|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 4, 2003
doi: 10.1242/10.1242/dev.00618

Cold Spring Harbor Laboratory, 1 Bungtown Road, Cold Spring Harbor, NY 11724, USA
Author for correspondence (e-mail:
jacksond{at}cshl.org)
Accepted 20 May 2003
| SUMMARY |
|---|
|
|
|---|
KN1 trafficking.
GFP
KN1 was able to traffic from the inner layers of the leaf to the
epidermis, but not in the opposite direction, from epidermis to mesophyll.
However, GFP or the GFP
movement protein fusion moved readily out of the
epidermis. GFP
KN1 was however able to traffic out of the epidermal (L1)
layer in the shoot apical meristem, indicating that KN1 movement out of the L1
was developmentally regulated. GFP
KNAT1/BREVIPEDICELLUS and
GFP
SHOOTMERISTEMLESS fusions could also traffic from the L1 to the L2/L3
layers of the meristem. In a test for the functional significance of
trafficking, we showed that L1-specific expression of KN1 or of KNAT1 was able
to partially complement the strong shootmeristemless-11
(stm-11) mutant. However, a cell-autonomous GUS fusion to KN1 showed
neither trafficking ability nor complementation of stm-11 when
expressed in the L1. These results suggest that the activity of KN1 and
related homeobox proteins is maintained following intercellular trafficking,
and that trafficking may be required for their normal developmental
function.
Key words: Homeodomain, KNOX, Shoot meristem, knotted1, GFP, Plasmodesmata, Protein trafficking, Arabidopsis thaliana
| INTRODUCTION |
|---|
|
|
|---|
The use of the green fluorescent protein (GFP) greatly facilitated the
development of in vivo trafficking assays. Tissue-specific GFP expression
studies also revealed dynamic regulation of PD SEL. Estimates for PD SEL in
mesophyll or trichome cells of mature leaves have been obtained from
microinjection experiments, and range from one to a few kDa
(Wolf et al., 1989
;
Waigmann and Zambryski, 1995
).
However, in immature sink tissues the observation of GFP diffusion suggests
that the PD SEL may be as high as 30-50 kDa in these tissues
(Imlau et al., 1999
;
Oparka et al., 1999
).
Developmental changes in GFP diffusion are correlated with changes in PD
structure during leaf development, from simple linear channels to complex
branched forms (Oparka et al.,
1999
). It is also evident that GFP can diffuse cell-to-cell in
some mature tissues, depending on the tissue type and species
(Crawford and Zambryski, 2000
;
Itaya et al., 2000
;
Kim et al., 2002
).
Developmental modifications to PDs are also relevant to MP localization and
trafficking. For example, TMV or cucumber mosaic virus MP has been shown to be
targeted to plasmodesmata and trafficked between cells only when the leaf
reached a certain developmental stage (Ding et al., 1992;
Moore et al., 1992
;
Itaya et al., 1998
). These
observations of GFP diffusion and MP trafficking reveal developmental
regulation of PD function, suggesting that signaling through PDs is important
in plant development. The idea that MP trafficking is related to that of
endogenous proteins is also supported by the fact that trafficking is
extremely rapid (Ding, 1998
),
and that a plant MP-related protein, CmPP16, can traffic itself and mRNA
through PDs (Xoconostle-Cazares et al.,
1999
). However, the extent to which trafficking of endogenous
proteins is developmentally regulated is unclear. Endogenous trafficking
proteins include phloem proteins
(Balachandran et al., 1997
) as
well as several developmental transcription factors such as LEAFY (LFY),
SHORTROOT (SHR) and KNOTTED1 (KN1). The LFY meristem identity protein acts
non-autonomously and is able to traffic from the L1 layer to the L2 and L3
meristem cells and to complement a lfy mutant
(Sessions et al., 2000
). In
the root, the SHR protein traffics from the stele into the endodermal cell
layer, and trafficking appears to be required for its function in cell fate
specification (Nakajima et al.,
2001
). The influence of tissue-specific or developmental signals
in trafficking of these proteins is largely unknown.
The first endogenous protein shown to traffic cell-to-cell was the maize
homeodomain protein, KN1. Mosaic analysis of a dominant Kn1 allele
showed that it acts non-autonomously during maize leaf development
(Hake and Freeling, 1986
).
Later, in situ hybridization and immunolocalization experiments showed that
KN1 protein is detected outside the domain of mRNA expression, suggesting the
possibility of KN1 trafficking (Jackson et
al., 1994
). Microinjection studies of fluorescently labeled KN1
protein showed directly that KN1 has the ability to traffic between mesophyll
cells, to increase PD SEL and to specifically transport its mRNA
(Lucas et al., 1995
). These
studies suggested that the KN1 protein itself could be the cell non-autonomous
signal, and in support of this hypothesis we showed that a GFP-tagged KN1
fusion is able to traffic in the leaf and shoot apical meristem (SAM) in
Arabidopsis (Kim et al.,
2002
). Arabidopsis encodes four class I KN1-related
homeobox (KNOX) genes (Bharathan et al.,
1999
; Reiser et al.,
2000
; Semiarti et al.,
2001
). The most closely related to KN1 are KNOTTED 1-like homeobox
protein 1/BREVIPEDICELLUS (KNAT1/BP) and SHOOTMERISTEMLESS (STM); KNAT1 is
thought to be the Arabidopsis ortholog of KN1
(Bharathan et al., 1999
;
Reiser et al., 2000
), but STM
has closer functional similarity to KN1 on the basis of similar null mutant
phenotypes and expression patterns (Long
et al., 1996
; Vollbrecht et
al., 2000
). STM and KN1 function in SAM initiation and/or
maintenance, and KNAT1/BP is involved in the regulation of inflorescence
architecture (Byrne et al.,
2002
; Douglas et al.,
2002
; Venglat et al.,
2002
). The possible involvement of trafficking in the function of
the Arabidopsis KNOX proteins has not been investigated.
In this report we show a specific difference in inter-layer trafficking in
the Arabidopsis leaf between GFP
MP and GFP
KN1. Our
observations suggest that different mechanisms are involved in the trafficking
of these proteins. We also show that GFP
KN1 trafficking is under
tissue-specific regulation and can be influenced by developmental stage. In
support of a biological function of KNOX protein trafficking, KN1 and the
related Arabidopsis proteins STM and KNAT1 could traffic out of the
L1 layer of the shoot apical meristem, and movement was correlated with the
complementation of stm-11 mutant phenotypes. Based on these findings,
we discuss the potential roles for trafficking of KNOX gene products during
development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA constructs
The pUAS-GFP
KN1 construct was described previously
(Kim et al., 2002
). We used a
10-alanine linker (represented as `
') between GFP and KN1 to improve
stability and folding (Doyle and Botstein,
1996
; Kim et al.,
2002
). The MP coding region (GenBank accession no. U03357) of
turnip vein clearing tobamovirus (TVCV) that is capable of viral
movement/infection in Arabidopsis
(Lartey et al., 1997
) was
amplified using proofreading PCR to insert restriction enzyme sites, allowing
the replacement of KN1 to produce pUAS-GFP
MP. The RbcS2b,
LTP1 and AtML1 gene promoters were amplified by PCR from
Ler genomic DNA and inserted upstream of the GAL4 gene in vector
pCambia2300. The primers used were: pRbcS2b (5' primer:
GCTGCTAGCTTTACCCTAACTACTCCTTT/3' primer:
GTCGTCGACCCCGGGTTGTTGTTTCTCTTCTTCTTTT), pLTP1 (5' primer:
GGGAAGCTTGACCAAAATGATTAACTTGCATTAC/3' primer:
GGGGGATCCATTGATCTCTTAGGTAGTGTTTTATGT) and pAtML1 (5' primer:
GAGGAATTCTTAATTAACATTGATTCTGAACTGTACCC/3' primer:
CATGGATCCGGCGCGCCAACCGGTGGATTCAGGGAG). All other constructs including
pAtML1-GFP
KN1, pAtML1-GFP
STM,
pAtML-GFP
KNAT1, pAtML1-GUS
GFP,
pAtML1-GUS
KN1, 35S-GUS
KN1 were prepared by
sequential modification (replacement by PCR fragments) of the original
GFP
KN1 construct. The PCR fragments were verified by sequencing.
, pAtML-GFP
KNAT1, pAtML1-GUS
GFP,
pAtML1-GUS
KN1, 35S-GUS
KN1 were prepared by
sequential modification (replacement by PCR fragments) of the original
GFP
KN1 construct. The PCR fragments were verified by sequencing.
Imaging
T1 or T2 Arabidopsis plants were grown in
long day conditions in an incubator or in the greenhouse. Unless noted
otherwise, leaf images were taken from fully expanded leaves. Confocal
microscopy was performed as described previously
(Kim et al., 2002
). For free
hand-cut cross sections, tissues were embedded in 4% agarose, cut using a
double-sided razor blade and mounted in water. The confocal pinhole was set at
3.0 Airy units (AU) for leaf tissues and at 2.0 AU for apex tissues.
Two-photon microscopy and scanning electron microscopy were conducted as
described by Oertner et al. (Oertner et
al., 2002
) and Taguchi-Shiobara et al.
(Taguchi-Shiobara et al.,
2001
) respectively, and whole plants were photographed using a
digital camera (Sony).
ß-glucuronidase staining and immunolocalization
ß-glucuronidase (GUS) staining was performed as described previously
(Jefferson, 1987
). The stained
tissues were fixed in FAA (50% ethanol, 10% formaldehyde, 5% acetic acid) for
1 hour, dehydrated, cleared and embedded in Paraplast X-tra (Fisher
Scientific) (Jackson et al.,
1994
). Tissue sections (10 µm) were dewaxed and mounted in
Cytoseal 60 (Stephens Scientific) mounting medium. Immunolocalization of KN1
was performed as described previously
(Lucas et al., 1995
).
stm-11 genotyping
Genotyping of The stm-11 allele was genotyped using a CAPS marker
(M. K. Barton, personal communication). Two stm primers (5'
primer: GGGCTTGATCAATTCATGGAAGCTTACTGTGAAATGCTCGTGCAGTATGAG, 3' primer:
CCCTAGTAACAACCATCAAAG) were used to produce a 350 bp fragment from genomic
DNA. PCR was performed as follows: 95°C 3 minutes, then 35 cycles
(94°C 45 seconds, 60°C 45 seconds, 72°C 1 minute) followed by
72°C for 6 minutes. The MwoI restriction enzyme cuts
50 bp
from the 5' end of the amplified wild-type fragment, but does not cut
the stm-11 fragment. The enzyme digestion was visualized after
running on a 2% agarose gel containing ethidium bromide.
| RESULTS |
|---|
|
|
|---|
KN1 fusion during leaf
development. For green tissue (primarily mesophyll and guard cells) we used
the rubisco small subunit gene (RbcS2b) promoter
(Kim et al., 2002
In all cases, plants expressing GFP, mGFP5-ER
(Fig. 1A) or GFP
TVCV MP
were indistinguishable from normal plants, for example in leaf shape and plant
stature. Plants expressing GFP
KN1, however, showed distinctive
developmental phenotypes. When expressing GFP
KN1 in the epidermis using
the LTP1 or the AtML1 promoters, the plants had a relatively
mild phenotype in which the leaves were reduced in size, rumpled and sometimes
mildly lobed (Fig. 1B,C,E). The
pAtML1-GFP
KN1 plants had stronger phenotypes than
pLTP1-GFP
KN1 plants. The overall stature of these plants upon
flowering was normal. In contrast, plants expressing GFP
KN1 from the
RbcS2b promoter had a more severe phenotype, reminiscent of plants
overexpressing KNOX genes using the strong constitutive 35S promoter
(Lincoln et al., 1994
;
Chuck et al., 1996
;
Kim et al., 2002
). These
plants were stunted and had reduced and severely lobed leaves
(Fig. 1D,E). Some seedlings had
a very severe phenotype where the whole shoot comprising multiple organs, was
smaller than a single cotyledon (Fig.
1F); these seedlings also developed ectopic shoots on the leaves,
again reminiscent of 35S-KNOX over-expressors
(Lincoln et al., 1994
;
Chuck et al., 1996
)
(Fig. 1G). In summary, plants
developed distinct phenotypes depending on whether they expressed GFP
KN1
in the epidermis or in the green (predominantly mesophyll) tissues.
|
|
|
KN1 and GFP
MP traffic from mesophyll to
epidermal cells in the leaf
KN1 or GFP
TVCV MP could traffic from
mesophyll to epidermal cells in the shoot, we imaged hand-cut cross sections
from the respective UAS-transgene seedlings carrying the pRbcS2b GAL4
driver (Fig. 2). (The term
`driver' means a promoter in the GAL4/UAS two-component system.) We observed
movement of GFP
KN1 (Fig.
2D-F), GFP
TVCV MP (Fig.
2G-I) and free GFP (Fig.
2J-L) to the epidermis. In each case, the level of fluorescence in
the epidermal cells was approximately equal to that in the mesophyll. We
assessed the sub-cellular localization of these fusion proteins at a higher
magnification in paradermal confocal sections. Both GFP
KN1 and
GFP
TVCV MP localized to the nuclei, the cytoplasm and to punctate spots
between cells (Fig. 2F,I).
Similar spots were not seen in plants expressing mGFP5-ER or free GFP
(Fig. 2C,L). The GFP
KN1
fusion protein was also detected in epidermal cell nuclei using the anti-KN1
antibody (Fig. 2N,O, lower
panel) (Smith et al., 1992
KN1 fusion protein and not a free GFP degradation product. This
observation of GFP
KN1 trafficking was consistent with results using an
enhancer trap line to express this fusion in perivascular cells
(Kim et al., 2002
TVCV MP were also able to move from
mesophyll to epidermal cells.
GFP
KN1 did not traffic out of the epidermis of leaf primordia or
of fully expanded leaves
GFP
KN1 could traffic in the leaf from the mesophyll to epidermal cell
layer, where it accumulated in nuclei and in punctate cell wall spots. To
investigate whether trafficking could also occur in the opposite direction,
from epidermis to mesophyll, we expressed GFP
KN1 and the other fusion
proteins in the epidermal layer of the shoot using the pLTP1 and
pAtML1 GAL4 drivers. In leaves and hypocotyls, the pLTP1 and
pAtML1 GAL4 drivers induced mGFP5-ER expression specifically in
epidermal cells, with no green fluorescence over background levels detected in
any other tissues of the shoot (Fig.
3A-C).
We next imaged fluorescence of GFP
KN1 under the control of the same
L1-specific GAL4 drivers. GFP
KN1 fluorescence was restricted to the
epidermal tissues of the mature leaf and hypocotyl, and we did not detect any
movement to mesophyll cells (Fig.
3D-F). Therefore, in contrast to the result from
mesophyll-specific expression, when expressed specifically in epidermal cells,
GFP
KN1 was unable to traffic into cells in the adjacent cell layers.
To determine whether the absence of trafficking of GFP
KN1 out of
epidermal cells also occurred in the early stages of leaf development, we
imaged GFP fluorescence from young leaf primordia approximately 2 mm long.
Expression of mGFP5-ER showed that pAtML1 was also epidermis specific
in young leaf primordia (Fig.
3H, upper panel). GFP
KN1 expressed under the control of
pAtML1 was also restricted to the epidermal layer
(Fig. 3G,H, lower panel).
Plants expressing GFP
KN1 under the control of a mesophyll or
perivascular tissue-specific GAL4 driver showed punctate localization in the
cell wall and we investigated whether plants expressing GFP
KN1 in the
epidermis also have this phenotype. We could not detect spots of GFP
fluorescence in the cell walls of plants expressing GFP
KN1 in the
epidermis (Fig. 3F), although
epidermally expressed GFP
MP did show this putative plasmodesmal
localization (Fig. 3K).
To test whether the restriction of protein trafficking out of epidermal
cells was a general phenomenon, we expressed free GFP and GFP
TVCV MP
using the L1-specific GAL4 drivers. Previous reports
(Oparka et al., 1999
) and our
unpublished results suggested that free GFP could move freely from epidermal
to mesophyll cells in bombardment assays, and we observed similar results in
stable transgenic lines (Fig.
3I). We also detected extensive trafficking of GFP
TVCV MP
from the epidermis into mesophyll and vascular tissues
(Fig. 3J). In these cases, the
green fluorescence intensity in mesophyll and vascular tissues was
approximately equal to that in epidermal cells, suggesting that GFP and
GFP
TVCV MP moved readily from epidermal to mesophyll cells. Therefore,
the PDs between epidermal and mesophyll cells were open to both non-selective
and selective movement.
Previous studies underline the importance that viral MPs play in long
distance viral movement and infection
(Deom et al., 1994
;
Wang et al., 1998
;
Itaya et al., 2002
). Since we
saw a high level of GFP fluorescence from the GFP
TVCV MP fusion in
mesophyll and vascular tissues of the shoot, we investigated how far
GFP
TVCV MP could traffic in the plant, by imaging roots of
pAtML1-GFP
TVCV MP plants. AtML1 mRNA is not detectable
in the root (Lu et al., 1996
),
and mGFP5-ER expression was not detected in the mature region of
pAtML1-mGFP5-ER roots (Fig.
3L, upper panel). However in seedlings carrying the
UAS-GFP
TVCV MP construct, green fluorescence was detected in
vascular and cortical tissue throughout the length of the root
(Fig. 3L, lower panel),
indicating that MP trafficking occurred over a long distance from the shoot
epidermis into the root, presumably through the phloem. Since MP binds to MP
RNA and facilitates its cell-to-cell trafficking
(Nguyen et al., 1996
), it is
possible that RNA trafficking is responsible for some of the non autonomous
effects.
In summary, whereas GFP
KN1 could traffic freely from mesophyll to
epidermal cells, it could not traffic in the opposite direction. The
epidermal/mesophyll interface was not blocked to either free
diffusion-mediated or selective movement, since both free GFP and GFP
TVCV
MP moved readily from epidermis to mesophyll and vascular tissues.
GFP fusions to
KN1,
STM and
KNAT1 trafficked out of the
epidermal (L1) layer in the shoot apical meristem
To investigate whether the restriction of trafficking of GFP
KN1 out of
the epidermal layer occurred throughout all stages of shoot development, we
imaged the SAM of pAtML1-GFP
KN1 plants. Our previous results
indicated that GFP
KN1 could traffic into the L3 layers of the
inflorescence meristem when expressed in L1 and L2 using the
SCARECROW promoter (Kim et al.,
2002
). However, that study did not determine specifically whether
GFP
KN1 could traffic out of the L1. In the SAM, pAtML1 induced
expression of the mGFP5-ER reporter specifically in the L1
(Fig. 4A) showing strong
perinuclear fluorescence (Fig.
4A, inset). A GUS
GFP fusion was similarly restricted to the
L1 (Fig. 4B). In contrast to
the situation in the leaf, we found that GFP
KN1 could traffic from the L1
into the L2 and L3 layers (Fig.
4C). We also tested if this cell-to-cell trafficking property of
KN1 was conserved in its Arabidopsis homologs. GFP
KNAT1 and
GFP
STM expressed using pAtML1 did traffic in the SAM and showed
strong L1 and weaker L2 fluorescence (Fig.
4D,E and inset). L3 GFP fluorescence from GFP
KNAT1 and
GFP
STM was not evident from the confocal images, but GFP
KNAT1 was
detected using a two-photon microscope
(Fig. 4F). Quantification of
the two-photon signal indicated that the photon number in the outer cell layer
of the L3 was at least two-fold higher than background levels
(Fig. 4G). The nuclear
accumulation of the GFP-tagged protein was less evident in the two-photon
image than in the confocal image because the two-photon microscope collects
light from a narrower Z-section (1 µm). However, nuclear signal was evident
in some cells in the two-photon image (arrowed in
Fig. 4F). We also expressed
GFP
MP and GFP in the L1 layer, and these proteins could also traffic out
of the L1. The fluorescence patterns in apices expressing GFP or GFP
MP
demonstrated more extensive movement than the GFP
KNOX fusions, through at
least 6 cell layers (Fig.
4H,I). Two to three apices from each of 4 independent transgenic
lines showed similar patterns of GFP or GFP
MP localization.
|
KN1 trafficking from the L1 into the L2/L3 occurred only in the SAM
indicating that this aspect of KN1 trafficking was under developmental
control. KNAT1 and STM could also traffic in the SAM, and trafficking of the
KNOX proteins was more restricted than that of GFP or GFP
MP. The
conservation in trafficking ability between functionally related KNOX proteins
in different species suggests that trafficking may be associated with their
innate functions.
L1-specific expression of KN1 and GFP
KN1 can partially complement
stm-11
What are the potential functions of KN1 trafficking during development? As
a first step to answer this question, we investigated whether KN1 continues to
function in SAM maintenance after cell-to-cell trafficking. We first tested
for complementation of stm mutants by KN1 or GFP
KN1. STM is
expressed in the central and peripheral regions of the SAM, in L1, L2 and L3
layers (Long et al., 1996
).
However, the STM promoter used in this study drove strong GUS
expression only in the peripheral region
(Fig. 5A; A. Fernandez and M.
K. Barton, personal communication).
|
KN1 construct. In
the transgenic seedlings, the GFP
KN1 expression pattern was similar to
that of pSTM-GUS, except that fluorescence was also evident in the
central region (Fig. 5B,
arrow), suggesting that GFP
KN1 was trafficking from the peripheral to
central region.
To determine whether stm-11 mutants were complemented by KN1 or
GFP
KN1, we genotyped the transgenic plants using a CAPS assay (A.
Fernandez and M. K. Barton, personal communication). We observed shoot rescue
in stm-11 homozygotes carrying the pSTM-GFP
KN1
transgene, and a representative plant is shown in
Fig. 5C. Similar rescue
phenotypes were observed in 50% of the independent transgenic lines (4 lines
total). The complemented plants showed relatively normal phyllotaxy, leaf and
flower morphology (Fig. 5C,
inset), but were shorter, had additional axillary shoots and were sterile. In
contrast, transgenic lines carrying pSTM-KN1 showed full
complementation of stm-11 (not shown), including normal stature,
flower morphology and fertile seeds. Therefore KN1 could fully complement
stm when expressed from the STM promoter, and the fusion of
GFP to KN1 slightly impaired its function.
To address whether KN1 expression in the L1 and its subsequent trafficking
into L2 and L3 layers was sufficient to rescue stm, we next
transformed stm-11 heterozygotes with the pAtML1-GFP
KN1
construct. In the T1 generation 21/32 (66%) of the stm-11
homozygotes showed partial complementation of the stm-11 phenotype
(Fig. 5D). All complemented
plants showed abnormal phyllotaxy and lacked flowers or had abnormal, sterile
flowers (Fig. 5D, right) that
were similar to those of the weak stm-2 mutant
(Clark et al., 1996
;
Endrizzi et al., 1996
).
Therefore, the L1 expression of GFP
KN1 gave partial complementation of
stm-11 that was less complete than the complementation we observed
using with pSTM-GFP
KN1. To identify whether the partial
complementation by L1 expression of GFP
KN1 was because of the GFP fusion
to KN1, we also transformed stm-11 heterozygotes with a
pAtML1-KN1 construct. The T1 stm-11 seedlings
(>20 independent lines) carrying the pAtML1-KN1 construct showed
similar phenotypes to those with pAtML1-GFP
KN1, i.e. they also
showed only partial complementation (Fig.
5D, left). We also analyzed the T2 generation from the
stm-11 heterozygous T1 plants carrying
pAtML1-KN1. About 32% (74/229) of stm homozygous seedlings
from 3 independent lines showed partial complementation, with phenotypes
similar to those observed in the T1 (not shown).
Since STM and KNAT1 could also traffic out of the L1, we determined whether
L1 expression of these proteins could complement stm-11. Plants
expressing STM or GFP
STM from pAtML1 showed a very severe
phenotype of stunted growth, small lobed leaves, no cauline leaves and flowers
defective in sepal, petal and stamen development
(Fig. 5E). This phenotypes was
presumably partly due to ectopic expression of STM in the leaves and floral
organs. A few plants showed milder, bushy phenotypes
(Fig. 5F). These bushy plants
were homozygous stm-11 (not shown), suggesting therefore partial
complementation by the L1-specific expression of STM. L1 expression of KNAT1
also resulted in partial complementation, as about 30% (7 /24) of T1 plants
expressing GFP
KNAT1 in the L1 showed partial rescue of stm-11.
The stm-11/pAtML1-GFP
KNAT1 seedlings developed rosette
shoots (Fig. 5G) that later
became bushy, similar to stm-2 plants (not shown).
In summary, L1 expression of KN1, STM or KNAT1 was sufficient to give
partial rescue of stm-11. We assume that this rescue is in part due
to KNOX protein that traffics into the L2 and L3 layers of the SAM. The
partial complementation of stm-11 by KNAT1 expression agrees with
previous findings that KNAT1 has a partially redundant function with STM
(Byrne et al., 2002
).
To test if KN1 trafficking was essential for complementation of
stm-11 in this assay, we made a non-trafficking GUS
KN1 fusion.
We fused GUS (68 kDa) at the N terminus of KN1, with an intervening alanine
linker, as previous studies showed this to be the optimal configuration for
KN1 fusions (Kim et al.,
2002
). The GUS
KN1 fusion protein behaved cell-autonomously in
the leaf, as GUS activity was detected only in the perivascular cells in
J2111/UAS-GUS
KN1 lines (Fig.
5H,I) or in the epidermis in pAtML1-GUS
KN1 lines
(Fig. 5J). The GUS
KN1
fusion was also cell-autonomous in the SAM, as pAtML1-GUS
KN1
plants showed GUS activity only in the L1 layer
(Fig. 5K).
We next asked if the L1 restricted expression of GUS
KN1 could rescue
stm-11. We observed no rescue of the stm-11 phenotype in 16
independent T1 stm-11 seedlings and in more than 200
stm-11 seedlings from 4 independent T2 lines that
expressed GUS
KN1 strongly in the L1
(Fig. 5K, inset). This failure
to complement could be because GUS
KN1 was unable to traffic into L2 and
L3 layers, or because the GUS fusion blocked KN1 function independently of its
inhibition of KN1 trafficking. To distinguish these possibilities, we asked if
expression of GUS
KN1 in all cell layers of the SAM was sufficient to
rescue stm-11. To this end, a 35S-GUS
KN1 construct was
transformed into stm-11 heterozygotes. As expected, the transgenic
plants showed constitutive GUS activity in all SAM layers
(Fig. 5L). We confirmed
GUS
KN1 over-expression by western blotting using the anti-KN1 antibody
(Smith et al., 1992
) (data not
shown). We observed shoot rescue in five out of 15 independent T2 lines (33%)
that segregated for stm-11, indicating that the GUS
KN1 fusion
was indeed functional in this shoot rescue assay
(Fig. 5M). The rescue
phenotypes were generally weaker than those of the GFP
KN1 lines, though
some of the 35S-GUS
KN1-rescued seedlings developed inflorescence shoots,
similar to the stm-11 plants rescued by L1-specific expression of
KNOX proteins (not shown). Therefore, GUS
KN1 expression in all SAM layers
could partially complement stm-11, whereas L1-specific expression
gave no such complementation.
We previously showed that 35S-GFP
KN1 plants develop KNOX
over-expression phenotypes (Kim et al.,
2002
). To our surprise, the 35S-GUS
KN1 transgenic
plants (>40) that were wild type for stm did not show any KN1
over-expression phenotypes (Fig.
5P), despite having strong expression of GUS
KN1 throughout
the leaves (Fig. 5P,
inset).
In summary, GUS
KN1 was cell-autonomous and partially complemented
stm-11 if expressed in all meristem layers, but not when expressed
specifically in the L1. These data support the hypothesis that trafficking out
of the L1 is required for shoot rescue in the pAtML1-KNOX expression
lines. Over-expression of the GUS
KN1 fusion did not produce KNOX
over-expression phenotypes, suggesting either that the over-expression
phenotypes require the trafficking function of KN1, or that the GUS fusion
interrupts some other function of KN1 involved specifically in generating
over-expression phenotypes.
| DISCUSSION |
|---|
|
|
|---|
Developmental and tissue-specific control of KN1 trafficking
In plants with simple leaves, KNOX genes are usually expressed only in the
SAM, though developmental consequences of ectopic leaf expression and the
expression of KNOX genes in compound leaves indicate that they can function
during leaf development (Bharathan et al.,
2002
). We found that GFP
KN1 trafficking was regulated
tissue-specifically in the leaf. Whereas it could traffic from mesophyll to
epidermis, trafficking did not occur from epidermis to mesophyll, in either
leaf primordia or in fully expanded leaves. Consistent with these
observations, distinctive phenotypes arose from layer-specific expression of
KN1. As expected, the mesophyll-specific expression of GFP
KN1 resulted in
strong KNOX over-expression phenotypes, similar to constitutive (35S promoter
driven) expression (Lincoln et al.,
1994
; Chuck et al.,
1996
). However, epidermal-specific expression of GFP
KN1
produced a relatively mild, rumpled phenotype. This mild phenotype is probably
due to the restriction of KN1 in the epidermis, though the fact that epidermal
expression is able to alter leaf shape does indicate a non autonomous effect
of KN1 that is presumably not due to trafficking. Similar unidirectional
signaling was observed in periclinal chimeras of the floral organ identity
genes GLOBOSA (GLO) and DEFICIENS (DEF) in
Antirrhinum. Some effects of DEF and GLO expression were non
cell-autonomous, however these effects were only partially explained by
movement, as DEF also moves from L2 to L1 but not in the opposite direction
(Perbal et al., 1996
). In this
study we showed that the lack of protein movement out of the epidermis was
not, however, a general phenomenon. Both GFP and GFP
TVCV MP moved freely
from epidermis to mesophyll, demonstrating that the PDs between epidermal and
mesophyll cells are open to both diffusion-mediated and selective protein
movement.
Uni-directional trafficking of KN1 in the leaf suggests that KN1 normally
traffics from inner to outer layers, and may reveal a directional signaling
pathway. Although class I KNOX genes are not normally expressed in the simple
leaves of maize, rice and Arabidopsis, they are expressed in compound
leaves (Bharathan et al.,
2002
). For example, LeT6 is expressed in tomato leaf primordia as
well as in the SAM (Chen et al.,
1997
; Kim et al.,
2001
). Chen et al. showed that LeT6 mRNA expression was
strong in the L2/L3 layers and reduced or absent from the L1 layer of the SAM,
and we note that this expression pattern continues in the young leaf primordia
(Chen et al., 1997
). It would
be interesting therefore to test whether KNOX proteins traffic directionally
in the tomato compound leaf; such a process could provide a mechanism for
regulation of leaf morphology by signaling from inner to outer layers during
development. Classic studies involving inter-specific periclinal leaf chimeras
indeed indicate the potential for direction signaling during leaf
morphogenesis (reviewed by Tilney-Bassett,
1986
).
In support of the hypothesis that KN1 traffics through PDs, it showed a
punctate pattern resembling that seen with GFP
MP, which has been linked
with plasmodesmata in studies using electron microscope level
immunolocalization (Ding et al.,
1992a
). Our results imply, however, that the mechanism of KN1
trafficking differs from that of the viral MP. This could be because
tissue-specific receptors that recognize distinct trafficking motifs in the
different proteins. This idea is supported by the recent report that
non-cell-autonomous pathway protein (NCAPP1), a putative PD receptor,
interacts with CmPP16 and TMV MP but not with KN1
(Lee et al., 2003
).
Alternatively, tissue-specific post-translational modification(s) of KN1 might
affect its ability to traffic. For example, phosphorylation regulates the
trafficking of TMV MP (Citovsky et al.,
1993
; Waigmann et al.,
2000
), and perhaps a similar mechanism controls KN1
trafficking.
KN1 and related Arabidopsis KNOX proteins STM and KNAT1
traffic in the SAM
Whereas KN1 was unable to traffic from epidermal to mesophyll cells in the
leaf, it could traffic from epidermal (L1) cells to underlying cells in the
inflorescence SAM. Two Arabidopsis homologs of KN1, KNAT1 and STM,
could also traffic in the SAM, suggesting that hypothetical signal(s) for
trafficking in KN1 are conserved in other KNOX proteins. These signal(s) could
be made up of a simple, short sequence and/or complex structural motif(s). So
far, studies using viral MPs and rice phloem proteins suggest that recognition
by the PD trafficking machinery involves structural motifs
(Haywood et al., 2002
;
Ishiwatari et al., 1998
),
though a short sequence motif appears to control the trafficking of the heat
shock cognate 70 chaperone (Aoki et al.,
2002
). In the case of KN1, a short peptide, homologous to a region
near the N terminus of the protein, can interfere with its trafficking, though
it is not known whether this sequence motif is sufficient for trafficking
(Kragler et al., 1998
).
We observed a relatively short range of GFP
KNOX protein trafficking in
the Arabidopsis SAM, which generated a steep gradient of GFP
fluorescence spanning approximately 2
3 cell layers. In contrast,
GFP
KN1 can traffic over at least 3-5 cell layers in the leaf
(Kim et al., 2002
).
GFP
TVCV MP or free GFP moved further than GFP
KNOX in the SAM,
through more than six cell layers. This suggests that KNOX protein trafficking
in the meristem is relatively restricted, and may be used for short range
signaling. The more pronounced nuclear localization of GFP
KN1 in the
meristem than in the leaf may be the cause of its shorter range of
trafficking, as nuclear localization probably restricts its chance to interact
with PD. A similar mechanism was proposed for the restriction of SHR
trafficking (Nakajima et al.,
2001
) and of GFP diffusion
(Crawford and Zambryski,
2000
). In the maize shoot apex, a KN1 protein gradient is also
evident between the SAM and leaf primordia
(Jackson, 2002
). Although the
biological significance of these KNOX protein gradients is not yet clear, it
is possible that they are used to activate target genes at different positions
along the gradient (Jackson,
2002
).
Caution is required in interpreting the trafficking of GFP fusion proteins.
The GFP tag increases the size of the protein and may affect trafficking
efficiency. However, the GFP
KN1 fusion used in this study produced normal
KN1 overexpression phenotypes and also complemented the stm mutation,
suggesting it retained normal biological function(s). In addition, the low
quantum yield for GFP, relative to other fluorophores, may well result in a
significant underestimation of the range over which the tagged protein can
traffic.
Biological function of KNOX homeodomain protein trafficking
The critical question is what, if any, is the function of KNOX protein
trafficking in intercellular signaling? The conservation of trafficking
ability in KNOX proteins of different species suggests that their function
requires trafficking, and the nuclear localization of GFP
KNOX proteins
following trafficking in the SAM suggests that they can function in
transcription in target cells. Cell-to-cell trafficking of KNAT1 could explain
the non cell-autonomous regulation of epidermal cell fate by KNAT1, reported
by Venglat et al. (Venglat et al.,
2002
).
GFP
KNOX expression in the L1 rescued shoot formation in
stm-11 mutants, and trafficking was probably required for this
rescue, because the cell-autonomous GUS
KN1 fusion did not result in
rescue. Whereas this failure to rescue could be because GUS
KN1 was
inactive, this was not the case since it could partially rescue
stm-11 when expressed in all meristem cell layers using the
35S promoter. However, the rescue of stm-11 by
35S-GUS
KN1 was only partial, and we speculate that full KN1
function in the SAM might require its intercellular trafficking. A functional
requirement for KN1 trafficking in the wild-type situation remains to be
tested by determining if expression of the non-trafficking version of KN1
under a faithful STM promoter can complement the stm
mutant.
Our results suggest that the correct spatial and temporal expression
pattern and/or level of KN1/STM in the SAM is required for full
complementation of stm-11. In contrast to the AtML1
promoter, use of the STM promoter resulted in GFP
KN1 expression
at a relatively homogeneous level in the different SAM layers. These
expression differences are probably the reason why the two constructs resulted
in different complementation phenotypes; pAtML1-GFP
KN1 (or KN1)
expression always resulted in partial complementation of stm and
abnormal phyllotaxy, while complementation using pSTM-GFP
KN1 (or
KN1) was more complete and produced seedlings with normal phyllotaxy. In this
regard, intercellular protein trafficking might provide a way to regulate the
distribution and concentration of key developmental regulators across a
cellular domain like the SAM. Intercellular KN1/STM trafficking may be a
redundant `fail-safe' mechanism to ensure all cells adopt the SAM fate,
analogous to the mechanism originally proposed by Mezitt and Lucas
(Mezitt and Lucas, 1996
) for
non-autonomous action of FLORICAULA, and supported by the demonstration of LFY
trafficking (Sessions et al.,
2000
).
Plants expressing the non-trafficking 35S-GUS
KN1 fusion did
not have the usual KN1 over-expression phenotypes. We therefore hypothesize
that KN1 trafficking might be required to generate the over-expression
phenotypes, or that movement per-se is important for function, rather than
simply which cells contain KN1. One possible mechanism would be if KN1 was
modified and gained a novel function during intercellular movement. Partial
unfolding of KN1 is required for passage through PDs
(Kragler et al., 1998
), and
could expose KN1 to post-translational modification(s). Alternatively, the
lack of a KNOX overexpression phenotype in the 35S-GUS
KN1 plants
could be because the fusion of GUS inhibits the ability KN1 to interact with
partner proteins, such as Arabidopsis homologs of KN1 interacting
protein (KIP), a BEL1-like TALE homeodomain protein
(Smith et al., 2002
). Such
interacting proteins may be differentially expressed or differentially
required for the over-expression and SAM functions of KN1. Lastly, the nuclear
localization of STM is required for its activity
(Gallois et al., 2002
), and if
the fusion of GUS interfered with KN1 nuclear localization specifically in the
leaf this could also affect its ability to generate over-expression
phenotypes.
In conclusion, KN1 trafficking is under temporal and tissue-specific developmental control, and trafficking ability is conserved in STM and KNAT1. Our results suggest that trafficking of KNOX homeodomain proteins is functionally significant, and may coordinate the development of source and target cells, or provide a redundant `fail-safe' mechanism to control the fate of cells in the SAM.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Aoki, K., Kragler, F., Xoconostle-Cazares, B. and Lucas, W.
J. (2002). A subclass of plant heat shock cognate 70
chaperones carries a motif that facilitates trafficking through plasmodesmata.
Proc. Natl. Acad. Sci. USA
99,16342
-16347.
Balachandran, S., Xiang, Y., Schobert, C., Thompson, G. A. and
Lucas, W. J. (1997). Phloem sap proteins from cucurbita
maxima and ricinus communis have the capacity to traffic cell to cell through
plasmodesmata. Proc. Natl. Acad. Sci. USA
94,14150
-14155.
Bharathan, G., Janssen, B. J., Kellogg, E. A. and Sinha, N. (1999). Phylogenetic relationships and evolution of the KNOTTED class of plant homeodomain proteins. Mol. Biol. Evol. 16,553 -563.[Abstract]
Bharathan, G., Goliber, T. E., Moore, C., Kessler, S., Pham, T.
and Sinha, N. R. (2002). Homologies in leaf form inferred
from KNOXI gene expression during development. Science
296,1858
-1860.
Byrne, M. E., Simorowski, J. and Martienssen, R. A. (2002). ASYMMETRIC LEAVES1 reveals knox gene redundancy in Arabidopsis. Development 129,1957 -1965.
Chen, J. J., Janssen, B. J., Williams, A. and Sinha, N. (1997). A gene fusion at a homeobox locus: alterations in leaf shape and implications for morphological evolution. Plant Cell 9,1289 -1304.[Abstract]
Chuck, G., Lincoln, C. and Hake, S. (1996). KNAT1 induces lobed leaves with ectopic meristems when overexpressed in Arabidopsis. Plant Cell 8,1277 -1289.[Abstract]
Citovsky, V., McLean, B. G., Zupan, J. R. and Zambryski, P.
(1993). Phosphorylation of tobacco mosaic virus cell-to-cell
movement protein by a developmentally regulated plant cell wall-associated
protein kinase. Genes Dev.
7, 904-910.
Clark, S. E., Jacobsen, S. E., Levin, J. Z. and Meyerowitz, E. M. (1996). The CLAVATA and SHOOT MERISTEMLESS loci competitively regulate meristem activity in Arabidopsis. Development 122,1567 -1575.[Abstract]
Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,735 -743.[CrossRef][Medline]
Crawford, K. M. and Zambryski, P. C. (2000). Subcellular localization determines the availability of non-targeted proteins to plasmodesmatal transport. Curr. Biol. 10,1032 -1040.[CrossRef][Medline]
Deom, C. M., Oliver, M. J. and Beachy, R. N.
(1987). The 30-kilodalton gene product of tobacco mosaic virus
potentiates virus movement. Science
237,389
-394.
Deom, C. M., He, X. Z., Beachy, R. N. and Weissinger, A. K. (1994). Influence of heterologous tobamovirus movement protein and chimeric-movement protein genes on cell-to-cell and long-distance movement. Virology 205,198 -209.[CrossRef][Medline]
Ding, B. (1998). Intercellular protein trafficking through plasmodesmata. Plant Mol. Biol. 38,279 -310.[CrossRef][Medline]
Ding, B., Haudenshield, J. S., Hull, R. J., Wolf, S., Beachy, R.
N. and Lucas, W. J. (1992a). Secondary plasmodesmata are
specific sites of localization of the tobacco mosaic virus movement protein in
transgenic tobacco plants. Plant Cell
4, 915-928.
Ding, B., Turgeon, R. and Parhtasarathy, M. V. (1992b). Substructure of freeze-substituted plasmodesmata. Protoplasma 169,28 -41.[CrossRef]
Ding, B., Kwon, M. O., Hammond, R. and Owens, R. (1997). Cell-to-cell movement of potato spindle tuber viroid. Plant J. 12,931 -936.[CrossRef][Medline]
Douglas, S. J., Chuck, G., Dengler, R. E., Pelecanda, L. and
Riggs, C. D. (2002). KNAT1 and ERECTA regulate inflorescence
architecture in Arabidopsis. Plant Cell
14,547
-558.
Doyle, T. and Botstein, D. (1996). Movement of
yeast cortical actin cytoskeleton visualized in vivo. Proc. Natl.
Acad. Sci. USA 93,3886
-3891.
Endrizzi, K., Moussian, B., Haecker, A., Levin, J. Z. and Laux, T. (1996). The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE. Plant J. 10,967 -979.[CrossRef][Medline]
Gallois, J. L., Woodward, C., Reddy, G. V. and Sablowski, R.
(2002). Combined SHOOT MERISTEMLESS and WUSCHEL trigger ectopic
organogenesis in Arabidopsis. Development
129,3207
-3217.
Gibbs, A. (1976). Virus and plasmodesmata. In Intercellular Communication in Plants: Studies on Plasmodesmata (ed. B. E. S. Gunning and R. W. Robards), pp.149 -164. Berlin/Heidelberg/New York: Springer-Verlag.
Hake, S. and Freeling, M. (1986). Analysis of genetic mosaics shows that the extraepidermal cell divisions in Knotted1 mutant maize plants are induced by adjacent mesophyll cells. Nature 320,621 -623.[CrossRef]
Haseloff, J., Siemering, K. R., Prasher, D. C. and Hodge, S.
(1997). Removal of a cryptic intron and subcellular localization
of green fluorescent protein are required to mark transgenic Arabidopsis
plants brightly. Proc. Natl. Acad. Sci. USA
94,2122
-2127.
Haywood, V., Kragler, F. and Lucas, W. J.
(2002). Plasmodesmata: pathways for protein and ribonucleoprotein
signaling. Plant Cell
14,S303
-S325.
Imlau, A., Truernit, E. and Sauer, N. (1999).
Cell-to-cell and long-distance trafficking of the green fluorescent protein in
the phloem and symplastic unloading of the protein into sink tissues.
Plant Cell 11,309
-322.
Ishiwatari, Y., Fujiwara, T., McFarland, K. C., Nemoto, K., Hayashi, H., Chino, M. and Lucas, W. J. (1998). Rice phloem thioredoxin h has the capacity to mediate its own cell-to-cell transport through plasmodesmata. Planta 205, 12-22.[CrossRef][Medline]
Itaya, A., Woo, Y. M., Masuta, C., Bao, Y., Nelson, R. S. and
Ding, B. (1998). Developmental regulation of intercellular
protein trafficking through plasmodesmata in tobacco leaf epidermis.
Plant Physiol. 118,373
-385.
Itaya, A., Liang, G., Nelson, R. S. and Ding, B. (2000). Nonspecific intercellular protein trafficking probed by green fluorescent protein. Protoplasma 213,165 -175.[CrossRef]
Itaya, A., Ma, F., Qi, Y., Matsuda, Y., Zhu, Y., Liang, G. and
Ding, B. (2002). Plasmodesma-mediated selective protein
traffic between `symplasmically isolated' cells probed by a viral movement
protein. Plant Cell 14,2071
-2083.
Jackson, D. (2001). The long and the short of
it: signaling development through plasmodesmata. Plant
Cell 13,2569
-2572.
Jackson, D. (2002). Double labeling of KNOTTED1
mRNA and protein reveals multiple potential sites of protein trafficking in
the shoot apex. Plant Physiol.
129,1423
-1429.
Jackson, D., Veit, B. and Hake, S. (1994). Expression of maize KNOTTED1 related homeobox genes in the shoot apical meristem predicts patterns of morphogenesis in the vegetative shoot. Development 120,405 -413.[Abstract]
Jefferson, R. A., Kavanagh, T. A. and Bevan, M. W. (1987). GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6,3901 -3907.[Medline]
Kim, M., Canio, W, Kessler, S. and Sinha, N.
(2001). Developmental changes due to long-distance movement of a
homeobox fusion transcript in tomato. Science
293,287
-289.
Kim, J. Y., Yuan, Z., Cilia, M., Khalfan-Jagani, Z. and Jackson,
D. (2002). Intercellular trafficking of a KNOTTED1 green
fluorescent protein fusion in the leaf and shoot meristem of Arabidopsis.
Proc. Natl. Acad. Sci. USA
99,4103
-4108.
Kragler, F., Monzer, J., Shash, K., Xoconostle-Cazares, B. and Lucas, W. J. (1998). Cell-to-cell transport of proteins: requirement for unfolding and characterization of binding to a putative plasmodesmal receptor. Plant J. 15,367 -381.[CrossRef]
Lartey, R., Ghoshroy, S., Ho, J. and Citovsky, V. (1997). Movement and subcellular localization of a tobamovirus in Arabidopsis. Plant J. 12,537 -545.[CrossRef][Medline]
Lee, J. Y., Yoo, B. C., Rojas, M. R., Gomez-Ospina, N.,
Staehelin, L. A. and Lucas, W. J. (2003). Selective
trafficking of non-cell-autonomous proteins mediated by NtNCAPP1.
Science 299,392
-396.
Lincoln, C., Long, J., Yamaguchi, J., Serikawa, K. and Hake,
S. (1994). A knotted1-like homeobox gene in Arabidopsis is
expressed in the vegetative meristem and dramatically alters leaf morphology
when overexpressed in transgenic plants. Plant Cell
6,1859
-1876.
Long, J. A., Moan, E. I., Medford, J. I. and Barton, M. K. (1996). A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379, 66-69.[CrossRef][Medline]
Lu, P., Porat, R., Nadeau, J. A. and O'Neill, S. D. (1996). Identification of a meristem L1 layer-specific gene in Arabidopsis that is expressed during embryonic pattern formation and defines a new class of homeobox genes. Plant Cell 8,2155 -2168.[Abstract]
Lucas, W. J., Ding, B. and van der Schoot, C. (1993). Plasmodesmata and the supracellular nature of plants. New Phytol. 125,435 -476[CrossRef]
Lucas, W. J. and Wolf, S. (1993). Plasmodesmata: the intercellular organelles of green plants. Trends Cell Biol. 3,308 -315.[CrossRef][Medline]
Lucas, W. J., Bouche-Pillon, S., Jackson, D. P., Nguyen, L.,
Baker, L., Ding, B. and Hake, S. (1995). Selective
trafficking of KNOTTED1 homeodomain protein and its mRNA through
plasmodesmata. Science
270,1980
-1983.
Maule, A. J. (1994). Plant-virus movement: de novo process or redeployed machinery? Trends Microbiol. 2,305 -306.[CrossRef][Medline]
Mezitt, L. A. and Lucas, W. J. (1996). Plasmodesmal cell-to-cell transport of proteins and nucleic acids. Plant Mol. Biol. 32,251 -273.[CrossRef][Medline]
Moore, P. J., Fenczik, C. A., Deom, C. M. and Beachy, R. N. (1992). Developmental-changes in plasmodesmata in transgenic tobacco expressing the movement protein of tobacco mosaic virus. Protoplasma 170,115 -127.[CrossRef]
Nakajima, K., Sena, G., Nawy, T. and Benfey, P. N. (2001). Intercellular movement of the putative transcription factor SHR in root patterning. Nature 413,307 -311.[CrossRef][Medline]
Nguyen, L., Lucas, W. J., Ding, B. and Zaitlin, M.
(1996). Viral RNA trafficking is inhibited in replicase-mediated
resistant transgenic tobacco plants. Proc. Natl. Acad. Sci.
USA 93,12643
-12647.
Oertner, T. G., Sabatini, B. L., Nimchinky, E. A. and Svoboda, K. (2002). Facilitation at single synapses probed with optical quantal analysis. Nature Neurosci. 7, 657-664.
Oparka, K. J., Roberts, A. G., Boevink, P., Santa Cruz, S., Roberts, I., Pradel, K. S., Imlau, A., Kotlizky, G., Sauer, N. and Epel, B. (1999). Simple, but not branched, plasmodesmata allow the nonspecific trafficking of proteins in developing tobacco leaves. Cell 97,743 -754.[CrossRef][Medline]
Perbal, M. C., Haughn, G., Saedler, H. and Schwarz-Sommer, Z. (1996). Non-cell-autonomous function of the Antirrhinum floral homeotic proteins DEFICIENS and GLOBOSA is exerted by their polar cell-to-cell trafficking. Development 122,3433 -3441.[Abstract]
Reiser, L., Sanchez-Baracaldo, P. and Hake, S. (2000). Knots in the family tree: evolutionary relationships and functions of knox homeobox genes. Plant Mol. Biol. 42,151 -166.[CrossRef][Medline]
Semiarti, E., Ueno, Y., Tsukaya, H., Iwakawa, H., Machida, C. and Machida, Y. (2001). The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana regulates formation of a symmetric lamina, establishment of venation and repression of meristem-related homeobox genes in leaves. Development 128,1771 -1783.[Abstract]
Sessions, A., Weigel, D. and Yanofsky, M. F. (1999). The Arabidopsis thaliana MERISTEM LAYER 1 promoter specifies epidermal expression in meristems and young primordia. Plant J. 20,259 -263.[CrossRef][Medline]
Sessions, A., Yanofsky, M. F. and Weigel, D.
(2000). Cell-cell signaling and movement by the floral
transcription factors LEAFY and APETALA1. Science
289,779
-782.
Smith, L. G., Greene, B., Veit, B. and Hake, S. (1992). A dominant mutation in the maize homeobox gene, Knotted-1, causes its ectopic expression in leaf cells with altered fates. Development 116,21 -30.[Abstract]
Smith, H. M., Boschke, I. and Hake, S. (2002).
Selective interaction of plant homeodomain proteins mediates high DNA-binding
affinity. Proc. Natl. Acad. Sci. USA
99,9579
-9584.
Taguchi-Shiobara, F., Yuan, Z., Hake, S. and Jackson, D.
(2001). The fasciated ear2 gene encodes a leucine-rich repeat
receptor-like protein that regulates shoot meristem proliferation in maize.
Genes Dev. 15,2755
-2766.
Thoma, S., Hecht, U., Kippers, A., Botella, J., de Vries, S. and Somerville, C. (1994). Tissue-specific expression of a gene encoding a cell wall-localized lipid transfer protein from Arabidopsis. Plant Physiol. 105,35 -45.[Abstract]
Tilney-Bassett, R. A. E. (1986). Plant Chimeras. London: Edward Arnold.
Venglat, S. P., Dumonceaux, T., Rozwadowski, K., Parnell, L.,
Babic, V., Keller, W., Martienssen, R., Selvaraj, G. and Datla, R.
(2002). The homeobox gene BREVIPEDICELLUS is a key regulator of
inflorescence architecture in Arabidopsis. Proc. Natl. Acad. Sci.
USA 99,4730
-4735.
Vollbrecht, E., Reiser, L. and Hake, S. (2000). Shoot meristem size is dependent on inbred background and presence of the maize homeobox gene, knotted1. Development 127,3161 -3172.[Abstract]
Waigmann, E., Lucas, W. J., Citovsky, V. and Zambryski, P.
(1994). Direct functional assay for tobacco mosaic virus
cell-to-cell movement protein and identification of a domain involved in
increasing plasmodesmal permeability. Proc. Natl. Acad. Sci.
USA 91,1433
-1437.
Waigmann, E. and Zambryski, P. (1995). Tobacco mosaic virus movement protein-mediated protein transport between trichome cells. Plant Cell 7,2069 -2079.[Abstract]
Waigmann, E., Chen, M. H., Bachmaier, R., Ghoshroy, S. and Citovsky, V. (2000). Regulation of plasmodesmal transport by phosphorylation of tobacco mosaic virus cell-to-cell movement protein. EMBO J. 19,4875 -4884.[CrossRef][Medline]
Wang, H. L., Wang, Y., Giesman-Cookmeyer, D., Lommel, S. A. and Lucas, W. J. (1998). Mutations in viral movement protein alter systemic infection and identify an intercellular barrier to entry into the phloem long-distance transport system. Virology 245, 75-89.[CrossRef][Medline]
Wille, A. C. and Lucas, W. J. (1984). Ultrastructural and histochemical studies on guard cells. Planta 160,129 -142.[CrossRef]
Wolf, S., Deom, C. M., Beachy, R. N. and Lucas, W. J.
(1989). Movement protein of tobacco mosaic virus modifies
plasmodesmatal size exclusion limit. Science
246,377
-379.
Wu, X., Weigel, D. and Wigge, P. A. (2002).
Signaling in plants by intercellular RNA and protein movement.
Genes Dev. 16,151
-158.
Xoconostle-Cazares, B., Xiang, Y., Ruiz-Medrano, R., Wang, H.
L., Monzer, J., Yoo, B. C., McFarland, K. C., Franceschi, V. R. and Lucas, W.
J. (1999). Plant paralog to viral movement protein that
potentiates transport of mRNA into the phloem. Science
283, 94-98.
Zambryski, P. and Crawford, K. (2000). Plasmodesmata: gatekeepers for cell-to-cell transport of developmental signals in plants. Annu. Rev. Cell Dev. Biol. 16,393 -421.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
Y. Benitez-Alfonso, M. Cilia, A. S. Roman, C. Thomas, A. Maule, S. Hearn, and D. Jackson Control of Arabidopsis meristem development by thioredoxin-dependent regulation of intercellular transport PNAS, March 3, 2009; 106(9): 3615 - 3620. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Cullis, B. J. Vorster, C. Van Der Vyver, and K. J. Kunert Transfer of genetic material between the chloroplast and nucleus: how is it related to stress in plants? Ann. Bot., February 1, 2009; 103(4): 625 - 633. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Shimizu, J. Ji, E. Kelsey, K. Ohtsu, P. S. Schnable, and M. J. Scanlon Tissue Specificity and Evolution of Meristematic WOX3 Function Plant Physiology, February 1, 2009; 149(2): 841 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bolduc, S. Hake, and D. Jackson Dual Functions of the KNOTTED1 Homeodomain: Sequence-Specific DNA Binding and Regulation of Cell-to-Cell Transport Sci. Signal., June 10, 2008; 1(23): pe28 - pe28. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-W. Wang, R. Schwab, B. Czech, E. Mica, and D. Weigel Dual Effects of miR156-Targeted SPL Genes and CYP78A5/KLUH on Plastochron Length and Organ Size in Arabidopsis thaliana PLANT CELL, May 1, 2008; 20(5): 1231 - 1243. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Winter, G. Kollwig, S. Zhang, and F. Kragler MPB2C, a Microtubule-Associated Protein, Regulates Non-Cell-Autonomy of the Homeodomain Protein KNOTTED1 PLANT CELL, October 1, 2007; 19(10): 3001 - 3018. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kumar, K. Kushalappa, D. Godt, M. S. Pidkowich, S. Pastorelli, S. R. Hepworth, and G. W. Haughn The Arabidopsis BEL1-LIKE HOMEODOMAIN Proteins SAW1 and SAW2 Act Redundantly to Regulate KNOX Expression Spatially in Leaf Margins PLANT CELL, September 1, 2007; 19(9): 2719 - 2735. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kessler, B. Townsley, and N. Sinha L1 Division and Differentiation Patterns Influence Shoot Apical Meristem Maintenance Plant Physiology, August 1, 2006; 141(4): 1349 - 1362. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cole, C. Nolte, and W. Werr Nuclear import of the transcription factor SHOOT MERISTEMLESS depends on heterodimerization with BLH proteins expressed in discrete sub-domains of the shoot apical meristem of Arabidopsis thaliana Nucleic Acids Res., March 2, 2006; 34(4): 1281 - 1292. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kurata, T. Ishida, C. Kawabata-Awai, M. Noguchi, S. Hattori, R. Sano, R. Nagasaka, R. Tominaga, Y. Koshino-Kimura, T. Kato, et al. Cell-to-cell movement of the CAPRICE protein in Arabidopsis root epidermal cell differentiation Development, December 15, 2005; 132(24): 5387 - 5398. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. I. Prokhnevsky, V. V. Peremyslov, and V. V. Dolja Actin Cytoskeleton Is Involved in Targeting of a Viral Hsp70 Homolog to the Cell Periphery J. Virol., November 15, 2005; 79(22): 14421 - 14428. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Lee, K.-i. Taoka, B.-C. Yoo, G. Ben-Nissan, D.-J. Kim, and W. J. Lucas Plasmodesmal-Associated Protein Kinase in Tobacco and Arabidopsis Recognizes a Subset of Non-Cell-Autonomous Proteins PLANT CELL, October 1, 2005; 17(10): 2817 - 2831. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-H. Chen, G.-W. Tian, Y. Gafni, and V. Citovsky Effects of Calreticulin on Viral Cell-to-Cell Movement Plant Physiology, August 1, 2005; 138(4): 1866 - 1876. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, A. Krichevsky, M. Vaidya, T. Tzfira, and V. Citovsky Uncoupling of the functions of the Arabidopsis VIP1 protein in transient and stable plant genetic transformation by Agrobacterium PNAS, April 19, 2005; 102(16): 5733 - 5738. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Kim, Y. Rim, J. Wang, and D. Jackson A novel cell-to-cell trafficking assay indicates that the KNOX homeodomain is necessary and sufficient for intercellular protein and mRNA trafficking Genes & Dev., April 1, 2005; 19(7): 788 - 793. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hackbusch, K. Richter, J. Muller, F. Salamini, and J. F. Uhrig A central role of Arabidopsis thaliana ovate family proteins in networking and subcellular localization of 3-aa loop extension homeodomain proteins PNAS, March 29, 2005; 102(13): 4908 - 4912. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kim, E. Cho, K. Crawford, F. D. Hempel, and P. C. Zambryski Cell-to-cell movement of GFP during embryogenesis and early seedling development in Arabidopsis PNAS, February 8, 2005; 102(6): 2227 - 2231. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Gallagher and P. N. Benfey Not just another hole in the wall: understanding intercellular protein trafficking Genes & Dev., January 15, 2005; 19(2): 189 - 195. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Champagne and N. Sinha Compound leaves: equal to the sum of their parts? Development, September 15, 2004; 131(18): 4401 - 4412. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Kimbrough, R. Salinas-Mondragon, W. F. Boss, C. S. Brown, and H. W. Sederoff The Fast and Transient Transcriptional Network of Gravity and Mechanical Stimulation in the Arabidopsis Root Apex Plant Physiology, September 1, 2004; 136(1): 2790 - 2805. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-C. Yoo, F. Kragler, E. Varkonyi-Gasic, V. Haywood, S. Archer-Evans, Y. M. Lee, T. J. Lough, and W. J. Lucas A Systemic Small RNA Signaling System in Plants PLANT CELL, August 1, 2004; 16(8): 1979 - 2000. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sena, J. W. Jung, and P. N. Benfey A broad competence to respond to SHORT ROOT revealed by tissue-specific ectopic expression Development, June 15, 2004; 131(12): 2817 - 2826. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Engstrom, A. Izhaki, and J. L. Bowman Promoter Bashing, microRNAs, and Knox Genes. New Insights, Regulators, and Targets-of-Regulation in the Establishment of Lateral Organ Polarity in Arabidopsis Plant Physiology, June 1, 2004; 135(2): 685 - 694. [Full Text] [PDF] |
||||
![]() |
G.-W. Tian, A. Mohanty, S. N. Chary, S. Li, B. Paap, G. Drakakaki, C. D. Kopec, J. Li, D. Ehrhardt, D. Jackson, et al. High-Throughput Fluorescent Tagging of Full-Length Arabidopsis Gene Products in Planta Plant Physiology, May 1, 2004; 135(1): 25 - 38. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Zambryski Cell-to-cell transport of proteins and fluorescent tracers via plasmodesmata during plant development J. Cell Biol., January 19, 2004; 164(2): 165 - 168. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-H. Cha, K. S. Cho, J. H. Lee, M. Kim, E. Kim, J. Park, S. B. Lee, and J. Chung Discrete Functions of TRAF1 and TRAF2 in Drosophila melanogaster Mediated by c-Jun N-Terminal Kinase and NF-{kappa}B-Dependent Signaling Pathways Mol. Cell. Biol., November 15, 2003; 23(22): 7982 - 7991. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||