|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online July 21, 2003
doi: 10.1242/10.1242/dev.00611
Department of Biology, Duke University, Durham, NC 27708, USA
* Author for correspondence (e-mail: gwray{at}duke.edu)
Accepted 24 April 2003
| SUMMARY |
|---|
|
|
|---|
35 million years ago: the most proximal
region (module A) is conserved, but the remaining modules (B-G) are
unalignable. Despite extensive divergence in promoter sequences, the pattern
of Endo16 transcription is largely conserved during embryonic and
larval development. Transient expression assays demonstrate that 2.2 kb of
upstream sequence in either species is sufficient to drive GFP reporter
expression that correctly mimics this pattern of Endo16
transcription. Reciprocal cross-species transient expression assays imply that
changes have also evolved in the set of transcription factors that interact
with the Endo16 promoter. Taken together, these results suggest that
stabilizing selection on the transcriptional output may have operated to
maintain a similar pattern of Endo16 expression in S.
purpuratus and L. variegatus, despite dramatic divergence in
promoter sequence and mechanisms of transcriptional regulation.
Key words: Echinoderm, Endo16, Evolution, Promoter, Sea urchin, Transcription
| INTRODUCTION |
|---|
|
|
|---|
Studying the evolution of transcriptional regulation requires a system in
which one or more promoter sequences have been characterized in detail using
biochemical and functional approaches
(Wray et al., 2003
). Most
importantly, this system must be amenable to functional analysis of promoter
sequences in multiple, closely related species. To date, relatively few
studies have analyzed the functional consequence of evolutionary changes in
transcriptional regulation (Franks et al.,
1988
; Li and Noll,
1994
; Ludwig et al.,
1998
; Ludwig et al.,
2000
; Shashikant et al.,
1998
; Singh et al.,
1998
; Crawford et al.,
1999
; Takahashi et al.,
1999
; Shaw et al.,
2002
; Tumpel et al.,
2002
). In this regard, sea urchins provide an outstanding system
in which to study the evolution of transcriptional regulation. Eggs can be
obtained in large quantities and develop synchronously upon fertilization,
facilitating the collection of material for biochemical analyses. This has
enabled researchers to characterize several promoter sequences in exceptional
detail including CyIIIa (Calzone
et al., 1988
; Theze et al.,
1990
; Wang et al.,
1995
; Kirchhamer and Davidson,
1996
; Calzone et al.,
1997
; Coffman et al.,
1996
; Coffman et al.,
1997
) and Endo16 (Yuh
et al., 1994
; Yuh et al.,
1996
; Yuh and Davidson,
1996
; Yuh et al.,
1998
; Yuh et al.,
2001a
). Transient expression assays have proven remarkably
successful for functional analysis of these promoter sequences in multiple
species (reviewed by Kirchhamer et al.,
1996
). Moreover, the evolutionary history of sea urchins and other
echinoderms is well characterized, allowing for interpretation of data in a
phylogenetic context (Littlewood and
Smith, 1995
).
The Endo16 gene was originally isolated from
Strongylocentrotus purpuratus by screening a gastrula stage cDNA
library (Nocente-McGrath et al.,
1989
). In S. purpuratus, Endo16 is initially expressed
throughout the vegetal plate of the hatched blastula
(Nocente-McGrath et al., 1989
;
Ransick et al., 1993
).
Endo16 expression is downregulated in primary mesenchymal cells
(PMCs) as they migrate away from the center of the vegetal plate to form the
larval skeleton. During gastrulation, Endo16 is expressed throughout
the invaginating archenteron. Endo16 expression is then downregulated
in secondary mesenchymal cells (SMCs) as they migrate away from the anterior
tip of the archenteron to form various cell types, including pigment cells,
muscle cells and coelomocytes. At the end of gastrulation, Endo16
expression is downregulated in the anterior third of the archenteron, which
corresponds to the prospective foregut, as well as the posterior third of the
archenteron, which corresponds to the prospective hindgut. Endo16
expression thereby becomes restricted to the midgut of the pluteus larva.
Transient expression assays demonstrated that 2.2 kb of sequence
immediately upstream of the transcriptional start site is sufficient to drive
Endo16 expression (Yuh et al.,
1994
). Approximately 56 sites of specific DNA/protein interactions
were mapped within this 2.2 kb region (Yuh
et al., 1994
) (Fig.
1A). These binding sites are clustered into six functionally
distinct modules, which contribute in specific ways to the regulatory output
of the Endo16 promoter (Yuh et
al., 1996
; Yuh and Davidson,
1996
) (Fig. 1B).
The most proximal region of the promoter, module A, activates transcription in
the vegetal plate and archenteron. Module B acts synergistically with module A
to elevate levels of transcription in these regions. The activity of module A
declines during gastrulation, and module B is responsible for maintaining
Endo16 expression in the midgut of the pluteus larva. The binding
sites responsible for shifting the spatial control of Endo16
expression to module B have been identified
(Yuh et al., 2001a
)
(Fig. 1C). The most distal
region of the promoter, module G, acts synergistically with modules A and B to
increase the rate of transcription by
4.2-fold throughout embryonic and
larval development. Modules DC, E and F serve to confine Endo16
expression to the endoderm: module DC represses transcription in PMCs, while
modules E and F repress transcription in ectoderm adjacent to the vegetal
plate. Finally, module A serves to communicate the integrated output of all
modules to the basal promoter.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Isolation of full-length LvEndo16 cDNA
RNA was isolated from gastrula-stage embryos using RNA STAT-60 (Tel-Test
"B", Friendswood, TX) and treated with DNase (Gibco BRL,
Gaithersburg, MD). Reverse transcription (RT) was performed according to the
instructions provided by the SuperScript Reverse Transcription kit (Gibco
BRL). After the addition of a poly(A) tail, the cDNA was used to perform
5' and 3' RACE PCR. Primers were based on a partial cDNA sequence
previously reported by Godin et al. (Godin
et al., 1997
) (GenBank Accession Number U89340). PCR products
obtained by 5' and 3' RACE PCR were gel purified and ligated into
pGEM-T vector (Promega, Madison, WI). Plasmid DNA was purified from
transformed DH5
cells (Gibco BRL) and sequenced using an ABI Prism 3700
DNA Analyzer (PE Applied Biosystems, Foster City, CA). Sequences were
assembled using Sequencher software (Gene Codes, Ann Arbor, MI).
Whole-mount in situ hybridization
Antisense and sense RNA probes were synthesized according to the
instructions provided by the DIG RNA Labeling Kit (SP6/T7) (Roche,
Indianapolis, IN) and stored in hybridization buffer (50 ng/µl) at
-70°C. Sea urchin embryos were cultured to various stages of development
and fixed for 2 hours in a solution containing 2.5% glutaraldehyde, 0.14 M
NaCl and 0.2 M phosphate buffer, pH 7.4. The embryos were rinsed twice for
15 minutes with buffer containing 0.3 M NaCl and 0.2 M phosphate buffer,
pH 7.4, and dehydrated through 70% ethanol. Whole-mount in situ hybridization
was performed using a protocol based on that of Zhu et al.
(Zhu et al., 2001
) with
several modifications. One important modification was extending the incubation
with PBST containing 5% sheep serum to
16 hours at 4°C. Images were
recorded using a SPOT camera (Diagnostic Instruments, Sterling Heights,
MI).
Isolation of LvEndo16 promoter and intron 1
Genomic DNA was isolated from sperm by phenol-chloroform extraction
followed by ethanol precipitation. LvEndo16 promoter sequence was
obtained according to the instructions provided by the Universal GenomeWalker
Kit (Clontech, Palo Alto, CA). In order to extend as far as 2.2 kb upstream of
the transcriptional start site, three DNA walks were performed. Two rounds of
amplification were performed for each DNA walk using nested primer pairs. Each
promoter fragment was cloned and sequenced as described above. It is important
to note that the promoter fragments overlapped by at least 50-100 bp. A 2337
bp sequence was assembled from overlapping fragments using Sequencher
software. LvEndo16 intron sequence was amplified by PCR using primers
flanking the position at which the first intron was predicted to occur based
on the S. purpuratus sequence (GenBank Accession Number L34680). The
sequence of the 5' primer was 5' AATGCGGAAGGAACTTTTTTGCTT and of
the 3' primer was 5' GAAAGATCAAAGTCGGGAATCAT. The 468 bp product
was cloned and sequenced as described above.
Sequences were aligned by ClustalX using default parameters
(Thompson et al., 1997
). This
alignment was not significantly improved by reducing the gap penalty. Sequence
similarity was calculated as the frequency of matching nucleotides for various
regions of the Endo16 locus, excluding indels (insertions and
deletions). At the present time, there are no generally accepted measures of
sequence similarity that incorporate indels. Seqcomp analyses were performed
to detect a specified number of matching nucleotides (f) in a sliding window
of size N in a manner similar to Sonnhammer and Durbin
(Sonnhammer and Durbin, 1995
).
Empirical work by Yuh et al. (Yuh et al.,
2002
) supports the calculations by Brown et al.
(Brown et al., 2002
) showing
that random matches are expected at or below a 0.7 threshold, but none above
0.75 for a 20 bp window. A seqcomp analysis of the LvEndo16 and
SpEndo16 promoter sequences was performed at a threshold (f) of 0.8
and a window size (N) of 20 bp. Seqcomp analyses of the LvEndo16
promoter sequence with BAC sequence from S. purpuratus (Sp127I21_S)
and of the SpEndo16 promoter sequence with BAC sequence from L.
variegatus (Lv199M10_L) also were performed at a threshold (f) of 0.8 and
a window size (N) of 100 bp. BAC sequences were obtained from the Sea Urchin
Genome Project
(http://sugp.caltech.edu:7000/resources/).
Results of the seqcomp analyses were visualized on a dot plot and feature map
using FamilyRelations (Brown et al.,
2002
). Similar results were obtained using identical parameters in
the mVISTA program developed by Mayor et al.
(Mayor et al., 2000
) (not
shown).
Microinjection
Endo16 promoter sequence was amplified by PCR as a single fragment
(2,305 bp, S. purpuratus; 2,159 bp, L. variegatus) from
genomic DNA using primers with restriction sites added to their 5' ends
in order to facilitate directional cloning. For S. purpuratus, the
sequence of the 5' primer was 5'
GCGCGAATTCGTCGGTGACCTAATTTCCCTTGTT, and of the 3' primer was 5'
GCGCGGATCCCATCGTCTCAAAAATTAG. For L. variegatus, the sequence of the
5' primer was 5' GCGCGAATTCGAGCTTGTCAATGAGGGTAATTTT and of the
3' primer was GCGCGGATCCCGACCAAGCAAAAAAGTTCC. The PCR products were
cloned and sequenced as described above. The promoter fragments were excised
from the pGEM-T vector (Promega) by restriction digestion with EcoRI
and BamHI, and ligated into digested pEGFP-1 vector (Clontech). The
ligation products were cloned and sequenced as described above. Promoter
constructs were verified by restriction digestions and sequencing using
primers based on the pEGFP-1 sequence. Prior to microinjection, the
SpEndo16-GFP and LvEndo16-GFP promoter constructs were
linearized upstream of the promoter fragment with SacI, and gel
purified.
Eggs were de-jellied by incubating in artificial sea water, pH 5.0 for 3.5 minutes (S. purpuratus) or 1.5 minutes (L. variegatus). The eggs were then transferred to plastic petri dishes coated with protamine sulfate. S. purpuratus eggs were fertilized prior to microinjection in artificial sea water containing 0.2% PABA to prevent hardening of the fertilization envelope. Eggs were microinjected using a PLI-100 picospritzer (Medical Systems, Greenvale, NY) under an Axiovert S100 inverted microscope (Zeiss, Jena, Germany). Approximately 1500 molecules of linearized plasmid DNA were injected per egg in a 2 pl volume of solution containing a fivefold molar excess of HindIII-digested genomic DNA, as well as 0.12 M KCl and 30% glycerol. Following microinjection, the L. variegatus eggs were fertilized. Fertilized eggs were cultured at 9°C (S. purpuratus) or room temperature (L. variegatus) until the desired stages. Embryos and larvae were observed under a Axioskop MOT II microscope (Zeiss) equipped for fluorescence microscopy. Images were recorded using a Hamamatsu digital camera (Model #C4742-95-12R) (Hamamatsu City, Japan) and analyzed using Openlab 2.2.4 (Improvision, Lexington, MA). S. purpuratus embryos were cultured at 9°C and therefore, developed more slowly than L. variegatus embryos; however, images were recorded at equivalent developmental stages for both species.
| RESULTS |
|---|
|
|
|---|
LvEndo16 is initially expressed throughout the vegetal plate of the hatched blastula (Fig. 2A). LvEndo16 expression is downregulated in PMCs as they ingress into the blastocoel (Fig. 2B). The PMCs lie at the center of the vegetal plate, so that LvEndo16 expression appears as a ring when viewed from the vegetal pole (Fig. 2a,b). During gastrulation, LvEndo16 is expressed throughout the invaginating archenteron (Fig. 2C), and continues to appear as a ring when viewed from the vegetal pole (Fig. 2c). LvEndo16 expression is downregulated in SMCs as they migrate away from the anterior tip of the archenteron (Fig. 2D). LvEndo16 expression thus remains restricted to the endoderm throughout gastrulation (Fig. 2C,D). This pattern of Endo16 expression during embryonic development is conserved between S. purpuratus and L. variegatus (Fig. 3).
|
|
Characterization of the LvEndo16 promoter
SpEndo16 expression can be driven by only 2.2 kb of sequence
immediately upstream of the transcriptional start site
(Yuh et al., 1994
). In the
present study, 2337 bp of LvEndo16 sequence was assembled from
overlapping fragments generated by a series of `walks' upstream of the
transcriptional start site (Fig.
4) (GenBank Accession Number AY292383). The LvEndo16
promoter sequence then was amplified as a single fragment (
2.2 kb) that
included the basal promoter, and cloned into the promoterless pEGFP-1 vector.
The LvEndo16 promoter sequence was inserted upstream of the EGFP gene
to create a reporter construct referred to as LvEndo16-GFP.
|
|
10% of the resulting embryos. These numbers are smaller
than those reported by Arnone et al.
(Arnone et al., 1997
Evolutionary analysis of the Endo16 promoter
Alignment of the Endo16 promoter sequences revealed that module A,
the most proximal
350 bp of the promoter, is well conserved between
S. purpuratus and L. variegatus
(Fig. 6). By contrast, upstream
modules B through G are not conserved (sequence not shown). Although sequences
upstream of module A were difficult to align, it is clear that modules B-G are
significantly more divergent than module A. Specifically, module A contains
only 11 indels (insertions and deletions), ranging from 1-5 bp in length,
whereas the best alignment of modules B through G contains considerably more
indels, ranging from 1 to 18 bp in length.
|
Surprisingly, none of the binding sites identified within modules B through
G of the SpEndo16 promoter can be identified in the LvEndo16
promoter, nor in the 5' UTR, first intron, or coding sequence
(Fig. 7A,B). It is important to
bear in mind that more than one nucleotide can often fit the consensus
sequence for a particular binding site. For example, the SpEndo16
promoter contains multiple binding sites for GCF1 and CG. The sequences for
many of these binding sites differ slightly within S. purpuratus, but
still fall within a well-defined consensus sequence
(Yuh et al., 1998
). Several
programs, including PipMaker (Schwartz et
al., 2000
), were employed to search for binding sites in the
LvEndo16 promoter. Other regions of the locus were also examined in
both the 5' and 3' orientation, as there can be drastic changes in
the order and spacing of binding sites during the evolution of cis-regulatory
elements (Wray et al., 2003
).
It remains possible that variants of binding sites from modules B-G occur
within the LvEndo16 promoter, but if so, they have diverged
considerably in sequence and perhaps relative position. In any case, such
sites were not detected using algorithms to search for consensus sequences
based on the SpEndo16 promoter.
|
To test the possibility that modules B-G are separated from module A by a
large insertion in the 5' flanking region in L. variegatus, we
compared the known Endo16 promoter sequences with BAC sequences
containing the Endo16 locus. Modules B-G do not appear to be located
further upstream of the isolated 2.2 kb sequence in L. variegatus, as
evidenced by a pairwise comparison of the SpEndo16 promoter sequence
with a
22 kb BAC sequence from L. variegatus that contains the
LvEndo16 locus. In this case, the analysis was performed using a
threshold of 0.8 and a larger window size of 100 in order to avoid noise from
repetitive elements. The feature map shows only one region of strong
conservation that corresponds to module A of the Endo16 promoter
(Fig. 7E). The same parameters
were applied to a pairwise comparison of the LvEndo16 promoter
sequence with a
50 kb BAC sequence from S. purpuratus that
contains the SpEndo16 locus. In this case, the feature map shows two
regions of conservation that correspond to module A of the Endo16
promoter as well as a microsatellite consisting of TAC repeats
(Fig. 7F).
Reciprocal injection of the Endo16 promoter
To investigate whether there have been evolutionary changes in the set of
transcription factors that bind to the Endo16 promoter, reciprocal
cross-species transient expression assays were performed. These experiments
tested whether the SpEndo16 promoter can drive correct expression in
L. variegatus and whether the LvEndo16 promoter can drive
correct expression in S. purpuratus. Endo16 promoter sequence from
one species (donor) was microinjected into the egg of the other species
(host), and GFP expression was observed in the resulting embryos and larvae by
fluorescence microscopy. The pattern of GFP expression was interpreted in the
context of the expression and sequence data obtained for each species, as well
as data from microinjection of the Endo16 promoter into eggs of the
same species. As described above, microinjection of LvEndo16-GFP into
L. variegatus eggs produced a pattern of GFP expression that
recapitulated the results of in situ hybridization
(Fig. 8J-L). Microinjection of
SpEndo16-GFP into S. purpuratus eggs produced a nearly
identical pattern of GFP expression; however, no fluorescence was observed in
the hindgut (Fig. 8A-C). This
latter result is consistent with studies by Yuh et al.
(Yuh et al., 1994
). No
fluorescence was detected upon microinjection of a promoterless construct into
eggs of either species as a negative control.
|
Microinjection of LvEndo16-GFP into S. purpuratus eggs resulted in a pattern of GFP expression similar to that observed in the reciprocal experiment. Fluorescence was observed in the vegetal plate of the hatched blastula, and later in the invaginating archenteron (Fig. 8D,E). In addition, fluorescence was observed in the midgut of the pluteus larva until at least the four-arm stage (Fig. 8F). Fluorescence was not observed in the hindgut, consistent with the endogenous pattern of SpEndo16 expression. Unlike the reciprocal experiment, ectopic fluorescence was not observed in the SMCs or any other cell type. These data are summarized in Fig. 9.
|
| DISCUSSION |
|---|
|
|
|---|
Evolutionary changes in the Endo16 promoter
Yuh et al. (Yuh et al.,
1994
) have demonstrated that Endo16 expression is
regulated by 2.2 kb of sequence immediately upstream of the transcriptional
start site. This sequence contains at least 56 transcription factor binding
sites that are clustered into six functionally distinct modules that regulate
the level, timing and spatial transcription of Endo16 in S.
purpuratus. We have shown that 2.2 kb of sequence immediately upstream of
the transcriptional start site is sufficient to drive Endo16
expression throughout embryonic and larval development in L.
variegatus as well. Although the pattern of Endo16 expression is
similar between S. purpuratus and L. variegatus
(Fig. 3), our data demonstrate
that drastic changes have evolved in the Endo16 promoter since these
two species diverged. Of the entire Endo16 promoter, only the most
proximal region, module A, is conserved between the two species
(Fig. 7).
These results indicate that different regions within the Endo16
promoter are under different levels of functional constraint. Specifically,
module A appears to be under a much higher level of functional constraint than
the rest of the promoter. It is not surprising that certain modules of the
Endo16 promoter are more conserved than others because they perform
different functions. Modularity in cis-regulatory sequences allows changes in
gene expression to evolve in one tissue independently of another, and has been
proposed to facilitate the evolution of morphological diversity (Kitchhamer et
al., 1996; Gerhart and Kirschner, 1998;
Carroll et al., 2001
). Within
the Endo16 promoter, the conservation of module A makes functional
sense given its essential roles in relaying the integrated output of all
modules to the basal promoter and serving as the primary activator of
Endo16 expression during embryogenesis
(Yuh et al., 1998
).
Nucleotides within binding sites are more conserved than those not in binding
sites presumably because they are directly responsible for activating
Endo16 expression. This pattern of functional constraint on binding
sites versus non-binding sites has been noted for a few genes (e.g.
Core et al., 1997
). It is
likely that negative selection has maintained functionally important binding
sites within module A of the Endo16 promoter since S.
purpuratus and L. variegatus last shared a common ancestor.
Functional conservation of the Endo16 promoter
The pattern of Endo16 expression is similar in S.
purpuratus and L. variegatus despite the fact that only module A
of the Endo16 promoter is conserved. It has been postulated that
selection for compensatory mutations is a primary mechanism by which patterns
of gene expression are conserved for long periods of evolutionary time
(Ludwig et al., 2000
). Several
studies provide support for this idea (e.g.
Ludwig and Kreitman, 1995
;
Maduro and Pilgrim, 1996
;
Tamarina et al., 1997
;
Ludwig et al., 1998
;
Piano et al., 1999
;
Takahashi et al., 1999
;
Ludwig et al., 2000
;
Tumpel et al., 2002
).
Functional compensation appears to have also evolved within the
Endo16 promoter, although the changes are more extensive than in any
of these previously known cases.
Several pieces of evidence are relevant to understanding the genetic basis
for conservation of function despite such divergence in sequences. Yuh and
Davidson (Yuh and Davidson,
1996
) demonstrated that microinjection of a GFP reporter construct
containing only module A drives GFP expression in the vegetal plate and
archenteron, but is not sufficient to maintain expression in the midgut of the
pluteus larva in S. purpuratus
(Yuh and Davidson, 1996
).
Despite the fact that only module A is conserved, the 2.2 kb region
immediately upstream of the transcriptional start site of the
LvEndo16 gene is sufficient to drive later phases of
LvEndo16 expression. It is possible that module A is entirely
responsible for the pattern of LvEndo16 expression, although this
seems unlikely given its inability to drive larval expression in S.
purpuratus. It is also possible that binding sites could not be
identified upstream of module A within the LvEndo16 promoter because
of unrecognized variation in their consensus sequences. Alternatively, the
remaining region of the 2.2 kb region of the LvEndo16 promoter may
contain binding sites for a different set of transcription factors that are
functionally equivalent to those in modules B-G of the SpEndo16
promoter. That is, during the evolution of the Endo16 promoter, some
binding sites may have been replaced by others that generate a similar pattern
of Endo16 expression. The transcription factors that interact with
the Endo16 promoter may have co-evolved to maintain this pattern of
Endo16 expression, as has been documented for the bicoid
promoter in insects (Shaw et al.,
2002
). In any case, the SpEndo16 and LvEndo16
promoter sequences are very different, yet generate a similar pattern of
Endo16 expression. Although this situation suggests the operation of
stabilizing selection, we cannot rule out the possibility that drift or
directional selection have been important contributors until data are obtained
for additional species.
Divergence in the pattern of Endo16 expression
Although the pattern of Endo16 expression is generally conserved,
transcription persists only in the midgut of the pluteus larva in S.
purpuratus (Nocente-McGrath et al.,
1989
; Ransick et al.,
1993
), but in both the midgut and hindgut of the pluteus larva in
L. variegatus. This difference in transcriptional regulation may have
evolved in several different ways. The SpEndo16 and LvEndo16
promoters may contain binding sites for different transcription factors
involved in segmentation of the tripartite gut. Alternatively, the expression
and/or activity of these transcription factors may be different between the
two species. For example, the transcription factor UI binds within module B of
the SpEndo16 promoter, and is directly responsible for maintaining
SpEndo16 expression in the midgut of the pluteus larva
(Yuh et al., 1998
). Although a
binding site for the transcription factor UI could not be identified within
the LvEndo16 promoter, it is possible that LvEndo16
expression persists in the hindgut due to expansion of the spatial domain of
UI expression in L. variegatus. Another possibility is the existence
of a transcription factor that represses Endo16 expression, and is
expressed in the hindgut of S. purpuratus but not L.
variegatus.
Evolutionary changes in transcription factors that bind to the
Endo16 promoter
Binding sites within modules B-G of the SpEndo16 promoter do not
appear to be present in any region of the LvEndo16 locus including
the 2.2 kb region that was shown to drive the correct pattern of GFP
expression (Fig. 7). This
result suggests that Endo16 expression is regulated, at least in
part, by a different set of transcription factors in S. purpuratus
and L. variegatus. Indeed, reciprocal injection of the
Endo16 promoter between the two species revealed differences in the
expression and/or activity of transcription factors that bind to the
Endo16 promoter.
Microinjection of SpEndo16-GFP into L. variegatus eggs,
as well as microinjection of LvEndo16-GFP into S. purpuratus
eggs, produced fluorescence in the vegetal plate and archenteron
(Fig. 9B,D). This result is
consistent with the fact that module A is responsible for activating
Endo16 expression in these regions
(Yuh et al., 1996
;
Yuh and Davidson, 1996
).
Moreover, this most proximal region of the Endo16 promoter is
conserved between S. purpuratus and L. variegatus. A few
nucleotide substitutions and indels occur within known transcription factor
binding sites of module A (Fig.
6). Some of these changes occur within multiply represented
binding sites for the `structural' protein GCF1, which stabilizes DNA looping
(Zeller et al., 1995
).
However, a few changes occur within binding sites for proteins with a
regulatory function. These changes may have been tolerated because they have
little or no effect on DNA/protein interactions, a possibility that can be
tested with mobility shift assays.
Reciprocal injection also produced fluorescence in the midgut of the
pluteus larva (Fig. 9B,D). Yet,
module B, which was shown to maintain SpEndo16 expression in this
region of endoderm (Yuh et al.,
1998
), is not present in L. variegatus. Thus, it appears
as if changes have evolved within the Endo16 promoter to maintain the
regulatory output of module B even in the absence of any obvious sequence
similarity. Interestingly, the fact that the SpEndo16 promoter
correctly drives GFP expression in the midgut of L. variegatus
indicates that the appropriate transcription factors are expressed in both
species in a conserved manner. If this were not the case, GFP reporter
expression would not mimic the expression of the endogenous gene in reciprocal
cross-species microinjection experiments. For example, microinjection of the
CyIIIa promoter from S. purpuratus into L. variegatus eggs
resulted in ectopic CAT activity in several cell types
(Franks et al., 1988
).
Fluorescence was not detected in the hindgut upon microinjection of SpEndo16-GFP into L. variegatus eggs (Fig. 9C). Microinjection of LvEndo16-GFP into S. purpuratus eggs also failed to produce fluorescence in the hindgut, despite the fact that LvEndo16 is expressed in this region of endoderm (Fig. 9B). Either the appropriate transcription factors are not present in this region of S. purpuratus, or there has been a change in the activity of co-factors that are required for these transcription factors to bind to the LvEndo16 promoter.
Interestingly, microinjection of SpEndo16-GFP into L. variegatus consistently produced ectopic fluorescence in the SMCs and their descendents, the pigment cells (Fig. 9C). By contrast, microinjection of LvEndo16-GFP into S. purpuratus did not produce ectopic fluorescence (Fig. 9B). These data suggest that L. variegatus and S. purpuratus use different mechanisms to repress Endo16 expression in the SMCs. The transcription factors that normally repress SpEndo16 expression in the SMCs may not be present in L. variegatus. However, any transcription factors that normally repress LvEndo16 expression in the SMCs must be present in S. purpuratus. Alternatively, it is possible that there are no binding sites within the LvEndo16 promoter capable of activating LvEndo16 expression in the SMCs and other nonendodermal cell types.
Thus, it appears as though compensatory changes have evolved that lie both
cis and trans to the Endo16 gene. Only a few studies have analyzed
promoter sequences in the context of another species to determine the extent
to which the corresponding transcription factors have co-evolved
(Klueg et al., 1997
;
Takahashi et al., 1999
;
Shaw et al., 2002
). For
example, Takahashi et al. (Takahashi et
al., 1999
) performed reciprocal injections of the
brachyury promoter in two species of ascidians, Ciona
intestinalis and Halocynthia roretzi. Extensive changes have
evolved in the brachyury promoter, although it activates
notochord-specific expression in both species
(Corbo et al., 1997
;
Takahashi et al., 1999
).
Microinjection of the C. intestinalis brachyury promoter into H.
roretzi eggs produced ectopic lacZ expression in other
mesodermally derived tissues, suggesting that there have also been alterations
in the set of transcription factors that bind to the brachyury
promoter. Most other studies carried out unidirectional analysis of promoter
sequences in the context of another species (e.g.
Franks et al., 1988
;
Ludwig et al., 1998
;
Ludwig et al., 2000
;
Shashikant et al., 1998
), and
may therefore have missed finding evidence for trans components to changes in
transcriptional regulation.
In summary, this study combines expression, sequence and functional data to analyze changes in cis-regulatory sequences that influence transcription. Data from additional species of sea urchins will help provide a more complete understanding of how changes in transcriptional regulation relate to the evolution of morphological diversity. In addition, site-directed mutagenesis and biochemical assays will allow us to test the functional consequences of specific nucleotide substitutions and indels on Endo16 expression both within and between closely related species.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Arnone, M. I., Bogarad, L. D., Collazo, A., Kirchhamer, C. V., Cameron, R. A., Rast, J. P., Gregorians, A. and Davidson, E. H. (1997). Green fluorescent protein in the sea urchin: new experimental approaches to transcriptional regulatory analysis in embryos and larvae. Development 124,4649 -4659.[Abstract]
Averof, M. and Patel, N. H. (1997). Crustacean appendage evolution associated with changes in Hox gene expression. Nature 388,682 -686.[CrossRef][Medline]
Brown, C. T., Rust, A. G., Clarke, P. J., Pan, Z., Schilstra, M. J., de Buysscher, T., Griffin, G., Wold, B. J., Cameron, R. A., Davidson, E. H. and Bolouri, H. (2002). New computational approaches for analysis of cis-regulatory networks. Dev. Biol. 246,86 -102.[CrossRef][Medline]
Calzone, F. J., Theze, N., Thiebaud, P., Hill, R. L., Britten,
R. J. and Davidson, E. H. (1988). Developmental appearance of
factors that bind specifically to cis-regulatory sequences of a gene
expressed in the sea urchin embryo. Genes Dev.
2,1074
-1088.
Calzone, F. J., Grainger, J., Coffman, J. A. and Davidson, E. H. (1997). Extensive maternal representation of DNA-binding proteins that interact with regulatory target sites of the Strongylocentrotus purpuratus CyIIIa gene. Mol. Mar. Biol. Biotechnol. 6,79 -83.[Medline]
Carroll, S. B., Grenier, J. K. and Weatherbee, S. D. (2001). From DNA to Diversity: Molecular Genetics and the Evolution of Animal Design. London: Blackwell Science.
Coffman, J. A., Kirchhamer, C. V., Harrington, M. G. and Davidson, E. H. (1996). SpRunt-1, a new member of the runt domain family of transcription factors, is a positive regulator of the aboral ectoderm-specific CyIIIa gene in sea urchin embryos. Dev. Biol. 174,43 -54.[CrossRef][Medline]
Coffman, J. A., Kirchhamer, C. V., Harrington, M. G. and Davidson, E. H. (1997). SpMyb functions as an intramodular repressor to regulate spatial expression of CyIIIa in sea urchin embryos. Development 124,4717 -4727.[Abstract]
Corbo, J. C., Levine, M. and Zeller, R. W. (1997). Characterization of a notochord-specific enhancer from the Brachyury promoter region of the ascidian, Ciona intestinalis. Development 124,589 -602.[Abstract]
Core, N., Charroux, B., McCormick, A., Vola, C., Fasano, L., Scott, M. P. and Kerridge, S. (1997). Transcriptional regulation of the Drosophila homeotic gene teashirt by the homeodomain protein Fushi tarazu. Mech. Dev. 68,157 -172.[CrossRef][Medline]
Crawford, D. L., Segal, J. A. and Barnett, J. L. (1999). Evolutionary analysis of TATA-less proximal promoter function. Mol. Biol. Evol. 16,194 -207.[Abstract]
Davidson, E. H. (2001). Genomic Regulatory Systems: Development and Evolution. San Diego: Academic Press.
Doebley, J. and Lukens, L. (1998).
Transcriptional regulators and the evolution of plant form. Plant
Cell 10,1075
-1082.
Dudareva, N., Cseke, L., Blanc, V. M. and Pichersky, E. (1996). Evolution of floral scent in Clarkia: novel patterns of S-linalool synthase gene expression in the C. breweri flower. Plant Cell 8,1137 -1148.[Abstract]
Franks, R. R., Hough-Evans, B. R., Britten, R. J. and Davidson,
E. H. (1988). Spatially deranged though temporally correct
expression of Strongylocentrotus purpuratus actin gene fusion in
transgenic embryos of a different sea urchin family. Genes
Dev. 2,1
-12.
Gerhart, J. and Kirschner, M. (1997). Cells, Embryos, and Evolution. Malden, MA: Blackwell Science.
Gibson, A. W. and Burke, R. D. (1985). The origin of pigment cells in embryos of the sea urchin Strongylocentrotus purpuratus. Dev. Biol. 107,414 -419.[CrossRef][Medline]
Godin, R. E., Klinzing, D. C., Porcaro, W. A. and Ernst, S. G. (1997) Specification of endoderm in the sea urchin embryo. Mech. Dev. 67,35 -47.[CrossRef][Medline]
Hariri, A. R., Mattay, V. S., Tessitore, A., Kolachana, B.,
Fera, F., Goldman, D., Egan, M. F. and Weinberger, D. R.
(2002) Serotonin transporter genetic variation and the response
of the human amygdala. Science
297,400
-403.
Kirchhamer, C. V. and Davidson, E. H. (1996) Spatial and temporal information processing in the sea urchin embryo: modular and intramodular organization of the CyIIIa gene cis-regulatory system. Development 122,333 -348.[Abstract]
Kirchhamer, C. V., Yuh, C. H. and Davidson, E. H.
(1996). Modular cis-regulatory organization of
developmentally expressed genes: two genes transcribed territorially in the
sea urchin embryo, and additional examples. Proc. Natl. Acad. Sci.
USA 93,9322
-9328.
Klueg, K. M., Harkey, M. A. and Raff, R. A. (1997). Mechanisms of evolutionary changes in timing, spatial expression, and mRNA processing in the msp130 gene in a direct-developing sea urchin, Heliocidaris erythrogramma. Dev. Biol. 182,121 -133.[CrossRef][Medline]
Kragh-Hansen, U. (1990). Structure and ligand binding properties of human serum albumin. Danish Med. Bull. 37,57 -84.
Li, X. and Noll, M. (1994). Evolution of distinct developmental functions of three Drosophila genes by acquisition of different cis-regulatory regions. Nature 367,83 -87.[CrossRef][Medline]
Littlewood, D. T. and Smith, A. B. (1995). A
combined morphological and molecular phylogeny for sea urchins (Echinoidea:
Echinodermata). Philos. Trans. R. Soc. Lond. B. Biol.
Sci. 347,213
-234.
Ludwig, M. Z. and Kreitman, M. (1995). Evolutionary dynamics of the enhancer region of even-skipped in Drosophila. Mol. Biol. Evol. 12,1002 -1011.[Abstract]
Ludwig, M. Z., Patel, N. H. and Kreitman, M. (1998). Functional analysis of eve stripe 2 enhancer evolution in Drosophila: rules governing conservation and change. Development 125,949 -958.[Abstract]
Ludwig, M. Z., Bergman, C., Patel, N. H. and Kreitman, M. (2000). Evidence for stabilizing selection in a eukaryotic enhancer element. Nature 403,564 -567.[CrossRef][Medline]
Maduro, M. and Pilgrim, D. (1996). Conservation of function and expression of unc-119 from two Caenorhabditis species despite divergence of non-coding DNA. Gene 183, 77-85.[CrossRef][Medline]
Mayor, C., Brudno, M., Schwartz, J. R., Poliakov, A., Rubin, E.
M., Frazer, K. A., Pachter, L. S. and Dubchak, I. (2000).
VISTA: visualizing global DNA sequence alignments of arbitrary length.
Bioinformatics 16,1046
-1047.
Nocente-McGrath, C., Brenner, C. A. and Ernst, S. G. (1989). Endo16, a lineage-specific protein of the sea urchin embryo, is first expressed just prior to gastrulation. Dev. Biol. 136,264 -272.[CrossRef][Medline]
Piano, F., Parisi, M. J., Karess, R. and Kambysellis, M. P.
(1999). Evidence for redundancy but not trans
factor-cis element coevolution in the regulation of Drosophila
Yp genes. Genetics
152,605
-616.
Raff, R. A. (1996). The Shape of Life. Chicago: University of Chicago Press.
Ransick, A., Ernst, S., Britten, R. J. and Davidson, E. H. (1993). Whole mount in situ hybridization shows Endo16 to be a marker for the vegetal plate territory in sea urchin embryos. Mech. Dev. 42,117 -124.[CrossRef][Medline]
Rockman, M. V. and Wray, G. A. (2002). Abundant
raw material for cis-regulatory evolution in humans. Mol.
Biol. Evol. 19,1991
-2004.
Schulte, P. M., Gomez-Chiarri, M. and Powers, D. A. (1997). Structural and functional differences in the promoter and 5' flanking region of Ldh-B within and between populations of the teleost Fundulus heteroclitus. Genetics 145,759 -769.[Abstract]
Schwartz, S., Zhang, Z., Frazer, K. A., Smit, A., Riemer, C.,
Bouck, J., Gibbs, R., Hardison, R. and Miller, W. (2000).
PipMakera web server for aligning two genomic DNA sequences.
Genome Res. 10,577
-586.
Shashikant, C. S., Kim, C. B., Borbely, M. A., Wang, W. C. and
Ruddle, F. H. (1998). Comparative studies on mammalian
Hoxc8 early enhancer sequence reveal a baleen whale-specific deletion
of a cis-acting element. Proc. Natl. Acad. Sci.
USA 95,15446
-15451.
Shaw, P. J., Wratten, N. S., McGregor, A. P. and Dover, G. A. (2002) Coevolution in bicoid-dependent promoters and the inception of regulatory incompatibilities among species of higher Diptera. Evol. Dev. 3,265 -277.
Singh, N., Barbour, K. W. and Berger, F. G. (1998). Evolution of transcriptional regulatory elements within the promoter of a mammalian gene. Mol. Biol. Evol. 15,312 -325.[Abstract]
Sinha, N. and Kellogg, E. (1996). Parallelism and diversity in multiple origins of C4 photsynthesis in the grass family. Am. J. Bot. 83,1458 -1470.[CrossRef]
Soltysik-Espanola, M., Klinzing, D. C., Pfarr, K., Burke, R. D. and Ernst, S. G. (1994). Endo16, a large multidomain protein found on the surface and ECM of endodermal cells during sea urchin gastrulation, binds calcium. Dev. Biol. 165, 73-85.[CrossRef][Medline]
Sonnhammer, E. L. and Durbin, R. (1995). A dot-matrix program with dynamic threshold control suited for genomic DNA and protein sequence analysis. Gene 176,GC1 -10.
Spitz, F., Gonzalez, F., Peichel, C., Vogt, T. F., Duboule, D.
and Zakany, J. (2001). Large scale transgenic and cluster
deletion analysis of the HoxD complex separate an ancestral regulatory module
from evolutionary innovations. Genes Dev.
15,2209
-2214.
Stern, D. L. (1998). A role of Ultrabithorax in morphological differences between Drosophila species. Nature 396,463 -466.[CrossRef][Medline]
Stockhaus, J., Schlue, U., Koczor, M., Chitty, J. A., Taylor, W. C. and Westhoff, P. (1997). The promoter of the gene encoding the C4 form of phosphoenolpyruvate carboxylase directs mesophyll-specific expression in transgenic C4 Flaveria spp. Plant Cell 9,479 -489.[Abstract]
Takahashi, H., Mitani, Y., Satoh, G. and Satoh, N. (1999). Evolutionary alterations of the minimal promoter for notochord-specific brachyury expression in ascidian embryos. Development 126,3725 -3734.[Abstract]
Tamarina, N. A., Ludwig, M. Z. and Richmond, R. C.
(1997). Divergent and conserved features in the spatial
expression of the Drosophila pseudoobscura esterase-5B gene and the
esterase-6 gene of Drosophila melanogaster. Proc.
Natl. Acad. Sci. USA 94,7735
-7741.
Theze, N., Calzone, F. J., Thiebaud, P., Hill, R. L., Britten, R. J. and Davidson, E. H. (1990). Sequences of the CyIIIa actin gene regulatory domain bound specifically by sea urchin embryo nuclear proteins. Mol. Reprod. Dev. 25,110 -122.[CrossRef][Medline]
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and
Higgins, D. G. (1997). The ClustalX windows interface:
flexible strategies for multiple sequence alignment aided by quality analysis
tools. Nucleic Acids Res.
25,4876
-4882.
Tumpel, S., Maconochie, M., Wiedemann, L. M. and Krumlauf, R. (2002). Conservation and diversity in the cis-regulatory networks that integrate information controlling expression of Hoxa2 in hindbrain and cranial neural crest cells in vertebrates. Dev. Biol. 246,45 -56.[CrossRef][Medline]
Wang, D. G., Kirchhamer, C. V., Britten, R. J. and Davidson, E. H. (1995) SpZ12-1, a negative regulator required for spatial control of the territory-specific CyIIIa gene in the sea urchin embryo. Development 121,1111 -1122.[Abstract]
Wray, G. A. and Lowe, C. J. (2000). Developmental regulatory genes and echinoderm evolution. Syst. Biol. 49,151 -174.
Wray, G. A., Hahn, M., Abouheif, E., Balhoff, J. P., Pizer, M., Rockman, M. V. and Romano, L. A. (2003). Evolution of eukaryotic transcription. Mol. Biol. Evol. (in press).
Yuh, C.-H. and Davidson, E. H. (1996). Modular cis-regulatory organization of Endo16, a gut-specific gene of the sea urchin embryo. Development 122,1069 -1082.[Abstract]
Yuh, C.-H., Ransick, A., Martinez, P., Britten, R. J. and Davidson, E. H. (1994). Complexity and organization of DNA-protein interactions in the 5'-regulatory region of an endoderm-specific marker gene in the sea urchin embryo. Mech. Dev. 47,165 -186.[CrossRef][Medline]
Yuh, C.-H., Moore, J. G. and Davidson, E. H. (1996). Quantitative functional interrelations within the cis-regulatory system of the S. purpuratus Endo16 gene. Development 122,4045 -4056.[Abstract]
Yuh, C.-H., Bolouri, H. and Davidson, E. H.
(1998). Genomic cis-regulatory logic: experimental and
computational analysis of a sea urchin gene. Science
279,1896
-1902.
Yuh, C.-H., Bolouri, H. and Davidson, E. H. (2001a). Cis-regulatory logic in the Endo16 gene: switching from a specification to a differentiation mode of control. Development 128,617 -629.[Abstract]
Yuh, C. H., Li, X., Davidson, E. H. and Klein, W. H. (2001b). Correct expression of spec2a in the sea urchin embryo requires both Otx and other cis-regulatory elements. Dev. Biol. 232,424 -438.[CrossRef][Medline]
Yuh, C. H., Brown, C. T., Livi, C. B., Rowen, L., Clarke, P. J. C. and Davidson, E. H. (2002). Patchy interspecific sequence similarities efficiently identify positive cis-regulatory elements in the sea urchin. Dev. Biol. 246,148 -161.[CrossRef][Medline]
Zeller, R. W., Griffith, J. D., Moore, J. G., Kirchhamer, C. V.,
Britten, R. J. and Davidson, E. H. (1995). A multimerizing
transcription factor of sea urchin embryos capable of looping DNA.
Proc. Natl. Acad. Sci. USA
92,2989
-2993.
Zhu, X., Mahairas, G., Illies, M., Cameron, R. A., Davidson, E.
H. and Ettensohn, C. A. (2001). A large-scale analysis of
mRNAs expressed by primary mesenchyme cells of the sea urchin embryo.
Development 128,2615
-2627.
This article has been cited by other articles:
![]() |
R. R Copley The animal in the genome: comparative genomics and evolution Phil Trans R Soc B, April 27, 2008; 363(1496): 1453 - 1461. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Genissel, L. M. McIntyre, M. L. Wayne, and S. V. Nuzhdin Cis and Trans Regulatory Effects Contribute to Natural Variation in Transcriptome of Drosophila melanogaster Mol. Biol. Evol., January 1, 2008; 25(1): 101 - 110. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Wittkopp Variable gene expression in eukaryotes: a network perspective J. Exp. Biol., May 1, 2007; 210(9): 1567 - 1575. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. van Opijnen, M. C. Boerlijst, and B. Berkhout Effects of random mutations in the human immunodeficiency virus type 1 transcriptional promoter on viral fitness in different host cell environments. J. Virol., July 1, 2006; 80(13): 6678 - 6685. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Wray The evolution of embryonic gene expression in sea urchins Integr. Comp. Biol., June 1, 2006; 46(3): 233 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Cameron, S. H. Chow, K. Berney, T.-Y. Chiu, Q.-A. Yuan, A. Kramer, A. Helguero, A. Ransick, M. Yun, and E. H. Davidson An evolutionary constraint: Strongly disfavored class of change in DNA sequence during divergence of cis-regulatory modules PNAS, August 16, 2005; 102(33): 11769 - 11774. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Balhoff and G. A. Wray Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites PNAS, June 14, 2005; 102(24): 8591 - 8596. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Oda-Ishii, V. Bertrand, I. Matsuo, P. Lemaire, and H. Saiga Making very similar embryos with divergent genomes: conservation of regulatory mechanisms of Otx between the ascidians Halocynthia roretzi and Ciona intestinalis Development, April 1, 2005; 132(7): 1663 - 1674. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ruvinsky and G. Ruvkun Functional tests of enhancer conservation between distantly related species Development, November 1, 2003; 130(21): 5133 - 5142. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||