|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 4, 2003
doi: 10.1242/10.1242/dev.00662
Zebrafish Neurogenetics Junior Research Group, Institute of Virology, Technical University-Munich, Trogerstrasse 4b, D-81675 Munich, Germany GSF-National Research Center for Environment and Health, Institute of Developmental Genetics, Ingolstaedter Landstrasse 1, D-85764 Neuherberg, Germany
* Author for correspondence (e-mail: bally{at}gsf.de)
Accepted 30 May 2003
| SUMMARY |
|---|
|
|
|---|
Key words: her5, Midbrain-hindbrain, Midbrain-hindbrain boundary, Zebrafish, acerebellar, no-isthmus, ET-cloning, Transgenesis
| INTRODUCTION |
|---|
|
|
|---|
The midbrain-hindbrain (MH) domain of the embryonic neural tube displays
extensive plasticity linked to specific ontogenic properties that make it an
important model to study developmental dynamics
(Martinez, 2001
;
Rhinn and Brand, 2001
;
Wurst and Bally-Cuif, 2001
).
The MH can be morphologically identified at early somitogenesis stages as
comprising the mesencephalic vesicle and the first rhombencephalic vesicle (or
metencephalon) (Fig. 1); the
latter- also called `rhombomere A' in the chicken embryo
(Vaage, 1969
) - will later
subdivide into rhombomeres (r) 1 and 2. Detailed fate map analyses in avian
embryos demonstrated that the mesencephalon generates all midbrain structures,
i.e. essentially an alar visual center, the tectum and a basal tegmentum,
containing cranial motorneuron III (Marin
and Puelles, 1994
; Martinez
and Alvarado-Mallart, 1989
). In addition, the caudal third of the
alar mesencephalic domain contributes to the dorsomedial part of the
cerebellar plate (Hallonet and Le Douarin,
1990
; Hallonet et al.,
1993
; Martinez and
Alvarado-Mallart, 1989
), while the alar domain of r1 will give
rise to remaining, lateral cerebellar structures
(Wingate and Hatten, 1999
)
(Fig. 1). Finally, the basal r1
territory will generate the pons, of which a prominent output is cranial
motorneuron IV. These distinct fates are prefigured by molecular gradients in
the expression of MH genes such as engrailed-2/3 or ephrins
(Martinez, 2001
;
Rhinn and Brand, 2001
;
Wurst and Bally-Cuif, 2001
).
MH structures, although physically and functionally distinct, develop in a
concerted fashion. Their growth and patterning is dependent upon and
coordinated by an organizing center [the `isthmic organizer' (IsO) or
`isthmus'] located at the midbrain-hindbrain boundary (MHB)
(Martinez, 2001
;
Rhinn and Brand, 2001
;
Wurst and Bally-Cuif, 2001
)
(Fig. 1). Among the factors
that likely mediate IsO activity are the secreted proteins Fgf8 and Wnt1,
expressed on either side of the MHB. Accordingly, genetic analyses in the
mouse, chicken and zebrafish demonstrate that a positive crossregulatory loop
between the expression of IsO markers, of Pax2/5/8- and of Engrailed-family
members is involved, at somitogenesis stages, in the stabilization of
identities surrounding the MHB (Martinez,
2001
; Rhinn and Brand,
2001
; Wurst and Bally-Cuif,
2001
).
|
The MH domain is also characterized by a striking profile of neurogenesis,
where neuronal differentiation in the immediate vicinity of the MHB (the
so-called `intervening zone', IZ) is much delayed compared to other domains of
the neural tube (Bally-Cuif et al.,
1993
; Palmgren,
1921
; Vaage, 1969
;
Wullimann and Knipp, 2000
)
(Fig. 1). IZ formation is
permitted by an active process of neurogenesis inhibition at the MHB
(Geling et al., 2003
) and, in
zebrafish, the bHLH E(spl)-like factor Her5
(Müller et al., 1996
) was
identified as the crucial element both necessary and sufficient for the
formation of the basal IZ domain (Geling
et al., 2003
). The IZ plays a crucial role in controlling the
extent of MH neurogenesis over time.
Understanding the dynamics of MH regional specification and neurogenesis
are thus important issues as sustained MH plasticity correlates with the
development of distinct and organized (1) MH derivatives and (2) neurogenesis
domains. To approach this question, we chose to focus on the regulation of
her5 expression. Two main reasons motivated our choice. First,
her5 is the earliest known marker of the MH area
(Bally-Cuif et al., 2000
;
Müller et al., 1996
), and
as such is the best candidate to label most MH precursors from the moment they
are induced within the neural plate. If this proves true, tracing the
descendants of cells expressing her5 at its onset thus should provide
the best available means of assessing the fate of MH precursors in vivo.
Second, because her5 expression within the IZ crucially controls the
neurogenesis process, looking at the regulation of her5 expression
should permit the appreciation of the dynamics of MH neurogenesis
progression.
We report here the construction of zebrafish embryos where a stable
reporter labels all descendents of her5-expressing cells. To maximize
our chances of isolating all her5 regulatory elements, we used in
vitro homologous recombination (ET-cloning)
(Muyrers et al., 2000
;
Muyrers et al., 1999
;
Zhang et al., 1998
) to
introduce an egfp reporter cDNA at the her5 locus in a PAC
containing more than 40 kb of her5 upstream sequence. We demonstrate
in several independent lines that gfp expression in transgenic
embryos carrying the recombined her5PAC:egfp construct faithfully
reproduces her5 transcription at all stages, including the earliest
step of her5 induction. Using the stability of GFP protein as a
marker for the descendants of her5-expressing cells, we first
demonstrate that the earliest her5-expression domain at gastrulation
encompasses and thus is the first known marker of the whole MH anlage. By
comparing the distribution of her5 RNA and GFP protein, we reveal a
dynamic restriction of her5 expression to the MHB over time, and
propose that this phenomenon permits the progression of neurogenesis in a
converging manner towards the MHB during MH development. Finally, we use GFP
to follow her5 progeny in the noi and ace
backgrounds. We demonstrate that MH precursor cells are maintained but express
alternative identities in noi and ace, albeit with striking
differences between the two mutant contexts. Our results suggest a model for
the progressive restriction of potentialities of MH precursors over time, and
the respective roles of Pax2.1 and Fgf8 in this process.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Isolation of her5-containing PACs and determination of
her5 genomic structure
Two independent PACs containing the genomic her5 locus
(BUSMP706P0356Q2, BUSMP706H15152Q2) were isolated by PCR from pools of library
706 (RZPD, Berlin) using the following primers: her5 upstream
5'TAGTAGACCTAGCTGGTCTTTTCAGTCTTTGGAGAGC3', her5 reverse
5'TAAAAAGGGCACGCACAGAGGAGAGTGATGAGGATGT3', with a 59°C
annealing temperature and 30 amplification cycles, producing a specific
amplification product of 450 bp. PAC DNA was prepared according to the Qiagen
Large Construct kit protocol. Genomic inserts are flanked by NotI
sites; digestion with NotI followed by pulse field gel
electrophoresis (PFGE) revealed that the inserts of both PACs were above 100
kb. Further restriction analyses and Southern blotting revealed that PAC
BUSMP706H15152Q2 contained more than 40 kb of upstream her5 sequence;
this PAC was chosen for further experiments. The genomic structure of
her5 (Fig. 2A) was
determined by PAC sequencing, and was verified on the endogenous her5
locus by PCR amplification and sequencing of genomic DNA.
|
Vectors used
pEGFP-1 (Clontech); pSV40/Zeo (Invitrogen);
pGlZl3_3 (modified pEGFP-1 with a loxP-flanked
Zeo-cassette in AflII-site, see below); pGETrec, carrying
arabinose-inducible recE gene
(Narayanan et al., 1999
);
p705-Cre (Buchholz et al.,
1996
); and her5-containing PAC (pCYPAC2n
backbone) with a total of about 100 kb genomic insert and at least 40 kb
upstream region of her5), further called her5PAC.
Construction of pGlZl3_3
pEGFP-1 was digested with AflII, and an insert containing
loxP and the restriction enzyme site NheI (produced by
oligonucleotide annealing) was inserted at this site. Similarly, a
loxP-NheI was introduced into the vector pSV40/Zeo
after restriction cutting with BamHI. pSV40/Zeo:loxP-NheI
was further cut with NheI to release the NheI fragment
containing full length of ZeoR and loxP, which
was inserted into pEGF:loxP-NheI open at NheI. This produced
pEGFP:loxP-ZeoR-loxP, further referred to as
pGlZl3_3. All plasmids containing ZeoR were grown
in INF
F' cells.
Preparation of the linear fragment
her5a-EGFP:loxP-ZeoR-loxP-her5b to homologously recombine
into the PAC
Primer design
The fragment for homologous recombination was prepared by PCR using the
following primers. Primer ET2: 48 nucleotides specific to the
5'-sequence of her5 exon 2
(Fig. 2A, fragment b) and 21
nucleotides specific to pGlZl3_3 (underlined) (sequence: 5'GTC
CCC AAG CCT CTC ATG GAG AAA AGG AGG AGA GAT CGC ATT AAT CAA GTC GCC ACC
ATG GTG AGC AAG3'). Primer ET1: 47 nucleotides specific to the
3'-sequence of her5 exon 2
(Fig. 2A, fragment b) and 22
nucleotides specific to pGlZl3_3 (underlined) (sequence: 5'CTC
ATT GTT TGT GTT CTC AAG TAA AAG CAT TCT CAA GGT TTC TAG GCT TAA CGC TTA
CAA TTT ACG CCT3').
Oligonucleotide purification
Oligonucleotides ET1 and ET2 were resuspended in water and purified as
follows. To 100 µl, 12 µl 3 M Sodium-Acetate (pH 7.5) and 120 µl
phenol were added, vortexed and centrifuged for 3 minutes. Then 360 µl
Ethanol was added, and the mix was placed 10 seconds at 80°C, washed once
with 75% ethanol, dried and finally dissolved in 100 µl water.
PCR amplification of the fragment her5a-EGFP:loxP-ZeoR-loxP-her5b: Template her5PAC DNA was denatured for 2 minutes at 94°C, followed by two cycles of denaturation at 94°C for 40 seconds. A first, annealing was performed at 62°C for 30 seconds, with extension at 72°C for 2 minutes. This was followed by 35 amplification cycles with denaturation at 94°C for 40 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 2 minutes. The reaction was stopped by a final extension at 72°C for 10 minutes and cooled at 4°C. The expected 2 kb amplification product was purified using the QIA gel extraction kit (Qiagen) as recommended, and eluted in 50 µl water.
Preparation of bacterial cells and transformation
The bacterial host cells DH10B containing her5PAC were transformed
with pGETrec and prepared for the recombination with the linear
her5a-EGFP:loxP-ZeoR-loxP-her5b fragment as follows:
starting from an overnight culture, the cells were grown at 37°C for 90
minutes (to OD600=0.2-0.3) with shaking. L-arabinose was added to
the culture to a final concentration of 0.2% and the culture was grown further
until OD600=0.5 was reached. The cells were then prepared as
electro-competent as described in
http://www.heidelberg.de/ExternalInfo/stewart/ETprotocols.html.
Electroporation of 120 ng of
her5a-EGFP:loxP-ZeoR-loxP-her5b fragment was performed
with 2.5 kV pulses and 25 µF in 100 µl, induced with 0.2% L-arabinose at
37°C for 90 minutes before harvesting and plating twice for selection.
Removal of loxP-flanked ZeoR-gene by
Cre-mediated deletion
Competent cells carrying the recombined her5PAC were transformed
with p705-Cre using standard protocols. p705 is based on the
pSC101 temperature-sensitive origin, which maintains a low copy
number and replicates at 30°C but not at 40°C. Furthermore,
Cre is expressed from the lambdaPR promoter weakly at
30°C and strongly at 37°C. Finally, these plasmids are lost from cells
if incubated at temperatures above 37°C. Thus, after transformation the
cells were incubated for 2 days at 30°C, followed by 1 day's incubation at
40°C to give a transient burst of Cre expression after which the plasmids
will be eliminated from the cell. The cells were then further grown for day at
37°C, transferred once and finally tested by PCR for excision of the
loxPZeoR-loxP cassette, generating her5PAC:egpf.
Because of the presence of a NotI site 3' to the egfp
gene, digestion of her5PAC:egfp with NotI generated two
fragments of 45 and 60 kb in addition to the vector backbone. PFGE and
Southern blotting with a her5 probe identified the 45 kb fragment as
containing the coding her5 sequence, thus her5PAC:egfp
contains more than 40 kb upstream her5 sequence driving egfp
expression.
Construction of her5PAC:egfp deletion fragments
The fragment containing 3650bp of her5 upstream sequence was
obtained by digestion of her5PAC:egfp with NotI +
BglII followed by pulse field gel electrophoresis, identification by
Southern blotting with a probe covering the her5 5' region, and
gel purification (Qiagen Gel extraction kit). The fragment was subcloned into
pBS(SK) for amplification, and was repurified by digestion and gel
extraction before injection. All other constructs were prepared as PCR
fragments from her5PAC:egfp and purified using the Qiagen PCR
purification kit. All fragments were eluted in H2O (Ambion).
Construction of the transgenic lines
her5PAC:eGFP DNA was isolated using the Qiagen Large Construct
Kit, eluted in H2O and injected (in circular form) into fertilized
eggs at the one-cell stage at a concentration of 50 ng/µl. All other
constructs were injected as linear fragments at the same concentration.
Injected embryos were raised to adulthood and mated to wild-type adults. F1
embryos expressing eGFP were then sorted-out, raised and crossed to wild-type
fish to establish the lines. We obtained integration and expression in three
from 600 injected fish for her5PAC:egfp and in average three from 50
injected fish for the other fragments. All results presented in this work were
verified over at least three generations.
In situ hybridisation and immunocytochemistry
In situ hybridisation and immunocytochemistry were carried out according to
standard protocols (Hauptmann and Gerster,
1994
). The following in situ antisense RNA probes were used:
her5 (Müller,
1996
; Thisse et al.,
1993
); egfp (Clontech); pax6
(Krauss et al., 1991
);
fgfr3 (Sleptsova-Friedrich et
al., 2002
); otx2 (Li
et al., 1994b
); hoxa2
(Prince et al., 1998
); and
krx20 (Oxtoby and Jowett,
1993
).
For immunocytochemistry, the following antibodies were used: mouse anti-GFP `JL-8' (Chemicon) used at a dilution of 1/100; mouse anti-invected 4D9 (DHSB), which recognises all zebrafish Eng proteins, used at a dilution of 1/8; and rabbit anti-phosphohistone H3 (Upstate Biotechnology, no.06-570) used at a dilution of 1/200. They were revealed using goat-anti-mouse-HRP or goat-anti-rabbit-HRP (Chemicon) (dilution 1/200) followed by DAB/H2O2 staining, or goat-anti-mouse-FITC (Dianova) (dilution 1/200), as appropriate. Double in situ hybridisation and immunocytochemistry staining on transgenic embryos were performed as follows: whole-mount embryos were first processed for in situ hybridisation, then cryostat-sectioned at 8 µm thickness and the sections were subjected to immunocytochemistry following standard protocols. In Fig. 7K-M, immunocytochemical detection was performed after in situ hybridisation on whole-mount specimen. Embryos were scored and photographed under a Zeiss SV11 stereomicroscope or a Zeiss Axioplan photomicroscope.
|
|
| RESULTS |
|---|
|
|
|---|
At early gastrulation, her5 is transcribed in a subset of anterior
endodermal precursors ('e' in Fig.
2C) (Bally-Cuif et al.,
2000
). Accordingly, we detected GFP expression in the pharynx at
24 hours post-fertilization (hpf) (Fig.
2D, Fig. 3) in all
her5PAC:egfp embryos. These results make of her5 the
earliest selective pharyngeal marker known to date, and are in line with the
proposed role of endodermal Her5 activity in attributing pharyngeal fate
(Bally-Cuif et al., 2000
). In
addition, wild-type her5 expression is initiated at the 70% epiboly
stage in a V-shaped neuroectodermal domain ('MH' in
Fig. 2C) that was fate-mapped
to the midbrain at 90% epiboly
(Müller et al., 1996
).
Accordingly, strong GFP expression was found in the MH domain (Figs
2D and
3).
|
Distinct positive and negative regulatory elements controlling
endodermal and neural expression of her5 are organized over 3 kb of
upstream sequence
To narrow down the sequences directing MH and/or endodermal expression of
her5, we performed a deletion analysis series of the
her5PAC:egfp transgene. A comprehensive series of reporter constructs
of varying length encoding the Her5-eGFP fusion protein and comprising between
60 and 3650 bp upstream of the her5 transcriptional start site
(Geling et al., 2003
) were
amplified by PCR from her5PAC:egfp and tested in transient or
transgenic assays (black or red lines in
Fig. 2B, respectively). In the
latter case, at least two independent lines were established for each
construct. Transient assays generally produced ectopic expression sites when
compared with transgenic analyses of the same fragments; however, comparison
of a sufficient number of injected embryos (n>30) allowed to
reliably predict the reporter expression profile (not shown). All results are
summarized in Fig. 2B,D. In
summary, we observed that all fragments containing 240 bp or more of upstream
sequence lead to non-neural expression
(Fig. 2B). Transgenic lines
established with 770 bp upstream region (-0.7her5:egfp) faithfully
recapitulated her5 endodermal expression, with similar onset and
anteroposterior extent (Fig.
2D-H and data not shown). These results locate the her5
endodermal enhancer to the first upstream 770 bp, the first her5
intron (contained in all constructs) or a combination of both.
We next examined the regulatory elements controlling neural expression of her5. We found that all constructs containing more than 770 bp of upstream sequence directed, in addition to endodermal expression, GFP fluorescence within the neural tube (Fig. 2D-G). However, MH selectivity in stable assays was only achieved with upstream sequences of 3.4 kb or more (-3.4her5:egfp lines) (Fig. 2E), whereas shorter elements triggered GFP expression over the MH as well as fore- and hindbrain (e.g. -1.7her5:egfp lines, Fig. 2F,G). Double in situ hybridisation experiments with gfp and her5 probes demonstrated that gfp transcription in -3.4her5:egfp transgenics faithfully reproduces expression of endogenous her5, including its induction and maintenance phases (Fig. 3B,E,F, and data not shown). Thus, all regulatory elements driving correct MH her5 both in time and space appear contained within the -3.4her5:egfp construct. Together, our analysis of the her5 enhancer demonstrates that spatially distinct and dissociable elements drive endodermal and MH expression of her5 during embryogenesis.
her5 expression in endodermal precursors is initiated at 30%
epiboly, and switched off at 90% epiboly
(Bally-Cuif et al., 2000
). We
could detect GFP protein in the pharynx until 26-30 hpf (e.g. see
Fig. 2D,F,H), thus GFP protein
is stable for
18-20 hours in this tissue in our lines. We reached a
similar conclusion for GFP stability in the neural tube, where posterior
her5-positive cells at 75% epiboly rapidly switch off her5
expression and give rise to metencephalic derivatives that loose GFP protein
around 24 hpf (see below). Thus, the GFP protein profile observed at a given
time corresponds to all descendants of the cells that expressed gfp
under her5 regulatory elements between 18-20 and a few hours before
the moment of analysis. The stability of the GFP protein in
her5PAC:egfp embryos thus offers the unique opportunity of following
the fate of her5-expressing cells, from the onset of endogenous
her5 expression and throughout embryogenesis.
Neural her5 expression at gastrulation encompasses the
entire MH anlage
The MH anlage is composed of precursors for the midbrain, isthmus, r1 and
r2 (Fig. 1). These domains are
together characterized by the expression of Eng2 proteins at somitogenesis
stages, but an early molecular marker of the entire presumptive MH remains to
be identified. The onset of her5 expression within the neural plate
is at 70% epiboly, and GFP protein becomes visible in this location around 90%
epiboly (not shown). To determine the fate of these early
her5-expressing cells, we performed a detailed spatiotemporal
analysis of GFP distribution by fluorescence microscopy on live embryos and
immunocytochemistry on whole-mount or sectioned specimen
(Fig. 4A-J). When necessary,
GFP protein distribution was compared with the expression of diagnostic
molecular markers for diencephalic (see
Fig. 8A,E,G,I) or hindbrain
domains (Fig. 4K-Q).
|
|
|
To ascertain that her5 expression at its onset within the neural plate comprises all MH precursors, we determined whether the spatial organization of the earliest her5-expressing cells prefigures the later distribution of MH cells along the AP axis. To this aim, we fate mapped the anterior and posterior extremities of the her5 domain at 70% epiboly. To reliably identify this domain, we relied on its giving rise to the earliest detectable GFP expression using fluorescence microscopy in her5PAC:egfp embryos, at 90-95% epiboly. Thus we activated caged-fluorescein in small groups of four or five GFP-positive cells located at the edges of the GFP domain in transgenic embryos at 95% epiboly (Fig. 5A), and followed these cells at 24 hpf (Fig. 5B-E). We found that anterior activated cells always gave rise to cell clones distributing within the anterior midbrain (Fig. 5B,C) (n=4), while posterior activated cells populate r2 (Fig. 5D,E) (n=5). Thus, the anterior and posterior extremities of the earliest her5-expressing domain at 70% epiboly prefigure the corresponding extremities of the later MH.
Together, our findings demonstrate that the early neural expression of her5 is a marker of the entire MH anlage, and it appears as the earliest MH marker known to date. Furthermore, this early domain displays some degree of ordered cell distribution, such that its anterior and posterior limits contain precursors for the anterior and posterior extremities of the later MH. Specifically, at 70% epiboly, anterior her5-positive cells abut and exclude the diencephalon anlage, while posterior cells comprise precursors for r1 and r2.
her5 expression follows a dynamic mode of
regulation that is precisely controlled in time and space
Her5 crucially controls MH neurogenesis
(Geling et al., 2003
), making
it important to analyze the regulation of its expression. In 30-somite
her5PAC:egfp embryos, we observed a dramatic difference in the AP
extent of her5 transcription and GFP protein distribution
(Fig. 6A-C). This observation
suggests that MH precursors loose her5 expression upon division, such
that the her5-positive territory shrinks from a domain covering the
entire MH anlage at early gastrulation, to be maintained at 30 somites at the
MHB only. To confirm this hypothesis, and assess the progression of this
phenomenon in time and space, we conducted a precise comparison of
her5 RNA and GFP protein distributions between 90% epiboly (first
stage where GFP protein becomes detectable in the MH domain) and 24 hpf. To
this aim, double in situ hybridisation and immunocytochemical detection was
performed on whole-mount embryos or serial sagittal sections (minimum three
embryos per stage). At 90% epiboly and until the one- to two-somite stage, the
anterior borders of her5 RNA and GFP protein expression were
coincident (Fig. 6D, and data
not shown). However their posterior limits differed by approximately one or
two cell rows (Fig. 6D, and
data no shown). Thus, between the onset of her5 expression in the
neural plate (70% epiboly) and 90% epiboly, her5 transcription
becomes restricted of a few cell rows posteriorly, although it is maintained
in all its progeny cells anteriorly (Fig.
6P, parts a,b). At three somites, her5 transcripts
distribute over approximately eight cell rows along the AP axis, while GFP
protein covers 15-18 rows (Fig.
6E,F). From this stage onwards, prominent differences in the AP
extent of her5 RNA and GFP protein are detectable posteriorly but
also anteriorly, on the lateral and basal domains of the midbrain
(Fig. 6E, black arrows). By
contrast, her5 expression still mostly matches GFP staining along the
dorsal midline of the neural tube (Fig.
6E, blue arrow). Similar observations can be made until the 12- to
14-somite stage (Fig. 6G,H). At
16 somites, the dorsal expression of her5 dramatically regresses and
her5 expression is restricted to a band of 4-6 cell rows across the
entire DV extent of the neural tube (Fig.
6I). At this stage, MH cells have further divided as GFP protein
extent now covers approximately 27-30 rows along AP
(Fig. 6J). This progression is
ongoing at least until the 30-somite stage, when GFP protein extends over
45-50 rows, against 3-5 rows for her5 RNA
(Fig. 4H,
Fig. 6K,L).
To ascertain the directionality of the progressive restriction of
her5 expression in MH precursors, we revealed her5 RNA and
GFP protein on single sagittal sections in double fluorescence experiments
(Fig. 6M-O). Such stainings
unambiguously located the final her5 expression domain to the center
of the GFP-positive domain, confirming that her5 expression is lost
both anteriorly and posteriorly upon cell divisions. Several other MH markers,
e.g. pax2.1, eng1, wnt1 and fgf8, display an expression
profile that globally compares in extent with her5 at early and late
stages, and GFP distribution in pax2.1:gfp transgenics
(Picker et al., 2002
) and
wnt1:gfp-injected embryos (Lekven
et al., 2003
) suggests that the expression of these genes follow a
restriction similar to her5 over time.
We conclude from these observations that (1) her5 expression
within the MH domain is subject to a highly dynamic regulation and is
progressively lost upon cell divisions between 70% epiboly and 24 hpf
(Fig. 6P), (2) the restriction
of her5 expression occurs in a centripetal manner towards the MHB,
and (3) it follows a precise spatial sequence: it is initiated posteriorly (in
the future metencephalon) before affecting the basolateral and finally the
dorsal mesencephalic areas. her5 expression, at least in the basal
plate, is always adjacent to neurogenesis sites
(Geling et al., 2003
). Thus,
our observations imply that neurogenesis within the MH domain is also a
spatially dynamic process, and converges towards the MHB over time (red arrows
in Fig. 6P, part d).
Most MH precursors are maintained but acquire distinct alternative
identities in noi and ace mutant backgrounds
We next used the stability of the GFP protein to study the potentialities
of MH precursors in terms of their spatial identity. MH precursors remain
plastic until late stages, and the choice and reinforcement of their
specification are incompletely understood. We addressed the role of Pax2.1 and
Fgf8 in these processes, by studying GFP distribution in noi and
ace mutants, where the fate of the presumptive MH anlage is
unknown.
We first ascertained that GFP protein could be used as a reliable marker of MH fate in noi and ace. To this aim, we verified that gfp transcription faithfully recapitulated her5 expression in these mutant contexts. Double in situ hybridisations with the her5 and gfp probes were performed on transgenic mutant embryos, and demonstrated an identical initiation (not shown) and later downregulation of her5 and gfp transcription in these backgrounds (Fig. 7A-D). Near-complete downregulation of gfp expression was observable at 24 hpf in her5PAC:egfp;ace embryos (Fig. 7B) and at the 10-somite stage in her5PAC:egfp;noi (Fig. 7D), like expression of endogenous her5. We conclude that the distribution of GFP protein can be used as a faithful tracer of MH precursors in the ace and noi contexts.
Live observation of 24 hour-old transgenic mutant embryos first revealed
that a significant number of GFP-positive fluorescent cells was maintained at
that stage in both the ace and noi backgrounds
(Fig. 7E-G). These cells
distribute over an AP territory that approaches wild-type size (compare
Fig. 7F,G with 7E), and
throughout the entire DV extent of the neural tube. No signs of aberrant cell
migration were apparent at any stage, i.e. no patches of unstained cells were
observed within the GFP-positive domain, and conversely, no patches of
positive cells were found outside the main GFP-positive domain. In addition,
at 15 somites, no difference was observed in the rate of cell death (as
revealed with Acridine Orange) (25±12 cells in wild-type, 26±9
cells in ace, 30±5 cells in noi; n=20)
(Fig. 7H-J) and cell
proliferation (anti-phosphohistone H3) (61±9 cells in wild-type,
55±6 cells in ace; 59±8 cells in noi;
n=10) (Fig. 7K-M) in
that area between wild-type, ace and noi embryos. Together,
these observations suggest that the normal complement of MH precursors is
present in the mutants at least until the 15-somite stage. The expression of
MHB markers (Brand et al.,
1996
; Lun and Brand,
1998
; Reifers et al.,
1998
), however, and of basal MH derivatives such as the III and IV
cranial nerves (Fig. 7E-G,
insets), is absent. Together, these results suggest that MH precursors
remained in place but, at least in part, display alternative identities in the
mutants. We used the co-detection of GFP protein and diagnostic molecular
markers expression on single sections to verify this hypothesis. We
demonstrate below that MH progeny cells display aberrant specification in
noi and ace as early as at 15 somites, when, as described
above, the survival, proliferation and migration of MH cells do not show signs
of perturbation.
The anterior limit of GFP protein abuts at all stages the caudal border of
pax6.1 expression (Fig.
8A,C,E,G), a marker for the posterior diencephalic alar plate.
Strikingly, however, ace mutants showed a significant overlap between
these two patterns at the 30-somite stage
(Fig. 8B,B'), where a
large number of cells in the anterior part of the GFP-positive territory
co-expressed pax6.1. A transient overlap in the expression of Pax6
and En has been documented in chicken
(Matsunaga et al., 2000a
),
suggesting that the co-expression GFP and pax6.1 in ace
might result from a failure to downregulate pax6.1 in anterior MH
precursors. However, in a precise comparison of pax6.1 and GFP, as
well as of pax6.1 and Eng proteins expression in zebrafish, we failed
to observe an overlap of these markers at any stage
(Fig. 8E,G and data not shown).
Thus, the co-expression of GFP and pax6.1 in ace rather
reflects aberrant pax6.1 transcription in MH precursors. A
time-course experiment further revealed that GFP-positive cells in
ace express a pax6.1-positive identity at least as early as
the 15-somite stages (Fig. 8,
compare F,F' with E and H,H' with G). In striking contrast to
these findings, a distinct pax6.1/GFP border was maintained in
noi, although pax6.1 expression appeared extended
posteriorly compared with its wild-type pattern (compare
Fig. 8C with 8D).
Diencephalic cells are also characterized by the expression of
fgfr3 (Fig. 8I). In
wild-type transgenic embryos, the GFP-positive territory abuts the caudal
border of fgfr3 expression (Fig.
8I, green arrowheads), which thus shares a common posterior limit
with pax6.1. As reported previously, we found that fgfr3
expression extends ectopically towards caudal in ace and noi
(Sleptsova-Friedrich et al.,
2002
). Double labeling of transgenic mutants reveals, in addition,
that GFP and fgfr3 expression overlap extensively in noi,
where all GFP-positive cells co-express fgfr3
(Fig. 8K), at least from the
15-somite stage onwards (Fig.
8L). By contrast, the fgfr3/GFP border is maintained in
the ace alar plate. Both markers overlap in the ace basal
plate (Fig. 8J), however,
further documenting the differential plasticity of basal and alar MH
precursors (see Lun and Brand,
1998
; Reifers et al.,
1998
; Sleptsova-Friedrich et
al., 2002
).
Metencephalic derivatives such as the cerebellum fail to develop in both
ace and noi, but the fate of metencephalic progenitors is
unknown. To address this question, we relied on the expression of
otx2, a marker of the fore- and midbrain, but not hindbrain
territories. In ace mutants, we found that the posterior limit of
otx2 expression precisely coincided with the posterior border of GFP
protein distribution (Fig. 8N).
Because no extensive cell death was observed in the mutants
(Reifers et al., 1998
)
(Fig. 7I and data not shown),
this result highlights that metencephalic precursors display an
otx2-positive identity in the absence of Fgf8 function. By contrast,
in noi mutants, the caudal border of otx2 expression
appeared to be located half way through the GFP-positive domain, in a manner
reminiscent of the wild-type situation
(Fig. 8M,O). Thus, some AP
distinctions related to ante- and post-MHB differences are maintained by the
descendents of MH progenitors in noi. Posterior GFP-positive,
otx2-negative cells also express fgfr3 at high levels
(Fig. 8K), suggesting that they
are of posterior r1 or r2 identity. However, because of the dynamic posterior
limit of GFP protein distribution in the hindbrain
(Fig. 4K-Q), it was not
possible to follow these cells.
Together, our findings demonstrate that MH precursors display aberrant spatial identities in ace and noi, in a manner that strikingly depends on the mutant context. An interpretative summary of our results is presented in Fig. 9.
|
| DISCUSSION |
|---|
|
|
|---|
Regulatory elements controlling her5 expression
During embryogenesis, her5 expression follows at least three
distinct phases: it is first transcribed in a subset of endodermal precursors,
then induced and maintained within the presumptive MH. In addition, each phase
is subject to dynamic regulation, as endodermal expression is transient
(Bally-Cuif et al., 2000
) and
MH expression is drastically downregulated over time (this paper). Because the
her5 enhancer had not been characterized and her5 expression
is complex, we chose the ET-cloning in vitro recombination technology
(Muyrers et al., 2000
;
Muyrers et al., 1999
;
Zhang et al., 1998
) to build
transgenic lines where gfp expression is driven by the complete set
of her5 regulatory elements. Precise analysis of
her5PAC:egfp embryos reveals that our lines indeed fully recapitulate
the phases and dynamics of in vivo her5 expression. Our results
confirm the power of artificial chromosome transgenesis in zebrafish to
decipher the complexity of developmental gene regulation in vivo.
All early MH markers studied to date, including zebrafish her5, pax2.1,
eng2, fgf8 and wnt1, follow a bi-phasic mode of regulation:
their expression is induced at late gastrulation, probably by independent
pathways, and maintained after the five-somite stage in a mutually
interdependent process (Lun and Brand,
1998
; Reifers et al.,
1998
; Scholpp and Brand,
2001
). These phases correspond to distinct regulatory elements on
the promoters of zebrafish pax2.1
(Picker et al., 2002
), mouse
Pax2 (Pfeffer et al.,
2002
; Rowitch et al.,
1999
) and mouse En2
(Li Song and Joyner, 2000
;
Song et al., 1996
). Our
deletion analysis (Fig. 2 and
data not shown) failed to dissociate initiation and maintenance elements
within the her5 enhancer, suggesting that they are closely linked
and/or overlapping at the her5 locus. The `maintenance' elements of
mouse En2 depend upon Pax2/5/8 binding sites
(Li Song and Joyner, 2000
;
Song et al., 1996
); those of
mouse Pax2 are at least targets for auto- or crossregulation by
Pax2/5/8 proteins (Pfeffer et al.,
2002
). her5 expression is dependent upon the presence of
Pax2.1 at somitogenesis (Lun and Brand,
1998
; Reifers et al.,
1998
); however, analysis of the her5 enhancer sequence
failed to reveal binding sites for this maintenance factor (A.T. and L.B.-C.,
unpublished). In addition, we showed previously that her5 expression
was not subject to autoregulation (Geling
et al., 2003
). Maintenance of her5 expression at
somitogenesis thus likely involves relay factors that have yet to be
identified.
A restricted subset of players involved in MH induction has been
identified: the Oct-like transcription factor Spiel-ohne-Grenzen (Spg)/Pou2
(Belting et al., 2001
;
Burgess et al., 2002
) and the
Btd/Sp1-like zinc finger protein Bts1
(Tallafuss et al., 2001
).
Accordingly, Oct- and Sp1-binding sites are found on the early-acting enhancer
of mouse Pax2, and at least the Oct sites are required for enhancer
activity (Pfeffer et al.,
2002
). Similarly, we found that several Oct and Sp sites are
present on the her5 MH enhancer (A.T. and L.B.-C., unpublished). The
requirement for these specific sites for her5 induction remains to be
directly demonstrated; suggestively, however, endogenous her5
expression (Reim and Brand,
2002
) and her5PAC-driven gfp expression (A.T.
and L.B.-C., not shown) followed the same decreased and delayed induction in
spg/pou2 mutants compared with wild-type siblings. Factors
restricting her5 expression to the MH anlage also remain crucial
components of the MH induction process to be identified. Some of these likely
bind the distal region of the her5 enhancer, as proximal domains
drove unrestricted reporter expression to the anterior brain in our transgenic
assays (Fig. 2F,G).
her5 expression is the earliest marker of MH
fate
GFP protein distribution (Fig.
4) and direct mapping of the anterior and posterior extremities of
the earliest her5-positive domain within the neural plate
(Fig. 5) position the early
anterior her5 expression border to the di-mesencephalic boundary,
while the posterior border of her5 expression is more dynamic and
expands, at early stages, a minor contribution into r3 and r4. GFP-positive
cells found in r3 and r4 might be accounted for by a transient overlap of
her5 expression with the r3/r4 anlage at gastrulation. However, at
this stage, her5 is not co-expressed with hoxa-1 (later
renamed hoxb1b) (A.T. and L.B.-C., unpublished), interpreted to
extend to the r3/r4 boundary (Koshida et
al., 1998
). Thus, alternatively, the contribution of GFP-positive
cells to r3 and r4 might result from the migration of metencephalic cells
towards caudal, followed by an acquisition of posterior identities (as
revealed, for example, by their expression of krox20)
(Fig. 4N). Such migration has
been documented in the chicken embryo at a later stage
(Marin and Puelles, 1995
). We
cannot formerly exclude either possibility at this point.
Outside this marginal contribution to posterior rhombomeres, the large
majority of GFP-positive cells is confined to mesencephalic (midbrain,
isthmus) and metencephalic (r1, r2) derivatives. GFP expression encompasses
the entire extent of the MH domain, and displays a ubiquitous distribution
within this domain. Thus, our results identify her5 expression at its
onset as a comprehensive marker of MH precursors. her5 expression at
90% epiboly was fate mapped to the midbrain only
(Müller et al., 1996
), an
observation in agreement with the immediate restriction of her5
expression from posterior cells between 70% and 90% epiboly
(Fig. 6D), and with the
identification of these posterior cells as metencephalic precursors
(Fig. 5D,E). The MH domain is
generally considered as an entity because its different sub-territories
develop in a concerted fashion (in direct or indirect response to IsO
activity), and because it is globally characterized by the expression of
molecular markers (such as En2) at somitogenesis stages
(Martinez, 2001
;
Rhinn and Brand, 2001
;
Wurst and Bally-Cuif, 2001
).
Our results add support to these ideas by providing the first direct molecular
evidence for the definition of a MH prodomain ('pro-MH') at early
developmental stages. Furthermore, they show that the AP distribution of
precursors within this pro-domain displays some degree of spatial coherence as
it prefigures the organization of the later MH.
The earliest her5 expression domain defines pro-MH cells although
Her5 function itself does not control the acquisition or maintenance of MH
identity (Geling et al.,
2003
). It is thus likely that (as yet unidentified) MH identity
factors display an expression profile similar to her5 at
gastrulation. These factors might be rapidly relayed in time by Pax2.1 and/or
Eng2/3.
Dynamic regulation of her5 expression and the spatiotemporal
progression of MH neurogenesis
An important demonstration of our study is the highly dynamic regulation of
her5 expression over time. Indeed her5 expression restricts
from a domain covering the entire MH anlage at 70% epiboly to a few cell rows
at the MHB at late somitogenesis (Fig.
6). We believe that this restriction is functionally relevant, as
the spatiotemporal distribution of the Her5 protein is likely to follow very
closely that of her5 mRNA. Indeed, her5 mRNA is always found
directly adjacent to sites undergoing neurogenesis
(Geling et al., 2003
)
(Fig. 6P), and Her5 protein
potently inhibits neurogenesis (Geling et
al., 2003
).
Between 70% epiboly and late somitogenesis, the total number of her5-expressing cells remains roughly unchanged; by contrast, the number of MH cells greatly increases. This observation demonstrates that her5 expression is progressively lost upon cell divisions in a converging manner from anterior and posterior towards the MHB. Whether this progressive downregulation follows an asymmetrical mode of cell division, where her5 expression is maintained in every other progeny cell at each cellular generation, or rather results from the progression of a maturation gradient within the MH in a manner unrelated to cell cycle events, remains to be determined. This will require the tracing of single GFP-positive cells.
Our results correlatively demonstrate that primary neurogenesis converges
from anterior and posterior towards the MHB over time
(Fig. 5P), and suggest that
neurogenesis progression is permitted by the dynamic downregulation of
her5 expression (Geling et al.,
2003
). Along the DV axis of the neural tube, the combinatorial
differentiation-promoting and differentiation-inhibiting activities of Shh and
Wnt signaling, respectively, has been proposed to account for the global
ventral-to-dorsal progression of neuronal maturation
(Megason and McMahon, 2002
).
Her5 might be regarded as a counterpart to Shh and Wnt along DV, which
controls the spatial order of neurogenesis progression along AP within the MH
domain.
Within the MH basal plate, neuronal identity varies according to, and has
been postulated to depend on, the position of the population considered
relative to the MHB (Agarwala and Ragsdale,
2002
; Broccoli et al.,
1999
; Wassarman et al.,
1997
). For example, nMLF reticulospinal neurons lie at the
anterior border of the mesencephalon, while motoneurons (of cranial nerves III
and IV) are found adjacent to the MHB. Our results on her5 and
neurogenesis dynamics also imply that these neurons are generated at different
times, the former being an early and the latter a late neuronal type. Along
this line, the combined action of the two E(spl)-like factors Hes1 and Hes3 is
required for IZ maintenance in the E10.5 mouse embryo
(Hirata et al., 2001
), and
premature neurogenesis at the MHB in
Hes1-/-;Hes3-/- embryos is correlated
with the loss of some but not all neuronal identities that normally develop
around the MHB after E10.5 (Hirata et al.,
2001
). Whether the primary determinant of neuronal identity is the
AP location of the different populations, or rather is the timing of their
engagement into the differentiation process, primarily controlled by
her5 restriction, becomes an important aspect of MH development to
address in future studies.
Plasticity of MH precursors and reinforcement of MH identity
A major interest of our lines is to permit the direct tracing of MH
precursors in mutant or manipulated contexts. We focused here on the
noi and ace mutants, where the fate of pro-MH cells is
unknown (Lun and Brand, 1998
;
Reifers et al., 1998
). Our
tracings first demonstrate that, in these mutants, a large proportion of these
cells are maintained but partially acquire alternative AP identities. Second,
they reveal dramatic differences in the final identities of MH precursors
between the noi and ace contexts. These findings, discussed
below, suggest models for the acquisition of MH fate in vivo, and clarify the
respective roles of Pax2.1 and Fgf8 in this process.
As previously discussed, the expression of her5 reveals that a pro-MH domain is identified at gastrulation stages within the neural plate. Several studies demonstrate that, at somitogenesis stages, the IsO is then necessary for the development of structures surrounding the MHB (such as the posterior tectum, isthmus and cerebellum). Thus, one likely function of the IsO is to permit or reinforce the diversification of MH identities at the center of the MH pro-domain. In addition, we directly demonstrate here that, in noi and ace, at least anterior and posterior MH precursors acquire characteristics of non-MH neighboring territories. Anteriorly, MH precursors express diencephalic markers (pax6.1 in ace, fgfr3 in noi). Posteriorly, in noi, otx2-negative MH precursors express pax6.1 and fgfr3 (Fig. 7), suggesting that r1 precursors express r2 characteristics. Thus, another function of IsO factors such as Pax2.1 and Fgf8 is to stabilize MH identity at the extremities of the MH pro-domain. Several mechanisms could account for this function. For example, the activity of IsO factors could (directly or not) act on cell movements to retain MH precursors away from more anterior or posterior patterning sources. Alternatively, IsO factors could bias or stabilize anterior and posterior MH precursors in their choice(s) of cell identity, favoring the reinforcement of MH values. We favor this interpretation, because we did not detect obvious signs of ectopic cell migrations in noi and ace, where GFP-positive cells remained in a compact and homogeneous domain. IsO factors could either be in themselves instructive to impart or reinforce MH identities at the boundaries, or render pro-MH cells responsive to instructive cues at the proper time.
The stage at which this activity takes place cannot directly be inferred
from our data. Gain- and loss-of-function experiments in the mouse, chick and
zebrafish demonstrated an antagonism between the expression of Pax6 and En
factors to delimit the di-mesencephalic border
(Araki and Nakamura, 1999
;
Liu and Joyner, 2001
;
Mastick et al., 1997
;
Matsunaga et al., 2000b
). Our
time-course expression studies in ace however suggest that aberrant
cell identity choice occurs at least as early as the 12-somite stage (see
pax6.1 at 15 somites on Fig.
8F, and data not shown). Furthermore, in noi, MH
precursors acquire fgfr3 expression but the pax6.1/GFP
boundary is maintained. Therefore, in anterior cells of the MH pro-domain, we
favor a model where IsO factors influence cell identity choices independently
of Pax6 action, most probably at an earlier stage than the Pax6/En interplay.
Because most MH markers display normal expression profiles in both mutants
until the five-somite stage, impaired choices of identity in MH precursors in
noi and ace might occur after that stage, in relation with a
deficient MH maintenance loop. Alternatively, they might occur before the
maintenance phase, when Pax2.1 and Fgf8 are broadly expressed within the MH
anlage (Lun and Brand, 1998
;
Reifers et al., 1998
). These
choices might take place progressively, perhaps in a manner starting at the
extremities of the pro-MH domain and converging towards the MHB, as suggested
by the progressive restriction of MH markers (directly demonstrated here for
her5) and the progression of maturation events such as neurogenesis
(this paper).
In noi, pax6.1 expression is extended posteriorly (this paper
Fig. 6); however, this
diencephalic expansion does not occur by recruiting mesencephalic precursors.
It is possible that cell death (Brand et
al., 1996
) or lower proliferation rate at a late stage, or altered
influences of midbrain cells on diencephalic development account for the
observed posterior expansion of pax6.1 expression. These results
stress the importance of direct lineage tracing in the interpretation of
patterning phenotypes.
Distinct functions of Fgf8 and Pax2.1 in cell identity choices of
pro-MH cells
In the light of the model proposed above, our results highlight strikingly
different impacts of the noi and ace backgrounds on the
orientation of identity choices of MH precursors. Major differences are (1)
the anterior expression of pax6.1 in alar MH precursors in
ace but not noi; (2) the acquisition of fgfr3
expression by all alar cells in noi, while no alar cells express
fgfr3 in ace; and (3) the expression of otx2 by
posterior MH precursors in ace. Several (non-exclusive)
interpretations can account for the differential plasticity of pro-MH cells in
ace versus noi. Timing might be involved: the downregulation
of MHB markers occurs generally later in ace (completed around the
20-somite stage) than in noi (completed around the 10-12-somite
stage), making it possible that partial IsO activity is maintained until a
later stage in ace and prevents, for example, the turning-on of
fgfr3 expression by most alar MH precursors. More likely, Pax2.1 and
Fgf8 exert distinct functions in the orientation of identity choices of pro-MH
cells. First, fgf8 and pax2.1 are expressed in overlapping
but non-identical domains, thus their primary and secondary target cells are
probably distinct. In addition, they probably control different cellular
processes. Pax2.1 appears generally required to prevent the pro-MH territory
as a whole from acquiring an fgfr3-positive fate. In noi,
because otx2-positive and -negative domains are maintained, the
easiest interpretation of the fgfr3 phenotype is an anteriorization
of mesencephalic precursors and a posteriorization of metencephalic
precursors. Thus, we propose that Pax2.1 activity in vivo prevents mes- and
metencephalic precursors from choosing immediately neighboring, non-MH fates.
These results extend previous findings in the mouse that implied Pax2
(together with Pax5) in the maintenance of MH identity or the IsO as a whole
(Schwarz et al., 1997
;
Urbanek et al., 1997
). Some MH
characters are however retained in MH precursors in noi, like the
non-expression of pax6.1. Because of the antagonistic effects of
noi and ace on pax6.1 and fgfr3
expression, this is possibly due to the maintenance of early Fgf8 activity in
noi.
By contrast, our results suggest distinct functions for Fgf8. First, Fgf8
expression prevents only the most anterior alar mesencephalic precursors from
acquiring a partial diencephalic identity. Thus, we propose that Fgf8 is
involved, at a distance, in the choice or reinforcement of an anterior tectal
fate. Furthermore, we report that all GFP-positive cells in ace are
otx2 positive. As no cell death was observed, this strongly suggests
that metencephalic precursors mostly choose an anterior identity in the
absence of Fgf8 function. These results validate earlier interpretations of
the Fgf8 mutant or gain-of-function phenotypes
(Brand et al., 1996
;
Reifers et al., 1998
;
Liu et al., 1999
;
Martinez et al., 1999
;
Sato et al., 2001
). Thus,
another function of Fgf8 is to maintain AP distinctions within the MH
pro-domain itself and permit the individualization of metencephalic versus
mesencephalic identities. Ectopic expression experiments in chicken at
somitogenesis stages demonstrated an antagonism between Fgf8 and
Hoxa1 expression to delimit the r1/r2 boundary and determine r1
versus r2 identities (Irving and Mason,
2000
). These results, together with ours, further suggest distinct
functions of Fgf8 over time: at an early stage, Fgf8 would orient the choice
of a metencephalic versus mesencephalic identity within the MH pro-domain;
later, within the metencephalic anlage, it would reinforce an r1 versus an r2
character. In the mouse and chicken, Fgf8 has also been proposed to control
proliferation (Lee et al.,
1997
). However, we could not detect gross alterations in the
number of her5 progeny cells between ace mutants and
wild-type siblings at the stage of our analysis, suggesting that Fgf8 alone,
in the zebrafish, does not initially play a major role in MH growth.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Agarwala, S. and Ragsdale, C. W. (2002). A role for midbrain arcs in nucleogenesis. Development 129,5779 -5788.[CrossRef][Medline]
Alvarado-Mallart, R.-M., Martinez, S. and Lance-Jones, C. (1990). Pluripotentiality of the 2-day old avian germinative neuroepithelium. Dev. Biol. 139, 75-88.[CrossRef][Medline]
Araki, I. and Nakamura, H. (1999). Engrailed defines the position of dorsal di-mesencephalic boundary by repressing diencephalic fate. Development 126,5127 -5135.[Abstract]
Bally-Cuif, L., Dubois, L. and Vincent, A. (1998). Molecular cloning of Zcoe2, the zebrafish homolog of Xenopus Xcoe2 and mouse EBF-2, and its expression during primary neurogenesis. Mech. Dev. 77,85 -90.[CrossRef][Medline]
Bally-Cuif, L., Goridis, C. and Santoni, M. J. (1993). The mouse NCAM gene displays a biphasic expression pattern during neural tube development. Development 117,543 -552.[Abstract]
Bally-Cuif, L., Goutel, C., Wassef, M., Wurst, W. and Rosa,
F. (2000). Coregulation of anterior and posterior
mesendodermal development by a hairy-related transcriptional repressor.
Genes Dev. 14,1664
-1677.
Belting, H. G., Hauptmann, G., Meyer, D., Abdelilah-Seyfried,
S., Chitnis, A., Eschbach, C., Soll, I., Thisse, C., Thisse, B., Artinger, K.
B. et al. (2001). spiel ohne grenzen/pou2 is required during
establishment of the zebrafish midbrain-hindbrain boundary organizer.
Development 128,4165
-4176.
Brand, M., Heisenberg, C. P., Jiang, Y. J., Beuchle, D., Lun, K., Furutani- Seiki, M., Granato, M., Haffter, P., Hammerschmidt, M., Kane, D. A. et al. (1996). Mutations in zebrafish genes affecting the formation of the boundary between midbrain and hindbrain. Development 123,179 -190.[Abstract]
Broccoli, V., Boncinelli, E. and Wurst, W. (1999). the caudal limit of Otx2 expression positions the isthmic organizer. Nature 401,164 -168.[CrossRef][Medline]
Buchholz, F., Angrand, P. O. and Stewart, A. F.
(1996). A simple assay to determine the functionality of Cre or
FLP recombination targets in genomic manipulation constructs. Nucl.
Acids Res. 24,3118
-3119.
Burgess, S., Reim, G., Chen, W., Hopkins, N. and Brand, M. (2002). The zebrafish spiel-ohne-grenzen (spg) gene encodes the POU domain protein Pou2 related to mammalian Oct4 and is essential for formation of the midbrain and hindbrain, and for pre-gastrula morphogenesis. Development 129,905 -916.[Medline]
Crossley, P., Martinez, S. and Martin, G. (1996). Midbrain development induced by FGF(in the chick embryo. Nature 380,66 -68.[CrossRef][Medline]
Dickmeis, T., Mourrain, P., Saint-Etienne, L., Fischer, N.,
Aanstad, P., Clark, M., Strähle, U. and Rosa, F. (2001).
A crucial component of the endoderm formation pathway, CASANOVA, is encoded by
a novel sox-related gene. Genes Dev.
15,1487
-1492.
Gardner, C. and Barald, K. (1991). The cellular environment controls the expression of engrailed-like proteins in the cranial neuroepithelium of quail/chick chimeric embryos. Development 113,1037 -1048.[Abstract]
Geling, A., Itoh, M., Tallafuß, A., Chapouton, P.,
Tannhäuser, B., Kuwada, J. Y., Chitnis, A. B. and Bally-Cuif, L.
(2003). bHLH transcription factor Her5 links patterning to
regional inhibition of neurogenesis at the midbrainhindbrain boundary.
Development 130,1591
-1604.
Hallonet, M. and le Douarin, N. (1990). A new approach to th development of the cerebellum provided by the quail/chick marker system. Development 108, 19-31.[Abstract]
Hallonet, M., Teillet, M.-A. and le Douarin, N. (1993). Tracing neuroepithelial cells of the mesencephalic and metencephalic alar plates during cerebellar ontogeny in quail/chick chimeras. Eur. J. Neurosci. 5,1145 -1155.[CrossRef][Medline]
Hauptmann, G. and Gerster, T. (1994). Two-colour whole-mount in situ hybridization to vertebrate and Drosophila embryos. Trends Genet. 10, 266.[CrossRef][Medline]
Higashijima, S., Hotta, Y. and Okamoto, H.
(2000). Visualization of cranial motor neurons in live transgenic
zebrafish expressing green fluorescent protein under the control of the
islet-1 promoter/enhancer. J. Neurosci.
20,206
-218.
Hirata, H., Tomita, K., Bessho, Y. and Kageyama, R. (2001). Hes1 and Hes3 regulate maintenance of the isthmic organizer and development of the mid/hindbrain. EMBO J. 20,4454 -4466.[CrossRef][Medline]
Irving, C. and Mason, I. (2000). Signaling by Fgf8 from the isthmus patterns anterior hindbrain and estabishes the anterior limit of Hox gene expression. Development 127,177 -186.[Abstract]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Koshida, S., Shinya, M., Mizuno, T., Kuroiwa, A. and Takeda, H. (1998). Initial anteroposterior pattern of the zebrafish central nervous system is determined by differential competence of the epiblast. Development 125,1957 -1966.[Abstract]
Kozlowski, D. J. and Weinberg, E. S. (2000). Photoactivatable (caged) fluorescein as a cell tracer for fate mapping in the zebrafish embryo. Methods Mol. Biol. 135,349 -355.[Medline]
Krauss, S., Johansen, T., Korzh, V., Moens, U., Ericson, J. and Fjose, A. (1991). Zebrafish pax(zf-a): a paired box-containing gene expressed in the neural tube. EMBO J. 10,3609 -3619.[Medline]
Lee, S., Danielian, P., Fritzsch, B. and McMahon, A. (1997). Evidence that FGF8 signaling from the midbrain-hindbrain junction regulates growth and polarity in the developing midbrain. Development 124,659 -696.
Lekven, A. C., Buckles, G. R., Kostakis, N. and Moon, R. T. (2003). Wnt1 and wnt10b function redundantly at the zebrafish midbrain-hindbrain boundary. Dev. Biol. 254,172 -187.[CrossRef][Medline]
Li, H. S., Yang, J. M., Jacobson, R. D., Pasko, D. and Sundin, O. (1994a). Pax-6 is first expressed in a region of ectoderm anterior to the early neural plate: implications for stepwise determination of the lens. Dev. Biol. 162,181 -194.[CrossRef][Medline]
Li, Y., Allende, M. L., Finkelstein, R. and Weinberg, E. S. (1994b). Expression of two zebrafish orthodenticle-related genes in the embryonic brain. Mech. Dev. 48,229 -244.[CrossRef][Medline]
Li Song, D. and Joyner, A. L. (2000). Two Pax2/5/8-binding sites in Engrailed2 are required for proper initiation of endogenous mid-hindbrain expression. Mech. Dev. 90,155 -165.[CrossRef][Medline]
Liu, A. and Joyner, A. L. (2001). EN and GBX2 play essential roles downstream of FGF8 in patterning the mouse mid/hindbrain region. Development 128,181 -191.[Abstract]
Liu, A., Losos, K. and Joyner, A. L. (1999). FGF8 can activate Gbx2 and transform regions of the rostral mouse brain into a hindbrain fate. Development 126,4827 -4838.[Abstract]
Lun, K. and Brand, M. (1998). A series of no isthmus (noi) alleles of the zebrafish pax2.1 gene reveals multiple signaling events in development of the midbrain-hindbrain boundary. Development 125,3049 -3062.[Abstract]
Macdonald, R., Xu, Q., Barth, K. A., Mikkola, I., Holder, N., Fjose, A., Krauss, S. and Wilson, S. W. (1995). Regulatory gene expression boundaries demarcate sites of neuronal differentiation in the embryonic zebrafish forebrain. Neuron 13,1039 -1053.
Marin, F. and Puelles, L. (1994). Patterning of the embryonic avian midbrain after experimental inversions: a polarizing activity from the isthmus. Dev. Biol. 163, 19-37.[CrossRef][Medline]
Marin, F. and Puelles, L. (1995). Morphological fate of rhombomeres in quail/chick chimeras: a segmental analysis of hindbrain nuclei. Eur. J. Neurosci. 7,1714 -1738.[CrossRef][Medline]
Martinez, S. (2001). The isthmic organizer and brain regionalization. Int. J. Dev. Biol. 45,367 -371.[CrossRef][Medline]
Martinez, S. and Alvarado-Mallart, R.-M. (1989). Rostral cerebellum originates fron the caudal portion of the so-called `mesencephalic' vesicle: a study using chick/quail chimeras. Eur. J. Neurosci. 1,549 -560.[CrossRef][Medline]
Martinez, S., Crossley, P., Cobos, I., Rubinstein, J. and Martin, G. (1999). FGF8 induces formation of an ectopic isthmic organizer and istmocerebellar development via a repressive effect on Otx2 expression. Development 126,1189 -1200.[Abstract]
Martinez, S., Wassef, M. and Alvarado-Mallart, R.-M. (1991). Induction of a mesencephalic phenotype in the 2-day old chick prosencephalon is preceded by the early expression of the homeobox gene En. Neuron 6,971 -981.[CrossRef][Medline]
Mastick, G. S., Davis, N. M., Andrew, G. L. and Easter, S. S., Jr (1997). Pax-6 functions in boundary formation and axon guidance in the embryonic mouse forebrain. Development 124,1985 -1997.[Abstract]
Matsunaga, E., Araki, I. and Nakamura, H. (2000a). Pax6 defines the dimesencephalic boundary by repressing En1 and Pax2. Development 127,2357 -2365.[Abstract]
Matsunaga, E., Araki, I. and Nakamura, H. (2000b). Pax6 defines the dimesencephalic boundary by repressing En1 and Pax2. Development 127,2357 -2365.[Abstract]
Megason, S. and McMahon, A. P. (2002). A
mitogen gradient of dorsal midline Wnts organize growth in the CNS.
Development 129,2087
-2098.
Müller, M., v. Weizsäcker, E. and Campos-Ortega, J. A. (1996). Transcription of a zebrafish gene of the hairy-Enhancer of split family delineates the midbrain anlage in the neural plate. Dev. Genes Evol. 206,153 -160.[CrossRef]
Muyrers, J. P., Zhang, Y. and Stewart, A. F. (2000). ET-cloning: think recombination first. Genet Eng. 22,77 -98.
Muyrers, J. P., Zhang, Y., Testa, G. and Stewart, A. F.
(1999). Rapid modification of bacterial artificial chromosomes by
ET-recombination. Nucleic Acids Res.
27,1555
-1557.
Nakamura, H., Takagi, S., Toshiaki, T., Matsui, K. and Fujisawa, H. (1988). the prosencephalon has the capacity to diffeentiate into the optic tectum: analysis by chick-specific monoclonal antibodies in quail-chick chimeric brains. Dev. Growth Differ. 30,717 -725.[CrossRef]
Narayanan, K., Williamson, R., Zhang, Y., Stewart, A. F. and Ioannou, P. A. (1999). Efficient and precise engineering of a 200 kb beta-globin human/bacterial artificial chromosome in E. coli DH10B using an inducible homologous recombination system. Gene Ther. 6,442 -447.[CrossRef][Medline]
Oxtoby, E. and Jowett, T. (1993). Cloning of
the zebrafish krox-20 gene (krx-20) and its expression during hindbrain
development. Nucleic Acids Res.
21,1087
-1095.
Palmgren, A. (1921). Embryological and morphological studies on the midbrain and cerebellum of vertebrates. Acta Zool. 2,1 -94.
Pfeffer, P. L., Payer, B., Reim, G., di Magliano, M. P. and Busslinger, M. (2002). The activation and maintenance of Pax2 expression at the midhindbrain boundary is controlled by separate enhancers. Development 129,307 -318.[Medline]
Picker, A., Brennan, C., Reifers, F., Clarke, J. D., Holder, N. and Brand, M. (1999). Requirement for the zebrafish mid-hindbrain boundary in midbrain polarisation, mapping and confinement of the retinotectal projection. Development 126,2967 -2978.[Abstract]
Picker, A., Scholpp, S., Bohli, H., Takeda, H. and Brand, M.
(2002). A novel positive transcriptional feedback loop in
midbrain-hindbrain boundary development is revealed through analysis of the
zebrafish pax2.1 promoter in transgenic lines.
Development 129,3227
-3239.
Prince, V. E., Moens, C. B., Kimmel, C. B. and Ho, R. K. (1998). Zebrafish hox genes: expression in the hindbrain region of wild-type and mutants of the segmentation gene, valentino. Development 125,393 -406.[Abstract]
Reifers, F., Bohli, H., Walsh, E. C., Crossley, P. H., Stainier, D. Y. and Brand, M. (1998). Fgf8 is mutated in zebrafish acerebellar (ace) mutants and is required for maintenance of midbrain-hindbrain boundary development and somitogenesis. Development 125,2381 -2395.[Abstract]
Reim, G. and Brand, M. (2002). Spiel-ohne-grenzen/pou2 mediates regional competence to respond to Fgf8 during zebrafish early neural development. Development 129,917 -933.[Medline]
Rhinn, M. and Brand, M. (2001). The midbrain-hindbrain boundary organizer. Curr. Opin. Neurobiol. 11,34 -42.[CrossRef][Medline]
Rowitch, D. H., Kispert, A. and McMahon, A. P. (1999). Pax-2 regulatory sequences that direct transgene expression in the developing neural plate and external granule cell layer of the cerebellum. Dev. Brain Res. 117,99 -108.[CrossRef][Medline]
Sato, T., Araki, I. and Nakamura, H. (2001).
Inductive signal and tissue responsiveness defining the tectum and the
cerebellum. Development
128,2461
-2469.
Scholpp, S. and Brand, M. (2001). Morpholino-induced knockdown of zebrafish engrailed genes eng2 and eng3 reveals redundant and unique functions in midbrain-hindbrain boundary development. Genesis 30,129 -133.[CrossRef][Medline]
Schwarz, M., Alvarez-Bolado, G., Urbanek, P., Busslinger, M. and
Gruss, P. (1997). Conserved biological function between Pax-2
and Pax-5 in midbrain and cerebellum development: evidence from targeted
mutations. Proc. Natl. Acad. Sci. USA
94,14518
-14523.
Sleptsova-Friedrich, I., Li, Y., Emelyanov, A., Ekker, M., Korzh, V. and Ge, R. (2002). fgfr3 and regionalization of anterior neural tube in zebrafish. Mech. Dev. 102,213 -217.
Song, D. L., Chalepakis, G., Gruss, P. and Joyner, A. L. (1996). Two Pax-binding sites are required for early embryonic brain expression of an Engrailed-2 transgene. Development 122,627 -635.[Abstract]
Tallafuss, A., Wilm, T. P., Crozatier, M., Pfeffer, P., Wassef, M. and Bally- Cuif, L. (2001). The zebrafish buttonhead-like factor Bts1 is an early regulator of pax2.1 expression during mid-hindbrain development. Development 128,4021 -4034.[Medline]
Thisse, C., Thisse, B., Schilling, T. and Postlethwait, J. (1993). Structure of th zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119,1203 -1215.[Abstract]
Urbanek, P., Fetka, I., Meisler, M. H. and Busslinger, M.
(1997). Cooperation of Pax2 and Pax5 in midbrain and cerebellum
development. Proc. Natl. Acad. Sci. USA
94,5703
-5708.
Vaage, S. (1969). Segmentation of the primitive neural tube in chick embryos. Ergebn. Anat. Entwickl.-Gesch. 41,1 -88.
Wassarman, K. M., Lewandoski, M., Campbell, K., Joyner, A. L., Rubenstein, J. L., Martinez, S. and Martin, G. R. (1997). Specification of the anterior hindbrain and establishment of a normal mid/hindbrain organizer is dependent on Gbx2 gene function. Development 124,2923 -2934.[Abstract]
Williams, J. A. and Holder, N. (2000). Cell turnover in neuromasts of zebrafish larvae. Hear. Res. 143,171 -181.[CrossRef][Medline]
Wingate, R. J. and Hatten, M. E. (1999). The role of the rhombic lip in avian cerebellum development. Development 126,4395 -4404.[Abstract]
Wullimann, M. and Knipp, S. (2000). Proliferation pattern changes in the zebrafish brain from embryonic through early postembryonic stages. Anat. Embryol. 202,385 -400.[CrossRef][Medline]
Wurst, W. and Bally-Cuif, L. (2001). Neural plate patterning: upstream and downstream of the isthmic organizer. Nat. Rev. Neurosci. 2,99 -108.[CrossRef][Medline]
Zhang, Y., Buchholz, F., Muyrers, J. P. and Stewart, A. F. (1998). A new logic for DNA engineering using recombination in Escherichia coli. Nat. Genet. 20,123 -128.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. Ninkovic, C. Stigloher, C. Lillesaar, and L. Bally-Cuif Gsk3{beta}/PKA and Gli1 regulate the maintenance of neural progenitors at the midbrain-hindbrain boundary in concert with E(Spl) factor activity Development, September 15, 2008; 135(18): 3137 - 3148. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Elworthy, M. Hargrave, R. Knight, K. Mebus, and P. W. Ingham Expression of multiple slow myosin heavy chain genes reveals a diversity of zebrafish slow twitch muscle fibres with differing requirements for Hedgehog and Prdm1 activity Development, June 15, 2008; 135(12): 2115 - 2126. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Chapouton, B. Adolf, C. Leucht, B. Tannhauser, S. Ryu, W. Driever, and L. Bally-Cuif her5 expression reveals a pool of neural stem cells in the adult zebrafish midbrain Development, November 1, 2006; 133(21): 4293 - 4303. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sakaguchi, Y. Kikuchi, A. Kuroiwa, H. Takeda, and D. Y. R. Stainier The yolk syncytial layer regulates myocardial migration by influencing extracellular matrix assembly in zebrafish Development, October 15, 2006; 133(20): 4063 - 4072. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Foucher, M. Mione, A. Simeone, D. Acampora, L. Bally-Cuif, and C. Houart Differentiation of cerebellar cell identities in absence of Fgf signalling in zebrafish Otx morphants Development, May 15, 2006; 133(10): 1891 - 1900. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-W. Jin, D. Beis, T. Mitchell, J.-N. Chen, and D. Y. R. Stainier Cellular and molecular analyses of vascular tube and lumen formation in zebrafish Development, December 1, 2005; 132(23): 5199 - 5209. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Groves, C. L. Hammond, and S. M. Hughes Fgf8 drives myogenic progression of a novel lateral fast muscle fibre population in zebrafish Development, October 1, 2005; 132(19): 4211 - 4222. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Beis, T. Bartman, S.-W. Jin, I. C. Scott, L. A. D'Amico, E. A. Ober, H. Verkade, J. Frantsve, H. A. Field, A. Wehman, et al. Genetic and cellular analyses of zebrafish atrioventricular cushion and valve development Development, September 15, 2005; 132(18): 4193 - 4204. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Holzschuh, N. Wada, C. Wada, A. Schaffer, Y. Javidan, A. Tallafuss, L. Bally-Cuif, and T. F. Schilling Requirements for endoderm and BMP signaling in sensory neurogenesis in zebrafish Development, August 15, 2005; 132(16): 3731 - 3742. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ninkovic, A. Tallafuss, C. Leucht, J. Topczewski, B. Tannhauser, L. Solnica-Krezel, and L. Bally-Cuif Inhibition of neurogenesis at the zebrafish midbrain-hindbrain boundary by the combined and dose-dependent activity of a new hairy/E(spl) gene pair Development, January 1, 2005; 132(1): 75 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Geling, C. Plessy, S. Rastegar, U. Strahle, and L. Bally-Cuif Her5 acts as a prepattern factor that blocks neurogenin1 and coe2 expression upstream of Notch to inhibit neurogenesis at the midbrain-hindbrain boundary Development, May 1, 2004; 131(9): 1993 - 2006. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jaszai, F. Reifers, A. Picker, T. Langenberg, and M. Brand Isthmus-to-midbrain transformation in the absence of midbrain-hindbrain organizer activity Development, December 29, 2003; 130(26): 6611 - 6623. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||