|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 4, 2003
doi: 10.1242/10.1242/dev.00662
Zebrafish Neurogenetics Junior Research Group, Institute of Virology, Technical University-Munich, Trogerstrasse 4b, D-81675 Munich, Germany GSF-National Research Center for Environment and Health, Institute of Developmental Genetics, Ingolstaedter Landstrasse 1, D-85764 Neuherberg, Germany
* Author for correspondence (e-mail: bally{at}gsf.de)
Accepted 30 May 2003
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: her5, Midbrain-hindbrain, Midbrain-hindbrain boundary, Zebrafish, acerebellar, no-isthmus, ET-cloning, Transgenesis
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The midbrain-hindbrain (MH) domain of the embryonic neural tube displays
extensive plasticity linked to specific ontogenic properties that make it an
important model to study developmental dynamics
(Martinez, 2001
;
Rhinn and Brand, 2001;
Wurst and Bally-Cuif, 2001).
The MH can be morphologically identified at early somitogenesis stages as
comprising the mesencephalic vesicle and the first rhombencephalic vesicle (or
metencephalon) (Fig. 1); the
latter- also called `rhombomere A' in the chicken embryo
(Vaage, 1969) - will later
subdivide into rhombomeres (r) 1 and 2. Detailed fate map analyses in avian
embryos demonstrated that the mesencephalon generates all midbrain structures,
i.e. essentially an alar visual center, the tectum and a basal tegmentum,
containing cranial motorneuron III (Marin
and Puelles, 1994; Martinez
and Alvarado-Mallart, 1989). In addition, the caudal third of the
alar mesencephalic domain contributes to the dorsomedial part of the
cerebellar plate (Hallonet and Le Douarin,
1990; Hallonet et al.,
1993; Martinez and
Alvarado-Mallart, 1989), while the alar domain of r1 will give
rise to remaining, lateral cerebellar structures
(Wingate and Hatten, 1999)
(Fig. 1). Finally, the basal r1
territory will generate the pons, of which a prominent output is cranial
motorneuron IV. These distinct fates are prefigured by molecular gradients in
the expression of MH genes such as engrailed-2/3 or ephrins
(Martinez, 2001;
Rhinn and Brand, 2001;
Wurst and Bally-Cuif, 2001).
MH structures, although physically and functionally distinct, develop in a
concerted fashion. Their growth and patterning is dependent upon and
coordinated by an organizing center [the `isthmic organizer' (IsO) or
`isthmus'] located at the midbrain-hindbrain boundary (MHB)
(Martinez, 2001;
Rhinn and Brand, 2001;
Wurst and Bally-Cuif, 2001)
(Fig. 1). Among the factors
that likely mediate IsO activity are the secreted proteins Fgf8 and Wnt1,
expressed on either side of the MHB. Accordingly, genetic analyses in the
mouse, chicken and zebrafish demonstrate that a positive crossregulatory loop
between the expression of IsO markers, of Pax2/5/8- and of Engrailed-family
members is involved, at somitogenesis stages, in the stabilization of
identities surrounding the MHB (Martinez,
2001; Rhinn and Brand,
2001; Wurst and Bally-Cuif,
2001).
|
), or
is reorganized around ectopic transplants of MHB-containing tissue
(Alvarado-Mallart et al., 1990;
Gardner and Barald, 1991;
Martinez et al., 1991;
Nakamura et al., 1988) or
around ectopic foci of Fgf8 expression
(Crossley et al., 1996;
Irving and Mason, 2000;
Lee et al., 1997;
Martinez et al., 1999). At the
same stage, MH identity can also be changed into a diencephalic or more
posterior hindbrain specification in misexpression experiments of diencephalic
(Pax6) (Matsunaga et al.,
2000a) or r2 (Hoxa2) (Irving
and Mason, 2000) factors. Further insight into the potentialities
of the MH domain will be provided by the analysis of mouse or zebrafish
mutants deficient in IsO activity. The zebrafish mutants for Pax2.1
(no-isthmus, noi) and Fgf8 (acerebellar, ace) functions are
of particular interest, because in these backgrounds molecular MH markers are
initially properly induced, but are not maintained
(Brand et al., 1996;
Lun and Brand, 1998;
Reifers et al., 1998). During
somitogenesis, strong noi alleles progressively loose the tectum,
isthmus and cerebellum (Brand et al.,
1996; Lun and Brand,
1998). Similarly, ace mutants progressively lack the
isthmus and cerebellum (Reifers et al.,
1998); they only maintain tectal structures, which express low
levels of Eng, ephrin-A5a and ephrin-A2, suggesting that
they are of anterior identity (Brand et
al., 1996; Picker et al.,
1999). Currently, several (non-exclusive) interpretations can
account for the loss of MH structures in noi and ace
mutants, among which are the death of MH precursors, their conversion to
alternative fates (still to be determined) or their decreased proliferation.
Understanding the fate of MH precursor cells in these backgrounds would reveal
the initial potentialities of the MH anlage and would clarify the role of the
IsO on cell fate.
The MH domain is also characterized by a striking profile of neurogenesis,
where neuronal differentiation in the immediate vicinity of the MHB (the
so-called `intervening zone', IZ) is much delayed compared to other domains of
the neural tube (Bally-Cuif et al.,
1993; Palmgren,
1921; Vaage, 1969;
Wullimann and Knipp, 2000)
(Fig. 1). IZ formation is
permitted by an active process of neurogenesis inhibition at the MHB
(Geling et al., 2003) and, in
zebrafish, the bHLH E(spl)-like factor Her5
(Müller et al., 1996) was
identified as the crucial element both necessary and sufficient for the
formation of the basal IZ domain (Geling
et al., 2003). The IZ plays a crucial role in controlling the
extent of MH neurogenesis over time.
Understanding the dynamics of MH regional specification and neurogenesis
are thus important issues as sustained MH plasticity correlates with the
development of distinct and organized (1) MH derivatives and (2) neurogenesis
domains. To approach this question, we chose to focus on the regulation of
her5 expression. Two main reasons motivated our choice. First,
her5 is the earliest known marker of the MH area
(Bally-Cuif et al., 2000;
Müller et al., 1996), and
as such is the best candidate to label most MH precursors from the moment they
are induced within the neural plate. If this proves true, tracing the
descendants of cells expressing her5 at its onset thus should provide
the best available means of assessing the fate of MH precursors in vivo.
Second, because her5 expression within the IZ crucially controls the
neurogenesis process, looking at the regulation of her5 expression
should permit the appreciation of the dynamics of MH neurogenesis
progression.
We report here the construction of zebrafish embryos where a stable
reporter labels all descendents of her5-expressing cells. To maximize
our chances of isolating all her5 regulatory elements, we used in
vitro homologous recombination (ET-cloning)
(Muyrers et al., 2000;
Muyrers et al., 1999;
Zhang et al., 1998) to
introduce an egfp reporter cDNA at the her5 locus in a PAC
containing more than 40 kb of her5 upstream sequence. We demonstrate
in several independent lines that gfp expression in transgenic
embryos carrying the recombined her5PAC:egfp construct faithfully
reproduces her5 transcription at all stages, including the earliest
step of her5 induction. Using the stability of GFP protein as a
marker for the descendants of her5-expressing cells, we first
demonstrate that the earliest her5-expression domain at gastrulation
encompasses and thus is the first known marker of the whole MH anlage. By
comparing the distribution of her5 RNA and GFP protein, we reveal a
dynamic restriction of her5 expression to the MHB over time, and
propose that this phenomenon permits the progression of neurogenesis in a
converging manner towards the MHB during MH development. Finally, we use GFP
to follow her5 progeny in the noi and ace
backgrounds. We demonstrate that MH precursor cells are maintained but express
alternative identities in noi and ace, albeit with striking
differences between the two mutant contexts. Our results suggest a model for
the progressive restriction of potentialities of MH precursors over time, and
the respective roles of Pax2.1 and Fgf8 in this process.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
); they were
raised and staged according to Kimmel et al.
(Kimmel et al., 1995).
Isolation of her5-containing PACs and determination of
her5 genomic structure
Two independent PACs containing the genomic her5 locus
(BUSMP706P0356Q2, BUSMP706H15152Q2) were isolated by PCR from pools of library
706 (RZPD, Berlin) using the following primers: her5 upstream
5'TAGTAGACCTAGCTGGTCTTTTCAGTCTTTGGAGAGC3', her5 reverse
5'TAAAAAGGGCACGCACAGAGGAGAGTGATGAGGATGT3', with a 59°C
annealing temperature and 30 amplification cycles, producing a specific
amplification product of 450 bp. PAC DNA was prepared according to the Qiagen
Large Construct kit protocol. Genomic inserts are flanked by NotI
sites; digestion with NotI followed by pulse field gel
electrophoresis (PFGE) revealed that the inserts of both PACs were above 100
kb. Further restriction analyses and Southern blotting revealed that PAC
BUSMP706H15152Q2 contained more than 40 kb of upstream her5 sequence;
this PAC was chosen for further experiments. The genomic structure of
her5 (Fig. 2A) was
determined by PAC sequencing, and was verified on the endogenous her5
locus by PCR amplification and sequencing of genomic DNA.
|
Vectors used
pEGFP-1 (Clontech); pSV40/Zeo (Invitrogen);
pGlZl3_3 (modified pEGFP-1 with a loxP-flanked
Zeo-cassette in AflII-site, see below); pGETrec, carrying
arabinose-inducible recE gene
(Narayanan et al., 1999);
p705-Cre (Buchholz et al.,
1996); and her5-containing PAC (pCYPAC2n
backbone) with a total of about 100 kb genomic insert and at least 40 kb
upstream region of her5), further called her5PAC.
Construction of pGlZl3_3
pEGFP-1 was digested with AflII, and an insert containing
loxP and the restriction enzyme site NheI (produced by
oligonucleotide annealing) was inserted at this site. Similarly, a
loxP-NheI was introduced into the vector pSV40/Zeo
after restriction cutting with BamHI. pSV40/Zeo:loxP-NheI
was further cut with NheI to release the NheI fragment
containing full length of ZeoR and loxP, which
was inserted into pEGF:loxP-NheI open at NheI. This produced
pEGFP:loxP-ZeoR-loxP, further referred to as
pGlZl3_3. All plasmids containing ZeoR were grown
in INF
F' cells.
Preparation of the linear fragment
her5a-EGFP:loxP-ZeoR-loxP-her5b to homologously recombine
into the PAC
Primer design
The fragment for homologous recombination was prepared by PCR using the
following primers. Primer ET2: 48 nucleotides specific to the
5'-sequence of her5 exon 2
(Fig. 2A, fragment b) and 21
nucleotides specific to pGlZl3_3 (underlined) (sequence: 5'GTC
CCC AAG CCT CTC ATG GAG AAA AGG AGG AGA GAT CGC ATT AAT CAA GTC GCC ACC
ATG GTG AGC AAG3'). Primer ET1: 47 nucleotides specific to the
3'-sequence of her5 exon 2
(Fig. 2A, fragment b) and 22
nucleotides specific to pGlZl3_3 (underlined) (sequence: 5'CTC
ATT GTT TGT GTT CTC AAG TAA AAG CAT TCT CAA GGT TTC TAG GCT TAA CGC TTA
CAA TTT ACG CCT3').
Oligonucleotide purification
Oligonucleotides ET1 and ET2 were resuspended in water and purified as
follows. To 100 µl, 12 µl 3 M Sodium-Acetate (pH 7.5) and 120 µl
phenol were added, vortexed and centrifuged for 3 minutes. Then 360 µl
Ethanol was added, and the mix was placed 10 seconds at 80°C, washed once
with 75% ethanol, dried and finally dissolved in 100 µl water.
PCR amplification of the fragment her5a-EGFP:loxP-ZeoR-loxP-her5b: Template her5PAC DNA was denatured for 2 minutes at 94°C, followed by two cycles of denaturation at 94°C for 40 seconds. A first, annealing was performed at 62°C for 30 seconds, with extension at 72°C for 2 minutes. This was followed by 35 amplification cycles with denaturation at 94°C for 40 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 2 minutes. The reaction was stopped by a final extension at 72°C for 10 minutes and cooled at 4°C. The expected 2 kb amplification product was purified using the QIA gel extraction kit (Qiagen) as recommended, and eluted in 50 µl water.
Preparation of bacterial cells and transformation
The bacterial host cells DH10B containing her5PAC were transformed
with pGETrec and prepared for the recombination with the linear
her5a-EGFP:loxP-ZeoR-loxP-her5b fragment as follows:
starting from an overnight culture, the cells were grown at 37°C for 90
minutes (to OD600=0.2-0.3) with shaking. L-arabinose was added to
the culture to a final concentration of 0.2% and the culture was grown further
until OD600=0.5 was reached. The cells were then prepared as
electro-competent as described in
http://www.heidelberg.de/ExternalInfo/stewart/ETprotocols.html.
Electroporation of 120 ng of
her5a-EGFP:loxP-ZeoR-loxP-her5b fragment was performed
with 2.5 kV pulses and 25 µF in 100 µl, induced with 0.2% L-arabinose at
37°C for 90 minutes before harvesting and plating twice for selection.
Removal of loxP-flanked ZeoR-gene by
Cre-mediated deletion
Competent cells carrying the recombined her5PAC were transformed
with p705-Cre using standard protocols. p705 is based on the
pSC101 temperature-sensitive origin, which maintains a low copy
number and replicates at 30°C but not at 40°C. Furthermore,
Cre is expressed from the lambdaPR promoter weakly at
30°C and strongly at 37°C. Finally, these plasmids are lost from cells
if incubated at temperatures above 37°C. Thus, after transformation the
cells were incubated for 2 days at 30°C, followed by 1 day's incubation at
40°C to give a transient burst of Cre expression after which the plasmids
will be eliminated from the cell. The cells were then further grown for day at
37°C, transferred once and finally tested by PCR for excision of the
loxPZeoR-loxP cassette, generating her5PAC:egpf.
Because of the presence of a NotI site 3' to the egfp
gene, digestion of her5PAC:egfp with NotI generated two
fragments of 45 and 60 kb in addition to the vector backbone. PFGE and
Southern blotting with a her5 probe identified the 45 kb fragment as
containing the coding her5 sequence, thus her5PAC:egfp
contains more than 40 kb upstream her5 sequence driving egfp
expression.
Construction of her5PAC:egfp deletion fragments
The fragment containing 3650bp of her5 upstream sequence was
obtained by digestion of her5PAC:egfp with NotI +
BglII followed by pulse field gel electrophoresis, identification by
Southern blotting with a probe covering the her5 5' region, and
gel purification (Qiagen Gel extraction kit). The fragment was subcloned into
pBS(SK) for amplification, and was repurified by digestion and gel
extraction before injection. All other constructs were prepared as PCR
fragments from her5PAC:egfp and purified using the Qiagen PCR
purification kit. All fragments were eluted in H2O (Ambion).
Construction of the transgenic lines
her5PAC:eGFP DNA was isolated using the Qiagen Large Construct
Kit, eluted in H2O and injected (in circular form) into fertilized
eggs at the one-cell stage at a concentration of 50 ng/µl. All other
constructs were injected as linear fragments at the same concentration.
Injected embryos were raised to adulthood and mated to wild-type adults. F1
embryos expressing eGFP were then sorted-out, raised and crossed to wild-type
fish to establish the lines. We obtained integration and expression in three
from 600 injected fish for her5PAC:egfp and in average three from 50
injected fish for the other fragments. All results presented in this work were
verified over at least three generations.
In situ hybridisation and immunocytochemistry
In situ hybridisation and immunocytochemistry were carried out according to
standard protocols (Hauptmann and Gerster,
1994). The following in situ antisense RNA probes were used:
her5 (Müller,
1996; Thisse et al.,
1993); egfp (Clontech); pax6
(Krauss et al., 1991);
fgfr3 (Sleptsova-Friedrich et
al., 2002); otx2 (Li
et al., 1994b); hoxa2
(Prince et al., 1998); and
krx20 (Oxtoby and Jowett,
1993).
For immunocytochemistry, the following antibodies were used: mouse anti-GFP `JL-8' (Chemicon) used at a dilution of 1/100; mouse anti-invected 4D9 (DHSB), which recognises all zebrafish Eng proteins, used at a dilution of 1/8; and rabbit anti-phosphohistone H3 (Upstate Biotechnology, no.06-570) used at a dilution of 1/200. They were revealed using goat-anti-mouse-HRP or goat-anti-rabbit-HRP (Chemicon) (dilution 1/200) followed by DAB/H2O2 staining, or goat-anti-mouse-FITC (Dianova) (dilution 1/200), as appropriate. Double in situ hybridisation and immunocytochemistry staining on transgenic embryos were performed as follows: whole-mount embryos were first processed for in situ hybridisation, then cryostat-sectioned at 8 µm thickness and the sections were subjected to immunocytochemistry following standard protocols. In Fig. 7K-M, immunocytochemical detection was performed after in situ hybridisation on whole-mount specimen. Embryos were scored and photographed under a Zeiss SV11 stereomicroscope or a Zeiss Axioplan photomicroscope.
|
). Embryos were fixed at 24 hpf and uncaged fluorescein was
detected by immunocytochemistry as described by Dickmeis et al.
(Dickmeis et al., 2001).
|
), with minor modifications. Briefly, embryos were incubated
for 20 minutes in 5 µg/ml Acridine Orange (Sigma) in embryo medium, washed
three times for 5 minutes in embryo medium and observed under fluorescence
microscopy with FITC filter. |
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Exon 2 codes for the 32 following amino acids,
comprising the basic domain, helix 1 and part of the loop domain of Her5
(Fig. 2A), and exon 3 for the
last 165 amino acids. We used the ET-cloning technology
(Muyrers et al., 2000;
Muyrers et al., 1999) to
recombine the egfp cDNA in frame after amino acid 33 of Her5 (end of
the basic domain) (Fig. 2A).
The egfp cDNA was terminated with a stop codon and polyadenylation
signal, thus translation of the recombined mRNA is stopped after a fusion
protein that does not comprise the protein interaction motifs of Her5 (HLH and
more C-terminal domains). We expected that this fusion protein would not
interfere with the activity of other bHLH factors. In line with this
prediction, we did not detect any morphological or molecular phenotype in all
our transient or stable expression assays (see below, and data not shown).
Three independent transgenic lines were established that carried the
recombined her5 PAC (her5PAC:egfp lines). All showed an
identical gfp RNA expression profile at all embryonic stages examined
(data not shown). These lines will be used indiscriminately below.
At early gastrulation, her5 is transcribed in a subset of anterior
endodermal precursors ('e' in Fig.
2C) (Bally-Cuif et al.,
2000). Accordingly, we detected GFP expression in the pharynx at
24 hours post-fertilization (hpf) (Fig.
2D, Fig. 3) in all
her5PAC:egfp embryos. These results make of her5 the
earliest selective pharyngeal marker known to date, and are in line with the
proposed role of endodermal Her5 activity in attributing pharyngeal fate
(Bally-Cuif et al., 2000). In
addition, wild-type her5 expression is initiated at the 70% epiboly
stage in a V-shaped neuroectodermal domain ('MH' in
Fig. 2C) that was fate-mapped
to the midbrain at 90% epiboly
(Müller et al., 1996).
Accordingly, strong GFP expression was found in the MH domain (Figs
2D and
3).
|
; Reifers et al.,
1998). To determine whether egfp transcription was a
faithful reporter of her5 expression, we performed double in situ
hybridisation experiments with gfp and her5 probes on
her5PAC:egfp embryos between 60% epiboly and 24 hpf.
her5PAC-driven gfp transcription faithfully reproduced
expression of endogenous her5 at all embryonic stages tested, both in
its onset and spatial extent (Fig.
3A,C,D, and data not shown). In particular, gfp
expression was initiated at 70% epiboly within the neural plate and maintained
in the MH domain thereafter, demonstrating that both the initiation and
maintenance phases of her5 transcription are recapitulated by
expression of the transgene. Together, these observations demonstrate that the
her5PAC construct comprises all the regulatory elements that control
endogenous her5 expression at embryonic stages.
Distinct positive and negative regulatory elements controlling
endodermal and neural expression of her5 are organized over 3 kb of
upstream sequence
To narrow down the sequences directing MH and/or endodermal expression of
her5, we performed a deletion analysis series of the
her5PAC:egfp transgene. A comprehensive series of reporter constructs
of varying length encoding the Her5-eGFP fusion protein and comprising between
60 and 3650 bp upstream of the her5 transcriptional start site
(Geling et al., 2003) were
amplified by PCR from her5PAC:egfp and tested in transient or
transgenic assays (black or red lines in
Fig. 2B, respectively). In the
latter case, at least two independent lines were established for each
construct. Transient assays generally produced ectopic expression sites when
compared with transgenic analyses of the same fragments; however, comparison
of a sufficient number of injected embryos (n>30) allowed to
reliably predict the reporter expression profile (not shown). All results are
summarized in Fig. 2B,D. In
summary, we observed that all fragments containing 240 bp or more of upstream
sequence lead to non-neural expression
(Fig. 2B). Transgenic lines
established with 770 bp upstream region (-0.7her5:egfp) faithfully
recapitulated her5 endodermal expression, with similar onset and
anteroposterior extent (Fig.
2D-H and data not shown). These results locate the her5
endodermal enhancer to the first upstream 770 bp, the first her5
intron (contained in all constructs) or a combination of both.
We next examined the regulatory elements controlling neural expression of her5. We found that all constructs containing more than 770 bp of upstream sequence directed, in addition to endodermal expression, GFP fluorescence within the neural tube (Fig. 2D-G). However, MH selectivity in stable assays was only achieved with upstream sequences of 3.4 kb or more (-3.4her5:egfp lines) (Fig. 2E), whereas shorter elements triggered GFP expression over the MH as well as fore- and hindbrain (e.g. -1.7her5:egfp lines, Fig. 2F,G). Double in situ hybridisation experiments with gfp and her5 probes demonstrated that gfp transcription in -3.4her5:egfp transgenics faithfully reproduces expression of endogenous her5, including its induction and maintenance phases (Fig. 3B,E,F, and data not shown). Thus, all regulatory elements driving correct MH her5 both in time and space appear contained within the -3.4her5:egfp construct. Together, our analysis of the her5 enhancer demonstrates that spatially distinct and dissociable elements drive endodermal and MH expression of her5 during embryogenesis.
her5 expression in endodermal precursors is initiated at 30%
epiboly, and switched off at 90% epiboly
(Bally-Cuif et al., 2000). We
could detect GFP protein in the pharynx until 26-30 hpf (e.g. see
Fig. 2D,F,H), thus GFP protein
is stable for 
18-20 hours in this tissue in our lines. We reached a
similar conclusion for GFP stability in the neural tube, where posterior
her5-positive cells at 75% epiboly rapidly switch off her5
expression and give rise to metencephalic derivatives that loose GFP protein
around 24 hpf (see below). Thus, the GFP protein profile observed at a given
time corresponds to all descendants of the cells that expressed gfp
under her5 regulatory elements between 18-20 and a few hours before
the moment of analysis. The stability of the GFP protein in
her5PAC:egfp embryos thus offers the unique opportunity of following
the fate of her5-expressing cells, from the onset of endogenous
her5 expression and throughout embryogenesis.
Neural her5 expression at gastrulation encompasses the
entire MH anlage
The MH anlage is composed of precursors for the midbrain, isthmus, r1 and
r2 (Fig. 1). These domains are
together characterized by the expression of Eng2 proteins at somitogenesis
stages, but an early molecular marker of the entire presumptive MH remains to
be identified. The onset of her5 expression within the neural plate
is at 70% epiboly, and GFP protein becomes visible in this location around 90%
epiboly (not shown). To determine the fate of these early
her5-expressing cells, we performed a detailed spatiotemporal
analysis of GFP distribution by fluorescence microscopy on live embryos and
immunocytochemistry on whole-mount or sectioned specimen
(Fig. 4A-J). When necessary,
GFP protein distribution was compared with the expression of diagnostic
molecular markers for diencephalic (see
Fig. 8A,E,G,I) or hindbrain
domains (Fig. 4K-Q).
|
|
|
; Macdonald et
al., 1995). From the onset of pax6.1 expression (12
somites) until at least the 30-somite stage, we found that GFP- and
pax6.1-positive cells precisely abut each other at the
di-mesencephalic border (Fig.
8A,C,E,G). The posterior extent of GFP protein distribution was
determined by comparison with the expression of hoxa2 from 10 somites
onwards, when hoxa2 exhibits a sharp anterior limit of expression at
the r1/r2 boundary (Prince et al.,
1998), and with the expression of krox20 that marks r3
and r5 (Oxtoby and Jowett,
1993). At 10 somites and subsequent stages until at least 30
somites, GFP distribution overlaps r2 (Fig.
4K,M,O,Q). A few GFP-positive cells can also transiently be found
within r3 and r4 at 10 somites (Fig.
4L). At this stage, cells in r3 co-express GFP protein and
krox20 (Fig. 4N,
yellow arrows). However the contribution to r3 and r4 is marginal and no
longer detectable at 20 somites (Fig.
4P). To ascertain that her5 expression at its onset within the neural plate comprises all MH precursors, we determined whether the spatial organization of the earliest her5-expressing cells prefigures the later distribution of MH cells along the AP axis. To this aim, we fate mapped the anterior and posterior extremities of the her5 domain at 70% epiboly. To reliably identify this domain, we relied on its giving rise to the earliest detectable GFP expression using fluorescence microscopy in her5PAC:egfp embryos, at 90-95% epiboly. Thus we activated caged-fluorescein in small groups of four or five GFP-positive cells located at the edges of the GFP domain in transgenic embryos at 95% epiboly (Fig. 5A), and followed these cells at 24 hpf (Fig. 5B-E). We found that anterior activated cells always gave rise to cell clones distributing within the anterior midbrain (Fig. 5B,C) (n=4), while posterior activated cells populate r2 (Fig. 5D,E) (n=5). Thus, the anterior and posterior extremities of the earliest her5-expressing domain at 70% epiboly prefigure the corresponding extremities of the later MH.
Together, our findings demonstrate that the early neural expression of her5 is a marker of the entire MH anlage, and it appears as the earliest MH marker known to date. Furthermore, this early domain displays some degree of ordered cell distribution, such that its anterior and posterior limits contain precursors for the anterior and posterior extremities of the later MH. Specifically, at 70% epiboly, anterior her5-positive cells abut and exclude the diencephalon anlage, while posterior cells comprise precursors for r1 and r2.
her5 expression follows a dynamic mode of
regulation that is precisely controlled in time and space
Her5 crucially controls MH neurogenesis
(Geling et al., 2003), making
it important to analyze the regulation of its expression. In 30-somite
her5PAC:egfp embryos, we observed a dramatic difference in the AP
extent of her5 transcription and GFP protein distribution
(Fig. 6A-C). This observation
suggests that MH precursors loose her5 expression upon division, such
that the her5-positive territory shrinks from a domain covering the
entire MH anlage at early gastrulation, to be maintained at 30 somites at the
MHB only. To confirm this hypothesis, and assess the progression of this
phenomenon in time and space, we conducted a precise comparison of
her5 RNA and GFP protein distributions between 90% epiboly (first
stage where GFP protein becomes detectable in the MH domain) and 24 hpf. To
this aim, double in situ hybridisation and immunocytochemical detection was
performed on whole-mount embryos or serial sagittal sections (minimum three
embryos per stage). At 90% epiboly and until the one- to two-somite stage, the
anterior borders of her5 RNA and GFP protein expression were
coincident (Fig. 6D, and data
not shown). However their posterior limits differed by approximately one or
two cell rows (Fig. 6D, and
data no shown). Thus, between the onset of her5 expression in the
neural plate (70% epiboly) and 90% epiboly, her5 transcription
becomes restricted of a few cell rows posteriorly, although it is maintained
in all its progeny cells anteriorly (Fig.
6P, parts a,b). At three somites, her5 transcripts
distribute over approximately eight cell rows along the AP axis, while GFP
protein covers 15-18 rows (Fig.
6E,F). From this stage onwards, prominent differences in the AP
extent of her5 RNA and GFP protein are detectable posteriorly but
also anteriorly, on the lateral and basal domains of the midbrain
(Fig. 6E, black arrows). By
contrast, her5 expression still mostly matches GFP staining along the
dorsal midline of the neural tube (Fig.
6E, blue arrow). Similar observations can be made until the 12- to
14-somite stage (Fig. 6G,H). At
16 somites, the dorsal expression of her5 dramatically regresses and
her5 expression is restricted to a band of 4-6 cell rows across the
entire DV extent of the neural tube (Fig.
6I). At this stage, MH cells have further divided as GFP protein
extent now covers approximately 27-30 rows along AP
(Fig. 6J). This progression is
ongoing at least until the 30-somite stage, when GFP protein extends over
45-50 rows, against 3-5 rows for her5 RNA
(Fig. 4H,
Fig. 6K,L).
To ascertain the directionality of the progressive restriction of
her5 expression in MH precursors, we revealed her5 RNA and
GFP protein on single sagittal sections in double fluorescence experiments
(Fig. 6M-O). Such stainings
unambiguously located the final her5 expression domain to the center
of the GFP-positive domain, confirming that her5 expression is lost
both anteriorly and posteriorly upon cell divisions. Several other MH markers,
e.g. pax2.1, eng1, wnt1 and fgf8, display an expression
profile that globally compares in extent with her5 at early and late
stages, and GFP distribution in pax2.1:gfp transgenics
(Picker et al., 2002) and
wnt1:gfp-injected embryos (Lekven
et al., 2003) suggests that the expression of these genes follow a
restriction similar to her5 over time.
We conclude from these observations that (1) her5 expression
within the MH domain is subject to a highly dynamic regulation and is
progressively lost upon cell divisions between 70% epiboly and 24 hpf
(Fig. 6P), (2) the restriction
of her5 expression occurs in a centripetal manner towards the MHB,
and (3) it follows a precise spatial sequence: it is initiated posteriorly (in
the future metencephalon) before affecting the basolateral and finally the
dorsal mesencephalic areas. her5 expression, at least in the basal
plate, is always adjacent to neurogenesis sites
(Geling et al., 2003). Thus,
our observations imply that neurogenesis within the MH domain is also a
spatially dynamic process, and converges towards the MHB over time (red arrows
in Fig. 6P, part d).
Most MH precursors are maintained but acquire distinct alternative
identities in noi and ace mutant backgrounds
We next used the stability of the GFP protein to study the potentialities
of MH precursors in terms of their spatial identity. MH precursors remain
plastic until late stages, and the choice and reinforcement of their
specification are incompletely understood. We addressed the role of Pax2.1 and
Fgf8 in these processes, by studying GFP distribution in noi and
ace mutants, where the fate of the presumptive MH anlage is
unknown.
We first ascertained that GFP protein could be used as a reliable marker of MH fate in noi and ace. To this aim, we verified that gfp transcription faithfully recapitulated her5 expression in these mutant contexts. Double in situ hybridisations with the her5 and gfp probes were performed on transgenic mutant embryos, and demonstrated an identical initiation (not shown) and later downregulation of her5 and gfp transcription in these backgrounds (Fig. 7A-D). Near-complete downregulation of gfp expression was observable at 24 hpf in her5PAC:egfp;ace embryos (Fig. 7B) and at the 10-somite stage in her5PAC:egfp;noi (Fig. 7D), like expression of endogenous her5. We conclude that the distribution of GFP protein can be used as a faithful tracer of MH precursors in the ace and noi contexts.
Live observation of 24 hour-old transgenic mutant embryos first revealed
that a significant number of GFP-positive fluorescent cells was maintained at
that stage in both the ace and noi backgrounds
(Fig. 7E-G). These cells
distribute over an AP territory that approaches wild-type size (compare
Fig. 7F,G with 7E), and
throughout the entire DV extent of the neural tube. No signs of aberrant cell
migration were apparent at any stage, i.e. no patches of unstained cells were
observed within the GFP-positive domain, and conversely, no patches of
positive cells were found outside the main GFP-positive domain. In addition,
at 15 somites, no difference was observed in the rate of cell death (as
revealed with Acridine Orange) (25±12 cells in wild-type, 26±9
cells in ace, 30±5 cells in noi; n=20)
(Fig. 7H-J) and cell
proliferation (anti-phosphohistone H3) (61±9 cells in wild-type,
55±6 cells in ace; 59±8 cells in noi;
n=10) (Fig. 7K-M) in
that area between wild-type, ace and noi embryos. Together,
these observations suggest that the normal complement of MH precursors is
present in the mutants at least until the 15-somite stage. The expression of
MHB markers (Brand et al.,
1996; Lun and Brand,
1998; Reifers et al.,
1998), however, and of basal MH derivatives such as the III and IV
cranial nerves (Fig. 7E-G,
insets), is absent. Together, these results suggest that MH precursors
remained in place but, at least in part, display alternative identities in the
mutants. We used the co-detection of GFP protein and diagnostic molecular
markers expression on single sections to verify this hypothesis. We
demonstrate below that MH progeny cells display aberrant specification in
noi and ace as early as at 15 somites, when, as described
above, the survival, proliferation and migration of MH cells do not show signs
of perturbation.
The anterior limit of GFP protein abuts at all stages the caudal border of
pax6.1 expression (Fig.
8A,C,E,G), a marker for the posterior diencephalic alar plate.
Strikingly, however, ace mutants showed a significant overlap between
these two patterns at the 30-somite stage
(Fig. 8B,B'), where a
large number of cells in the anterior part of the GFP-positive territory
co-expressed pax6.1. A transient overlap in the expression of Pax6
and En has been documented in chicken
(Matsunaga et al., 2000a),
suggesting that the co-expression GFP and pax6.1 in ace
might result from a failure to downregulate pax6.1 in anterior MH
precursors. However, in a precise comparison of pax6.1 and GFP, as
well as of pax6.1 and Eng proteins expression in zebrafish, we failed
to observe an overlap of these markers at any stage
(Fig. 8E,G and data not shown).
Thus, the co-expression of GFP and pax6.1 in ace rather
reflects aberrant pax6.1 transcription in MH precursors. A
time-course experiment further revealed that GFP-positive cells in
ace express a pax6.1-positive identity at least as early as
the 15-somite stages (Fig. 8,
compare F,F' with E and H,H' with G). In striking contrast to
these findings, a distinct pax6.1/GFP border was maintained in
noi, although pax6.1 expression appeared extended
posteriorly compared with its wild-type pattern (compare
Fig. 8C with 8D).
Diencephalic cells are also characterized by the expression of
fgfr3 (Fig. 8I). In
wild-type transgenic embryos, the GFP-positive territory abuts the caudal
border of fgfr3 expression (Fig.
8I, green arrowheads), which thus shares a common posterior limit
with pax6.1. As reported previously, we found that fgfr3
expression extends ectopically towards caudal in ace and noi
(Sleptsova-Friedrich et al.,
2002). Double labeling of transgenic mutants reveals, in addition,
that GFP and fgfr3 expression overlap extensively in noi,
where all GFP-positive cells co-express fgfr3
(Fig. 8K), at least from the
15-somite stage onwards (Fig.
8L). By contrast, the fgfr3/GFP border is maintained in
the ace alar plate. Both markers overlap in the ace basal
plate (Fig. 8J), however,
further documenting the differential plasticity of basal and alar MH
precursors (see Lun and Brand,
1998; Reifers et al.,
1998; Sleptsova-Friedrich et
al., 2002).
Metencephalic derivatives such as the cerebellum fail to develop in both
ace and noi, but the fate of metencephalic progenitors is
unknown. To address this question, we relied on the expression of
otx2, a marker of the fore- and midbrain, but not hindbrain
territories. In ace mutants, we found that the posterior limit of
otx2 expression precisely coincided with the posterior border of GFP
protein distribution (Fig. 8N).
Because no extensive cell death was observed in the mutants
(Reifers et al., 1998)
(Fig. 7I and data not shown),
this result highlights that metencephalic precursors display an
otx2-positive identity in the absence of Fgf8 function. By contrast,
in noi mutants, the caudal border of otx2 expression
appeared to be located half way through the GFP-positive domain, in a manner
reminiscent of the wild-type situation
(Fig. 8M,O). Thus, some AP
distinctions related to ante- and post-MHB differences are maintained by the
descendents of MH progenitors in noi. Posterior GFP-positive,
otx2-negative cells also express fgfr3 at high levels
(Fig. 8K), suggesting that they
are of posterior r1 or r2 identity. However, because of the dynamic posterior
limit of GFP protein distribution in the hindbrain
(Fig. 4K-Q), it was not
possible to follow these cells.
Together, our findings demonstrate that MH precursors display aberrant spatial identities in ace and noi, in a manner that strikingly depends on the mutant context. An interpretative summary of our results is presented in Fig. 9.
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
), this
result implies that MH neurogenesis is dynamically regulated and progresses
towards the MHB over time. Finally, we demonstrate that MH precursors are
mostly maintained but harbor alternative identities in noi and
ace, and we show that these identities depend on the mutant context.
Together, our findings provide models for the dynamics of MH neurogenesis and
maintenance, and directly determine pax2.1 and fgf8 mutant
gene activities for their effect on cell identity choices.
Regulatory elements controlling her5 expression
During embryogenesis, her5 expression follows at least three
distinct phases: it is first transcribed in a subset of endodermal precursors,
then induced and maintained within the presumptive MH. In addition, each phase
is subject to dynamic regulation, as endodermal expression is transient
(Bally-Cuif et al., 2000) and
MH expression is drastically downregulated over time (this paper). Because the
her5 enhancer had not been characterized and her5 expression
is complex, we chose the ET-cloning in vitro recombination technology
(Muyrers et al., 2000;
Muyrers et al., 1999;
Zhang et al., 1998) to build
transgenic lines where gfp expression is driven by the complete set
of her5 regulatory elements. Precise analysis of
her5PAC:egfp embryos reveals that our lines indeed fully recapitulate
the phases and dynamics of in vivo her5 expression. Our results
confirm the power of artificial chromosome transgenesis in zebrafish to
decipher the complexity of developmental gene regulation in vivo.
All early MH markers studied to date, including zebrafish her5, pax2.1,
eng2, fgf8 and wnt1, follow a bi-phasic mode of regulation:
their expression is induced at late gastrulation, probably by independent
pathways, and maintained after the five-somite stage in a mutually
interdependent process (Lun and Brand,
1998; Reifers et al.,
1998; Scholpp and Brand,
2001). These phases correspond to distinct regulatory elements on
the promoters of zebrafish pax2.1
(Picker et al., 2002), mouse
Pax2 (Pfeffer et al.,
2002; Rowitch et al.,
1999) and mouse En2
(Li Song and Joyner, 2000;
Song et al., 1996). Our
deletion analysis (Fig. 2 and
data not shown) failed to dissociate initiation and maintenance elements
within the her5 enhancer, suggesting that they are closely linked
and/or overlapping at the her5 locus. The `maintenance' elements of
mouse En2 depend upon Pax2/5/8 binding sites
(Li Song and Joyner, 2000;
Song et al., 1996); those of
mouse Pax2 are at least targets for auto- or crossregulation by
Pax2/5/8 proteins (Pfeffer et al.,
2002). her5 expression is dependent upon the presence of
Pax2.1 at somitogenesis (Lun and Brand,
1998; Reifers et al.,
1998); however, analysis of the her5 enhancer sequence
failed to reveal binding sites for this maintenance factor (A.T. and L.B.-C.,
unpublished). In addition, we showed previously that her5 expression
was not subject to autoregulation (Geling
et al., 2003). Maintenance of her5 expression at
somitogenesis thus likely involves relay factors that have yet to be
identified.
A restricted subset of players involved in MH induction has been
identified: the Oct-like transcription factor Spiel-ohne-Grenzen (Spg)/Pou2
(Belting et al., 2001;
Burgess et al., 2002) and the
Btd/Sp1-like zinc finger protein Bts1
(Tallafuss et al., 2001).
Accordingly, Oct- and Sp1-binding sites are found on the early-acting enhancer
of mouse Pax2, and at least the Oct sites are required for enhancer
activity (Pfeffer et al.,
2002). Similarly, we found that several Oct and Sp sites are
present on the her5 MH enhancer (A.T. and L.B.-C., unpublished). The
requirement for these specific sites for her5 induction remains to be
directly demonstrated; suggestively, however, endogenous her5
expression (Reim and Brand,
2002) and her5PAC-driven gfp expression (A.T.
and L.B.-C., not shown) followed the same decreased and delayed induction in
spg/pou2 mutants compared with wild-type siblings. Factors
restricting her5 expression to the MH anlage also remain crucial
components of the MH induction process to be identified. Some of these likely
bind the distal region of the her5 enhancer, as proximal domains
drove unrestricted reporter expression to the anterior brain in our transgenic
assays (Fig. 2F,G).
her5 expression is the earliest marker of MH
fate
GFP protein distribution (Fig.
4) and direct mapping of the anterior and posterior extremities of
the earliest her5-positive domain within the neural plate
(Fig. 5) position the early
anterior her5 expression border to the di-mesencephalic boundary,
while the posterior border of her5 expression is more dynamic and
expands, at early stages, a minor contribution into r3 and r4. GFP-positive
cells found in r3 and r4 might be accounted for by a transient overlap of
her5 expression with the r3/r4 anlage at gastrulation. However, at
this stage, her5 is not co-expressed with hoxa-1 (later
renamed hoxb1b) (A.T. and L.B.-C., unpublished), interpreted to
extend to the r3/r4 boundary (Koshida et
al., 1998). Thus, alternatively, the contribution of GFP-positive
cells to r3 and r4 might result from the migration of metencephalic cells
towards caudal, followed by an acquisition of posterior identities (as
revealed, for example, by their expression of krox20)
(Fig. 4N). Such migration has
been documented in the chicken embryo at a later stage
(Marin and Puelles, 1995). We
cannot formerly exclude either possibility at this point.
Outside this marginal contribution to posterior rhombomeres, the large
majority of GFP-positive cells is confined to mesencephalic (midbrain,
isthmus) and metencephalic (r1, r2) derivatives. GFP expression encompasses
the entire extent of the MH domain, and displays a ubiquitous distribution
within this domain. Thus, our results identify her5 expression at its
onset as a comprehensive marker of MH precursors. her5 expression at
90% epiboly was fate mapped to the midbrain only
(Müller et al., 1996), an
observation in agreement with the immediate restriction of her5
expression from posterior cells between 70% and 90% epiboly
(Fig. 6D), and with the
identification of these posterior cells as metencephalic precursors
(Fig. 5D,E). The MH domain is
generally considered as an entity because its different sub-territories
develop in a concerted fashion (in direct or indirect response to IsO
activity), and because it is globally characterized by the expression of
molecular markers (such as En2) at somitogenesis stages
(Martinez, 2001;
Rhinn and Brand, 2001
