|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 4, 2003
doi: 10.1242/10.1242/dev.00655


1 Section of Plant Biology, University of California, Davis, CA, USA
2 Plant Gene Expression Center, USDA/ARS-University of California, Berkeley, CA,
USA
3 Section of Molecular and Cellular Biology, University of California, Davis,
CA, USA
Author for correspondence (e-mail:
nrsinha{at}ucdavis.edu)
Accepted 2 June 2003
| SUMMARY |
|---|
|
|
|---|
Key words: KNOX, PHAN, Tomato, Leaf dorsiventrality, Compound leaf
| INTRODUCTION |
|---|
|
|
|---|
Several genes in several species are thought to specify the adaxial and
abaxial domains. For example, leaf adaxial cell fate is replaced by abaxial
cell fate in the phantastica mutation of Antirrhinum,
suggesting that PHANTASTICA (PHAN), a MYB domain
transcription factor, plays an important role in establishing (or maintaining)
adaxial cell fate in leaf primordia
(Waites and Hudson, 1995
;
Waites et al., 1998
). In
Arabidopsis ARGONAUTE1 (AGO), REVOLUTA (REV) and
PINHEAD (PNH) are also important for specifying adaxial cell
fate in lateral organs and for promoting meristematic activity in the SAM and
axillary meristems (Bohmert et al.,
1998
; Lynn et al.,
1999
; Talbert et al.,
1995
). PHABULOSA and PHAVOLUTA are homeodomain-leucine zipper (HD
ZIP III) proteins with a START (steroid/lipid-binding) domain expressed in the
adaxial cells of the leaf primordium and in the SAM and semi-dominant
mutations in these genes produce radial leaves with adaxial cell fates
(McConnell and Barton, 1998
;
McConnell et al., 2001
). In
the leafbladeless mutant in maize, ectopic patches of abaxial
identity are seen on the adaxial side of the leaf and ectopic lamina forms at
the boundary between the two cell fates
(Timmermans et al., 1998
).
FILAMENTOUS FLOWER (FIL), YABBY2 (YAB2),
YABBY3 (YAB3) and KANADI are expressed only
abaxially in all lateral organs of Arabidopsis, and ectopic
expression of FIL or YAB3 is sufficient to induce ectopic
abaxial patches in the adaxial region of the leaf
(Sawa et al., 1999a
;
Siegfried et al., 1999
).
Together, all these mutant phenotypes strongly suggest that the juxtaposition
of adaxial and abaxial cell fates is necessary for proper leaf lamina
development in simple-leafed species, and that adaxial and abaxial cell fates
are mutually antagonistic.
The Class I KNOTTED-1 LIKE HOMEOBOX (KNOX I) genes play
an important role in maintaining indeterminacy in the SAM and in subsequent
shoot development. Loss-of-function mutations in some of these genes (e.g.
kn1 and stm) result in an inability to form or maintain a
SAM (Barton and Poethig, 1993
;
Kerstetter et al., 1997
;
Smith et al., 1995
;
Vollbrecht et al., 2000
).
Mutations in other KNOX genes cause reduced internode or axis
elongation (Postma-Haarsma et al.,
2002
; Venglat et al.,
2002
). Ectopic overexpression of KNOX genes in dicots
leads to more dissected and highly lobed leaves, often accompanied by ectopic
shoot meristem formation on leaves (Chen et
al., 1997
; Chuck et al.,
1996
; Janssen et al.,
1998
; Lincoln et al.,
1994
; Nishimura et al.,
2000
; Sinha et al.,
1993
). Dominant mutants in the KNOX gene LeT6, Mouse
Ears (Me) and Curl (Cu), express LeT6
ectopically in the mature leaves and show increased leaf dissection
(Chen et al., 1997
;
Parnis et al., 1997
).
Furthermore, KNOX gene expression in leaf primordia accompanies leaf
dissection in many species, suggesting a role for KNOX genes in
making compound leaves (Bharathan et al.,
2002
).
PHAN is reported to be a negative regulator of KNOX
genes. Mutations in PHAN orthologs (RS2 in maize and
AS1 in Arabidopsis) caused KNOX genes to be
expressed ectopically (Byrne et al.,
2000
; Schneeberger et al.,
1998
; Timmermans et al.,
1999
; Tsiantis et al.,
1999
). The phenotype of the double mutant, stm/stm,
as1/as1 indicates that as1 is epistatic to stm in
Arabidopsis (Byrne et al.,
2000
). Because AS1 represses KNAT1 (and
RS2 represses RS1) and STM in turn represses
AS1, the expression domains of PHAN orthologs and
KNOX genes do not overlap (Byrne
et al., 2000
; Timmermans et
al., 1999
; Tsiantis et al.,
1999
; Waites et al.,
1998
). PHAN orthologs are expressed only in the incipient
leaf primordium (P0) and developing leaf primordia
(Timmermans et al., 1999
;
Tsiantis et al., 1999
;
Waites et al., 1998
), but
KN1 and STM are expressed in the SAM and are downregulated
in P0 and leaf primordia in species with simple leaves
(Jackson et al., 1994
;
Long et al., 1996
). However,
in tomato LePHAN and LeT6 mRNA were both detected in the
SAM, in leaflet primordia and in growing leaflet laminas
(Chen et al., 1997
;
Janssen et al., 1998
;
Koltai and Bird, 2000
).
We describe four non-allelic mutants, wiry (w), wiry3 (w3), wiry4 (w4) and wiry6 (w6) that are defective in ab-adaxial symmetry in tomato. The degree of leaf compounding in these mutant plants was severely reduced. The expression patterns of LeT6, TKN1, LePHAN and LeYAB B were determined in the w, w3 and w6 mutants. The regulatory relationship between LePHAN and KNOX genes in the meristem and early leaf primordium is different from that seen during the later stages of leaf development in tomato and may explain the compound nature of the tomato leaf.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mapping the LePHAN locus and w6
The w and w4 loci are on chromosome four (at 20 cM and 28
cM from the distal end of short arm). The w6 locus was mapped using
an F2 mapping population from a cross between w6 (L.
esculentum) and L. pennellii
(Tanksley et al., 1989
). Using
recombination between the w6 mutant phenotype and a LePHAN
RFLP (HindIII) between L. esculentum and L.
pennellii, we determined that the w6 locus is 30 cM from the
LePHAN locus on chromosome 10.
Histology and scanning electron microscopy
Tissues for plastic sections were fixed and sectioned as described
previously (Kessler et al.,
2001
). Samples were viewed with a Nikon Eclipse E600 microscope
and images collected using a SPOT (RT Color) digital camera. Samples for SEM
were fixed and viewed as described previously
(Kessler et al., 2001
).
Electronic images, collected either directly from the SEM or from a SPOT
camera, were processed in Adobe Photoshop.
In situ hybridization and RT-PCR in situ hybridization
In situ hybridizations were performed as described previously
(Long et al., 1996
) using
full-length cDNA probes for LeT6, TKN1, LeYAB B and LePHAN.
Approximately 500,000 pfu of a
gt10 library from 6-7 mm tomato flowers
were screened using INNER NO OUTER, a YABBY member, as probe
(Villanueva et al., 1999
) to
obtain LeYAB B. Median sections (containing the SAM) from multiple
different tissue samples including positive controls were placed on each slide
and processed. Each experiment was repeated at least four times. Tissues for
RT-PCR in situ hybridizations were embedded, sectioned with a Zeiss Microtome
HM340E, and processed as previously described
(Long et al., 1996
). Instead
of an overnight hybridization step, RT-PCR was performed on sections as
previously described (Ruiz-Medrano et al.,
1999
). Primers used for the RT-PCR in situ experiments were
designed based on the cDNA sequence of LePHAN and LeT6 as
follows:
LePHAN1: 5'ACGAGCAGCGTCTTGTTATACAACTAC3',
LePHAN2: 5'CCCTTCGTCTAAATCCTTGCAGC3',
LeT65': 5'TCTTTAACTAACAATAACAATGCAGAAAC3',
LeT63': 5'CCAAAGCAGATTCATGAGAAGAATAG3'.
Immunolocalization
Immunolocalization was performed as described previously
(Jackson et al., 1994
) using a
polyclonal antibody against ROUGHSHEATH2 [a generous gift from Dr Marja
Timmermans, for details on antibody preparation see Kim et al.
(Kim et al., 2003
)].
| RESULTS |
|---|
|
|
|---|
|
|
|
Scanning electron microscopy (SEM) revealed that epidermal cell fates were altered in w3 and w6 leaves. The adaxial epidermal cells of the wild-type leaf were less lobed with fewer crenulations and very few stomata (Fig. 3A), while the abaxial epidermal cells were highly crenulated and irregularly zigzag-shaped with lots of stomata (Fig. 3B). In addition, the wild-type adaxial leaf surface was smooth, compared to the rougher abaxial leaf surface. In contrast, both the upper and lower epidermal cells of w3 leaves had characters intermediate between those seen in the abaxial and adaxial surface of wild type. Both epidermal cells were less lobed (like wild-type adaxial epidermal cells) and had more crenulations (like wild-type abaxial epidermal cells) with roughly equal numbers of stomata, suggesting the loss of distinct abaxial-adaxial epidermal differentiation (Fig. 3C,D). In w6, epidermal cells on both leaf surfaces were highly crenulated and irregular in shape, suggesting abaxialization of the adaxial epidermis of the leaves (Fig. 3E,F). However, w epidermal cells were normal with distinct ab-adaxial features (Fig. 3G,H).
|
|
|
In the wild-type apex, LePHAN mRNA levels were severalfold higher in the leaf primordia than in the SAM central zone. During early leaf development in wild type, LePHAN transcripts were detected in both adaxial and abaxial sides of the leaf primordium (Fig. 5A), but later, as the leaf primordium grew out, LePHAN mRNA was confined to the adaxial side (Fig. 5B). At later developmental stages, strong LePHAN expression was detected in the leaflet primordium and immature leaflet lamina regions (Fig. 5C).
|
LeYABBY B expression in w, w3 and
w6
To further characterize ab-adaxiality in w, w3 and w6
leaves, we examined the expression of LeYAB B, a member of the
YABBY gene family, in leaves of wild-type and the wiry mutants.
LeYAB B was expressed in the abaxial regions of wild-type leaf
primordia (Fig. 5D). In
w6 plants, LeYAB B expression was seen in both the adaxial
and abaxial sides of later radial leaves, and serial sections showed a hollow
tube-like pattern of expression (Fig.
5H,I arrow). Earlier flattened w6 leaves showed a
wild-type LeYAB B expression pattern
(Fig. 5H,I arrowheads).
Interestingly, in the w3 leaf primordium, LeYAB B mRNA
accumulated on the adaxial instead of the abaxial side
(Fig. 5M arrow). No LeYAB
B expression was detected in the w leaf primordium
(Fig. 5Q). These results were
confirmed by northern hybridization to RNA extracted from wiry shoot
apices (data not shown).
Expression of LeT6 and TKN1 in w,
w3 and w6
To determine if reduced leaflet formation in w3 and w6
leaves is due to the alteration of class I KNOX gene expression and
to determine the regulatory relationship between LePHAN and
KNOX genes in tomato, the mRNA expression patterns of two class I
KNOX genes, LeT6 (the tomato STM ortholog) and
TKN1 (the tomato KNAT1 ortholog) were examined.
In wild type, LeT6 mRNA accumulates in the SAM, in the early leaf
primordia, and later in leaflet primordia and growing leaflet blades
(Fig. 5E)
(Chen et al., 1997
). Strong
LeT6 expression was detected in the central zone of wild-type SAM
(Fig. 5E). In the w
and w3 mutants less LeT6 mRNA was detected in the region of
the SAM (Fig. 5N,R).
Downregulation of LeT6 mRNA was seen in later stages of w,
w3 and w6 leaf development. This is equivalent to the stage
producing leaflet primordia and growing leaflet lamina in wild type. No
LeT6 mRNA could be seen in w6 plants that were producing
wire-like leaves (Fig. 5J
inset, R inset). However, LeT6 mRNA localized in the leaflet and
leaflet lamina regions of w, w3 and w6 plants that were
producing leaves that either were cup-shaped or had a reduced number of
leaflets (Fig. 5N insets).
TKN1 expression could be seen in the wild-type SAM, leaf primordia and growing leaflet lamina, but the signal was stronger in the leaf primordia and the peripheral zone of the SAM than in the central zone (Fig. 5F). In w6 plants, a high level of TKN1 RNA was detected throughout the SAM and in both early and late leaf primordia, including the radially symmetrical primordia (Fig. 5K). In w3 and w, TKN1 expression was normal in the SAMs but downregulated in the leaflet primordia (Fig. 5O,S). Expression of TKN1 was absent at the tip of the leaf primordium (distal region), where abaxialized wire-like structures are seen in w shoots (Fig. 5S arrow).
The expressions of KNOX genes (LeT6 and TKN1) were altered in wiry mutants. In particular, downregulation of LeT6 in later stage of leaf primordia was accompanied by reduction of leaf compounding in wiry mutants. Reduction of LePHAN expression and upregulation of TKN1 in w6 suggests a negative regulatory relationship between LePHAN and TKN1.
LeT6 is a negative regulator of LePHAN in
tomato
To determine if LeT6 regulates LePHAN in tomato, we
analyzed LePHAN expression in Curl (Cu), a mutant
known to overexpress LeT6 (Parnis
et al., 1997
). As reported
(Parnis et al., 1997
), ectopic
expression of the LeT6 mRNA was detected in Cu leaflets and
leaflet lamina (Fig. 6A). In
Cu plants, LePHAN was present but reduced in the leaf
primordia, leaflet and leaflet blade regions
(Fig. 6B,C). This
LePHAN downregulation in Cu was not sufficient to cause a
LePHAN downregulation phenotype, as the Cu leaf showed
normal anatomy and epidermal cells (data not shown). Another LeT6
overexpression mutation, Mouse Ears (Me), is caused by a
gene duplication that leads to early overexpression of a homeobox-containing
fusion RNA (Chen et al., 1997
;
Janssen et al., 1998
;
Parnis et al., 1997
). In the
Me mutant, LePHAN expression was reduced and the location of
expression was altered (Fig.
6E,F). In the Me plants, LePHAN expression was
reduced in the proximal region of the leaf primordia (data not shown) and
confined to a narrower adaxial domain in leaf primordia
(Fig. 6E). Often, LePHAN
expression was absent from the leaf primordia of Me/Me
(Fig. 6F), except in vascular
tissues, and the leaves produced were radial. This downregulation of
LePHAN correlated with the production simple leaves and wire-like
leaves at the upper nodes in Me/Me plants
(Fig. 6O), phenocopying
LePHAN downregulation phenotypes
(Fig. 6J). In these
LePHAN antisense transgenic plants, LePHAN expression was reduced to
a narrow domain or only to vascular tissues
(Kim et al., 2003
), similar to
LePHAN expression in Me/Me
(Fig. 6F). Together, these data
suggest that LeT6 is a negative regulator of LePHAN.
|
When Cu was crossed into a LePHAN antisense transgenic line, the Cu phenotype was less severe, having less curled leaves and often cup-shaped leaves with simple leaf blades (Fig. 6H). The curled leaf phenotypes were confined to distal region of the leaf. These plants showed elongated and radially symmetric petioles (Fig. 6G). These results suggest that LePHAN downregulation phenotype is epistatic to Cu and that the LeT6 overexpression phenotypes of Cu require LePHAN activity. In Me/Me, LeT6 overexpression also led to the production of ectopic shoots on the leaves (Fig. 6K,L, asterisk). These ectopic shoots were formed only in the narrow adaxial domains, where LePHAN was expressed (Fig. 6E). Often this adaxial domain converged to a point (Fig. 6L) and ectopic shoots emerged at this point, suggesting that LePHAN activity is required for LeT6 overexpression phenotypes in Me.
Because a phenocopy of PHAN downregulation is seen only in
homozygous Me, but not in heterozygous Me plants, the
suppression of LePHAN by LeT6 seems to be dosage sensitive.
Me/+ plants show a typical KNOX overexpression phenotype
with an increase in leaf compounding (Chen
et al., 1997
; Parnis et al.,
1997
) (Fig. 6N).
Similarly, w6/w6 homozygous plants (with reduced LePHAN
levels) generated wire-like leaves (Fig.
6P) while, w6/+ heterozygous plants produced lobed
leaves, a phenotype also seen in the plants overexpressing KNAT1 in
Arabidopsis (Fig.
6P).
| DISCUSSION |
|---|
|
|
|---|
It has been proposed that the boundary between abaxial and adaxial cell
fates is important for lateral lamina outgrowth
(Bowman et al., 2002
;
Lynn et al., 1999
;
McConnell and Barton, 1998
;
Timmermans et al., 1998
).
Reduced adaxial domain is accompanied by significantly reduced leaflet numbers
in w, w3 and w6 (Table
1). One explanation for the fewer leaflets in w, w3 and
w6 compound leaves is that leaflet primordium formation, like lamina
outgrowth, also requires a proper ab-adaxial boundary.
LePHAN expression in w, w3 and
w6
Two aspects of LePHAN expression in tomato set it apart from
orthologs in other species. No other PHAN ortholog has been reported
to be expressed in the SAM or specifically in the adaxial domain of leaf
primordia. At later stages of leaf development, LePHAN is expressed
only in the region of leaflet primordium initiation
(Fig. 5C), suggesting that
LePHAN (like LeT6) might be involved in leaflet formation,
or in establishing ab-adaxiality of leaflets. The possible function of
LePHAN in leaflet development is also supported by the fact that
LePHAN is not expressed in wire-like leaves and localizes to the
growing leaflet primordium or leaflet lamina region in cup-shaped, or less
compound leaves of w, w3 and w6. Downregulation of
LePHAN was seen in the leaf primordium and leaflet primordium in
these mutants, suggesting that W, W3 and W6 are positive
regulators of LePHAN expression in leaves. In addition, W6
may also regulate LePHAN expression positively in the meristem.
Regulatory relationship between LePHAN and KNOX
genes in tomato
Tomato LePHAN expression was reported to be absent from the SAM in
one study (Pien et al., 2001
)
but was seen in the SAM and leaf primordia in a domain that overlaps the
KNOX expression domain by others
(Koltai and Bird, 2000
). Our
results indicate that the latter is the case and that LePHAN
(Fig. 5A,
Fig. 6F,G) and TKN1
are expressed most strongly in the peripheral zone of the meristem, whereas
LeT6 expresses strongly in the central zone of the meristem
(Fig. 5A,E,F). In
Arabidopsis, STM is a negative regulator of AS1. This
regulatory relationship is conserved to a large extent in tomato. In
Cu and Me (LeT6 overexpression mutants),
LePHAN was reduced, suggesting that LeT6 is a negative
regulator of LePHAN. TKN1 was upregulated in w6 where
LePHAN was downregulated. A simple interpretation for the
upregulation of TKN1 in w6 is that LePHAN is a
negative regulator of TKN1. However, it is unclear how
LePHAN and TKN1 express in an overlapping manner in both the
SAM and early leaf primordia. Perhaps LePHAN and another gene (gene
A) have a mutually exclusive relationship and gene A in turn inhibits
TKN1 expression.
The regulatory dynamics between LePHAN, TKN1 and LeT6 in later leaf and leaflet primordia is different from that in the meristem and early leaf primordium. LePHAN, TKN1 and LeT6 all express in the leaflet primordium and all of them are downregulated in the wire-like leaves of w and w3. These expression data imply that the negative regulation of LeT6 on LePHAN seen in the meristem region does not hold in the wild-type leaflet primordium. Rather, LePHAN functions with LeT6 in a coordinate manner. Cu phenotypes were reduced in antiLePHAN/+ plants and Cu and Me phenotypes were confined to the region where LePHAN was expressed, suggesting that the LeT6 overexpression phenotype requires LePHAN function. Similarly, downregulation of LePHAN masked TKN1 overexpression phenotypes in w6/w6 and suggests that TKN1 also requires sufficient LePHAN activity in the leaflet primordium in tomato.
LeT6 regulation of LePHAN is dosage sensitive
A reduced blade phenotype can be seen only in homozygous Me/Me
plants (Fig. 6O) and not in
heterozygous Me/+ plants (Fig.
6N), implying that a high dose of LeT6 is needed to
downregulate LePHAN in tomato. This hypothesis is also supported by
the fact that the expression domains where LePHAN and LeT6
express strongly do not overlap (Fig.
5A,E). We suggest that low levels of overexpression of either
LeT6 or TKN1 in leaf primordia can cause KNOX
overexpression phenotypes (such as increased dissection of leaves, or more
lobed or heart shaped leaves with palmate venation), but high levels of
LeT6 overexpression might lead to severe LePHAN
downregulation, causing a LePHAN downregulation phenotype. Thus,
w6/+ heterozygous plants produced highly lobed leaves
(Fig. 6P), a phenotype
generally attributed to KNOX gene overexpression, whereas
w6/w6 homozygous plants generated mostly cup-shaped or wire-like
leaves, which is a LePHAN downregulation phenotype
(Fig. 6P). Furthermore, this
LePHAN downregulation phenotype masks the KNOX
overexpression phenotypes in tomato, because a certain level of
LePHAN is required for the KNOX overexpression phenotypes
(as seen in Cu crossed to antiLePHAN and
Me/Me). This idea is supported by some of the phenotypes
seen in tomato plants that overexpress 35S::LeT6. Some
35S::LeT6 transgenic lines showed wire-like radially symmetrical
leaves, resembling PHAN downregulation phenotypes, instead of the
typical LeT6 overexpression phenotypes with more leaflets.
LeT6 overexpression was at much higher level in these plants
producing wire-like leaves, than in plants showing leaflet overproliferation
phenotypes (Janssen et al.,
1998
).
We propose a model (Fig. 7)
that summarizes how LeT6 and LePHAN are regulated in tomato.
Our results suggest that LeT6 and LePHAN have a mutually
antagonistic expression pattern and that each is affected by the quantity of
the other. Thus, high levels of LePHAN repress LeT6 and
similarly high levels of LeT6 repress LePHAN. Our data does
not support increase in LeT6 expression by low levels of
LePHAN and vice versa. At intermediate levels both these genes
express. Since LeT6 is thought to be necessary for meristem formation
in higher plants (although this has not been directly demonstrated in tomato),
loss of LeT6 gene function or downregulation of LeT6 could
be lethal for plants. Low transformation and plant regeneration success in
experiments using 35S::LePHAN constructs support this hypothesis (our
unpublished data). LePHAN and LeT6 levels are well balanced
in the wild-type leaf, producing 7-9 leaflets with normal ab-adaxiality. Weak
LeT6 overexpression and LePHAN downregulation lead to
LeT6 overexpression phenotypes seen in the 35S::LeT6 plants
(Janssen et al., 1998
),
Me/+ and Cu leaves. We suggest that the as1
mutation showing only KNOX overexpression phenotypes in
Arabidopsis and the rs2 phenotype in maize can be
categorized in this group. Perhaps, in these instances, KNOX
overexpression does not reach a level that would cause leaf lobing or the
PHAN downregulation phenotype. Strong KNOX overexpression
and LePHAN downregulation cause LePHAN downregulation
phenotypes including cup-shaped or wire-like leaves, as seen in the
as1 strong allele (Sun et al.,
2002
), severe 35S::LeT6, Me/Me, w6/w6 and
Cu/Cu;antiLePHAN/+ leaves. However, it should be emphasized that a
direct interaction between the KNOX genes and PHAN has not
been proved and this interaction may involve multiple regulatory steps.
|
Is a compound leaf a reiterated shoot system or a carved simple
leaf?
The origins and homologies of compound leaves have been a matter of debate.
One view is that dicot compound leaves are a homeotic reiteration of simple
leaves along the rachis region of a compound leaf
(Lacroix and Sattler, 1994
;
Rutishauser, 1995
). In
contrast, others proposed that a compound leaf is formed by dissecting or
carving a simple leaf, perhaps by inhibition of blade formation in the rachis
area (Hagemann, 1984
;
Kaplan, 1975
).
The adaxial domain is necessary for leaflet primordium formation in tomato.
This is reminiscent of the situation where the adaxial domain of a leaf
primordium is required for normal SAM activity, and is suggestive of some
similarity between compound leaves and shoot systems. This similarity is
further supported by the presence of KNOX gene expression in the
leaflet primordia in all compound-leafed species from ferns and cycads to
higher plants (Bharathan et al.,
2002
).
If the expression of KNOX genes is crucial to make compound
leaves, introducing the expression of KNOX genes into the leaf would
have been an important evolutionary innovation that led to the occurrence of
compound leaves. In Arabidopsis, Antirrhinum and maize (simple
leaves), no KNOX gene expression can be seen in the leaf primordia at
any stage of leaf development. Perhaps this is due to the fact that
PHAN and KNOX have a very tight mutually exclusive
regulatory relationship in Arabidopsis, Antirrhinum and maize
(Byrne et al., 2000
;
Schneeberger et al., 1998
;
Timmermans et al., 1999
;
Tsiantis et al., 1999
;
Waites et al., 1998
). Our
study shows that both KNOX (LeT6 and TKN1) and
LePHAN are expressed in leaflet primordia, suggesting that
KNOX genes and LePHAN are not mutually exclusive in the
tomato leaflet primordium and that their functions might be dependent on each
other. Acquisition of a positive regulatory relationship between KNOX
genes and LePHAN in the leaf primordium might be an evolutionarily
significant change to introduce leaflet formation in the ancestral simple leaf
primordium. In fact, the discovery that the regulation between KNOX
genes and LePHAN of tomato differs from that of simple-leafed species
raises several questions. It will be interesting to determine if the positive
regulatory relationship between KNOX genes and PHAN is
conserved among compound-leafed species and if this positive regulation is
responsible for allowing KNOX expression in leaf primordia of
compound-leafed species.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Department of Plant Biology, University of Georgia,
Athens, GA, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Barton, M. K. and Poethig, R. S. (1993). Formation of the shoot apical meristem in Arabidopsis thaliana: an analysis of development in the wild type and in the shoot meristemless mutant. Development 119,823 -831.[Abstract]
Becraft, P. and Freeling, M. (1994). Genetic analysis of Rough sheath 1 developmental mutants of maize. Genetics 136,295 -311.[Abstract]
Bharathan, G., Goliber, T. E., Moore, C., Kessler, S., Pham, T.
and Sinha, N. R. (2002). Homologies in leaf form inferred
from KNOXI gene expression during development. Science
296,1858
-1860.
Bohmert, K., Camus, I., Bellini, C., Bouchez, D., Caboche, M. and Benning, C. (1998). AGO1 defines a novel locus of Arabidopsis controlling leaf development. EMBO J. 17,170 -180.[CrossRef][Medline]
Bowman, J. L., Eshed, Y. and Baum, S. F. (2002). Establishment of polarity in angiosperm lateral organs. Trends Genet. 18,134 -141.[CrossRef][Medline]
Bowman, J. L. and Smyth, D. R. (1999). CRABS CLAW, a gene that regulates carpel and nectary development in Arabidopsis, encodes a novel protein with zinc finger and helix-loop-helix domains. Development 126,2387 -2396.[Abstract]
Byrne, M. E., Barley, R., Curtis, M., Arroyo, J. M., Dunham, M., Hudson, A. and Martienssen, R. (2000). Asymmetric leaves1 mediates leaf patterning and stem cell function in Arabidopsis. Nature 408,967 -971.[CrossRef][Medline]
Chen, J.-J., Janssen, B.-J., Williams, A. and Sinha, N. (1997). A gene fusion at a homeobox locus: Alternations in leaf shape and implications for morphological evolution. Plant Cell 9,1289 -1304.[Abstract]
Chen, Q., Atkinson, A., Otsuga, D., Christensen, T., Reynolds, L. and Drews, G. N. (1999). The Arabidopsis FILAMENTOUS FLOWER gene is required for flower formation. Development 126,2715 -2726.[Abstract]
Chuck, G., Lincoln, C. and Hake, S. (1996). KNAT1 induces lobed leaves with ectopic meristems when overexpressed in arabidopsis. Plant Cell 8,1277 -1289.[Abstract]
Clayberg, C. D., Butler, L., Rick, C. M. and Robinson, R. W.
(1966). Third list of known genes in the tomato. J.
Hered. 57,189
-196.
Dengler, N. G. (1984). Comparison of leaf development in normal (+/+), entire (e/e), and Lanceolate (La/+) plants of tomato, Lycopersicon esculentum ' Ailsa Craig'. Bot. Gaz. 145, 66-77.[CrossRef]
Eshed, Y., Baum, S. F., Perea, J. V. and Bowman, J. L. (2001). Establishment of polarity in lateral organs of plants. Curr. Biol. 11,1251 -1260.[CrossRef][Medline]
Freeling, M. (1992). A conceptual framework for maize leaf development. Dev. Biol. 153, 44-58.[CrossRef][Medline]
Hagemann, W. (1984). Morphological aspects of leaf development in ferns and angiosperms. New York: Academic Press.
Hanawa, J. (1961). Experimental studies on leaf dorsiventrality in Sesamum indicum L. Bot. Mag. Tokyo 74,303 -309.
Jackson, D., Veit, B. and Hake, S. (1994). Expression of maize KNOTTED 1 related homeobox genes in the shoot apical meristem predicts patterns of morphogenesis in the vegetative shoot. Development 120,405 -413.[Abstract]
Janssen, B.-J., Lund, L. and Sinha, N. (1998).
Overexpression of a homeobox gene, LeT6, reveals indeterminate
features in the tomato compound leaf. Plant Physiol.
117,771
-786.
Kaplan, D. R. (1975). Comparative developmental evaluation of the morphology of Unifacial leaves in the monocotyledons. Bot. Jahrb. Syst. 95,1 -105.
Kerstetter, R. A., Laudencia-Chingcuanco, D., Smith, L. G. and Hake, S. (1997). Loss-of-function mutations in the maize homeobox gene, knotted1, are defective in shoot meristem maintenance. Development 124,3045 -3054.[Abstract]
Kessler, S., Kim, M., Pham, T., Weber, N. and Sinha, N. (2001). Mutations altering leaf morphology in tomato. Int. J. Plant Sci. 162,475 -492.[CrossRef]
Kim, M., McCormick, S., Timmermans, M. and Sinha, N. (2003). The expression domain of PHANTASTICA determines leaflet placement in compound leaves. Nature 424,438 -443.[CrossRef][Medline]
Koltai, H. and Bird, D. M. (2000). Epistatic repression of PHANTASTICA and class I KNOTTED genes is uncoupled in tomato. Plant J. 22,455 -459.[CrossRef][Medline]
Kumaran, M., Bowman, J. and Sundaresan, V.
(2002). YABBY polarity genes mediate the repression of
KNOX homeobox genes in Arabidopsis. Plant
Cell 14,2761
-2770.
Lacroix, C. R. and Sattler, R. (1994). Expression of shoot features in early leaf development of Murraya paniculata (Rutaceae). Can. J. Bot. 72,678 -687.
Lincoln, C., Long, J., Yamaguchi, J., Serikawa, K. and Hake,
S. (1994). A knotted1-like homeobox gene in
Arabidopsis is expressed in the vegetatative meristem and dramatically alters
leaf morphology when overexpressed in transgenic plants. Plant
Cell 6,1859
-1876.
Long, J. A., Moan, E. I., Medford, J. I. and Barton, M. K. (1996). A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379, 66-69.[CrossRef][Medline]
Lynn, K., Fernandez, A., Aida, M., Sedbrook, J., Tasaka, M., Masson, P. and Barton, M. K. (1999). The PINHEAD/ZWILLE gene acts pleiotropically in Arabidopsis development and has overlapping functions with the ARGONAUTE1 gene. Development 126,469 -481.[Abstract]
McConnell, J. R. and Barton, M. K. (1998). Leaf polarity and meristem formation in Arabidopsis. Development 125,2935 -2942.[Abstract]
McConnell, J. R., Emery, J., Eshed, Y., Bao, N., Bowman, J. and Barton, M. K. (2001). Role of PHABULOSA and PHAVOLUTA in determining radial patterning in shoots. Nature 411,709 -713.[CrossRef][Medline]
McCormick, S. (1991). Transformation of tomato with Agrobacterium tumefaciens. In Plant Tissue Culture Manual, Fundamentals and Applications, Vol.B6 (ed. K. Lindsey), pp. 1-9. Dordrecht: Kluwer.
McHale, N. A. (1993a). LAM-1 and FAT genes
control development of the leaf blade in Nicotiana sylvestris.
Plant Cell 5,1029
-1038.
McHale, N. A. (1993b). The lam-1 gene controls blade formation through reorientation of division in the L3 cell layer. J. Cell. Biochem. Suppl. 32.
McHale, N. A. and Marcotrigiano, M. (1998). LAM1 is required for dorsoventrality and lateral growth of the leaf blade in Nicotiana. Development 125,4235 -4243.[Abstract]
Meicenheimer, R. D., Muehlbauer, F. J., Hindman, J. L. and Gritton, E. T. (1983). Meristem characteristics of genetically modified pea (Pisum sativun) leaf primordia. Can. J. Bot. 61,3430 -3437.
Nishimura, A., Tamaoki, M., Sakamoto, T. and Matsuoka, M. (2000). Over-expression of tobacco knotted1-type class1 homeobox genes alters various leaf morphology. Plant and Cell Physiology 41,583 -590.
Parnis, A., Cohen, O., Gutfinger, T., Hareven, D., Zamir, D. and Lifschitz, E. (1997). The dominant developmental mutants of tomato, Mouse-ear and Curl, are associated with distinct modes of abnormal transcriptional regulation of a Knotted gene. Plant Cell 9,2143 -2158.[Abstract]
Pien, S., Wyrzykowska, J. and Fleming, A. J. (2001). Novel marker genes for early leaf development indicate spatial regulation of carbohydrate metabolism within the apical meristem. Plant J. 25,663 -674.[CrossRef][Medline]
Postma-Haarsma, A. D., Rueb, S., Scarpella, E., den Besten, W., Hoge, J. H. C. and Meijer, A. H. (2002). Developmental regulation and downstream effects of the knox class homeobox genes Oskn2 and Oskn3 from rice. Plant Mol. Biol. 48,423 -441.[CrossRef][Medline]
Rick, C. M. and Butler, L. (1956). Cytogenetics of tomato. Adv. Genet. 7, 267-382.
Ruiz-Medrano, R., Xoconostle-Cazares, B. and Lucas, W. J. (1999). Phloem long-distance transport of CmNACP mRNA: Implications for supracellular regulation in plants. Development 126,4405 -4419.[Abstract]
Rutishauser, R. (1995). Developmental patterns of leaves in Podostemaceae compared with more typical flowering plants: Saltational evolution and fuzzy morphology. Can J. Bot. 73,1305 -1317.
Sawa, S., Ito, T., Shimura, Y. and Okada, K.
(1999a). Filamentous flower controls the formation and
development of Arabidopsis inflorescences and floral meristems.
Plant Cell 11,69
-86.
Sawa, S., Watanabe, K., Goto, K., Kanaya, E., Hayato Morita, E.
and Okada, K. (1999b). Filamentous flower, a meristem and
organ identity gene of Arabidopsis, encodes a protein with a zinc
finger and HMG-related domains. Genes Dev.
13,1079
-1088.
Schneeberger, R., Tsiantis, M., Freeling, M. and Langdale, J. A. (1998). The rough sheath2 gene negatively regulates homeobox gene expression during maize leaf development. Development 125,2857 -2865.[Abstract]
Siegfried, K. R., Eshed, Y., Baum, S. F., Otsuga, D., Drews, G. N. and Bowman, J. L. (1999). Members of the YABBY gene family specify abaxial cell fate in Arabidopsis. Development 126,4117 -4128.[Abstract]
Sinha, N. and Hake, S. (1994). The Knotted leaf blade is a mosaic of blade, sheath, and auricle identities. Dev. Genet. 15,401 -414.[CrossRef]
Sinha, N., Williams, R. E. and Hake, S. (1993).
Overexpression of the maize homeobox gene, KNOTTED-1, causes a switch
from determinate to indeterminate cell fates. Genes
Dev. 7,787
-795.
Smith, L. G., Jackson, D. and Hake, S. (1995). Expression of knotted1 marks shoot meristem formation during maize embryogenesis. Dev. Genet.s 16,344 -348.[CrossRef]
Snow, M. and Snow, R. (1959). The dorsiventrality of leaf primordium. New Phytol. 58,188 -207.[CrossRef]
Sun, Y., Zhou, Q., Zhang, W., Fu, Y. and Huang, H. (2002). ASYMMETRIC LEAVES1, an Arabidopsis gene that is involved in the control of cell differentiation in leaves. Planta 214,694 -702.[CrossRef][Medline]
Sussex, I. M. (1954). Experiments on the cause of dorsiventrality in leaves. Nature 167,651 -652.
Sussex, I. M. (1955). Morphogenesis in Solanum tuberosum L. Apical structure and developmental pattern of the juvenile shoot. Phytomorphology 5, 253-273.
Talbert, P. B., Adler, H. T., Paris, D. W. and Comai, L. (1995). The REVOLUTA gene is necessary for apical meristem development and for limiting cell divisions in the leaves and stems of Arabidopsis thaliana. Development 121,2723 -2735.[Abstract]
Tanksley, S. D., Young, N. D., Paterson, A. H. and Bonierbale, M. W. (1989). RFLP mapping in plant breeding: New tools for an old science. Biotechnology 7, 257-264.[CrossRef]
Timmermans, M. C. P., Hudson, A., Becraft, P. W. and Nelson,
T. (1999). Rough sheath2: A Myb protein that represses knox
homeobox genes in maize lateral organ primordia.
Science 284,151
-153.
Timmermans, M. C. P., Schultes, N. P., Jankovsky, J. P. and Nelson, T. (1998). Leafbladeless1 is required for dorsoventrality of lateral organs in maize. Development 125,2813 -2823.[Abstract]
Tsiantis, M., Schneeberger, R., Golz, J. F., Freeling, M. and
Langdale, J. A. (1999). The maize rough sheath2 gene and leaf
development programs in monocot and dicot plants.
Science 284,154
-156.
Venglat, S. P., Dumonceaux, T., Rozwadowski, K., Parnell, L.,
Babic, V., Keller, W., Martienssen, R., Selvaraj, G. and Datla, R.
(2002). The homeobox gene brevipedicellus is a key regulator of
inflorescence architecture in Arabidopsis. Proc. Natl. Acad. Sci.
USA 99,4730
-4735.
Villanueva, J. M., Broadhvest, J., Hauser, B. A., Meister, R.
J., Schneitz, K. and Gasser, C. S. (1999). INNER NO OUTER
regulates abaxial-adaxial patterning in Arabidopsis ovules. Genes
Dev. 13,3160
-3169.
Vollbrecht, E., Reiser, L. and Hake, S. (2000). Shoot meristem size is dependent on inbred background and presence of the maize homeobox gene, knotted1. Development 127,3161 -3172.[Abstract]
Waites, R. and Hudson, A. (1995). phantastica: a gene required for dorsoventrality of leaves in Antirrhnum majus. Development 121,2143 -2154.[Abstract]
Waites, R., Selvadurai, H. R. N., Oliver, I. R. and Hudson, A. (1998). The Phantastica gene encodes a MYB transcription factor involved in growth and dorsoventrality of lateral organs in Antirrhinum. Cell 93,779 -789.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
H. Wang, J. Chen, J. Wen, M. Tadege, G. Li, Y. Liu, K. S. Mysore, P. Ratet, and R. Chen Control of Compound Leaf Development by FLORICAULA/LEAFY Ortholog SINGLE LEAFLET1 in Medicago truncatula Plant Physiology, April 1, 2008; 146(4): 1759 - 1772. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Bartley and B. K. Ishida Ethylene-sensitive and insensitive regulation of transcription factor expression during in vitro tomato sepal ripening J. Exp. Bot., June 1, 2007; 58(8): 2043 - 2051. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Paquet, M. Bernadet, H. Morin, J. Traas, M. Dron, and C. Charon Expression patterns of TEL genes in Poaceae suggest a conserved association with cell differentiation J. Exp. Bot., June 1, 2005; 56(416): 1605 - 1614. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Tattersall, L. Turner, M. R. Knox, M. J. Ambrose, T.H. N. Ellis, and J. M.I. Hofer The Mutant crispa Reveals Multiple Roles for PHANTASTICA in Pea Compound Leaf Development PLANT CELL, April 1, 2005; 17(4): 1046 - 1060. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Champagne and N. Sinha Compound leaves: equal to the sum of their parts? Development, September 15, 2004; 131(18): 4401 - 4412. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Juarez, R. W. Twigg, and M. C. P. Timmermans Specification of adaxial cell fate during maize leaf development Development, September 15, 2004; 131(18): 4533 - 4544. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Golz, M. Roccaro, R. Kuzoff, and A. Hudson GRAMINIFOLIA promotes growth and polarity of Antirrhinum leaves Development, August 1, 2004; 131(15): 3661 - 3670. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Eckardt The Role of PHANTASTICA in Leaf Development PLANT CELL, May 1, 2004; 16(5): 1073 - 1075. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||