|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 4, 2003
doi: 10.1242/10.1242/dev.00631

1 Department of Craniofacial Development, GKT Dental Institute, Kings College
London, Floor 28 Guy's Tower, Guy's Hospital, London SE1 9RT, UK
2 Laboratoire de Biologie Moléculaire et Cellulaire, UMR 5665 CNRS/ENS
Lyon, Ecole Normale Supérieure de Lyon, 46 allée d'Italie, 69364
Lyon Cedex 07, France
3 Department of Cell and Molecular Biology, Karolinska Nobel Institutet, SE-171
77 Stockholm, Sweden
Author for correspondence (e-mail:
paul.sharpe{at}kcl.ac.uk)
Accepted 28 May 2003
| SUMMARY |
|---|
|
|
|---|
To define the role of ISL1 in the acquisition of incisor shape, we have analysed regulation of Islet1 expression in mandibular explants. Local application of bone morphogenetic protein 4 (BMP4) in the epithelium of molar territories either by bead implantation or by electroporation stimulated Islet1 expression. Inhibition of BMP signalling with Noggin resulted in a loss of Islet1 expression. Inhibition of Islet1 in distal epithelium resulted in a loss of Bmp4 expression and a corresponding loss of Msx1 expression, indicating that a positive regulatory loop exists between ISL1 and BMP4 in distal epithelium. Ectopic expression of Islet1 in proximal epithelium produces a loss of Barx1 expression in the mesenchyme and resulted in inhibition of molar tooth development. Using epithelial/mesenchymal recombinations we show that at E10.5 Islet1 expression is independent of the underlying mesenchyme whereas at E12.5 when tooth shape specification has passed to the mesenchyme, Islet1 expression requires distal (presumptive incisor) mesenchyme. Islet1 thus plays an important role in regulating distal gene expression during jaw and tooth development.
Key words: Islet1, LIM transcription factors, Incisor, Ameloblast, Tooth
| INTRODUCTION |
|---|
|
|
|---|
LIM homeodomain-containing proteins are considered as major transcriptional
regulators that, in cooperation with other transcription factors, play
critical roles in the control of pattern formation and cell type specification
of various tissues (Dawid et al.,
1995
; Jurata et al.,
1996
; Thaler et al.,
2002
). The disruption of several LIM homeodomain genes has
demonstrated their importance in embryonic development. Deletion of
Lim1 (Lhx1) in mice leads to inhibition of head formation
and lethality around E10 (Shawlot and
Behringer, 1995
), while inactivation of Lim3
(Lhx3) by targeted mutation leads to severe perturbations in
pituitary development (Sheng et al.,
1996
). Mice lacking the Islet1 (Isl1) gene die
at E9.5 (Pfaff et al., 1996
)
indicating the importance of the LIM transcription factors in development.
Islet1 (ISL1) is the earliest marker for motor neuron differentiation
(Karlsson et al., 1990
;
Ericson et al., 1995
;
Yamada et al., 1993
) and
inhibition of Isl1 expression prevents motor neuron and interneuron
specification (Pfaff et al.,
1996
). However, Isl1 expression is not restricted to
developing neuronal structures, and it has been demonstrated that ISL1 also
controls pituitary and pancreas organogenesis
(Ahlgren et al., 1997
;
Sheng et al., 1997
). Two LIM
homeodomain encoding genes, Lhx6 and Lhx7, are found to be
preferentially expressed in the mesenchyme of the first branchial arch
(presumptive dental mesenchyme) prior to initiation of tooth formation
(Grigoriou et al., 1998
),
indicating that members of the LIM family of transcriptional regulators also
control tooth formation and patterning.
In the present study we describe the expression patterns of the Isl1 gene and ISL1 protein in the developing mouse teeth, and we examine its implication in the cascade of molecular events governing odontogenesis. A role for Isl1 in patterning of the dentition is proposed as an activator of BMP4 expression in incisor (distal) areas of the stomatodeal epithelium.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Immunohistochemistry and in situ hybridisation on tissue
sections
Affinity-purified rabbit antibody against the ISL1 protein was a gift from
Dr T. Edlund (Umea University, Sweden). Preparation and characterisation of
this antibody has been described earlier
(Karlsson et al., 1990
).
Immunoperoxidase (ABC kit, Vector Laboratories, Burlingame, CA) staining
was performed as previously described
(Mitsiadis et al., 1992
;
Mitsiadis et al., 1995
).
Positive peroxidase staining produces red/brown colour visible with light
microscopy. Omission of the primary antibody served as a negative control.
For in situ hybridisation, digoxigenin-labelled antisense rat Isl1
riboprobe was used. In situ hybridisation on cryosections was carried out as
earlier described (Wilkinson,
1995
; Mitsiadis et al.,
1995
; Mitsiadis et al.,
1998
).
Mandibular explants
Mouse mandibles were carefully dissected from the rest of the heads of
E9-E11 embryos in Dulbecco's PBS and placed into a solution of Dulbecco's
Modified Eagle Medium containing glutamax (DMEM; Gibco-BRL) containing 20
units/ml penicillin/streptomycin (Gibco-BRL). The first branchial arches were
then placed on top of a 0.1 µm Millipore filter on a stainless steel wire
mesh (0.25 mm diameter wire) (Goodfellows) in an organ culture dish (Marathon)
containing medium consisting of DMEM, 20% foetal calf serum (FCS; Gibco-BRL)
and 20 units/ml penicillin/streptomycin. The mandibles were cultured in a
humidified atmosphere of 5% CO2, 40% O2 at 37°C
(Nuaire incubator) for the appropriate length of time.
After the required period of culture, explants were made to stick to the filters by washing in ice cold methanol (BDH) for 2 minutes and then fixed in 4% PFA in PBS overnight at 4°C. They were then dehydrated through a graded series of ethanol and stored at -20°C until required.
The explants were used for whole-mount immunohistochemistry and whole-mount in situ hybridisation analyses.
Recombinant proteins and treatment of beads
Recombinant BMP4 protein (1.12 mg/ml) was a kind gift from Dr V. Rosen
(Genetics Institute, Cambridge, Massachusetts). The proteins were stored at
-70°C in 0.5 mM arginine-HCl, 10 mM histidine (pH 5.6) until use.
Affi-gel agarose beads (75-150 µm diameter; Biorad) were used as
carriers of BMP4 protein (Mitsiadis et
al., 1995
). Beads were washed once with PBS and pelleted.
Recombinant proteins were diluted into PBS, pH 7.4, to concentrations 50-250
ng/µl/5 µl/50 beads (FGF4 and FGF8, 100-200; Sonic hedgehog (SHH),
50-150; BMP4, 50-250) and incubated for 30 minutes at room temperature. Beads
were washed for 5-15 minutes in culture medium and then transferred with a
mouth-controlled capillary pipette on top of E9-E11 explants. Control beads
were treated identically with 0.1% BSA in PBS.
All bead experiments were accompanied by positive controls to check activity of the proteins used.
Expression constructs
The cytomegalovirus (CMV) promoter construct pIRES2-EGFP (Clontech) was
used. pIRES2-EGFP is a bicistronic expression vector, which has an internal
ribosomal entry site (IRES), a nuclear localisation signal expressed
downstream of the gene of interest and a green fluorescent protein (GFP),
which allows visualisation of the targeting efficiency of the electroporation.
This construct mediates gene expression in all cells that take up the DNA.
Full-length coding fragments for BMP4 and Noggin were cloned into this vector,
recombinant plasmids were purified using a standard plasmid purification kit
(Qiagen) and sequenced. The Islet1 construct used (pND21) was
provided by Tanna Franz (Freiburg) and expression was driven by the EF1-alpha
promoter. This construct was coelectroporated with pIRES2-EGFP.
The expression constructs were used at a concentration of 1 µg/µl in TE (Tris-EDTA) buffer or in PBS for all electroporations. Fast green 1/10,000 (Sigma Chemical Co., St. Louis, MO) was added to the DNA solution for visualisation within the mandible.
Morpholinos
Isl1 antisense morpholino oligonucleotides were obtained from Gene
Tools (USA). The sequence was 5' TTGGTGGATCGCCCATGTCTCCCAT 3',
tagged with 3' fluorescein and used at a concentration of 100 µM. A
control antisense morpholino for the zebrafish Sox9B gene with a sequence of
5' GCAGAGAGAGAGTGTTGAGTGTGT 3' was used.
Electroporation
The gene constructs were introduced to targeted area of the mouse mandible
using fine glass needles prepared from glass capillary tubes (1 mm in
diameter) using a standard micropuller equipped with a heating element.
Needles were filled with DNA solution in 1% carboxy methyl cellulose by
capillary action. Needles were connected to a syringe pump through a fine
silicone tube. Two electrodes (0.1 mm in diameter) (Goodfellows) set on a
micromanipulator were placed parallel on the surface of the mandible, 2-4 mm
apart. The tungsten microelectrode was inserted just beneath the epithelium
and the platinum electrode connected to the anode was placed at the surface of
the epithelium. The DNA solution was applied to the epithelium close to the
electrodes and a few drops of DMEM were added to cover the electrodes. Square
electrical pulses were applied immediately. Square wave current pulses (5-8)
of 30-45 V and 50 msecond duration were applied using a square wave
electroporator (Intracept TSS10, Intracel, UK). Pulses were generated every 1
second so that a pulse of 50 ms seconds was followed by a 950 ms second rest
phase. With this method, the electric pulse results in a brief opening of
plasma membrane channels allowing the entry of small molecules. Using this
particular electrode set-up the electroporated DNA is restricted to the
epithelium. Following electroporation of the GFP reporter constructs, one side
of the mandible was GFP positive, whereas the other side was GFP-negative and
thereby served as an internal control. All explants were cultured for 24 hours
before further processing.
Whole mount immunohistochemistry and in situ hybridisation of
mandibular explants
The explants were treated with 3% H2O2/PBS for 60
minutes before starting whole-mount immunohistochemistry and in situ
hybridisation. Whole-mount immunohistochemistry using antibodies against ISL1
was performed as previously described
(Mitsiadis et al., 1995
). When
the colour reaction was satisfactory, the explants were washed in tap water
and then fixed in 4% PFA. Digoxigenin-labelled antisense rat Isl1,
mouse Bmp4, Barx1 and Msx1 riboprobes were used. Whole-mount
in situ hybridisation was carried out as previously described
(Wilkinson, 1995
;
Mitsiadis et al., 1998
).
Renal transfers
Following electroporation of Isl1 into proximal epithelium and GFP
control plasmid into the same region on the contralateral side of mandible
explants, the explants were cultured for 24 hours and then dissected into two
pieces: a piece that contained the molar region of the Isl1-positive
side and another piece that contained the whole incisor region together with
the molar region of the control side. These pieces were transferred separately
into renal capsules of adult male mice and left to develop for 10-14 days.
Teeth were isolated from the kidneys and counted.
Tissue recombinations
The regions where molar and incisor tooth germs will develop were carefully
dissected in Dulbecco's PBS from the rest of the developing jaw of E10.5-E12.5
mouse embryos and incubated 5 minutes in 2.25% trypsin/0.75% pancreatin on
ice. Epithelial and mesenchymal tissues were separated in Dulbecco's Minimum
Essential Medium (DMEM) supplemented with 15% foetal calf serum (FCS; Gibco).
Isolated mesenchymal tissues were transferred with a mouth-controlled pipette
onto pieces of Nuclepore filters (pore size, 0.1 µm) supported by metal
grids (Trowell-type), while isolated epithelia were placed on top of the
mesenchymal tissues. The recombinants were homochronic but heterotopic
(epithelium of the molar region mesenchyme from the incisor region and vice
versa), and were cultured for 24 hours in DMEM supplemented with 15% FCS in a
humidified atmosphere of 5% C02 in air, at 37°C. After culture,
explants were fixed in 4% PFA overnight at 4°C, washed in PBS and finally
stored in methanol at -20°C until analysis by whole-mount in situ
hybridisation.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
|
|
|
Mesenchymal requirements for Isl1 expression
In order to determine the influence of the underlying mesenchyme on
Isl1 expression, epithelial/mesenchymal recombinations were
performed. Recombination of distal, Isl1-positive epithelium with
proximal mesenchyme at E10.5 maintained Isl1 expression
(Fig. 9A). In the reciprocal
recombination of proximal Isl1-negative epithelium with distal
mesenchyme, no ectopic Isl1 expression was induced.
(Fig. 9B). Similar
recombinations were carried out at E12.5, a time when the spatial information
specifying tooth shape has transferred from the epithelium to the mesenchyme
(Ferguson et al., 2000
). Distal
Isl1-positive epithelium, recombined with proximal (presumptive
molar) mesenchyme resulted in a loss of Isl1 expression
(Fig. 9C). Proximal
Isl1-negative epithelium recombined with distal (presumptive incisor)
mesenchyme stimulated ectopic Isl1 expression in the proximal
epithelium (Fig. 9D). Thus, at
E10.5, Isl1 expression is intrinsic to distal epithelium and is not
influenced by the underlying mesenchyme, whereas by E12.5, distal mesenchyme
can instruct overlying epithelium to express Isl1. Such instructive
signals are not present in proximal mesenchyme.
|
| DISCUSSION |
|---|
|
|
|---|
The present study shows that Isl1 is expressed in distinct areas
of the oral epithelium prior to initiation of tooth formation. During
odontogenesis, Isl1 is expressed in the epithelium of the incisors,
but not of molars. Early embryonic lethality of homozygous mutants prevents
analysis of tooth formation in the absence of Isl1. However, the fact
that Isl1 expression in oral epithelium is missing from molar
territories may suggest that its role is to pattern the mammalian dentition.
ISL1 is specific for the epithelial compartment of the forming incisors
throughout odontogenesis. The induction and maintenance of Isl1
expression in distal (presumptive incisor) epithelium is time dependent and
reflects the changes in proximodistal potential of the cells. Thus at E10.5,
when odontogenic potential and proximodistal specification is present in the
epithelium, Isl1 expression in distal epithelium is intrinsic and not
induced by the underlying mesenchyme. By E12.5, the proximodistal odontogenic
potential originally present in the epithelium has been transferred to the
mesenchyme as a result of induction of FGF and BMP signalling from the
epithelium regulating spatial expression of mesenchymal genes such as Dlx,
Msx and Barx1 (Tucker et
al., 1998a
; Tucker et al.,
1998b
). At E12.5, Isl1 expression in distal epithelium
requires the presence of distal mesenchyme. Moreover, distal mesenchyme is
able to induce ectopic Isl1 expression in proximal epithelium. The
regulation of Isl1 in distal epithelium thus correlates with the
changing potential to specify incisors. The ability of distal mesenchyme to
induce ectopic Isl1 expression suggests the existence of signalling
factors spatially localised in distal mesenchyme, although no obvious
candidate molecules have been identified.
We suggest that Isl1 is involved in signalling between epithelium and mesenchyme that is necessary for normal progression of morphogenesis and cytodifferentiation events in incisors. Incisors of rodents are continuously growing teeth, characterised by distinct zones of cell proliferation, differentiation and maturation along their anterior-posterior axis. Another feature of incisors is that lingual dental epithelial cells do not differentiate into ameloblasts and thus cannot synthesise enamel matrix. Isl1 expression in epithelial cells of all incisor areas (proliferation and differentiation compartments) indicates a potential role of Isl1 in the progression of progenitor cells from the dividing and undifferentiated state to that of postmitotic ameloblasts secreting enamel matrix. The present results suggest that Isl1 expression comprises two phases, which are driven by different mechanisms: a first phase of position-dependent expression in the stomatodeal epithelium is followed by a second phase of expression in incisor epithelium probably maintained/initiated by mesenchyme-derived signals.
During late crown morphogenesis of molars, ameloblasts synthesise and secrete enamel matrix proteins. Functional ameloblasts localised at the `enamel-free' cusp of the first molar express ISL1 protein. The `enamel-free' area is quite different from other cusp regions where normal amelogenesis occurs. Ameloblasts of the `enamel-free' cusp demonstrate a post-secretory appearance and seem to produce an extracellular matrix consisting of `enamel-like' molecules. ISL1 expression in these ameloblasts may suggest that the molecular control involved in the `enamel-free' cusp differs from those of other crown territories in molars.
Odontogenesis involves a series of epithelial-mesenchymal interactions,
where BMP4 constitutes an essential early epithelial signal that has a crucial
role in activating mesenchymally expressed genes (reviewed by
Thesleff and Sharpe, 1997
).
The transient expression of BMP4 in distal epithelium of the facial primordia
has been shown to be required for underlying expression of Msx1 in
ectomesenchyme. Msx1 appears to have an important role in directing
the development of incisor morphogenesis at this stage and forms part of a
number of overlapping domains of expression of homeobox genes that provide the
spatial information of dental patterning
(Sharpe, 1995
). The
transcriptional regulation of Bmp4 expression in distal epithelium
has until now not been explored. We have shown that Isl1 is
co-expressed with Bmp4 in distal epithelium and is thus a candidate
for a transcriptional regulator of Bmp4 expression. Misexpression of
Isl1 in proximal epithelium resulted in ectopic expression of
Bmp4; inhibition of Isl1 in distal epithelium using
morpholino antisense resulted in a loss of Bmp4 expression in the
epithelium and, furthermore, suppressed Msx1 expression in the
underlying mesenchyme. Since BMP4 is known to regulate Msx1
expression (Vainio et al.,
1993
), we assume that loss of Msx1 is a direct result of
loss of epithelial BMP4. Although not proven, it seems logical that BMP4 is a
direct target of ISL1. Another possible candidate for regulating Bmp4
expression is Dlx2, which is co-expressed with Isl1 and
Bmp4 in distal epithelium. Dlx2 does not, however, appear to
be required for Bmp4 expression and may have a role in regulating
other signalling molecules (unpublished data).
The early distal expression of Isl1 and its interactions with
Bmp4 suggest a specific role in incisor development. Ectopic
expression of Isl1 in molar epithelium resulted in the expected loss
of Barx1 expression, but surprisingly, Msx1 was not induced.
BMP4 is thus not sufficient to induce/maintain Msx1 expression in
proximal mesenchyme and either other factors are required or Msx1
expression is actively inhibited. The outcome of loss of Barx1 was
inhibition of molar tooth development. Localised loss of Barx1
expression in maxillary molar mesenchyme in Dlx1/2 mutants also
results in inhibition of molar development
(Thomas et al., 1997
). In both
these cases, loss of Barx1 expression is not accompanied by any gain
of expression of distal genes such as Msx1. Significantly,
redirection of cells from the incisor to molar pathway involves both gain of
Barx1 expression and loss of Msx1 expression.
Since tooth development involves reciprocal signalling interactions between
epithelium and mesenchyme, the possible role of signalling factors in
regulation of Isl1 expression was investigated. FGFs, BMPs and SHH
are all possible candidates, having been identified as regulators of many of
the key early interactions during tooth development. Moreover, Shh has been
shown to participate in the regulation of Isl1 expression in neural
tube development (Ericson et al.,
1995
). Addition of FGF8 and Shh to mandibular primordia failed to
induce Isl1 expression. BMP4 protein supplied on beads or BMP4
expression induced by electroporation of an expression construct produced
clear induction of Isl1 expression. Since Bmp4 and
Isl1 are co-expressed in distal epithelial cells at a time when there
is no Bmp4 expression in the underlying mesenchyme, it seems probable
that the affect of BMP4 on Isl1 expression occurs within the
epithelium, although the possibility that there is an intermediate signal from
BMP4 to Isl1 via the mesenchyme cannot be excluded. Isl1 and
Bmp4 thus appear to have a positive autoregulatory relationship
(Fig. 10). We assume that this
functions to maintain transient, high levels of BMP4 in distal epithelium to
regulate Msx1 expression in the underlying mesenchyme. Such positive
autoregulation is a common feature among the oral epithelial signalling
molecules since we have observed autoregulation of both Shh and
Fgf8 expression (unpublished).
|
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Ahlgren, U., Pfaff, S. L., Jessel, T. M., Edlund, T. and Edlund,
H. (1997). Independent requirement for ISL1 in formation of
pancreatic mesenchyme and islet cells. Nature
385,257
-260.[CrossRef][Medline]
Angeli, I., James, C. T., Morgan, P. J. and Sharpe, P. T.
(2002). Misexpression of genes in mouse tooth germs using in
vitro electroporation. Conn. Tissue Res.
43,180
-185.
Bitgood, M. J. and McMahon, A. P. (1995).
Hedgehog and Bmp genes are coexpressed at many diverse sites of cell-cell
interaction in the mouse embryo. Dev. Biol.
172,126
-138.[CrossRef][Medline]
Chen, Y.-P., Bei, M., Woo, I., Satokata, I. and Maas, R.
(1996). Msx1 controls inductive signaling in mammalian tooth
morphogenesis. Development
122,3035
-3044.[Abstract]
Dawid, I. B., Toyama, R. and Taira, M. (1995).
LIM domain proteins. C.R. Acad Sci. (Ser. III)
318,295
-306.
Echelard, Y., Epstein, D. J., St-Jacques, B., Shen, L., Mohler,
J., McMahon, J. A. and McMahon, A. P. (1993). Sonic Hedgehog,
a member of a family of putative signalling molecules, is implicated in the
regulation of CNS polarity. Cell
75,1417
-1430.[CrossRef][Medline]
Ericson, J., Muhr, J., Placzek, M., Lints, T., Jessell, T. M.
and Edlund, T. (1995). Sonic hedgehog induces the
differentiation of ventral forebrain neurons: a common signal for ventral
patterning within the neural tube. Cell
81,747
-756.[CrossRef][Medline]
Ferguson, C. A., Tucker, A. S., Christensen, L., Lau, A. L.,
Matzuk, M. M. and Sharpe, P. T. (1998). Activin is an
essential early mesenchymal signal in tooth development that is required for
patterning of the murine dentition. Genes Dev.
12,2636
-2649.
Ferguson, C. A., Tucker, A. S. and Sharpe, P. T.
(2000). Temporospatial cell interactions regulating mandibular
and maxillary arch patterning. Development
127,403
-412.[Abstract]
Ferguson, C. A., Tucker, A. S., Heikinheimo, K., Nomura, M., Oh,
P., Li, E. and Sharpe, P. T. (2001). The role of effectors of
the activin signalling pathway, activin receptors IIA and IIB, and Smad2, in
patterning of tooth development. Development
128,4605
-4613.
Grigoriou, M., Tucker, A. S., Sharpe, P. T. and Pachnis, V.
(1998). Expression and regulation of Lhx6 and Lhx7, a novel
subfamily of LIM homeodomain encoding genes, suggests a role in mammalian head
development. Development
125,2063
-2074.[Abstract]
Hardcastle, Z., Mo, R., Hui, C.-c. and Sharpe, P. T.
(1998). The Shh signalling pathway in tooth development: defects
in Gli2 and Gli3 mutants.
Development 125,2803
-2811.[Abstract]
Jurata, L. W., Kenny, D. A. and Gill, G. N.
(1996). Nuclear LIM interactor, a rhombotin and LIM homeodomain
interacting protein, is expressed early in neuronal development.
Proc. Natl. Acad. Sci. USA
93,11693
-11698.
Karlsson, O., Thor, S., Norbert, T., Ohlsson, H. and Edlund,
T. (1990). Insulin gene enhancer binding protein Isl-1 is a
member of a novel class of proteins containing both homeo and Cys-His domain.
Nature 344,879
-882.[CrossRef][Medline]
Lumsden, A. G. S. (1988). Spatial organization
of the epithelium and the role of neural crest cells in the initiation of the
mammalian tooth germ. Development
103,155
-169.
Mitsiadis, T. A., Dicou, E., Joffre, A. and Magloire, H.
(1992). Immunohistochemical localization of nerve growth factor
(NGF) and NGF receptor (NGF-R) in the developing first molar tooth of the rat.
Differentiation 49,47
-61.[CrossRef][Medline]
Mitsiadis, T. A., Muramatsu, T., Muramatsu, H. and Thesleff,
I. (1995). Midkine (MK), a heparin-binding
growth/differentiation factor, is regulated by retinoic acid and
epithelial-mesenchymal interactions in the developing mouse tooth, and affects
cell proliferation and morphogenesis. J. Cell Biol.
129,267
-281.
Mitsiadis, T. A, Hirsinger, E., Lendahl, U. and Goridis, C.
(1998). Delta-notch signaling in odontogenesis: correlation with
cytodifferentiation and evidence for feedback regulation. Dev.
Biol. 204,420
-431.[CrossRef][Medline]
Peters, H., Neubüser, A., Kratochwil, K. and Balling,
R. (1998). Pax9-deficient mice lack pharyngeal pouch
derivatives and teeth and exhibit craniofacial and limb abnormalities.
Genes Dev. 12,2735
-2747.
Pfaff, S. L., Mendelsohn, M., Stewart, C. L., Edlund, T. and
Jessel, T. (1996). Requirement for LIM homeobox gene
Isl1 in motor neuron generation reveals a motor neuron-dependent step
in interneuron differentiation. Cell
84,309
-320.[CrossRef][Medline]
Qiu, M., Bulfone, A., Ghattas, I., Meneses, J. J., Christensen,
L., Sharpe, P. T., Presley, R., Pedersen, R. A. and Rubenstein, J. L.
(1997). Role of the Dlx homeobox genes in proximodistal
patterning of the branchial arches: mutations of Dlx-1, Dlx-2, and Dlx-1 and
-2 alter morphogenesis of proximal skeletal and soft tissue structures derived
from the first and second arches. Dev. Biol.
185,165
-184.[CrossRef][Medline]
Ruch, J.-V. (1987). Determinisms of
odontogenesis. In Cell Biology Reviews (ed. E.
Barbera-Guillem), pp. 1-112. Berlin:
Springer-Verlag.
Sharpe, P. T. (1995). Homeobox genes and
orofacial development. Conn. Tiss. Res.
32, 17-25.
Shawlot, W. and Behringer, R. R. (1995).
Requirement for Lim1 in head-organizer function.
Nature 374,425
-430.[CrossRef][Medline]
Sheng, H. Z., Moriyama, K., Yamashita, T., Li, H., Potter, S.
S., Mahon, K. A. and Westphal, H. (1997). Multistep control
of pituitary organogenesis. Science
278,1809
-1812.
Sheng, H., Zhadanov, B. M., Fujji, T., Bertuzzi, S., Grinberg,
A., Lee, E. J., Huang, S.-P., Mahon, K. A. and Westphal, H.
(1996). The LIM homeobox gene Lhx-3 is essential for the
specification and proliferation of pituitary cell lineages.
Science 272,1004
-1007.[Abstract]
Thaler, J. P., Lee, S. K., Jurata, L. W., Gill, G. N. and Pfaff,
S. L. (2002). LIM factor Lhx3 contributes to the
specification of motor neuron and interneuron identity through
cell-type-specific protein-protein interactions. Cell
110,237
-249.[CrossRef][Medline]
Thesleff, I. and Sharpe, P. T. (1997).
Signalling networks regulating dental development. Mech.
Dev. 67,111
-123.[CrossRef][Medline]
Thomas, B. L., Tucker, A. S., Qui, M., Ferguson, C. A.,
Hardcastle, Z., Rubenstein, J. L. R. and Sharpe, P. T.
(1997). Role of Dlx-1 and Dlx-2 genes in patterning of the murine
dentition. Development
124,4811
-4818.[Abstract]
Thomas, B. L., Liu, J. K., Rubenstein, J. L. R. and Sharpe, P.
T. (2000). Independent regulation of Dlx2 expression in the
epithelium and mesenchyme of the first branchial arch.
Development 127,217
-224.[Abstract]
Tsuchida, T., Ensini, M., Morton, S. B., Baldassare, M., Edlund,
T., Jessell, T. M. and Pfaff, S. L. (1994). Topographic
organization of embryonic motor neurons defined by expression of LIM homeobox
genes. Cell 79,957
-970.[CrossRef][Medline]
Tucker, A. S., Al Khamis, A. and Sharpe, P. T.
(1998a). Interactions between Bmp-4 and Msx-1 act to restrict
gene expression to odontogenic mesenchyme. Dev. Dyn.
212,533
-539.[CrossRef][Medline]
Tucker, A. S., Matthews, K. L. and Sharpe, P. T.
(1998b). Transformation of tooth type induced by inhibition of
BMP signaling. Science
282,1136
-1138.
Tucker, A. S., Yamada, G., Grigoriou, M., Pachnis, V. and
Sharpe, P. T. (1999). Fgf-8 determines rostral-caudal
polarity in the first branchial arch. Development
126, 51-61.[Abstract]
Vainio, S., Karavanova, I., Jowett, A. and Thesleff, I.
(1993). Identification of BMP-4 as a signal mediating secondary
induction between epithelial and mesenchymal tissues during early tooth
development. Cell 75,45
-58.[CrossRef][Medline]
Wilkinson, D. G. (1995). In Situ
Hybridization, A Practical Approach. Oxford, UK: IRL
Press.
Yamada, T., Pfaff, S. L., Edlund, T. and Jessel, T. M.
(1993). Control of cell pattern in the neural tube: motor neuron
induction by diffusible factors from notochord and floor plate.
Cell 73,673
-686.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. Ohazama, C. J. Haycraft, M. Seppala, J. Blackburn, S. Ghafoor, M. Cobourne, D. C. Martinelli, C.-M. Fan, R. Peterkova, H. Lesot, et al. Primary cilia regulate Shh activity in the control of molar tooth number Development, March 15, 2009; 136(6): 897 - 903. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Granger, C. Bleux, M.-L. Kottler, S. J. Rhodes, R. Counis, and J.-N. Laverriere The LIM-Homeodomain Proteins Isl-1 and Lhx3 Act with Steroidogenic Factor 1 to Enhance Gonadotrope-Specific Activity of the Gonadotropin-Releasing Hormone Receptor Gene Promoter Mol. Endocrinol., September 1, 2006; 20(9): 2093 - 2108. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Coudert, L. Pibouin, B. Vi-Fane, B. L. Thomas, M. Macdougall, A. Choudhury, B. Robert, P. T. Sharpe, A. Berdal, and F. Lezot Expression and regulation of the Msx1 natural antisense transcript during development Nucleic Acids Res., September 12, 2005; 33(16): 5208 - 5218. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||