E., Ueno, Y., Tsukaya, H., Iwakawa, H., Machida, C. and Machida, Y. (2001). The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana regulates formation of a symmetric lamina, establishment of venation and repression of meristem-related homeobox genes in leaves. Development 128,1771 -1783.[Abstract]
Shuai, B., Reynaga-Pena, C. G. and Springer, P. S.
(2002). The LATERAL ORGAN BOUNDARIES gene defines a
novel, plant-specific gene family. Plant Physiol.
129,747
-761.
Smith, H. M., Boschke, I. and Hake, S. (2002).
Selective interaction of plant homeodomain proteins mediates high DNA-binding
affinity. Proc. Natl. Acad. Sci. USA
99,9579
-9584.
Snow, M. and Snow, R. (1931). Experiments on phyllotaxis I. The effect of isolating a primordium. Philos. Trans. R. Soc. Lond. B221,1 -43.
Springer, P. S., McCombie, W. R., Sundaresan, V. and
Martienssen, R. A. (1995). Gene trap tagging of
PROLIFERA, an essential MCM2-3-5-like gene in
Arabidopsis. Science
268,877
-880.
Steeves, T. A. and Sussex, I. M. (1989). Patterns in Plant Development. Cambridge: Cambridge University Press.
Sundaresan, V., Springer, P., Volpe, T., Haward, S., Jones, J.
D. G., Dean, C., Ma, H. and Martienssen, R. (1995). Patterns
of gene action in plant development revealed by enhancer trap and gene trap
transposable elements. Genes Dev.
9,1797
-1810.
Takahashi, T., Matsuhara, S., Abe, M. and Komeda, Y.
(2002). Disruption of a DNA topoisomerase I gene affects
morphogenesis in Arabidopsis. Plant Cell
14,2085
-2093.
The Arabidopsis Genome Initiative (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408,796 -815.[CrossRef][Medline]
Timmermans, M. C., Hudson, A., Becraft, P. W. and Nelson, T.
(1999). ROUGH SHEATH2: a Myb protein that represses knox homeobox
genes in maize lateral organ primordia. Science
284,151
-153.
Tsiantis, M., Schneeberger, R., Golz, J. F., Freeling, M. and
Langdale, J. A. (1999). The maize rough sheath2 gene
and leaf development programs in monocot and dicot plants.
Science 284,154
-156.
Veit, B., Briggs, S. P., Schmidt, R. J., Yanofsky, M. F. and Hake, S. (1998). Regulation of leaf initiation by the terminal ear 1 gene of maize. Nature 393,166 -168.[CrossRef][Medline]
Venglat, P., Dumonceaux, T., Parnell, L., Rozwadowski, K.,
Babic, V., Keller, W., Martienssen, R. A., Selvaraj, G. and Datla, R.
(2002). The Arabidopsis BREVIPEDICELLUS gene is an
important regulator of pedicel and internode development. Proc.
Natl. Acad. Sci. USA 99,4730
-4735.
Vernoux, T., Kronenberger, J., Grandjean, O., Laufs, P. and Traas, J. (2000). PIN-FORMED 1 regulates cell fate at the periphery of the shoot apical meristem. Development 127,5157 -5165.[Abstract]
Vollbrecht, E., Reiser, L. and Hake, S. (2000). Shoot meristem size is dependent on inbred background and presence of the maize homeobox gene, knotted1. Development 127,3161 -3172.[Abstract]
Vollbrecht, E., Veit, B., Sinha, N. and Hake, S. (1991). The developmental gene Knotted-1 is a member of a maize homeobox gene family. Nature 350,241 -243.[CrossRef][Medline]
Vongs, A., Kakutani, T., Martienssen, R. A. and Richards, E.
J. (1993). Arabidopsis thaliana DNA methylation
mutants. Science 260,1926
-1928.
This article has been cited by other articles:
![]() |
V. Pinon, J. P. Etchells, P. Rossignol, S. A. Collier, J. M. Arroyo, R. A. Martienssen, and M. E. Byrne Three PIGGYBACK genes that specifically influence leaf patterning encode ribosomal proteins Development, April 1, 2008; 135(7): 1315 - 1324. [Abstract] [Full Text] [PDF] |
||||