|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 4, 2003
doi: 10.1242/10.1242/dev.00650
Division of Developmental Biology, Children's Hospital, Cincinnati, OH 45229, USA
* Author for correspondence (e-mail: wylv9m{at}chmcc.org)
Accepted 15 April 2003
| SUMMARY |
|---|
|
|
|---|
Key words: GP130, LIF, Germ cells, Oogenesis, Ovulation, Mouse
| INTRODUCTION |
|---|
|
|
|---|
Germ cell survival and proliferation are regulated at multiple stages of
development. This regulation is vital because errors in germ cell
proliferation cause profound effects on fertility and result in the formation
of germ line tumors. Several growth factors have been identified that can
affect PGC survival/proliferation in culture (reviewed by
Wylie, 1999
). Specifically,
factors controlling the survival of migratory PGCs have been well defined and
a mixture of bFGF, Kit-ligand (KITL) and LIF has been shown to immortalize
PGCs in culture (Matsui et al.,
1992
; Resnick et al.,
1992
). KIT is necessary for PGC survival in vivo based on the
observations that mutations in Kit and Kitl cause a compete
loss of PGCs by E9.5 (Besmer et al.,
1993
). However, the in vivo roles of bFGF and LIF in germ cell
development are uncertain. bFGF-knockout animals are viable, fertile and have
no obvious defects in gametogenesis
(Ortega et al., 1998
).
LIFR-knockout animals have defects in multiple organ systems and die shortly
after birth; however, they appear to have normal numbers of PGCs
(Ware et al., 1995
).
LIF-knockout females are infertile because of a defect in implantation;
however, these animals have normal numbers of oocytes, and these oocytes are
ovulated, fertilize and develop normally when transplanted into a wild-type
uterine environment (Stewart et al.,
1992
).
The lack of an obvious PGC defect in LIF- and LIFR-knockout animals is
surprising considering the profound effect LIF has on PGC survival in culture.
However, LIF is a member of a family of cytokines that exhibit overlapping
functions (reviewed by Taga and Kishimoto,
1997
). In the mouse, the IL6 family consists of six members [IL6,
IL11, LIF, OSM, CNTF and CT1 (SLC6A8 - Mouse Genome Informatics)]. Members of
this family signal through receptor complexes that are dimers (or multimers)
comprising high affinity growth factor specific receptors [e.g. LIFR, OSMR,
IL6R (IL6R
- Mouse Genome Informatics)] and a low affinity common
receptor (GP130; IL6ST - Mouse Genome Informatics). Binding of the IL6 ligands
to their receptor complexes results in the activation of members of the JAK
family, and subsequent phosphorylation of STAT3 (signal transducers and
activator of transcription). Alternatively, GP130-mediated signals can be
transduced through the RAS/MAPK pathway (reviewed by
Taga and Kishimoto, 1997
).
These cytokines share common receptors and common signal transduction
machinery, and this might explain the relatively mild phenotypes resulting
from inactivation of a single family member or a single high affinity
receptor. Ablation of the common receptor (GP130), or a common cytoplasmic
component (STAT3), should affect all IL6 family members and result in stronger
phenotypes. This appears to be the case. STAT3-knockout animals die by E7.5
(Takeda et al., 1997
), and
GP130-null animals die of cardiac and hematological disorders by E15.5
(Yoshida et al., 1996
), or at
birth (Kawasaki et al., 1997
),
depending on the genetic background. Intriguingly, GP130-null animals have
been reported to have fewer numbers of PGCs (T. Taga, unpublished).
In order to clarify the role of the IL6 family in PGC development, we examined PGC numbers in GP130-deficient males and females. In addition, we have used the Cre-loxP system to generate germ-cell-specific ablations of GP130. Surprisingly, our data demonstrate that GP130-mediated signaling is not required for the early stages of PGC development, but reveal a novel role for GP130-mediated signaling late in oogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
PE:GFP lines have been described
previously (Anderson et al.,
1999
PE:GFP strain are described by
Anderson et al. (Anderson et al.,
1999
allele. Presence of this allele was
confirmed by Southern blotting using a PCR generated probe
(Betz et al., 1998
RT-PCR
PGC-containing tissue was dissected from E10.5 and E12.5 animals, and
digested in 500 µl 0.25% trypsin (37°C for 15 minutes). The tissue was
triturated into a single cell suspension and filtered through a nylon mesh.
The mesh was washed with 1 ml 2% BSA in PBS, and the resulting 1.5 ml
suspension was sorted using a FACS Vantage. GFP-positive cells (typically 98%
pure) were spun down (10 minutes, 1,000 g), and lysed in 300
µl TriZol Reagent (Invitrogen). RNA was isolated as per the manufacturer's
instructions using 5 µg of linear polyacrylamide (Sigma) as a carrier. 15
ng RNA (from 3000 cells) was reverse transcribed (1 hour, 42°C) in a 10
µl volume containing 1xbuffer (Invitrogen), 100 ng oligo dT, 2 mM
DTT, 0.5 mM dNTPs, 10 U RNAsin (Promega) and 200 U Superscript II
(Invitrogen). PCR was performed on 1 µl of the RT reaction using RedMix
Plus as a source of Taq, buffer and dNTPs. Cycling was performed as described
above. Primers were:
GP130 (forward: CGTGGGAAAGGAGATGGTTGTG; reverse: AGGGTTGTCAGGAGGAAGGCTAAG);
OSMR (forward: CACGATGGGCTATGTTGTGGAC; reverse: TCTGAGGTGATGGTGGTGCTTG); and
LIFR (forward: ATTTCCCCAGTTGCTGAGC; reverse: TCTTCCTCTGCTTTGGCTTGC).
Primers for the PGC marker gene Kit, and the somatically expressed
gene Kitl (Steel), were used as positive and negative
controls, respectively (Anderson et al.,
1999
).
Immunostaining
Whole-mount GP130 staining was performed on PGC-containing tissue dissected
from E10.5 embryos. Embryos were dissected in PBS/2% bovine serum, and tissues
were fixed in 4%PFA/PBS for 20 minutes at room temperature. Tissues were
washed for five minutes (3x with PBS and stored overnight in PBS+0.1%
TX-100 (4°C, with rocking). Two GP130 antibodies were used; a goat
anti-GP130 (g
GP130) (R and D Systems), raised against the extracellular
domain, and a rabbit anti-GP130 (M20) (Santa Cruz) raised against the
cytoplasmic domain. When using the goat primary, tissues were blocked
overnight at 4°C in 2% donkey serum in PBS. For the rabbit primary,
tissues were blocked in 2% horse serum/2% BSA. Tissues were incubated
overnight at 4°C with primary antibody at a concentration of 2 µg/ml in
the appropriate blocking buffer. Tissues were washed for 1 hour (5x) in
PBS/0.1% TX-100 at room temperature. Secondary antibodies were purchased from
Jackson ImmunoResearch Laboratories, and used at 15 µg/ml in the
appropriate blocking buffer (4°C, overnight). Tissues were washed as
described and mounted in 75% glycerol on Lab-Tek chambered coverglass
(NalgeNunc International). Images were captured using a Zeis LSM 510 confocal
system.
For later stage embryos or adults, frozen sections were prepared. The gonads were dissected and fixed in 4% PFA/PBS for either 20 minutes at room temperature (embryos), or overnight at 4°C (adults). Adult testes were cut in half to allow better penetration of the fixative. The gonads were washed for 5 minutes (3x) in PBS, and then sunk in sucrose (20% sucrose) overnight at 4°C. Gonads were embedded in OCT medium and 12 µm sections cut. Sections were blocked (1 hour at room temperature in the appropriate blocking buffer) and then incubated with 2 µg/ml primary in blocking buffer. Slides were washed for 5 minutes (3x) with PBS and incubated with secondary antibodies (15 µg/ml cy5-conjugated secondary antibodies in blocking buffer for 1 hour at room temperature). Slides were washed as described above and mounted in 75% glycerol with 100 µg/ml DABCO (Sigma).
For western blotting, extracts of embryonic gonads were prepared in NP-40 buffer (1% NP-40 (Sigma) in 10 mM HEPES, 150 mM NaCl, 1.5 mM EDTA) plus a 1:50 dilution of Protease Inhibitor Cocktail (Sigma) and 1 mM PMSF. Membranes were blocked in 5% milk (for M20 staining) or with 2% IgG-free BSA (Jackson ImmunoResearch Laboratories) (for goat anti-GP130 staining) in PBS/0.1% Tween-20. Primary antibodies were used at a concentration of 1 µg/ml in the appropriate blocking solution.
Histology
For Hematoxylin and Eosin staining, ovaries were fixed in 4%PFA/PBS at
4°C overnight. They were then dehydrated and processed for paraffin
sectioning. 12 µm sections were cut and stained with Harris Hematoxylin and
Eosin (Sigma).
Ovulation tests
Natural breeds were set up between CD1 and GP130Flox/
TNAPCre/+
animals. Females were sacrificed by CO2 inhalation, and ovulated
eggs were collected at noon (E0.5) after observing a copulation plug. Eggs
were collected and cultured in M2 medium
(Hogan et al., 1994
).
Germ cell counts
Individual gonads from E13.5 embryos were digested in 50 µl trypsin
(37°C for 15 minutes). The digestion was stopped by the addition of 5
µl 50 mg/ml soybean trypsin inhibitor (Sigma). Tissues were triturated into
a single cell suspension and gfp-positive cells were counted on a
hemacytometer. Three fields were counted and averaged to determine the
concentration of gfp-positive cells. Total PGCs=concentrationx55
µl.
| RESULTS |
|---|
|
|
|---|
GP130). Both antibodies recognized a
single 150 kDa protein band in extracts prepared from E14.5 male and female
gonads (Fig. 1B; data not
shown). Using the g
GP130 antibody we detected GP130-surface staining on
PGCs at E10.5 and at E15.5 (Fig.
1C-F). At all embryonic stages, staining in the PGCs appeared
weaker than staining in the surrounding somatic tissue. GP130 was also
expressed in follicle cells (both granulosa and thecal) and oocytes of the
adult ovary (Fig. 2A-C).
Staining in primordial stage oocytes was weak and diffuse
(Fig. 2B), whereas cell surface
staining became more obvious in growing oocytes (2C). The appearance of
staining in the adult testes varied from tubule to tubule, suggesting that
GP130 expression is also stage specific during spermiogenesis
(Fig. 2D-F). Membrane staining
was evident in primary spermatocytes in tubules exhibiting a few elongating
spermatids (Fig. 2E). Intense
membrane staining was visible within all spermatocytes and spermatids of
tubules containing mature sperm (Fig.
2F). The M20 antibody also stained germ cells from embryonic and
adult stages, but it appeared to detect mainly a cytoplasmic pool of the
protein (Fig. 2G,H).
|
|
PE:GFP animals (Anderson et
al., 1999
/+ GFP+/- double
heterozygotes. The efficiency of excision was high in male and female
GP130Flox/+ TNAPCre/+ parents based on transmission of the GP130
allele
(32 out of the 58 offspring examined were GP130
/+). The GFP marker was
bred to homozygosity and GP130
/+ GFP+/+ animals were crossed
to generate GP130
/
animals carrying the GFP germ cell marker. No
GP130
/
offspring survived until birth in these crosses. However,
the normal Mendelian ratio of GP130
/
animals was observed at
E13.5 (in 4 litters, 14 out of 48 pups were GP130
/
). At this
stage most GP130
/
animals were indistinguishable from their
littermates (5 out of 14 were visibly runted). However, GP130
/
collected at later stages (E15.5) were smaller than their littermates and
visibly anemic.
As the reduced numbers of PGCs observed by Taga (T. Taga, unpublished)
could be a secondary effect caused by hematopoietic and/or other disorders in
GP130-null animals, we have chosen to examine PGC numbers only in those E13.5
embryos that appeared overtly normal. Gonads were dissected from E13.5
embryos, sectioned and stained for GP130 expression. The loxP sites in the
GP130Flox allele flank exon 16 (1852-1917 nucleotides of the coding sequence),
which encodes for the transmembrane domain of GP130. Hence, excision of the
GP130Flox allele should result in the formation of a non-functional secreted
form of GP130 (Betz et al.,
1998
). However, antibody staining of GP130
/
gonads
revealed a reduction in overall GP130 staining as opposed to a relocalization
of the protein (Fig. 3A-D).
This is similar to the reduction of overall GP130 levels observed by Hirota et
al. (Hirota et al., 1999
) in
MLC2vCreKI/+ GP130Flox/GP130Flox hearts. The small, GFP-positive structures
(punctate staining) seen in the GP130
/
ovary
(Fig. 3A) are probably
apoptotic germ cells. We have performed PARP staining on similar ovary
sections, and have observed PARP-positive (apoptotic) cell fragments occurring
at similar frequencies in both GP130
/
and wild-type ovaries
(data not shown). Also, despite reduced GP130 staining, both male and female
GP130
/
gonads still appeared to have normal numbers of PGCs. To
quantitate PGC numbers, individual gonads were dissected from E13.5 embryos
and dissociated in trypsin; GFP-positive cells were then counted as described
in the Materials and Methods. GP130
/
males exhibited a slight,
but statistically significant reduction in germ cell numbers; however, females
were normal (Fig. 3E). Hence,
GP130 does not appear to play an essential role in the early development of
PGCs.
|
TNAP-Cre/+ animals (22/169) was recovered in these crosses, and these animals
were similar in size to their heterozygous and homozygous littermates.
Four-month-old GCKO females or males were crossed with CD1 animals in order to
test their breeding performance. When possible, Flox/
Cre-siblings were
selected as controls; however, when siblings of this genotype were not
available +/
Cre+ or +/+ Cre+ animals were used. When compared with
their siblings, the breeding performance of GCKO females declined in their
second and third litters (when females were 5 months and 6 months old,
respectively; Fig. 4A). Several
GCKO females (n=3) produced no pups in multiple breeding attempts.
The breeding performance of GCKO males was indistinguishable from their
littermates (n=4; data not shown).
|
allele to offspring (see above). To examine
excision efficiency of the second allele, ovaries from GCKO animals were
fixed, sectioned and stained for GP130. Growing and antral-stage oocytes from
GCKO ovaries were surrounded by an intense ring of GP130 staining
(Fig. 4B). Secreted GP130
filled the developing zona, and it was not possible to distinguish any
membrane staining at the surface of the oocyte. This staining was dramatically
different from wild type (Fig.
4C) and was distinct from GP130 heterozygotes
(Fig. 4D). Heterozygous
littermates typically exhibit a less intense ring of secreted GP130. Staining
intensity of 18 growing or antral-stage GCKO oocytes (from six females), and
18 growing or antral-stage heterozygous sibling oocytes (from six females)
were quantified by summing the pixel intensities within the secreted ring of
GP130 using NIH Image
(http://rsb.info.nih.gov/nih-image/index.html),
and then subtracting the staining intensity of the IgG control. GCKO oocytes
had an average stain of 1,222,860±632,660. Controls had an average
stain of 575,716±688,605. Hence, taken as a population, GCKO females
exhibit twice the staining of their sibling controls (n=18, Student's
t-test P<0.006); however, staining variations were large
both between animals and within individual ovaries (see
Fig. 4E).
Inactivation of GP130 in germ cells does not have a dramatic effect
on ovary morphology
Morphometric analysis was performed on GCKO ovaries to determine whether
loss of GP130 function affects oocyte survival and/or maturation. After breed
testing, ovaries from seven-month-old females were fixed, serially sectioned,
and then stained with Hematoxylin and Eosin
(Fig. 5). Follicles were
counted in every fifth section (i.e at 60 µm intervals). GP130 GCKO ovaries
had normal total numbers of follicles (Fig.
5C); however, they had a slight reduction in the percentage of
primary follicles (statistically significant, P<0.03, Student's
t-test), and a slight increase in the percentage of atretic follicles
(not significant; Fig. 5D). Hence, loss of GP130 function did not dramatically perturb oocyte
survival.
|
|
| DISCUSSION |
|---|
|
|
|---|
Data from culture experiments led us to expect that GP130 signaling would
be important for mediating germ cell survival during the period in which PGCs
are migrating and colonizing the gonads. Consequently, we have analyzed PGC
numbers in male and female E13.5 GP130-deficient embryos. The males were found
to have a slight but statistically significant decrease in PGC numbers,
whereas the females were normal. This suggests that an IL6 family member maybe
required in the developing testis to support either PGC survival or
proliferation. However, germ cell specific ablation of GP130 had no effect on
male fertility or testis morphology in the adult (data not shown). This
suggests that GP130 signaling is not necessary in germ cells in the male. Hara
et al. have shown that OSM is a potent mitogen for Sertoli cells
(Hara et al., 1998
). We
speculate that our GP130-deficient males may have a defect in Sertoli cell
development that indirectly affects PGC numbers. Additionally, LIF is believed
to promote PGC survival in culture by blocking apoptosis
(Pesce et al., 1993
); however,
we did not observe an increase in apoptotic PGCs in GP130-deficient testes
(data not shown). Finally, Chuma and Nakatsuji have recently reported that LIF
can prevent male PGCs from undergoing meiosis in culture
(Chuma and Nakatsuji, 2001
). It
is possible that LIF might control this process in vivo and that ablation of
GP130 could indirectly affect PGC numbers in the male by altering their
meiotic state; however, on the basis of nuclear morphology, it does not appear
that PGCs in GP130-null testes are initiating meiosis (data not shown).
Contrary to the potent effects described for LIF on cultured PGCs,
signaling by LIF/IL6 family members appears to have only a slight role (in the
male) during the early stages of PGC development. However, GP130 signaling is
required for germ cell function in the female. GCKO females produce either
small litters or no litters at all. Ovaries from GCKO females have normal
numbers of follicles, but a slight reduction in the percentage of primary
stage follicles. Consistent with this, Nilsson et al. have demonstrated that
LIF can promote the primordial to primary transition in cultured rat follicles
(Nilsson et al., 2002
). bFGF
(Nilsson et al., 2001
) and
KITL (Packer et al., 1994
)
have also been shown to promote growth in cultured follicles. In addition,
certain mutations in Kitl (Slpan and Slt) can
impair oocyte growth in vivo (Huang et al.,
1993
; Kuroda et al.,
1988
). However, unlike KIT, GP130-mediated signaling is not
obligatory for this transition, as the GCKO females still have follicles
present at all stages.
GCKO females exhibit a dramatic and significant reduction in the number of
oocytes released during natural matings, and the oocytes that are released
rarely cleave. Hence, we propose that the fertility defect observed in these
animals is caused by a defect occurring late in oocyte growth. By contrast,
Ernst et al. (Ernst et al.,
2001
) have reported that females homozygous for a mutated form of
GP130 that lacks the STAT3 binding domain (GP130
STAT3) are not impaired
in ovulation but instead exhibit a defect in implantation similar to the
defect described for LIF-/- females
(Stewart et al., 1992
). We are
uncertain as to why our GCKO animals and the GP130
STAT3 animals have
defects at different stages. GP130
STAT3 homozygous animals are viable,
unlike GP130
homozygotes, indicating that the
STAT3 allele
retains some signaling function (perhaps through the RAS/MAPK pathway), and
perhaps this activity is sufficient to rescue oocyte maturation/ovulation. We
have generated a limited number of STAT3 GCKO animals (see below), and the
females have a phenotype similar to that of our GP130 GCKO females (data not
shown). This suggests that STAT3 is required for this step. Also, it rules out
any possible dominant-negative effect resulting from the large amount of
secreted GP130 produced by our mutant animals.
Our results suggest that GP130 signaling is dispensable in the male germ
line but has an unexpected function in female germ cells. This conclusion
depends on the efficiency and tissue specificity of the TNAP-Cre line. This
line has been previously described (Lomeli
et al., 2000
). Briefly, Lomeli et al. observed
60% excision
of a reporter gene by E13.5 (Lomeli et
al., 2000
). In addition, transmission of the GP130
allele
indicates that excision is highly efficient and can reach 100% in adults.
Hence, Cre-mediated excision appears to be efficient at this locus. Lomeli et
al. have reported that some animals of the TNAP-Cre line can exhibit
non-tissue specific expression of Cre, particularly if the TNAP-Cre allele is
inherited from the mother (Lomeli et al.,
2000
). We were able to obtain a normal Mendelian ratio of GP130
GCKO animals using either male or female carriers for Cre. This suggests that
the leakiness of this Cre line is not extensive enough to result in lethality.
However, we recovered very few GCKO STAT3 animals (2 out of 134 pups),
indicating that TNAP-Cre mediated excision was not entirely effective at
bypassing lethality in this case. Clearly, the efficiency of excision and the
consequence of leaky Cre expression need to be evaluated on a case-by-case
basis.
In summary, we have clarified the role of GP130-mediated signaling in PGC
development by examining both PGC numbers in GP130-deficient animals and
breeding performance in GP130 GCKO adults. Surprisingly, our evidence suggests
that IL6 signaling is not vital for either PGC proliferation or survival in
early embryos. We suggest that GP130-mediated signaling is necessary to
control some aspect of oocyte growth. Nichols et al. have recently reported
that GP130-mediated signaling plays a subtle role in maintaining the
survival/pluripotency of blastocysts arrested in diapause
(Nichols et al., 2001
).
Perhaps GP130 signaling performs a similar function in growing oocytes, which
must maintain pluripotency and meiotic arrest during a long period of growth.
Future work will focus on trying to understand what aspect of oocyte growth is
controlled by GP130 signaling.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Anderson, R., Fassler, R., Georges-Labouesse, E., Hynes, R. O., Bader, B. L., Kreidberg, J. A., Schaible, K., Heasman, J. and Wylie, C. (1999). Mouse primordial germ cells lacking beta1 integrins enter the germline but fail to migrate normally to the gonads. Development 126,1655 -1664.[Abstract]
Besmer, P., Manova, K., Duttlinger, R., Huang, E. J., Packer, A., Gyssler, C. and Bachvarova, R. F. (1993). The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl.125 -137.
Betz, U. A., Bloch, W., van den Broek, M., Yoshida, K., Taga,
T., Kishimoto, T., Addicks, K., Rajewsky, K. and Muller, W.
(1998). Postnatally induced inactivation of gp130 in mice results
in neurological, cardiac, hematopoietic, immunological, hepatic and pulmonary
defects. J. Exp. Med.
188,1955
-1965.
Chuma, S. and Nakatsuji, N. (2001). Autonomous transition into meiosis of mouse fetal germ cells in vitro and its inhibition by gp130-mediated signaling. Dev. Biol. 229,468 -479.[CrossRef][Medline]
Ernst, M., Inglese, M., Waring, P., Campbell, I. K., Bao, S.,
Clay, F. J., Alexander, W. S., Wicks, I. P., Tarlinton, D. M., Novak, U. et
al. (2001). Defective gp130-mediated signal transducer and
activator of transcription (STAT) signaling results in degenerative joint
disease, gastrointestinal ulceration, and failure of uterine implantation.
J. Exp. Med. 194,189
-203.
Hara, T., Tamura, K., de Miguel, M. P., Mukouyama, Y., Kim, H., Kogo, H., Donovan, P. J. and Miyajima, A. (1998). Distinct roles of oncostatin M and leukemia inhibitory factor in the development of primordial germ cells and sertoli cells in mice. Dev. Biol. 201,144 -153.[CrossRef][Medline]
Hirota, H., Chen, J., Betz, U. A., Rajewsky, K., Gu, Y., Ross, J., Jr, Muller, W. and Chien, K. R. (1999). Loss of a gp130 cardiac muscle cell survival pathway is a critical event in the onset of heart failure during biomechanical stress. Cell 97,189 -198.[CrossRef][Medline]
Hogan, B., Beddington, R., Constantini, F. and Lacy, E. (1994). Manipulating the Mouse Embryo. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Huang, E. J., Manova, K., Packer, A. I., Sanchez, S., Bachvarova, R. F. and Besmer, P. (1993). The murine steel panda mutation affects kit-ligand expression and growth of early ovarian follicles. Dev. Biol. 157,100 -109.[CrossRef][Medline]
Kawasaki, K., Gao, Y. H., Yokose, S., Kaji, Y., Nakamura, T.,
Suda, T., Yoshida, K., Taga, T., Kishimoto, T., Kataoka, H. et al.
(1997). Osteoclasts are present in gp130-deficient mice.
Endocrinology 138,4959
-4965.
Kuroda, H., Terada, N., Nakayama, H., Matsumoto, K. and Kitamura, Y. (1988). Infertility due to growth arrest of ovarian follicles in Sl/Slt mice. Dev. Biol. 126,71 -79.[CrossRef][Medline]
Lass, A., Weiser, W., Munafo, A. and Loumaye, E. (2001). Leukemia inhibitory factor in human reproduction. Fertil. Steril. 76,1091 -1096.[CrossRef][Medline]
Lawson, K. A. and Hage, W. J. (1994). Clonal analysis of the origin of primordial germ cells in the mouse. Ciba Found. Symp. 182,68 -84.[Medline]
Lomeli, H., Ramos-Mejia, V., Gertsenstein, M., Lobe, C. G. and Nagy, A. (2000). Targeted insertion of Cre recombinase into the TNAP gene: excision in primordial germ cells. Genesis 26,116 -117.[CrossRef][Medline]
Manova, K., Nocka, K., Besmer, P. and Bachvarova, R. F.
(1990). Gonadal expression of c-kit encoded at the W locus of the
mouse. Development 110,1057
-1069.
Matsui, Y., Zsebo, K. and Hogan, B. L. (1992). Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture. Cell 70,841 -847.[CrossRef][Medline]
McLaren, A. (2001). Mammalian germ cells: birth, sex, and immortality. Cell Struct. Funct. 26,119 -122.[CrossRef][Medline]
Nichols, J., Chambers, I., Taga, T. and Smith, A. (2001). Physiological rationale for responsiveness of mouse embryonic stem cells to gp130 cytokines. Development 128,2333 -2339.
Nilsson, E., Parrott, J. A. and Skinner, M. K. (2001). Basic fibroblast growth factor induces primordial follicle development and initiates folliculogenesis. Mol. Cell. Endocrinol. 175,123 -130.[CrossRef][Medline]
Nilsson, E. E., Kezele, P. and Skinner, M. K. (2002). Leukemia inhibitory factor (LIF) promotes the primordial to primary follicle transition in rat ovaries. Mol. Cell. Endocrinol. 188,65 -73.[CrossRef][Medline]
Ortega, S., Ittmann, M., Tsang, S. H., Ehrlich, M. and Basilico,
C. (1998). Neuronal defects and delayed wound healing in mice
lacking fibroblast growth factor 2. Proc. Natl. Acad. Sci.
USA 95,5672
-5677.
Packer, A. I., Hsu, Y. C., Besmer, P. and Bachvarova, R. F. (1994). The ligand of the c-kit receptor promotes oocyte growth. Dev. Biol. 161,194 -205.[CrossRef][Medline]
Pesce, M., Farrace, M. G., Piacentini, M., Dolci, S. and De Felici, M. (1993). Stem cell factor and leukemia inhibitory factor promote primordial germ cell survival by suppressing programmed cell death (apoptosis). Development 118,1089 -1094.[Abstract]
Resnick, J. L., Bixler, L. S., Cheng, L. and Donovan, P. J. (1992). Long-term proliferation of mouse primordial germ cells in culture. Nature 359,550 -551.[CrossRef][Medline]
Saito, M., Yoshida, K., Hibi, M., Taga, T. and Kishimoto, T. (1992). Molecular cloning of a murine IL-6 receptor-associated signal transducer, gp130, and its regulated expression in vivo. J. Immunol. 148,4066 -4071.[Abstract]
Stewart, C. L., Kaspar, P., Brunet, L. J., Bhatt, H., Gadi, I., Kontgen, F. and Abbondanzo, S. J. (1992). Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature 359,76 -79.[CrossRef][Medline]
Taga, T. and Kishimoto, T. (1997). Gp130 and the interleukin-6 family of cytokines. Annu. Rev. Immunol. 15,797 -819.[CrossRef][Medline]
Takeda, K., Noguchi, K., Shi, W., Tanaka, T., Matsumoto, M.,
Yoshida, N., Kishimoto, T. and Akira, S. (1997). Targeted
disruption of the mouse Stat3 gene leads to early embryonic lethality.
Proc. Natl. Acad. Sci. USA
94,3801
-3804.
Tam, P. P. and Snow, M. H. (1981). Proliferation and migration of primordial germ cells during compensatory growth in mouse embryos. J. Embryol. Exp. Morphol. 64,133 -147.[Medline]
Ware, C. B., Horowitz, M. C., Renshaw, B. R., Hunt, J. S., Liggitt, D., Koblar, S. A., Gliniak, B. C., McKenna, H. J., Papayannopoulou, T., Thoma, B. et al. (1995). Targeted disruption of the low-affinity leukemia inhibitory factor receptor gene causes placental, skeletal, neural and metabolic defects and results in perinatal death. Development 121,1283 -1299.[Abstract]
Wylie, C. (1999). Germ cells. Cell 96,165 -174.[CrossRef][Medline]
Yoshida, K., Taga, T., Saito, M., Suematsu, S., Kumanogoh, A.,
Tanaka, T., Fujiwara, H., Hirata, M., Yamagami, T., Nakahata, T. et al.
(1996). Targeted disruption of gp130, a common signal transducer
for the interleukin 6 family of cytokines, leads to myocardial and
hematological disorders. Proc. Natl. Acad. Sci. USA
93,407
-411.
This article has been cited by other articles:
![]() |
Z. Liu, D. G. de Matos, H.-Y. Fan, M. Shimada, S. Palmer, and J. S. Richards Interleukin-6: An Autocrine Regulator of the Mouse Cumulus Cell-Oocyte Complex Expansion Process Endocrinology, July 1, 2009; 150(7): 3360 - 3368. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Heaney, M. V. Michelson, K. K. Youngren, M.-Y. J. Lam, and J. H. Nadeau Deletion of eIF2beta suppresses testicular cancer incidence and causes recessive lethality in agouti-yellow mice Hum. Mol. Genet., April 15, 2009; 18(8): 1395 - 1404. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kocer, J. Reichmann, D. Best, and I. R. Adams Germ cell sex determination in mammals Mol. Hum. Reprod., April 1, 2009; 15(4): 205 - 213. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q.-Y. Sun, K. Liu, and K. Kikuchi Oocyte-Specific Knockout: A Novel In Vivo Approach for Studying Gene Functions During Folliculogenesis, Oocyte Maturation, Fertilization, and Embryogenesis Biol Reprod, December 1, 2008; 79(6): 1014 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Childs, P. T.K. Saunders, and R. A. Anderson Modelling germ cell development in vitro Mol. Hum. Reprod., September 1, 2008; 14(9): 501 - 511. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kida, M. L. Mucenski, A. R. Thitoff, T. D. Le Cras, K.-S. Park, M. Ikegami, W. Muller, and J. A. Whitsett GP130-STAT3 Regulates Epithelial Cell Migration and Is Required for Repair of the Bronchiolar Epithelium Am. J. Pathol., June 1, 2008; 172(6): 1542 - 1554. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shimada, Y. Yanai, T. Okazaki, Y. Yamashita, V. Sriraman, M. C. Wilson, and J. S. Richards Synaptosomal-Associated Protein 25 Gene Expression Is Hormonally Regulated during Ovulation and Is Involved in Cytokine/Chemokine Exocytosis from Granulosa Cells Mol. Endocrinol., October 1, 2007; 21(10): 2487 - 2502. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.R. Barnett, C. Schilling, C.R. Greenfeld, D. Tomic, and J.A. Flaws Ovarian follicle development and transgenic mouse models Hum. Reprod. Update, September 1, 2006; 12(5): 537 - 555. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-M. Cai, Y.-T. Gui, X. Guo, J. Yu, L.-D. Guo, L.-B. Zhang, H. Wang, and J. Yu Low Expression of Glycoprotein Subunit 130 in Ejaculated Spermatozoa from Asthenozoospermic Men J Androl, September 1, 2006; 27(5): 645 - 652. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. DiNapoli, J. Batchvarov, and B. Capel FGF9 promotes survival of germ cells in the fetal testis Development, April 15, 2006; 133(8): 1519 - 1527. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Roy and M. M Matzuk Deconstructing mammalian reproduction: using knockouts to define fertility pathways Reproduction, February 1, 2006; 131(2): 207 - 219. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Dorval-Coiffec, J.-G. Delcros, H. Hakovirta, J. Toppari, B. Jegou, and C. Piquet-Pellorce Identification of the Leukemia Inhibitory Factor Cell Targets Within the Rat Testis Biol Reprod, March 1, 2005; 72(3): 602 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. De Felici, M.L. Scaldaferri, M. Lobascio, S. Iona, V. Nazzicone, F.G. Klinger, and D. Farini Experimental approaches to the study of primordial germ cell lineage and proliferation Hum. Reprod. Update, May 1, 2004; 10(3): 197 - 206. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Abir, B. Fisch, S. Jin, M. Barnnet, S. Freimann, R. Van den Hurk, D. Feldberg, S. Nitke, H. Krissi, and A. Ao Immunocytochemical detection and RT-PCR expression of leukaemia inhibitory factor and its receptor in human fetal and adult ovaries Mol. Hum. Reprod., May 1, 2004; 10(5): 313 - 319. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Stallock, K. Molyneaux, K. Schaible, C. M. Knudson, and C. Wylie The pro-apoptotic gene Bax is required for the death of ectopic primordial germ cells during their migration in the mouse embryo Development, December 29, 2003; 130(26): 6589 - 6597. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||