|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online July 21, 2003
doi: 10.1242/10.1242/dev.00595

National Creative Research Initiatives Center for Cell Growth Regulation and Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Taejon 305-701, Korea
Author for correspondence (e-mail:
jchung{at}mail.kaist.ac.kr)
Accepted 12 May 2003
| SUMMARY |
|---|
|
|
|---|
Key words: blistery, Drosophila, Integrin, JNK, Tensin, Wing blister
| INTRODUCTION |
|---|
|
|
|---|
Tensin is best known as an adaptor protein linking integrin to the actin
cytoskeleton. Integrins are a family of the transmembrane receptors that are
localized in focal adhesions (Hynes,
1992
). The extracellular domain of integrin interacts with the
extracellular matrix, and its cytoplasmic domain anchors actin filaments to
the plasma membrane through the focal adhesion protein complex
(Burridge et al., 1988
;
Hynes, 1992
;
Lo et al., 1994a
;
Jockusch et al., 1995
).
Integrin is also believed to participate in diverse biological events such as
cytoskeletal restructuring, cell motility and even cell survival via focal
adhesion complexes that include tensin, focal adhesion kinase (FAK), Src
kinase and protein kinase C (Burridge et
al., 1988
; Schwartz et al.,
1995
; Giancotti and Ruoslahti,
1999
). Most interestingly, integrin is involved in various cell
signaling pathways through its association with focal adhesion proteins. For
example, integrin activates ERKMAP kinase by promoting the SH2 domain-mediated
association of Grb2 with tyrosine kinases such as FAK and c-Src in focal
adhesions (Schlaepfer et al.,
1994
). The phosphoinositide 3 kinase (PI3K)-dependent signaling
pathway is also activated by integrin through FAK-dependent mechanism
(Chen and Guan, 1994
;
Shaw et al., 1997
;
Reiske et al., 1999
). In
addition, several reports have demonstrated that JNK is also activated by
integrins when cells are attached to the extracellular matrix
(Miranti et al., 1998
;
Oktay et al., 1999
).
The role of tensin as an adaptor for integrin and as a required component
in focal adhesions suggests the possibility that it may act as a mediator of
integrin signaling. In support of this idea, much indirect and direct evidence
has been collected. Previously, the SH2 and PTB domains in the C terminus of
tensin have been demonstrated to bind tyrosine phosphorylated proteins such as
PI3K and p130 CAS (Salgia et al.,
1995
; Salgia et al.,
1996
; Auger et al.,
1996
). In addition, tensin itself is phosphorylated at serine,
threonine and tyrosine residues when cells are stimulated by either cell
adhesion (Bockholt and Burridge,
1993
), growth factors (Jiang
et al., 1996
) or oncogenes, including v-Src and Bcr/Abl
(Davis et al., 1991
;
Salgia et al., 1995
). Indeed,
a recent study has shown that overexpression of tensin alone can activate JNK
in human embryonic kidney 293T cells (Katz
et al., 2000
). According to this report, the tensin-mediated JNK
activities are independent of the activities of small GTP-binding proteins
such as Rac and Cdc42, but dependent on the activity of SEK
(Katz et al., 2000
).
In the present study, we have shown that by, one of the previously reported genes to result in a blistered wing phenotype when disrupted, encodes the Drosophila ortholog of mammalian tensins, and with the by mutants, we were able to characterize the functions of tensin in vivo. The blistered wing phenotype of the by loss-of-function flies was demonstrated to be caused by a defective wing unfolding process after eclosion. Additionally, using a genetic approach and immunohistochemistry, we have shown that tensin functionally interacts with integrin and the JNK signaling pathway. Our results demonstrate the in vivo roles of tensin in development and suggest that tensin might be a transducer of signals from integrin to the JNK signaling pathway.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The blistery mutants
The blistery mutant by2 is a P-element
insertion line. The by2 line was isolated accidentally
during the generation of UAS lines of a Drosophila EST clone,
SD01679. Of many UAS lines generated, this line was distinct from others,
showing a blistered wing phenotype and partial sterility for the females. At
first, these features made us speculate that they were caused by the inserted
transgene, but as other transgenic lines of the EST inserted at other loci did
not display the same phenotype, and the imprecise excision lines also showed
the same phenotype as their original line, we concluded that the phenotype was
the outcome of a gene disruption caused by the inserted P-element. The
identity of the disrupted gene was revealed by performing inverse-PCR and
sequencing the regions flanking the P-element. The P-element insertion site in
this line was 28 bp upstream of the by open reading frame (ORF),
which encodes Drosophila tensin protein, and this mutant line was
thus named by2. P-element excision alleles were generated
as Horowitz and Berg performed previously
(Horowitz and Berg, 1995
),
except that TMS
2-3 was used as the transposase source and
white was a background mutation. The molecular characterization of
each mutant line was performed by genomic DNA polymerase chain reactions
(PCR). We generated six revertants and two excision alleles of
by2 from a P-element excision experiment. In
byex49, one of the imprecise excision alleles, 3.56 kb of
genomic region including most of by exon was deleted, and in the
other imprecise excision line, byex10, 1.1 kb fragment of
the original P-element remained in the 5' upstream of the by
locus (Fig. 3A).
|
N: amino acids
1-450 deleted,
C: amino acids 451-720 deleted,
PTB: amino acids
567-720 deleted) were each subcloned into separate pUAST vectors. Standard
procedures for the egg injection were used for the transformation of
Drosophila (Ashburner,
1989
Northern blot analyses
Total RNA, extracted by the easy-BlueTM system (Intron, Korea),
was separated by electrophoresis on denaturing formaldehyde agarose gels in
MOPS buffer, transferred onto a nylon membrane, and successively hybridized
with nick-translated 32P-labeled cDNA probe. The probe was made
with the PCR product that corresponds to the 3' region of the
by amplified with the primers
(5'GGTGTCCGCCGATTCCGTACAATTT3' for 5' and
5'GGCCCGCACCGGTGGTAC3' for 3'). Hybridized probes were
visualized by autoradiography.
RT-PCR and RNA in situ hybridizations
For RT-PCR, total RNA was isolated from wild-type and the by
mutant adult flies using the easy-BlueTM system (Intron, Korea),
and reverse transcribed into cDNA. PCR was performed with the by
primers. One set of PCR primers (5'ATGCGGACGCCGTACGAAGAAAG3' for
5' and 5'CACATTCGTATTCGTTGGCC3' for 3') was designed
to amplify the 5' portion of by (designated as `a' in
Fig. 6A), and the other set
(5'ATGCGTCACTTCCTCATCGAG3' for 5' and
5'CGAGGAGACCTTGAAGTGCAC3' for 3') was prepared to amplify
the 3' region of by (designated as `b' in
Fig. 6A).
|
Histochemical analyses
Drosophila wing imaginal discs were dissected and fixed in 4%
paraformaldehyde in phosphate-buffered saline (PBS). They were then washed in
PBST (PBS + 0.1% Tween 20) and blocked in PBST with 3% bovine serum albumin.
The samples were incubated overnight at 4°C with either anti-beta PS
integrin mouse antibody [1:200 dilution; a gift from Dr D. L. Brower
(University of Arizona, Tucson, AZ)] or anti-phosphospecific JNK rabbit
antibody (1:200 dilution; Promega, WI). Next, the samples were further
incubated for 4 hours at room temperature in either FITC-labeled anti-mouse
secondary antibody (1:200 dilution; Sigma, MO) or HRP-conjugated anti-rabbit
IgG secondary antibody (1:200 dilution; Molecular Probes, OR), and analyzed
using an LSM510 laser confocal microscope (Carl Zeiss, Germany). Alexa Fluor
568 tyramide (Molecular Probes, OR) was used as a substrate for HRP-conjugated
anti-rabbit IgG secondary antibody. In order to visualize the actin structure,
pupal wing discs were stained with phalloidin-TRITC (Sigma, MO) for 20
minutes. For Acridine Orange (Sigma, MO) staining, third-instar larval wing
discs were dissected in PBS and incubated for 5 minutes in 1.6 µM Acridine
Orange-PBS solution. The samples were observed by a confocal microscope (Carl
Zeiss, Germany).
| RESULTS |
|---|
|
|
|---|
|
Next, we decided to investigate the in vivo function of Drosophila tensin using genetic approaches. As described in the Materials and Methods, we found one P-element insertion line, by2, containing a P-element in the 5' flanking sequence of the Drosophila tensin open reading frame (Fig. 1A). To examine whether the P-element insertion in by2 hampers the transcription of Drosophila tensin, we performed RT-PCR, which showed highly reduced Drosophila tensin expression level in the whole body (Fig. 3C). In addition to by2, six revertants and two imprecise excision alleles of by2 were generated as described in the Materials and Methods. These newly obtained mutants were verified by genomic PCR and subsequent sequencing analyses. The expression levels of Drosophila tensin in these lines were also examined by RT-PCR. The transcript levels of Drosophila tensin were completely normal in the revertant lines (data not shown) compared with wild type. By contrast, Drosophila tensin expression was highly reduced or completely missing in the imprecise excision alleles (Fig. 3C).
Drosophila tensin mutants display a blistered wing
phenotype
Homozygous but not heterozygous by2 mutant flies showed
blisters in their wings (Fig.
2A). To see whether this phenotype is related to
Drosophila tensin expression, in situ hybridization was performed in
wing imaginal discs. As shown in Fig.
1D, Drosophila tensin expression was dramatically reduced
in the by2 mutants
(Fig. 1D, right panel) compared
with the control (Fig. 1D, left
panel). Interestingly, the Drosophila tensin transcript was highly
enriched in the wing pouch (Fig.
1D, left panel). We confirmed that the blistered wing phenotype
was indeed caused by a deficiency in Drosophila tensin expression, by
generating transgenic flies specifically overexpressing Drosophila
tensin within a homozygotic by2 genetic background.
Ectopic expression of full-length Drosophila tensin in wing imaginal
discs dramatically rescued the wing blister phenotype of
by2 (Fig.
2B). Moreover, two additional Drosophila tensin
loss-of-function alleles, byex10
(Fig. 2C) and
byex49 (data not shown) failed to complement the blistered
wing phenotype of the by2 mutants. However,
byrv8, one of the revertants, fully complemented the
by2 mutation (Fig.
2D). These results unequivocally demonstrate that the blistered
wing phenotype in the Drosophila tensin mutants is due to a defect in
Drosophila tensin function.
|
Significantly, the transheterozygotic alleles of by1 and by2 failed to complement each other's blistered wing phenotype (Fig. 2F), implying that they are alleles of the same gene. Consistently, byex10 and byex49 also failed to complement the blistered wing phenotype of by1 (data not shown).
To further confirm that the Drosophila tensin mutants are allelic to by, we sequenced the Drosophila tensin locus in the by1 mutants. As expected, we found that by1 allele contains two missense point mutations that convert tyrosine 62 and threonine 163 to asparagine (Y62N) and arginine (T163R) in tensin, respectively (Fig. 3A). Therefore, we conclude that our Drosophila tensin mutants and by1 are different alleles of by, and hereafter we refer to Drosophila tensin as by.
The severity of the blistered wing phenotype varies depending on by
expression levels
The by mutant flies exhibited a blistered wing phenotype with
varying degrees of severity, which can be classified into three groups; normal
wing, class I wing which contains a small blister (< 1/4 size of the total
wing area) within a restricted region, and class II wing with a large blister
(> 1/4 size of the total wing area) resulting in a crumpled wing phenotype
(Fig. 3B). We determined the
severity of the wing blister phenotype by measuring the frequency of each wing
class. By comparing the severity in various mutants
(Fig. 3B) and their by
expression levels (Fig. 3C), we
found that the severity of wing blisters is closely related to the level of
the by transcript. For example, a relatively mild phenotype of the
byex10 mutants can be explained by higher expression of
by than the other by mutants.
Besides the blistered wing phenotype, the by mutants exhibited reduced hatching rate of laid eggs (Fig. 3D). The hatching rate of the mutant eggs was reduced to about 60% of wild type, while the survival rate of mutants after hatching was not significantly affected (Fig. 3D). These results demonstrate that tensin plays important roles during Drosophila early development as well. Our unpublished data suggest that the impairment in egg hatching is resulted from defective fertilization, therefore the by mutants are homozygous viable with decreased fertility.
The blistered wing phenotype is resulted from a defective wing
unfolding process after eclosion
Drosophila wing development after pupariation (AP) consists of two
distinct stages: prepupal and pupal wing morphogenesis
(Fristrom et al., 1993
;
Fristrom et al., 1994
). And
pupal wing morphogenesis is further divided into three stages: separation
(11-12 hours AP) of the ventral cell layer from the dorsal layer,
re-apposition of the inter-vein cells (21-36 hours AP) and re-separation (60
hours AP) of the two cell layers. Shortly after eclosion, wings expand and
unfold by an influx of hemolymph. According to a previous report, PS integrins
are required for the attachment of the two wing surfaces during pupal wing
re-apposition and for the maintenance of the wing bilayer
(Brabant et al., 1996
).
To determine the detailed roles of tensin during wing morphogenesis, we examined the pupal wings of the by2 flies. As shown in Fig. 4, we were not able to observe any differences in the attachment of two wing surfaces (Fig. 4A-H) and in the integrin localization (Fig. 4I-L) between wild type (Fig. 4, left panels) and by2 (Fig. 4, right panels) wings during both prepupal apposition (4-6 hours AP, Fig. 4A-D) and pupal reapposition stages (30-36 hours AP, Fig. 4E-L).
|
|
The N-terminal region and the SH2 domain of tensin play a role in the
attachment of the two wing surfaces
We examined the functional significance of each domain of tensin in normal
wing development. We have generated UAS lines overexpressing either
full-length tensin protein or various deletion mutant forms of tensin as shown
in Fig. 6A. The ectopic
expression of each transgene in the wing imaginal discs by MS1096-GAL4 driver
was confirmed by RT-PCR (Fig.
6B). Unlike
N (Fig.
6D) and
C (Fig.
6E), overexpression of
PTB by MS1096-GAL4 driver completely
rescued the blistered wing phenotype of by2
(Fig. 6C). These data suggest
that both the N-terminal region and the SH2 domain of tensin are required for
proper attachment of two wing surfaces.
Tensin genetically interacts with integrin
As mammalian tensin is known to participate in the integrin signaling
(Zamir and Geiger, 2001
), we
have examined whether tensin genetically interacts with integrin. As expected,
the blistered wing phenotype became more severe in the
if3; by2/+ mutants
(Fig. 7C) and extremely severe
in the double homozygotic mutants for if3 and
by2 (Fig.
7D), compared with if3 homozygotes
(Fig. 7A) or
by2 heterozygotes (Fig.
7B). In addition, the rate of flies showing blistered wings in the
total population greatly increased in the double mutants
(Table 1).
|
|
Tensin genetically interacts with the JNK signaling pathway
In mammalian cells, tensin has been implicated in signal transduction
related to cell adhesion such as Src, JNK and PI3K
(Thomas et al., 1995
;
Auger et al., 1996
;
Katz et al., 2000
). To examine
the role of tensin in the signaling processes related to wing development, we
investigated the in vivo interaction between tensin and signaling molecules
including rl/Erk, Src, JNK and PI3K. Interestingly, we found that the JNK
signaling pathway is tightly correlated with tensin in the wing development
(Fig. 8), while other signaling
molecules including rl/Erk did not show any interactions with tensin
(Fig. 8I,J, and data not
shown). Homozygous by2 mutants with heterozygotic
mutations of the JNK signaling components bsk1
(Fig. 8B,
Table 1) or
hep1 (Fig.
8E,F, Table 1) (the
loss-of-function mutants for Drosophila JNK and MKK7,
respectively) displayed a highly severe blistered wing phenotype compared with
either homozygous by2
(Fig. 2A,
Table 1), heterozygous
bsk1 (Fig.
8A, Table 1) or
heterozygous hep1 (Fig.
8D, Table 1)
mutants. Notably, the rate of flies, which showed Class II blistered wings,
increased from 46.5% to 70% for these double mutants compared with homozygous
by2 mutants, and about 15% of these flies had multiple
blisters in their wings. Furthermore, the double homozygotic mutants for
by2 and hep1 died at pharate adult
stage (Fig. 8C). The lethality
of these double mutants may be due to an impairment of essential in vivo
interactions between tensin and the JNK signaling pathway in
Drosophila.
|
Overexpression of by induces the activation of JNK and
ectopic apoptosis
To further confirm the genetic interaction between tensin and the JNK
pathway, we measured the effect of tensin in JNK activity in vivo. We examined
the extent of JNK phosphorylation using anti-phosphospecific JNK antibody in
the by overexpression line and the by2 mutants.
As expected, JNK phosphorylation was dramatically increased in the wing
imaginal discs overexpressing by
(Fig. 9C) compared with the
control (Fig. 9A), which
directly demonstrated increased JNK activity by by. On the contrary,
JNK phosphorylation in the imaginal discs of the by2
mutants was reduced (Fig. 9B)
compared with the control (Fig.
9A).
|
| DISCUSSION |
|---|
|
|
|---|
The N-terminal region of tensin is responsible for the wing blister phenotype of the by mutants
Our current data demonstrate that by1 allele contains
two missense mutations in the N-terminal region of tensin, and that the
expression of by is not affected in the by1
mutants compared with the wild-type control
(Fig. 3C). Because the severity
of the wing blister phenotype in by1 was not significantly
different from the by-deficient mutants such as
by2 and byex49
(Fig. 3B), and the ectopic
expression of
N form of tensin did not rescue the blistered wing
phenotype of by2 (Fig.
6), we think that the mutations in the N-terminal region of
Drosophila tensin including tyrosine 62 and threonine 163 are
responsible for the wing blister phenotype.
However, as Tyr62 and Thr163 are not conserved in other tensins, and there is no information for unmutagenized parental chromosomes of by1, further studies are required to verify the exact nature of by1 mutations, and to address the molecular mechanism underlying how mutations of by1 allele affect the cellular functions of tensin.
Tensin cooperates with integrin for the proper attachment of wing
epithelia
During Drosophila wing development, the dorsal and ventral wing
epithelia are fused together by highly specified cell-cell adhesions, and
defects in this process result in blistered wings. Therefore, the blistered
wing phenotype observed in the by mutants indicates that tensin
functions in such a cell adhesion process.
In Drosophila, integrin is well known as a central molecule that
mediates adhesion between wing layers. Previous studies have shown that the
loss of PS integrin function in the wings causes the formation of a
fluid-filled blister (Brower and Jaffe,
1989
; Wilcox et al.,
1989
; Brabant and Brower,
1993
; Brown et al.,
2000
). Moreover, the loss of adaptor proteins such as short
stop (Prout et al., 1997
)
and integrin-linked kinase
(Zervas et al., 2001
) that
mediate attachment of extracellular matrix (ECM)-integrin complexes to
cytoskeleton also result in a wing blister phenotype, implying that integrin
and its adaptor protein complexes are indispensable in wing layer adhesion.
Because tensin is a major component of the ECM-integrin complex, and the wing
blister phenotype of an integrin mutant was dramatically enhanced by
additional loss of by in this study
(Fig. 7 and
Table 1) we believe that
improperly mediated integrin signaling caused by the loss of tensin results in
the wing blister phenotype in the by mutants. This idea is supported
by previous mammalian cell studies showing that tensin acts as a molecular
linker between actin cytoskeleton and integrin
(Zamir and Geiger, 2001
), and
plays a crucial function when integrin translocates from focal adhesions to
fibrillar adhesions (Pankov et al.,
2000
).
Besides the defects in wing cell adhesion process, we observed another
distinct mutant phenotype in the by mutants; they laid rounded eggs
due to defective oocyte elongation during oogenesis (K.S.C., unpublished). Our
unpublished genetics data suggest the possibility of a functional interaction
between tensin and integrin during oogenesis. Interestingly, a similar
phenotype has been reported recently in the studies with follicle cell clones
lacking PS integrin (Bateman et al.,
2001
).
Taken together, above findings suggest that tensin and integrins are tightly linked together during most, if not all, of their various functions in Drosophila development.
Tensin regulates JNK activity during wing development
In this study, tensin was observed to genetically interact with the
components of the JNK signaling pathway, and regulate JNK activity during wing
development (Figs 8,
9). The supporting evidence for
the engagement of tensin in the JNK signaling pathway comes from a recent
report that transfected mammalian tensin activates JNK signaling in HEK 293T
cells (Katz et al., 2000
).
Interestingly, in mammalian cells, JNK is also activated via adaptor
proteins p130 CAS and Crk which receive a signal from the FAK/Src tyrosine
kinase complex in the cell adhesion sites when cells attach to the ECM
(Oktay et al., 1999
). As
tensin is a possible substrate for FAK
(Guan, 1997
), and p130 CAS is
able to interact with the C terminus of tensin
(Salgia et al., 1995
;
Salgia et al., 1996
), it is
highly possible that tensin is involved in this signaling cascade and mediates
signals from integrin and FAK to the JNK signaling pathway.
In addition, tensin was observed not to genetically interact with other signaling pathways known to interact with integrins such as the ERK-MAPK (Fig. 8) and the PI3K signaling pathways (data not shown). As previously mentioned, integrin signaling is mediated mainly by protein complexes including tensin in focal adhesions. Thus, we think that focal adhesion molecules related to integrin such as tensin are important for directing integrin mediated extracellular signals to a specific signaling pathway. Consequently, we tentatively suggest that at least during Drosophila wing development, tensin has an ability to drive signals from integrin selectively to the JNK signaling pathway. However, further studies are required to confirm this hypothesis and determine the details behind the connection between focal adhesion proteins and related intracellular signaling.
In summary, we have characterized by mutant flies and analyzed the developmental roles of by specifically in wings. We found evidence for the functional interaction between integrin and tensin, and for the modulation of JNK signaling by tensin during Drosophila wing development. These results strongly suggest that tensin is not merely an adaptor protein in focal adhesions, but also an important mediator of signal transduction in Drosophila. Our Drosophila model will be useful in future studies that address the function of tensin as a signaling molecule.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Adachi-Yamada, T., Fujimura-Kamada, K., Nishida, Y. and Matsumoto, K. (1999). Distortion of proximodistal information causes JNK-dependent apoptosis in Drosophila wing. Nature 400,166 -169.[CrossRef][Medline]
Ashburner, M. (1989).Drosophila . Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Auger, K. R., Songyang, Z., Lo, S. H., Roberts, T. M. and Chen,
L. B. (1996). Platelet-derived growth factor-induced
formation of tensin and phosphoinositide 3-kinase complexes. J.
Biol. Chem. 271,23452
-23457.
Bateman, J., Reddy, R. S., Saito, H. and van Vactor, D. (2001). The receptor tyrosine phosphatase Dlar and integrins organize actin filaments in the Drosophila follicular epithelium. Curr. Biol. 11,1317 -1327.[CrossRef][Medline]
Bockholt, S. M. and Burridge, K. (1993). Cell
spreading on extracellular matrix proteins induces tyrosine phosphorylation of
tensin. J. Biol. Chem.
268,14565
-14567.
Brabant, M. C. and Brower, D. L. (1993). PS2 integrin requirements in Drosophila embryo and wing morphogenesis. Dev. Biol. 157, 49-59.[CrossRef][Medline]
Brabant, M. C., Fristrom, D., Bunch, T. A. and Brower, D. L. (1996). Distinct spatial and temporal functions for PS integrins during Drosophila wing morphogenesis. Development 122,3307 -3317.[Abstract]
Brower, D. L. and Jaffe, S. M. (1989). Requirement for integrins during Drosophila wing development. Nature 342,285 -287.[CrossRef][Medline]
Brown, N. H., Gregory, S. L. and Martin-Bermudo, M. D. (2000). Integrins as mediators of morphogenesis in Drosophila. Dev. Biol. 223, 1-16.[CrossRef][Medline]
Burridge, K., Fath, K., Kelly, T., Nuckolls, G. and Turner, C. (1988). Focal adhesions: transmembrane junctions between the extracellular matrix and the cytoskeleton. Annu. Rev. Cell Biol. 4,487 -525.[CrossRef][Medline]
Chen, H. C. and Guan, J. L. (1994). Stimulation
of phosphatidylinositol 3'-kinase association with focal adhesion kinase
by platelet-derived growth factor. J. Biol. Chem.
269,31229
-31233.
Chen, H., Ishii, A., Wong, W. K., Chen, L. B. and Lo, S. H. (2000). Molecular characterization of human tensin. Biochem. J. 351,403 -411.
Chen, H., Duncan, I. C., Bozorgchami, H. and Lo, S. H.
(2002). Tensin and a previously undocumented family member,
tensin2, positively regulate cell migration. Proc. Natl. Acad. Sci.
USA 99,733
-738.
Cho, K. S., Lee, J. H., Kim, S., Kim, D., Koh, H., Lee, J., Kim,
C., Kim, J. and Chung, J. (2001). Drosophila
phosphoinositide-dependent kinase-1 regulates apoptosis and growth via the
phosphoinositide 3-kinase-dependent signaling pathway. Proc. Natl.
Acad. Sci. USA 98,6144
-6149.
Chuang, J. Z., Lin, D. C. and Lin, S. (1995).
Molecular cloning, expression, and mapping of the high affinity actin-capping
domain of chicken cardiac tensin. J. Cell Biol.
128,1095
-1109.
Davis, S., Lu, M. L., Lo, S. H., Lin, S., Butler, J. A., Druker,
B. J., Roberts, T. M., An, Q. and Chen, L. B. (1991).
Presence of an SH2 domain in the actin-binding protein tensin.
Science 252,712
-715.
Fristrom, D., Wilcox, M. and Fristrom, J. (1993). The distribution of PS integrins, laminin A and F-actin during key stages in Drosophila wing development. Development 117,509 -523.[Abstract]
Fristrom, D., Gotwals, P., Eaton, S., Kornberg, T., Sturtevant,
M., Bier, E. and Fristrom, J. W. (1994). blistered:
a gene required for vein/intervein formation in wings of Drosophila.
Development 120,2661
-2671.
Giancotti, F. G. and Ruoslahti, E. (1999).
Integrin signaling. Science
285,1028
-1032.
Glass, H. B. (1934). New mutants report. Dros. Inf. Serv. 2,7 -8.
Goberdhan, D. C. and Wilson, C. (1998). JNK, cytoskeletal regulator and stress response kinase? A Drosophila perspective. BioEssay 20,1009 -1019.[CrossRef][Medline]
Guan, J. L. (1997). Focal adhesion kinase in integrin signaling. Matrix Biol. 16,195 -200.[CrossRef][Medline]
Horowitz, H. and Berg, C. A. (1995). Aberrant splicing and transcription termination caused by P-element insertion into the intron of a Drosophila gene. Genetics 139,327 -335.[Abstract]
Hynes, R. O. (1992). Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69, 11-25.[CrossRef][Medline]
Jockusch, B. M., Bubeck, P., Giehl, K., Kroemker, M., Moschner, J., Rothkege, M., Rudiger, M., Schluter, K., Stanke, G. and Winkler, J. (1995). The molecular architecture of focal adhesions. Annu. Rev. Cell Dev. Biol. 11,379 -416.[CrossRef][Medline]
Jiang, B., Yamamura, S., Nelson, P. R., Mureebe, L. and Kent, K. C. (1996). Differential effects of platelet-derived growth factor isotypes on human smooth muscle cell proliferation and migration are mediated by distinct signaling pathways. Surgery 120,427 -431.[CrossRef][Medline]
Katz, B. Z., Zohar, M., Teramoto, H., Matsumoto, K., Gutkind, J. S., Lin, D. C., Lin, S. and Yamada, K. M. (2000). Tensin can induce JNK and p38 activation. Biochem. Biophys. Res. Commun. 272,717 -720.[CrossRef][Medline]
Lo, S. H., Janmey, P. A., Hartwig, J. H. and Chen, L. B.
(1994a). Interactions of tensin with actin and identification of
its three distinct actin-binding domains. J. Cell
Biol. 125,1067
-1075.
Lo, S. H., An, Q., Bao, S., Wong, W. K., Liu, Y., Janmey, P. A.,
Hartwig, J. H. and Chen, L. B. (1994b). Molecular cloning of
chick cardiac muscle tensin. Full-length cDNA sequence, expression, and
characterization. J. Biol. Chem.
269,22310
-22319.
Miranti, C. K., Leng, L., Maschberger, P., Brugge, J. S. and Shattil, S. J. (1998). Identification of a novel integrin signaling pathway involving the kinase Syk and the guanine nucleotide exchange factor Vav1. Curr. Biol. 8,1289 -1299.[CrossRef][Medline]
Oktay, M., Wary, K. K., Dans, M., Birge, R. B. and Giancotti, F.
G. (1999). Integrin-mediated activation of focal adhesion
kinase is required for signaling to Jun NH2-terminal kinase and progression
through the G1 phase of the cell cycle. J. Cell Biol.
145,1461
-1469.
Pankov, R., Cukierman, E., Katz, B. Z., Matsumoto, K., Lin, D.
C., Lin, S., Hahn, C. and Yamada, K. M. (2000). Integrin
dynamics and matrix assembly: tensin-dependent translocation of
5ß1 integrins promotes early fibronectin
fibrillogenesis. J. Cell Biol.
148,1075
-1090.
Prout, M., Damania, Z., Soong, J., Fristrom, D. and Fristrom, J. W. (1997). Autosomal mutations affecting adhesion between wing surfaces in Drosophila melanogaster. Genetics 146,275 -285.[Abstract]
Reiske, H. R., Kao, S. C., Cary, L. A., Guan, J. L., Lai, J. F.
and Chen, H. C. (1999). Requirement of phosphatidylinositol
3-kinase in focal adhesion kinase-pormoted cell migration. J. Biol.
Chem. 274,12361
-12366.
Salgia, R., Brunkhorst, B., Pisick, E., Li, J. L., Lo, S. H., Chen, L. B. and Griffin, J. D. (1995). Increased tyrosine phosphorylation of focal adhesion proteins in myeloid cell lines expressing p210BCR/ABL. Oncogene 11,1149 -1155.[Medline]
Salgia, R., Pisick, E., Sattler, M., Li, J. L., Uemura, N.,
Wong, W. K., Burky, S. A., Hirai, H., Chen, L. B. and Griffin, J. D.
(1996). p130CAS forms a signaling complex with the adapter
protein CRKL in hematopoietic cells transformed by the BCR/ABL oncogene.
J. Biol. Chem. 271,25198
-25203.
Schlaepfer, D. D., Hanks, S. K., Hunter, T. and van der Geer, P. (1994). Integrin-mediated signal transduction linked to Ras pathway by GRB2 binding to focal adhesion kinase. Nature 372,786 -791.[Medline]
Schwartz, M. A., Schaller, M. D. and Ginsberg, M. H. (1995). Integrins: emerging paradigms of signal transduction. Annu. Rev. Cell Dev. Biol. 11,549 -599.[CrossRef][Medline]
Shaw, L. M., Rabinovitz, I., Wang, H. H., Toker, A. A. and Mercurio, A. M. (1997). Activation of phosphoinositide 3-OH kinase by the alpha6beta4 integrin promotes carcinoma invasion. Cell 91,949 -960.[CrossRef][Medline]
Thomas, S. M., Soriano, P. and Imamoto, A. (1995). Specific and redundant roles of Src and Fyn in organizing the cytoskeleton. Nature 376,267 -271.[CrossRef][Medline]
Walsh, E. P. and Brown, N. H. (1998). A screen
to identify Drosophila genes required for integrin-mediated adhesion.
Genetics 150,791
-805.
Wilcox, M., DiAntonio, A. and Leptin, M.
(1989). The function of PS integrins in Drosophila wing
morphogenesis. Development
107,891
-897.
Zamir, E. and Geiger, B. (2001). Molecular complexity and dynamics of cell-matrix adhesions. J. Cell Sci. 114,3583 -3590.
Zervas, C. G., Gregory, S. L. and Brown, N. H.
(2001). Drosophila integrin-linked kinase is required at
sites of integrin adhesion to link the cytoskeleton to the plasma membrane.
J. Cell Biol. 152,1007
-1018.
This article has been cited by other articles:
![]() |
L. Zhang, Y. Zhang, and K. G. T. Hagen A Mucin-type O-Glycosyltransferase Modulates Cell Adhesion during Drosophila Development J. Biol. Chem., December 5, 2008; 283(49): 34076 - 34086. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kirchner, S. Gross, D. Bennett, and L. Alphey The Nonmuscle Myosin Phosphatase PP1{beta} (flapwing) Negatively Regulates Jun N-Terminal Kinase in Wing Imaginal Discs of Drosophila Genetics, April 1, 2007; 175(4): 1741 - 1749. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Guichard, J. M. Park, B. Cruz-Moreno, M. Karin, and E. Bier From The Cover: Anthrax lethal factor and edema factor act on conserved targets in Drosophila PNAS, February 28, 2006; 103(9): 3244 - 3249. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Lee, J. Park, J. U. Jung, and J. Chung Nef induces apoptosis by activating JNK signaling pathway and inhibits NF-{kappa}B-dependent immune responses in Drosophila J. Cell Sci., May 1, 2005; 118(9): 1851 - 1859. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Grabbe, C. G. Zervas, T. Hunter, N. H. Brown, and R. H. Palmer Focal adhesion kinase is not required for integrin function or viability in Drosophila Development, December 1, 2004; 131(23): 5795 - 5805. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Huang, K. Jacobson, and M. D. Schaller MAP kinases and cell migration J. Cell Sci., September 15, 2004; 117(20): 4619 - 4628. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||