|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 4, 2003
doi: 10.1242/10.1242/dev.00640


1 Division of Developmental Biology, Children's Hospital Research Foundation,
Cincinnati, OH 45229, USA
2 Developmental Genetics Program, Skirball Institute of Biomolecular Medicine,
New York University Medical Center and Howard Hughes Medical Institute, New
York, NY 10016, USA
3 Max Planck Institute for Biophysical Chemistry, Am Fassberg 11, 37077
Gottingen, Germany
4 Molecular Pathogenesis Program, Skirball Institute of Biomolecular Medicine,
New York University Medical Center and Howard Hughes Medical Institute, New
York, NY 10016, USA
Authors for correspondence (e-mail:
Lehmann{at}saturn.med.nyu.edu
and
Christopher.Wylie{at}chmcc.org)
Accepted 29 May 2003
| SUMMARY |
|---|
|
|
|---|
Key words: PGCs, SDF1, CXCR4, Chemokine, Migration, Mouse
| INTRODUCTION |
|---|
|
|
|---|
Recent work on zebrafish embryos has shown that the G-protein-coupled
receptor CXCR4, and its ligand Stromal cell-derived factor-1 (SDF1; CXCL12 -
Mouse Genome Informatics) (Bacon et al.,
2002
) play essential roles in primordial germ cell migration
(Doitsidou et al., 2002
;
Knaut et al., 2003
). The
SDF1-CXCR4 interaction is known to play roles in the chemotaxis of several
cell types, such as lymphocytes (Bleul et
al., 1996a
; Bleul et al.,
1996b
), cerebellar and hippocampal neurons
(Lu et al., 2002
;
Zou et al., 1998
), and lateral
line cells (David et al.,
2002
). It also plays a part in several pathological situations,
for example, tumor metastasis (Muller et
al., 2001
), joint infiltration
(Buckley et al., 2000
) and
HIV-1 entry (Feng et al.,
1996
). SDF1 is the only known ligand of the receptor CXCR4
(Ma et al., 1998
).
In this paper we show that colonization of the gonads by PGCs in the mouse requires the ligand-receptor interaction of SDF1 and CXCR4. First, the receptor is expressed on the migrating germ cells, whereas its ligand is expressed in the dorsal body wall during migration. Second, the migration of germ cells in living embryo cultures is perturbed by the presence of added SDF1. Third, germ cells do not colonize the genital ridges correctly in embryos carrying targeted mutations of the receptor CXCR4, although the primordial germ cells do colonize the hindgut in these embryos. In addition, addition of SDF1 causes increased survival of germ cells, whereas targeted mutation of the CXCR4 receptor causes a progressive reduction of germ cells during and after the colonization of the genital ridges.
These data show that the SDF1-CXCR4 interaction is needed for the growth and survival of germ cells, and that this interaction may also play a role in guiding migrating germ cells to the genital ridge. The fact that germ cell development is affected in CXCR4-mutant mice and zebrafish further suggests that the same G-protein-coupled receptor (GPCR)-signaling mechanism regulates early germ cell development in vertebrates.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RT-PCR and chip analysis
PGC containing tissue was dissected from E10.5, E11.5 and E12.5 animals,
and digested in 500 µl of 0.25% trypsin (37°C for 15 minutes). The
tissue was triturated into a single cell suspension and filtered through a
nylon mesh. The mesh was washed with 1 ml 2% BSA in PBS and the resulting 1.5
ml suspension was sorted using a FACS Vantage. GFP-positive cells (typically
98% pure) or GFP-negative cells were spun down (10 minutes at 1,000
g) and lysed in 300 µl TriZol Reagent (Invitrogen). RNA was
isolated according to the manufacturer's instructions, using 5 µg linear
polyacrylamide (Sigma) as a carrier. For quantitative RT-PCR, 15 ng of PGC or
somatic mRNA was reverse transcribed in a 10 µl volume containing
1xbuffer (Invitrogen), 100 ng Oligo dT, 2 mM DTT, 0.5 mM dNTPs, 10 U
RNAsin (Promega), 200 U Superscript II (Invitrogen) and 8 µg T4gp32 protein
(USB). Standard curves were generated by diluting PGC or somatic cDNAs 1:10,
1:20 and 1:100 in H20. 1 µl of the dilutions was used for PCR.
PCR was performed in a 25 µl volume using QuantiTect SYBR Green mix
(Qiagen) as a source of Taq, buffer and dNTPs. PCR mix was supplemented with
5% DMSO, as per MJ Research instructions for difficult templates. Cycling and
quantitation was performed in the Opticon Cycler (MJ Research) (15 minutes at
95°C; followed by 40 cycles of 30 seconds at 95°C, 30 seconds at
51°C, 40 seconds at 72°C and 30 seconds at 73°C [optical read];
followed by a 5 minute extension at 72°C and a melting curve). Primers
were used at a final concentration of 0.2 µM and were as follows: CXCR4,
AGCCTGTGGATGGTGGTGTTTC (forward) and CCTTGCTTGATGACTCCCAAAAG (reverse);
GAPDH, ACCACAGTCCATGCCATCAC (forward) and TCCACCACCCTGTTGCTGTA (reverse);
ODC, GCCATTGGGACAGGATTTGAC (forward) and CATCATCTGGACTCCGTTACTGG (reverse);
Stag3, AGTGGGCAAGAAGCAAAAAGG (forward) and TTCCATAAGGCTGAGTCGGGTC (reverse);
SPARC, AAGATACTGTGAGACCTGAGGACCC (forward) and TGGAAAGAAACGCCCGAAG (reverse); and
Cystatin C, CAACAAGGGCAGCAACGATG (forward) and GGGAAGGAGCACAAGTAAGGAAC (reverse).
For chip analysis, 15 ng RNA was reverse transcribed as above except 100 ng Oligo-dT T7 (GTAATACGACTCACTATAGGGCT(18)) and 1 µl SMARTII Oligo (Clontech) were added to the reaction. Half of the resulting cDNA was amplified using the Smart cDNA synthesis kit (Clontech) with Oligo-dT-T7 as a 3' primer. Amplified cDNA was purified over a QIAquick column (Qiagen), and precipitated with sodium acetate and ethanol. Probes were prepared from amplified cDNA using the BioArray Labeling kit (Enzo). Probes were applied to MG-U74Av2 chips (Affymetrix) according the manufacturer's instructions. Chip analysis was performed using MicroArray Suite software (Affymetrix) to statistically determine `presence' and `absence' calls. The average chip signal was normalized to an arbitrary value of 1000.
Immunostaining
Slices were fixed in 4% PFA/PBS for 20 minutes at room temperature. Tissues
were washed for five minutes with PBS (3x) and stored overnight in PBS
with 0.1% TX-100 (4°C, with rocking). Slices were blocked (overnight,
4°C) in 2% Donkey Serum in PBS (blocking buffer). Anti-SDF1 (Sigma) was
used at 2.5 µg/ml in blocking buffer (overnight, 4oC). Tissues
were washed five times for 1 hour in PBS/0.1% TX-100 at room temperature.
Cy5-donkey anti-goat (Jackson Immuno Research) was used at 15 µg/ml in
blocking buffer (overnight, 4oC). Slices were washed as above and
mounted in 75% glycerol on Lab-Tek chambered coverglass (NalgeNunc).
Mouse breeding and embryo preparation
All animals were treated according to protocols approved by the Committee
on Animal Research at New York University School of Medicine. Embryos from
E9.5-E12.5 were recovered from matings between two CXCR4+/--mutant
animals (Zou et al., 1998
).
CXCR4 +/+, +/- and -/- embryos were fixed overnight at 4°C in 4% formalin
(Ultra pure formaldehyde, Polysciences). Embryos were then washed with PBS,
partially dissected and incubated in 30% sucrose overnight at 4°C. The
posterior region was mounted in OCT compound (Tissue-Tek) and frozen in dry
ice. Blocks were kept at -80°C until processing. All cryosections
presented in this paper were 20 µm thick.
Alkaline phosphatase staining of germ cells
Sections on slides were washed in PBS then in alkaline phosphatase (AP)
buffer (100 mM NaCl, 100 mMTris PH 9.5, 50 mM MgCl2, 0.1% Tween)
for 10 minutes. The sections were stained with BCIP/NBT (0.33 mg/ml and 0.2
mg/ml, respectively) in AP buffer at RT for 20 minutes. Stained sections were
mounted using Crystal Mount (Biomeda). Pictures were taken on an Axioskop
microscope (Zeiss) and images acquired via a JVC digital KY-F70 camera and
saved as 24-bit Tiff files in Adobe Phostoshop. All sections were photographed
with a 5x objective.
Genotyping for CXCR4
Genomic DNA was prepared from yolk sacs or tissues in SDS-free buffer at
55°C [50 mM KCl, 10 nM Tris (pH 8.5), 0.01% gelatin, 0.45% Nonidet P-40,
0.45% Tween-20]. Proteinase K was added to a final concentration of 200
µg/ml.
The sequences of the primers used to detect both a wild-type (1 kb) and a mutant (450 bp) band are given below:
5'-TGGCTGACCTCCTCTTTGTCATCA-3'
5'-TGGAGTGTGACAGCTTGGAGATGA-3'
| RESULTS |
|---|
|
|
|---|
2000 cells) was amplified using the Clontech
Smart cDNA synthesis kit and 24 cycles of PCR. Two independent E10.5 samples
and two E12.5 samples were applied to the MG-U74Av2 array (12,488 features).
On the array, CXCR4 was found to be present at similar levels in E10.5 and
E12.5 PGCs (Fig. 1A). This
observation was confirmed by RTPCR using unamplified PGC cDNA
(Fig. 1B). Additionally, we
have used quantitative RT-PCR to demonstrate that CXCR4 is enriched in PGCs
relative to the somatic tissue of the gonad
(Fig. 1C).
|
SDF1 alters PGC migration in slice cultures
To determine whether added SDF1 could affect PGC behavior, we cultured
transverse slices from the hindgut regions of E9.5 embryos for 20 hours in
serum-free medium, either in the presence or absence of added SDF1. PGC
behavior was observed in the slices using the Oct4
PE:GFP+
transgene, which allows direct observation of the living PGCs
(Anderson et al., 2000
). In the
absence of SDF1, germ cells emerged from the hindgut, exclusively from its
dorsal aspect, and divided into two bilateral streams, which migrated
laterally towards the genital ridges (Fig.
2A). At the end of the culture period, germ cells had formed
discrete groups in each genital ridge in 10 out of 21 slices (49%); in 9 out
of 21 slices (42%), germ cells remained more scattered across the midline. In
a small percentage of slices, germ cells failed to migrate significantly
(2/21). This behavior contrasts with that observed previously in high
concentrations of serum (Molyneaux et al.,
2001
), in which PGCs did not migrate directionally in the body
wall mesenchyme, which leads us to conclude that there are inhibitory factors
in serum.
|
Soluble SDF1 slows PGC migration
To test whether the PGC migration defect caused by added SDF1 was caused by
a change in motility, slices were incubated in the presence or absence of
soluble SDF1, and the GFP-marked PGCs were filmed for 7.5 hours starting at
E9.5. Fig. 3A-D shows examples
of beginning and endpoint pictures taken from control
(Fig. 3A,C) and SDF1-treated
slices (Fig. 3B,D) (see Movies
at
http://dev.biologists.org/supplemental/).
The movements of five cells were traced in each movie and the resulting traces
are shown in Fig. 3E,F. Cells
in the SDF1-treated slice had short and twisted trajectories
(Fig. 3F). Similar results were
seen in four slices. Velocity data for these are presented in
Fig. 3G. SDF1 treatment
produced a statistically significant (Student's t-test) decrease in
both the average and maximum velocity of PGCs, showing that PGC motility is
decreased by elevated concentrations of SDF1.
|
|
CXCR4-mutant embryos show defects in germ cell migration and
survival
To determine the role of SDF1 and its receptor CXCR4 during germ cell
migration we analyzed CXCR4-deficient embryos during various stages of germ
cell development. Mutant embryos were compared with control embryos during and
after migration, from E9.5 to E12.5. During this time PGCs in
CXCR4+/+ or CXCR4+/- control embryos leave the hindgut
and migrate dorsally, separate into two bilateral groups, and move into the
genital ridges. CXCR4-mutant embryos could not be distinguished from their
siblings at E9.5 (data not shown), which suggests that the specification of
germ cells and their initial migration into, and then within, the developing
gut, do not require CXCR4. Between E9.5 and E10.5 wild-type PGCs migrate from
the hindgut towards the bilateral genital ridges. In E10.5 mutant sibling
embryos, we detected less germ cells in the genital ridge, and more germ cells
along the mesentery and the hindgut compared with wild type
(Fig. 5A,B). Shortly
thereafter, at E11.5, most control PGCs have entered the genital ridge and the
total number of germ cells has increased in wild-type embryos. However,
CXCR4-deficient embryos showed a striking decrease of PGCs in the genital
ridge compared with wild-type or heterozygous siblings at this stage
(Fig. 5C,D). This defect can
only partially be explained by a delay in migration, as the overall number of
PGCs in the genital ridge and the mesentery was reduced at this stage in the
mutant compared with control embryos. Thus CXCR4 seems to be required for the
proliferation and/or survival of germ cells. In normal embryos, PGCs in the
genital ridge continue to divide, and increase in number from less than 100 at
the onset of migration to more than 25,000 at stage E13
(Tam and Snow, 1981
). We have
quantified the PGC survival defect in CXCR4-mutant animals by counting PGCs in
tissue sections (Fig. 5G).
Beginning at stage E10.5, CXCR4-mutant embryos had less PGCs in the genital
ridge compared with their heterozygous and wild-type siblings. By E12.5, the
number of PGCs in both mutant and wild-type embryos increased by approximately
the same amount (Fig. 5E,F,G),
suggesting that CXCR4 is not required for germ cell survival and/or
proliferation once PGCs reach the genital ridge. These data, together with the
slice culture results, suggest that CXCR4 function in germ cells may initially
be required to mediate the directed migration of germ cells towards the
genital ridge; however, CXCR4 and SDF1 may also control germ cell survival
during migration.
|
|
| DISCUSSION |
|---|
|
|
|---|
The experiments with SDF1-coated beads show that germ cells closest to the
bead (i.e. within a few cell diameters) move to, or remain around, the bead,
whereas those further away ignore the bead and migrate laterally towards the
genital ridges. This suggests either that the chemoattractive range of
SDF1-coated bead is small, or that it is countered, at greater distances, by
the signal provided by the endogenous environment. During migration germ cells
extend long processes (see Movies at
http://dev.biologists.org/supplemental/)
that span at least 2-4 cell diameters. A contact-based mechanism, as
previously suggested as a basis for the action of SDF1 on migrating lateral
line cells (David et al.,
2002
), may therefore also account for the narrow range of effect
of SDF1 on germ cells.
It is interesting to compare the roles of SDF1/CXCR4 in the mouse with
those observed in zebrafish. It is clear that neither species require this
ligand-receptor pair for germ cell formation. However, in the zebrafish,
mutations or oligo-mediated loss-of-function cause defective migration from
its onset (Doitsidou et al.,
2002
; Knaut et al.,
2003
), whereas, in the mouse, CXCR4 is dispensable for the early
migration of PGCs. In the mouse, the early migration is from the posterior
primitive streak (E7.5) into the hindgut endoderm, where they remain actively
motile until E9.5, when they exit dorsally from the hindgut. The SDF1-CXCR4
interaction is not required for this component of migration. This component of
germ cell migration is not shared by the zebrafish, which may explain why it
is not mediated by a common signaling pathway. In the zebrafish, ectopic
migration of germ cells can be easily seen, suggesting that SDF1-CXCR4
interaction is not required for survival, whereas, in the mouse, the numbers
of germ cells are increased by the addition of SDF1 and decreased in
CXCR4-/- embryos.
In conclusion, we have shown that the SDF1-CXCR4 interaction is required for normal colonization of the gonad by PGCs in early mouse embryos. We also show that part of the PGC migration process in the mouse shares a conserved molecular mechanism with the zebrafish, whereas other parts show evolutionary divergence.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Anderson, R., Copeland, T. K., Scholer, H., Heasman, J. and Wylie, C. (2000). The onset of germ cell migration in the mouse embryo. Mech. Dev. 91, 61-68.[CrossRef][Medline]
Bacon, K., Baggiolini, M., Broxmeyer, H., Horuk, R., Lindley, I., Mantovani, A., Maysushima, K., Murphy, P., Nomiyama, H., Oppenheim, J. et al. (2002). Chemokine/chemokine receptor nomenclature. J. Interferon Cytokine Res. 22,1067 -1068.[CrossRef][Medline]
Bleul, C. C., Farzan, M., Choe, H., Parolin, C., Clark-Lewis, I., Sodroski, J. and Springer, T. A. (1996a). The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature 382,829 -833.[CrossRef][Medline]
Bleul, C. C., Fuhlbrigge, R. C., Casasnovas, J. M., Aiuti, A.
and Springer, T. A. (1996b). A highly efficacious lymphocyte
chemoattractant, stromal cell-derived factor 1 (SDF-1). J. Exp.
Med. 184,1101
-1109.
Buckley, C. D., Amft, N., Bradfield, P. F., Pilling, D., Ross,
E., Arenzana-Seisdedos, F., Amara, A., Curnow, S. J., Lord, J. M.,
Scheel-Toellner, D. et al. (2000). Persistent induction of
the chemokine receptor CXCR4 by TGF-beta 1 on synovial T cells contributes to
their accumulation within the rheumatoid synovium. J.
Immunol. 165,3423
-3429.
David, N. B., Sapede, D., Saint-Etienne, L., Thisse, C., Thisse,
B., Dambly-Chaudiere, C., Rosa, F. M. and Ghysen, A. (2002).
Molecular basis of cell migration in the fish lateral line: role of the
chemokine receptor CXCR4 and of its ligand, SDF1. Proc. Natl. Acad.
Sci. USA 99,16297
-16302.
Doitsidou, M., Reichman-Fried, M., Stebler, J., Koprunner, M., Dorries, J., Meyer, D., Esguerra, C. V., Leung, T. and Raz, E. (2002). Guidance of primordial germ cell migration by the chemokine SDF-1. Cell 111,647 -659.[CrossRef][Medline]
Feng, Y., Broder, C. C., Kennedy, P. E. and Berger, E. A. (1996). HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272,872 -877.[Abstract]
Ginsburg, M., Snow, M. H. L. and McLaren, A.
(1990). Primordial germ cells in the mouse embryo during
gastrulation. Development
110,521
-528.
Godin, I., Wylie, C. C. and Heasman, J. (1990). Genital ridges exert long-range effects on mouse primordial germ cell numbers and direction of migration in culture. Development 108,357 -363.[Abstract]
Knaut, H., Werz, C., Geisler, R. and Nusslein-Volhard, C. (2003). A zebrafish homologue of the chemokine receptor Cxcr4 is a germ-cell guidance receptor. Nature 421,279 -282.[CrossRef][Medline]
Lu, M., Grove, E. A. and Miller, R. J. (2002).
Abnormal development of the hippocampal dentate gyrus in mice lacking the
CXCR4 chemokine receptor. Proc. Natl. Acad. Sci. USA
99,7090
-7095.
Ma, Q., Jones, D., Borghesani, P. R., Segal, R. A., Nagasawa,
T., Kishimoto, T., Bronson, R. T. and Springer, T. A. (1998).
Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron
migration in CXCR4- and SDF-1-deficient mice. Proc. Natl. Acad.
Sci. USA 95,9448
-9453.
McGrath, K. E., Koniski, A. D., Maltby, K. M., McGann, J. K. and Palis, J. (1999). Embryonic expression and function of the chemokine SDF-1 and its receptor, CXCR4. Dev. Biol. 213,442 -456.[CrossRef][Medline]
Molyneaux, K. A., Stallock, J., Schaible, K. and Wylie, C. (2001). Time-lapse analysis of living mouse germ cell migration. Dev. Biol. 240,488 -498.[CrossRef][Medline]
Moore, L., Broihier, H., VanDoren, M., Lunsford, L. and Lehmann, R. (1998). Identification of genes controlling germ cell migration and embryonic gonad formation in Drosophila. Development 125,667 -678.[Abstract]
Muller, A., Homey, B., Soto, H., Ge, N., Catron, D., Buchanan, M. E., McClanahan, T., Murphy, E., Yuan, W., Wagner, S. N. et al. (2001). Involvement of chemokine receptors in breast cancer metastasis. Nature 410,50 -56.[CrossRef][Medline]
Pezzi, N., Prieto, I., Kremer, L., Perez Jurado, L. A., Valero,
C., Del Mazo, J., Martinez, A. C. and Barbero, J. L. (2000).
STAG3, a novel gene encoding a protein involved in meiotic chromosome pairing
and location of STAG3-related genes flanking the Williams-Beuren syndrome
deletion. FASEB J. 14,581
-592.
Starz-Gaiano, M., Cho, N. K., Forbes, A. and Lehmann, R. (2001). Spatially restricted activity of a Drosophila lipid phosphatase guides migrating germ cells. Development 128,983 -991.[Abstract]
Tam, P. P. and Snow, M. H. (1981). Proliferation and migration of primordial germ cells during compensatory growth in mouse embryos. J. Embryol. Exp. Morphol. 64,133 -147.[Medline]
Van Doren, M., Broihier, H., Moore, L. and Lehmann, R. (1998). HMG CoA reductase guides migrating primordial germ cells. Nature 396,466 -469.[CrossRef][Medline]
Wertz, K. and Herrmann, G. (2000). Large-scale screen for genes involved in gonad development. Mech. Dev. 98,51 -70.[CrossRef][Medline]
Wylie, C. (1999). Germ Cells. Cell 96,165 -174.[CrossRef][Medline]
Zhang, N., Zhang, J., Purcell, K., Cheng, Y. and Howard, K. (1997). The Drosophila protein Wunen repels migrating germ cells. Nature 385,64 -66.[CrossRef][Medline]
Zou, Y. R., Kottmann, A. H., Kuroda, M., Taniuchi, I. and Littman, D. R. (1998). Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 393,595 -599.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
C. R. Nicholas, S. L. Chavez, V. L. Baker, and R. A. Reijo Pera Instructing an Embryonic Stem Cell-Derived Oocyte Fate: Lessons from Endogenous Oogenesis Endocr. Rev., May 1, 2009; 30(3): 264 - 283. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Raz and H. Mahabaleshwar Chemokine signaling in embryonic cell migration: a fisheye view Development, April 15, 2009; 136(8): 1223 - 1229. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bucay, M. Yebra, V. Cirulli, I. Afrikanova, T. Kaido, A. Hayek, and A. M.P. Montgomery A Novel Approach for the Derivation of Putative Primordial Germ Cells and Sertoli Cells from Human Embryonic Stem Cells Stem Cells, January 1, 2009; 27(1): 68 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Kunwar, H. Sano, A. D. Renault, V. Barbosa, N. Fuse, and R. Lehmann Tre1 GPCR initiates germ cell transepithelial migration by regulating Drosophila melanogaster E-cadherin J. Cell Biol., October 6, 2008; 183(1): 157 - 168. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Sang, M. S. Curran, and A. W. Wood Paracrine Insulin-Like Growth Factor Signaling Influences Primordial Germ Cell Migration: In Vivo Evidence from the Zebrafish Model Endocrinology, October 1, 2008; 149(10): 5035 - 5042. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakamura, Y. Yamamoto, F. Usui, T. Mushika, T. Ono, A. R. Setioko, K. Takeda, K. Nirasawa, H. Kagami, and T. Tagami Migration and Proliferation of Primordial Germ Cells in the Early Chicken Embryo Poult. Sci., October 1, 2007; 86(10): 2182 - 2193. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bowles and P. Koopman Retinoic acid, meiosis and germ cell fate in mammals Development, October 1, 2007; 134(19): 3401 - 3411. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Boldajipour and E. Raz What Is Left Behind--Quality Control in Germ Cell Migration Sci. Signal., April 24, 2007; 2007(383): pe16 - pe16. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Runyan, K. Schaible, K. Molyneaux, Z. Wang, L. Levin, and C. Wylie Steel factor controls midline cell death of primordial germ cells and is essential for their normal proliferation and migration Development, December 15, 2006; 133(24): 4861 - 4869. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zheng, S.-h. Oh, Y. Jung, and B. E. Petersen Oval Cell Response in 2-Acetylaminofluorene/Partial Hepatectomy Rat Is Attenuated by Short Interfering RNA Targeted to Stromal Cell-Derived Factor-1 Am. J. Pathol., December 1, 2006; 169(6): 2066 - 2074. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.R. Barnett, C. Schilling, C.R. Greenfeld, D. Tomic, and J.A. Flaws Ovarian follicle development and transgenic mouse models Hum. Reprod. Update, September 1, 2006; 12(5): 537 - 555. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Burger and T. J. Kipps CXCR4: a key receptor in the crosstalk between tumor cells and their microenvironment Blood, March 1, 2006; 107(5): 1761 - 1767. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Roy and M. M Matzuk Deconstructing mammalian reproduction: using knockouts to define fertility pathways Reproduction, February 1, 2006; 131(2): 207 - 219. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Turnpenny, C. M. Spalluto, R. M. Perrett, M. O'Shea, K. P. Hanley, I. T. Cameron, D. I. Wilson, and N. A. Hanley Evaluating Human Embryonic Germ Cells: Concord and Conflict as Pluripotent Stem Cells Stem Cells, February 1, 2006; 24(2): 212 - 220. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takeuchi, K. Molyneaux, C. Runyan, K. Schaible, and C. Wylie The roles of FGF signaling in germ cell migration in the mouse Development, December 15, 2005; 132(24): 5399 - 5409. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Akekawatchai, J. D. Holland, M. Kochetkova, J. C. Wallace, and S. R. McColl Transactivation of CXCR4 by the Insulin-like Growth Factor-1 Receptor (IGF-1R) in Human MDA-MB-231 Breast Cancer Epithelial Cells J. Biol. Chem., December 2, 2005; 280(48): 39701 - 39708. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sano, A. D. Renault, and R. Lehmann Control of lateral migration and germ cell elimination by the Drosophila melanogaster lipid phosphate phosphatases Wunen and Wunen 2 J. Cell Biol., November 21, 2005; 171(4): 675 - 683. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mahakali Zama, F. P. Hudson III, and M. A. Bedell Analysis of Hypomorphic KitlSl Mutants Suggests Different Requirements for KITL in Proliferation and Migration of Mouse Primordial Germ Cells Biol Reprod, October 1, 2005; 73(4): 639 - 647. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Vasyutina, J. Stebler, B. Brand-Saberi, S. Schulz, E. Raz, and C. Birchmeier CXCR4 and Gab1 cooperate to control the development of migrating muscle progenitor cells Genes & Dev., September 15, 2005; 19(18): 2187 - 2198. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Guo, G. Hangoc, H. Bian, L. M. Pelus, and H. E. Broxmeyer SDF-1/CXCL12 Enhances Survival and Chemotaxis of Murine Embryonic Stem Cells and Production of Primitive and Definitive Hematopoietic Progenitor Cells Stem Cells, September 1, 2005; 23(9): 1324 - 1332. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Balabanian, B. Lagane, J. L. Pablos, L. Laurent, T. Planchenault, O. Verola, C. Lebbe, D. Kerob, A. Dupuy, O. Hermine, et al. WHIM syndromes with different genetic anomalies are accounted for by impaired CXCR4 desensitization to CXCL12 Blood, March 15, 2005; 105(6): 2449 - 2457. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nie, J. Waite, F. Brewer, M.-J. Sunshine, D. R. Littman, and Y.-R. Zou The Role of CXCR4 in Maintaining Peripheral B Cell Compartments and Humoral Immunity J. Exp. Med., November 1, 2004; 200(9): 1145 - 1156. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Martin and S. M. Parkhurst Parallels between tissue repair and embryo morphogenesis Development, July 1, 2004; 131(13): 3021 - 3034. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. De Felici, M.L. Scaldaferri, M. Lobascio, S. Iona, V. Nazzicone, F.G. Klinger, and D. Farini Experimental approaches to the study of primordial germ cell lineage and proliferation Hum. Reprod. Update, May 1, 2004; 10(3): 197 - 206. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||