|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 18, 2003
doi: 10.1242/10.1242/dev.00670
q and excitable cells in C. elegans



1 Howard Hughes Medical Institute and Division of Biology, California Institute
of Technology, Pasadena, CA 91125, USA
2 Department of Biology, Texas A&M University, 3258 TAMU, College Station,
TX 77843, USA
3 Laboratory of Molecular Neurobiology, Neuroscience Research Institute AIST,
Tsukuba, 305-8566, Japan
Authors for correspondence (e-mail:
nmoghal{at}caltech.edu
and
rgarcia{at}mail.bio.tamu.edu)
Accepted 12 June 2003
| SUMMARY |
|---|
|
|
|---|
q protein, EGL-30.
EGL-30 acts with muscle-expressed EGL-19 L-type voltage-gated calcium channels
to promote vulva development, and acts downstream or parallel to LET-60 (RAS).
This pathway is not essential for vulval induction on standard Petri plates,
but can be stimulated by expression of activated EGL-30 in neurons, or by an
EGL-30-dependent change in behavior that occurs in a liquid environment. Our
results indicate that excitable cells and animal behavior can provide
modulatory inputs into the effects of growth factor signaling on cell fates,
and suggest that communication between these cell populations is important for
normal development to occur under certain environmental conditions.
Key words: EGF, Muscle, Neurons, Behavior, Vulva, G protein
| Introduction |
|---|
|
|
|---|
Several genes have been identified whose mutation does not affect vulval
induction under standard laboratory growth conditions, but affects vulva
development in sensitized backgrounds. These include ksr-1
(Kornfeld et al., 1995
;
Sundaram and Han, 1995
),
ksr-2 (Ohmachi et al.,
2002
), sur-8
(Sieburth et al., 1998
),
sur-6 (Sieburth et al.,
1999
), ptp-2 (Gutch
et al., 1998
), unc-101
(Lee et al., 1994
),
sli-1 (Jongeward et al.,
1995
; Yoon et al.,
1995
), gap-1 (Hajnal
et al., 1997
), ark-1
(Hopper et al., 2000
),
lip-1 (Berset et al.,
2001
), dpy-22/sop-1
(Moghal and Sternberg, 2003a
),
eor-1 and eor-2 (Howard
and Sundaram, 2002
), and the redundant class A and class B genes
in the synthetic multivulva pathway (e.g.
Ferguson and Horvitz, 1989
).
It is conceivable that the general absence of mutant phenotypes for these
genes reflects roles under natural ecologic conditions that are not
recapitulated in the laboratory. Therefore it is unclear whether vulval
cell-fate specification is modulated by additional pathways in the wild, and
in what context this modulation might occur.
The first report of a large-scale genetic screen to identify mutations
affecting vulva development provided evidence that the environment and an
animal's physiology can modulate the ability of growth factors to induce
vulval fates (Ferguson and Horvitz,
1985
). The severity of the vulvaless phenotypes of certain
let-23, lin-2, lin-7, lin-3, lin-24 and lin-33 alleles is
reduced by starvation and exit from dauer. The dauer is an arrested,
alternative third stage of larval development that occurs under conditions of
high population density and reduced food supply (reviewed by
Riddle and Albert, 1997
). Both
entry and exit from dauer are controlled by chemosensory cues involving
neurons (Bargmann and Horvitz,
1991
; Shakir et al.,
1993
; Tabish et al.,
1995
), suggesting that excitable cells have the capacity to
modulate vulval cell fate. Because the contribution of excitable cell activity
to growth factor-dependent regulation of cell fate has not been studied in
detail, we sought to analyze this in C. elegans.
We find that activation of the heterotrimeric G
q protein EGL-30,
normally associated with regulation of animal behavior, promotes vulval cell
fates. Post-embryonic muscles, and in particular, muscle-expression of the
EGL-19
1 L-type voltage-gated-calcium channel subunit are required,
suggesting that muscle excitation can promote development of vulval tissue.
This pathway is sensitive to functional levels of BAR-1 (ß-catenin), and
can be stimulated by activation of EGL-30 in neurons, or by the
EGL-30-dependent change in behavior that occurs when worms are grown in a
liquid environment. On plates, ablation of the post-embryonic muscles, or
egl-19 and egl-30 loss-of-function mutations, do not affect
vulval induction, suggesting that this pathway might exist to modulate
development in response to certain environmental conditions.
| Materials and methods |
|---|
|
|
|---|
let-23(sa62gf)/+; syIs1/+ worms were obtained by first crossing N2 males into hermaphrodites carrying the X-linked syIs1 transgenic array. F1 males that were hemizygous for the X chromosome were used to transfer syIs1 into homozygous let-23(sa62gf) unc-4(e120) hermaphrodites. Non-Unc F1 hermaphrodite cross progeny were scored for vulval induction during the L4 stage. let-23(sa62gf)/+; let-60(sy95dn)/+; syIs1/+ animals were obtained by crossing syIs1-bearing males into let-23(sa62gf) unc-4(e120); unc-24(e138) let-60(sy95dn)/nT1[let(m435)] hermaphrodites, and picking non-Unc cross progeny. Because the F1 cross progeny consisted of both let-60(sy95dn)/+ and nT1[let(m435)]/+ genotypes, we scored vulval induction in all cross progeny, recovered the individual worms and identified the F1 genotype by examining the F2 generation. The let-60(sy95dn)/+ genotype was assigned to F1s segregating Vul animals and dead larvae in the F2 generation.
Molecular biology
The plasmid pR30, used to overexpress wild-type egl-30, was
constructed as follows. Full-length egl-30 genomic DNA was amplified
by PCR from wild-type worms using the upstream primer
5'-ATGGCCTGCTGTTTATCCGAAGAG-3' and the downstream primer
5'-TTACACCAAGTTGTACTCCTTCAGATTATGCTGTAGAAT-3'. The PCR product was
blunt-end ligated into the BamHI site of the unc-119
promoter plasmid pBY103 (a gift from M. Maduro), making pR30
(unc-119::egl-30). To determine how the egl-30 introns
contributed to the expression pattern of pR30, pR39 was constructed from pR30,
and contained the gfp open reading frame cloned in-frame to
egl-30. The same upstream egl-30 primer was used with the
downstream primer 5'-CACCAAGTTGTACTCCTTCAGATTATGCTGTAGAATTG 3'
that does not contain a stop codon, to amplify full-length egl-30
genomic DNA by PCR. This egl-30 coding fragment was fused in-frame to
gfp by blunt-end ligating the PCR fragment into the BamHI
site of the promoterless GFP plasmid pPD95.75 (a gift of A. Fire), creating
the construct pR36. A 5 kbp XbaI-ApaI fragment from pR36 was
swapped between the NheI-ApaI sites of pR30 to create the
unc-119::egl-30::gfp plasmid pR39. The myo-3::egl-19 and
myo-3::egl-19::gfp constructs were generated by injection of ligation
reactions directly into worms and have been described previously
(Garcia et al., 2001
). The
aex-3::egl-30(tg26gf) plasmid, pTG100.1, which places the
egl-30 cDNA containing the tg26 mutation under the control
of the aex-3 promoter, has been described previously
(Doi and Iwasaki, 2002
). This
egl-30 cDNA contains the last intron of egl-30 to aid with
expression from this vector. To determine how the last intron of
egl-30 affects expression from the aex-3 promoter, pAEXYFP
was constructed. This plasmid contains the yfp coding region and
unc-54 3'UTR inserted downstream of the aex-3 promoter
and upstream of the last 58 bp of exon 7 to the end of exon 8 (including the
last intron) of egl-30. The yfp coding region and
unc-54 3'UTR were amplified by PCR from pSX95.77 (courtesy of
S. Xu) with the primers
5'-GCCGCGGATCCAAATGAGTAAAGGAGAAGAACTTTTCAC-3' and
5'-ACGTGCTGCGACAAACAGTTATGTTTGGTATATTGGGAATG-3'. pSX95.77 contains
the yfp coding region and unc-54 3'UTR from pPD136.64
(a gift of A. Fire) inserted into pBR322. The yfp::unc-54 PCR product
was digested with BamHI and SalI, and ligated into
BamHI/SalI-digested pTG100.1. pLIN31EGL30 was constructed by
amplifying the egl-30(tg26gf) cDNA from pTG100.1 with the primers
5'-ATAAGAATGCGGCCGCAAAAATGGCCTGCTGTTTATCCGAAGAG-3' and
5'-CCTGTAAAGCGGCCGCTTACACCAAGTTGTACTCCTTCAG-3', and cloning the
NotI-digested PCR product into the NotI site of the
lin-31 expression vector, pB255
(Tan et al., 1998
). The
unc-18::egl-30(tg26gf) plasmid, pUNC18tg26, was created as follows.
First, the egl-30 cDNA containing the egl-30(tg26gf)
mutation and the last intron was released from pTG100.1 by digestion with
ApaI and BsrG1. The egl-30 fragment was made blunt,
and subsequently cloned into the SmaI site of pBSKS to generate
pBStg26. The unc-18 promoter (extending from the unc-18
start ATG to the next 5' gene F27D9.8) was amplified by PCR with the
primers UNC18-3 5'-AGCCCAAGCTTTGAAGGACAATGAACTAGAGG GAC-3' and
UNC18-4 5'-AGCCCAAGCTTCCCATTTTTCAAAAATCCTCGTC GATGCACTCAC-3',
digested with HindIII, and cloned into HindIII-digested
pBStg26 to yield pUNC18tg26. The unc-18::yfp::egl-30 reporter
plasmid, pUNC18YFP, was created as follows. First, the yfp::egl-30
intron fusion from pAEXYFP was released by digestion with ApaI and
BamHI, the ends made blunt and the fragment cloned into the
SmaI site of pBSKS to yield pBSYFPEGL30. The PCR-generated
unc-18 promoter fragment was then cloned into the HindIII
site of pBSYFPEGL30 to yield pUNC18YFP. The plasmid pLR1, which was used to
express the egl-30(tg26gf) cDNA from the unc-4 promoter, was
constructed as follows. A 3.0 kbp HindIII-Sma I fragment,
which contains the unc-4 promoter and extends through part of the
second exon (Miller and Niemeyer,
1995
), was cloned between the HindIII and SmaI
sites in pBSKS to make the plasmid pBSUNC4 (courtesy of C. Van Buskirk). The
primers 5' ATGGCCTGCTGTTTATCCGAAGAG 3' and 5'
TCCCCCGGGGGATTTCGAGGTTAGCTTGATGGG 3' were used to PCR amplify the
egl-30(tg26gf) cDNA and its 3' UTR sequences from pTG100.1. The
2.3 kbp PCR fragment was then blunt-end ligated between the NsiI
and SmaI sequences in the unc-4 expression vector. The
cloning fuses the first egl-30(tg26gf) ATG 18 basepairs downstream of
the unc-4 initiation codon.
Microinjections and transgenic experiments
PCR fragments containing native egl-30 upstream sequences and
coding region were too unstable to be maintained in worms when injected into
the gonadal syncytium at concentrations even as low as 5 pg
µl-1. Transgenic worms were extremely hyperactive, slow growing
and had low fertility, making transmittance of the extrachromosomal arrays not
efficient for strain maintenance. To circumvent this problem, we fused the
egl-30 genomic coding region to the unc-119 promoter to make
the pR30 hybrid construct that led to more stable expression of
egl-30. pR39, which has gfp cloned in-frame to
egl-30 in pR30, was used to determine the expression pattern of the
pR30 hybrid construct. Injection of pR39 at a concentration of 50 ng
µl-1 into worms resulted in expression of GFP in the nervous
system, pharyngeal muscles, sex muscles, anal depressor muscles and epidermis
(data not shown). Although the unc-119 promoter drives expression
mainly in neurons, sequences in the egl-30 genomic DNA (specifically
from the first intron) contribute to broad expression of the transgene.
Consistent with this expression pattern, injection of pR30 at 50 pg
µl-1 rescued every behavioral phenotype caused by the
loss-of-function mutation egl-30(ad805) {data not shown, rescuing
array: syEx474 [myo-2:gfp (10 ng µl-1);
unc-119::egl-30 (50 pg µl-1)]}. The extrachromosomal
array that overexpresses wild-type egl-30, syEx532, was obtained by
co-injecting pR30 (750 pg µl-1) and pTG96 (sur-5::gfp)
(Gu et al., 1998
) (10 ng
µl-1) into egl-30(ad805); let-23(sy1) hermaphrodites.
From the GFP-positive transgenic animals, the most hyperactive transmitting
line was kept and scored for vulval development.
Experiments with the egl-30 cDNA driven from the unc-119
promoter indicated that functional rescue of the egl-30(ad805)
phenotypes could be obtained in the F1 generation, but could not be segregated
into the F2 generation without the first intron of egl-30.
Microinjection mixtures containing digested N2 genomic DNA as a source of
carrier DNA were also used in an attempt to create complex arrays; however,
this did not alleviate the generational silencing problem. These data
suggested to us that the first intron of egl-30 prevents generational
silencing of the transgene, and that high levels of EGL-30 activity in certain
cell populations are toxic. Because of this problem, we were not able to
achieve stable expression of the wild-type or tg26
mutation-containing egl-30 cDNA from certain heterologous promoters.
To analyze the consequences of driving egl-30(tg26gf) cDNA expression
in neurons, we coinjected either pTG100.1 [aex-3::egl-30(tg26gf)] (50
ng µl-1), or pUNC18tg26 [unc-18::egl-30(tg26gf)] (50 ng
µl-1), or pLR1 [unc-4::egl-30(tg26gf)] (50 ng
µl-1) with pPD118.33 (myo-2::gfp) (10 ng
µl-1) and pBSSK (120 ng µl-1) into
lin-3(n378) animals. Transgenic F1s were identified by expression of
myo-2::gfp in the pharynx. The extrachromosomal arrays containing
lin-31::egl-30(tg26gf) were generated by injecting pLIN31EGL30
[lin-31::egl-30(tg26gf)] (50 ng µl-1) with pBSSK (140
ng µl-1) and pPD118.33 (myo-2::gfp) (10 ng
µl-1) into lin-3(n378) animals. The extrachromosomal
arrays syEx570 and syEx594 were generated by injecting
pAEXYFP (aex-3::yfp::egl-30) (200 ng µl-1) with pBX-1
(pha-1) (Granato et al.,
1994
) (100 ng µl-1) or pUNC18YFP
(unc-18::yfp::egl-30) (50 ng µl-1) with pBX-1
(pha-1) (100 ng µl-1) and pBSSK (30 ng
µl-1) into pha-1(e2123ts) animals, respectively.
Vulval induction assay and M cell ablations
Vulval induction was scored during the L4 stage under Nomarski optics
(Sternberg and Horvitz, 1986
).
The number of vulval nuclei is used to extrapolate how many of the Pn.p cells
were induced to adopt vulval fates. A VPC that gives rise to seven or eight
great granddaughters and no hyp7 tissue is scored as 1.0 cell induction. A VPC
in which one daughter fuses with hyp7, and the other daughter divides to
generate three or four great granddaughter cells is scored as 0.5 cell
induction. In wild-type animals, P5.p, P6.p and P7.p each undergo 1.0 cell
induction, whereas the other Pn.p cells do not adopt vulval fates, resulting
in a total of 3.0 cell induction. Animals displaying more than 3.0 cell
induction are multivulva and animals with less than 3.0 cell induction are
vulvaless. Laser ablations were conducted using a standard protocol
(Bargmann and Avery, 1995
). M
cell ablations were done at the L1 stage and were confirmed by the loss of
M-derived coelomocytes (Sulston and
Horvitz, 1977
).
Liquid growth assays
A solution of commercial bleach and 4N NaOH (1:1 v/v) was applied to gravid
worms on NG plates without bacteria. The next day, starved, synchronized L1
worms were transferred to liquid M9 buffer
(Brenner, 1974
) in 1.5 ml
Eppendorf tubes. On average, tubes contained 30-40 worms in a final volume of
25 µl and E. coli OP50 at a concentration of A600 nm=1.0. Worms
were grown in a 20°C incubator without shaking until they reached mid-L4,
at which time, vulval induction was scored.
| Results |
|---|
|
|
|---|
q) promotes vulval cell fates
q/G
11, and is
the only C. elegans member of the G
q class of heterotrimeric
G
proteins (Brundage et al.,
1996
3
helix region of G
q, a region implicated in GTP hydrolysis and effector
binding (Itoh and Gilman,
1991
|
|
o).
Although both alleles cause muscle hyperactivity and feeding defects
(Avery, 1993We next tested whether the effects on vulval cell fate caused by the R243Q change encoded by egl-30(tg26gf) reflected elevated EGL-30 activity or a new property of EGL-30. We injected the wild-type egl-30 genomic coding region into an egl-30 loss-of-function; let-23 loss-of-function double mutant. We were able to recover one transgenic line, egl-30(ad805); let-23(sy1); syEx532 [egl-30 XS], that displayed hyperactive behaviors similar to those observed in egl-30(tg26gf) animals (data not shown). In addition to conferring behavioral similarities with egl-30(tg26gf) animals, overexpression of wild-type EGL-30 also suppresses the vulvaless phenotype let-23(sy1) (Table 1). Thus, elevated EGL-30 activity promotes vulval induction.
Activation of EGL-30 (G
q) in neurons promotes vulval
induction
Anti-EGL-30 antibody staining indicates that EGL-30 is most strongly
expressed in neurons (C.B., M.S. and P.W.S., unpublished), and
egl-30::gfp translational fusions also reveal strong expression in
neurons, as well as muscle, and the differentiated secondary cells of the
mature vulva (Lackner et al.,
1999
) (C.B., M.S. and P.W.S., unpublished). In view of its
expression in excitable cells, and the defective locomotion and egg-laying
behaviors associated with loss-of-function mutations in egl-30
(Brundage et al., 1996
), we
asked whether neuronal signaling is required for activated EGL-30 to promote
vulval induction. We tested whether mutations in either unc-13, which
encodes a diacyglycerol-binding protein involved in EGL-30-mediated synaptic
transmission (Lackner et al.,
1999
; Maruyama and Brenner,
1991
; Richmond et al.,
1999
), or unc-64, which encodes syntaxin 1a
(Ogawa et al., 1998
;
Saifee et al., 1998
), disrupt
the ability of egl-30(tg26gf) to suppress the let-23(sy1)
vulvaless phenotype. The non-null unc-64(e246) and
unc-13(e51) alleles partially reduced the effect of activated EGL-30
on vulval induction, possibly indicating some involvement of neurons in this
pathway (Table 2).
|
To drive activated EGL-30 expression in neurons, we first used the
aex-3 (Iwasaki et al.,
1997
) and unc-18
(Gengyo-Ando et al., 1993
)
promoters, which drive expression in multiple neurons, including head, tail
and ventral cord motor neurons. Because the egl-30 cDNA we used
contained the last intron of egl-30 to promote splicing, we verified
that this intron did not cause ectopic expression in muscle, the Pn.p cells or
the anchor cell. When placed downstream of the yfp coding region, the
last intron of egl-30 did not alter the activity of the
aex-3 or unc-18 promoters. In both cases, YFP accumulated in
the ventral cord and head and tail neurons, but not in muscle, the anchor cell
or the Pn.p cells (Fig. 1A-F
and Fig. 2). We co-injected the
aex-3::egl-30(tg26gf) or unc-18::egl-30(tg26gf) plasmids
with pPD118.25, which drives GFP expression in the pharynx, into
lin-3(n378) vulvaless animals. We observed two types of GFP-positive
transgenic F1 animals: those that displayed a hyperactive phenotype similar to
that of egl-30(tg26gf) mutants, and those that looked behaviorally
wild-type. None of the F1s displaying a strong behavioral phenotype
transmitted this phenotype to subsequent generations, suggesting that
transgenic expression of egl-30 was being lost, and that high levels
of EGL-30 activity can be toxic (see Materials and Methods). Therefore, we
only examined F1 animals for rescue of vulval induction defects. We found that
aex-3 or unc-18-driven EGL-30 (R243Q) could only rescue the
vulvaless phenotype of lin-3(n378) when expressed in cells at levels
sufficient to confer a hyperactive phenotype
(Table 2). Animals that were
GFP-positive, but did not show a behavioral phenotype, did not have more
vulval induction than uninjected worms
(Table 2). This tight
correlation between the effects of the aex-3::egl-
30(tg26gf) and unc-18::egl-30(tg26gf) transgenes on behavior
and rescue of the lin-3(n378) vulvaless defect, suggests that
activation of EGL-30 in motor neurons promotes vulval induction. To examine
this possibility in more detail, we used the unc-4 promoter
(Miller and Niemeyer, 1995
) to
drive expression of activated EGL-30 in the A-type motor neurons, which
include the VAs and DAs in ventral cord, and the SABs in the retrovesicular
ganglion. We obtained three stable transgenic lines, with one line
demonstrating clear functional rescue of the lin-3(n378) vulvaless
phenotype (Table 2). Together,
these results suggest that activation of EGL-30 in ventral cord motor neurons
promotes vulval induction.
|
|
EGL-30 (G
q) modulation of vulval induction requires
muscle-expressed EGL-19 L-type voltage-gated calcium channels
Because of the hyperactive movement phenotype displayed by
egl-30(tg26gf) mutants, the correlation between hyperactive behavior
and enhancement of vulval induction in the aex-3::egl-30(tg26gf) and
unc-18::egl-30(tg26gf) transgenic animals, and the ability of
activated EGL-30 to promote vulval development from the A-type motor neurons,
we considered the possibility that muscle excitation might be necessary for
EGL-30 to promote vulval cell fates. We therefore used an egl-19
loss-of-function mutation to compromise muscle excitation
(Jospin et al., 2002
;
Lee et al., 1997
).
egl-19 encodes the worm homolog of the L-type voltage-gated calcium
channel
1 subunit, and although it is expressed in both neurons and
muscles, site of action experiments have thus far only demonstrated function
in muscles (Garcia et al.,
2001
; Jospin et al.,
2002
; Lee et al.,
1997
). Reducing EGL-19 activity with the egl-19(n582)
allele did not affect vulval induction by itself, but it strongly reduced the
ability of egl-30(tg26gf) to suppress the let-23(sy1)
vulvaless phenotype (Table 3).
However, hyperactivation of EGL-19 by the gain-of-function
egl-19(n2368gf) allele, which induces hypercontraction of muscles
(Lee et al., 1997
), did not
rescue the vulvaless phenotype of let-23(sy1), suggesting that EGL-30
has additional targets besides EGL-19
(Table 3).
|
To identify muscles involved in the EGL-30-stimulated pathway, we ablated
the M mesoblast in egl-30(tg26gf); let-23(sy1) L1 larvae. The M
mesoblast gives rise to 14 post-embryonic body-wall muscles prior to the onset
of vulval induction, and 16 sex muscles after vulval induction has occurred
(Sulston and Horvitz, 1977
).
Removal of the M mesoblast does not enhance the vulvaless phenotype of animals
containing the weak ku1 mutation in the worm MAP kinase gene
mpk-1 (Wu and Han,
1994
), demonstrating that ablation of the M lineage does not
generally exacerbate mutation-induced defects in vulval induction
(Table 3). However, ablation of
the M cell reduces egl-30(tg26gf)-mediated suppression of the
let-23(sy1) vulvaless phenotype
(Table 3). Because the
sex-muscles are not formed until after the period of vulval induction, and the
myo-3 promoter is not expressed in undifferentiated sex myoblasts
(data not shown), the post-embryonic body-wall muscles are the muscles that
probably transduce some of the EGL-30-modulating activity to the VPCs.
Furthermore, these muscles only contribute to vulval induction under certain
conditions, such as in the presence of activated EGL-30, which causes muscle
hyperactivity.
EGL-30 (G
q) acts downstream or parallel to LET-60 (RAS) and is
sensitive to functional levels of BAR-1 (ß-catenin)
Experiments in cultured mammalian cells have demonstrated that
heterotrimeric G-protein signaling can promote EGFR and MAP kinase activation
(reviewed by Gschwind et al.,
2001
; Lowes et al.,
2002
). In some instances, G-proteins promote
metalloprotease-dependent shedding of the EGFR ligand, HBEGF, whereas in other
cases G-proteins promote MAP kinase activation through stimulation of
signaling molecules such as protein kinase C, c-SRC and PYK2. We therefore
tested whether activated EGL-30 acts by promoting LET-23 (EGFR) activation. We
constructed double mutants with dominant-negative let-60(sy95dn) and
either the gain-of-function let-23(sa62gf) allele or
egl-30(tg26gf). let-23(sa62gf) encodes a constitutively active
receptor that induces ectopic vulval fates in more than 90% of animals
(Katz et al., 1996
)
(Table 4). Despite the ability
of constitutively active LET-23 to cause a much stronger multivulva phenotype
than egl-30(tg26gf), the let-23(sa62gf) allele did not
suppress the let-60(sy95dn) mutation as well as
egl-30(tg26gf) (Table
4). We also examined whether overexpression of LIN-3 can suppress
the vulvaless phenotype conferred by dominant-negative LET-60 (RAS). In this
experiment, we also included one copy of let-23(sa62gf) to further
enhance the amount of pathway activation upstream of RAS. Despite the fact
that multiple copies of the lin-3 gene in the form of the integrated
transgenic array syIs1 (Katz et
al., 1995
) also confer a much stronger multivulva phenotype than
egl-30(tg26gf) (Table
4), egl-30(tg26gf) is still a much better suppressor of
the dominant-negative let-60(sy95dn) mutation. These data indicate
that EGL-30 pathway activity is not correlated with functional levels of LIN-3
or LET-23 activation, and that EGL-30 acts either downstream or parallel to
LET-60 (RAS).
To determine whether EGL-30 acts directly on some component downstream of LET-23 signaling, we made use of the observation that egl-30(tg26gf) suppresses the vulvaless phenotypes of lin-3(n378) and let-23(sy1) single mutations (Table 1). If EGL-30 acts downstream of receptor activation, then activation of EGL-30 might be expected to suppress a let- 23(sy1); lin-3(n378) double mutant (Table 4). We find that egl-30(tg26gf) cannot suppress the vulvaless phenotype of let-23(sy1); lin-3(n378) double mutants (Table 4). Taken together, our data suggest that EGL-30 might act parallel to the LET-23 pathway.
WNT signaling is the only other pathway known to act parallel to the RAS
pathway during vulval induction. A null mutation in the ß-catenin
bar-1 results in a partially penetrant vulvaless phenotype, partly
because of a reduction in lin-39 hox gene expression
(Eisenmann et al., 1998
), also
a target of the RAS pathway (Maloof and
Kenyon, 1998
). Moreover, hyperactivation of WNT signaling through
a mutation in pry-1, an axin-like inhibitor of the WNT pathway, can
suppress let-23 pathway vulvaless mutations
(Gleason et al., 2002
). Based
on these observations, we explored the possibility that activated EGL-30 might
promote vulval induction by elevating WNT pathway activity. We found that
unlike the effects on the RAS pathway mutations, egl-30(tg26gf) did
not suppress the vulvaless phenotype of the bar-1(ga80) allele
(Table 4). In addition, we
examined the sensitivity of the EGL-30 pathway to bar-1
(ß-catenin) levels. Although the weak loss-of-function
bar-1(mu63) allele is phenotypically wild-type by itself
(Maloof et al., 1999
), it
reduces the output of elevated WNT signaling. In particular,
bar-1(mu63) suppresses the ectopic mab-5 expression, and
polyray and vulval phenotypes conferred by pry-1(mu38)
(Maloof et al., 1999
;
Moghal and Sternberg, 2003a
).
bar-1(mu63) also reduces the ability of egl-30(tg26gf) to
suppress the vulvaless phenotype of let-23(sy1)
(Table 4). The
bar-1(mu63) mutation does not, however, affect the ability of a
mutation in the RAS pathway component dpy-22 to comparably suppress
let-23(sy1) (Moghal and
Sternberg, 2003a
). Thus, bar-1(mu63) reduces WNT and
EGL-30 pathway activity, but not RAS pathway activity. These data are
consistent with a model in which EGL-30 acts through BAR-1, rather than on RAS
signaling, or a novel third pathway, to promote vulval induction.
EGL-30 (G
q) is required for liquid growth-mediated stimulation
of vulval induction
Because excitable cell populations can respond to changing environmental
conditions, we thought the EGL-30 pathway might modulate vulval induction in
response to certain environmental conditions. We therefore searched for an
environmental condition that might promote vulval induction in an
EGL-30-dependent manner. Previous work has shown that the vulvaless phenotypes
of lin-3(n378) and let-23(n1045) can be partially suppressed
by exit from dauer and starvation, respectively
(Ferguson and Horvitz, 1985
).
We found that these conditions only weakly suppressed let-23(sy1),
and did not suppress the dominant-negative let-60(sy95dn) mutation
(data not shown). Besides being grown on standard NG Petri plates, C.
elegans can be grown in liquid media. When we grew lin-3(n378),
let-23(sy1) and let-60(sy95dn) single mutants in liquid M9
buffer, instead of on Petri plates, we found that in all cases, animals
consistently had a higher number of VPCs adopting vulval cell fates compared
with animals grown on standard NG plates
(Fig. 3,
Table 5). Thus, growth of worms
in a liquid environment promotes vulval induction.
|
|
Because the pathway stimulated by activated EGL-30 on NG plates is sensitive to functional levels of BAR-1 (Table 4), we tested whether the liquid growth-stimulated pathway displayed the same sensitivity to WNT pathway mutations. Similar to the results with egl-30(tg26gf) animals growing on NG plates, liquid growth was not able to suppress the vulvaless phenotype of bar-1(ga80) (Table 5). Furthermore, as with egl-30(ad805), the weak loss-of-function bar-1(mu63) mutation blocked the ability of liquid growth to suppress the let-23(sy1) vulvaless phenotype (Table 5). This result is also similar to the sensitivity of egl-30(tg26gf) to bar-1(mu63) on NG plates (Table 4). Thus, liquid growth-mediated effects on vulval induction are strongly dependent on EGL-30 and BAR-1 (ß-catenin) signaling.
| Discussion |
|---|
|
|
|---|
q
gene egl-30, we have identified a connection between the activity of
excitable cells and the responsiveness of epithelial precursor cells to EGF in
C. elegans. Activation of EGL-30 by either a point mutation or
overexpression causes hyperactive forward and backward locomotion and
suppresses the vulvaless phenotype of loss-of-function mutations in the
let-23 pathway (Table
1). egl-30 is strongly expressed in neurons
(Lackner et al., 1999
|
q (Boyer et al.,
1994
The M cell lineage is required for the EGL-30 pathway, and
myo-3-driven egl-19, which is only expressed in
differentiated muscle, can promote pathway activity
(Table 3). Because the
M-derived body-wall muscles are formed during L2, prior to vulval induction,
whereas the M-derived sex muscles are not formed until the L4 stage, after
vulval induction is completed (Sulston and
Horvitz, 1977
), it is probable that post-embryonic body-wall
muscles promote vulva development. These muscles occupy positions posterior to
the gonadal primordium, both dorsally and ventrally, and are used for
locomotion, similar to their embryonically derived counterparts
(Garcia et al., 2001
;
Sulston and Horvitz, 1977
).
The most anterior of the muscles is close to P7.p., which might be close
enough to affect vulval induction directly
(Fig. 4). However, because the
unc-4-expressing VA and DA motor neurons innervate both ventral and
dorsal body-wall muscles, respectively
(White et al., 1986
), it is
also possible that the post-embryonic muscles can affect vulva development
from a distance. At present, there is no reason to think that the
post-embryonic body-wall muscles are functionally distinct from the other
body-wall muscles. Therefore, we favor a model in which ablation of the M cell
simply reduces the number of muscles below a critical threshold, so that the
EGL-30 pathway can no longer fully promote vulva development.
Several models could explain the form of communication between the neurons,
muscles and vulval precursor cells that promotes vulval induction. In all
cases, excitation of body-wall muscles is crucial. In a simple model
(Fig. 4), EGL-30-driven
activation of motor neurons stimulates body-wall muscle, which in turn,
signals to the VPCs. In contrast, in C. elegans, body-wall muscles
have been shown to modulate neuronal synaptic development via the C2 domain
protein AEX-1 and the AEX-5 prohormone convertase
(Doi and Iwasaki, 2002
).
Therefore, it is also possible that neurons may directly modulate vulval
induction in a manner that is not strongly dependent on synaptic transmission,
but requires retrograde signaling from the muscle to the neurons. Finally,
it's possible that two parallel signals are sent by the neurons and body-wall
muscle to the vulval precursor cells.
Experiments with cultured mammalian cells have demonstrated that
G-protein-coupled receptor activation can lead to metalloprotease-stimulated
shedding of HB-EGF, an EGFR ligand (Daub
et al., 1996
; Prenzel et al.,
1999
), which can then act in an autocrine and paracrine manner.
However, we find that expression of activated EGL-30 in the vulval precursor
cells does not promote vulval induction
(Table 2), nor is the activity
of EGL-30 correlated with functional levels of LIN-3 or LET-23 activation
(Table 4). Instead, we find
that activated EGL-30 acts downstream or parallel to the LET-60 (RAS)
(Table 4). WNT signaling is the
only other pathway known to act parallel to RAS signaling during vulval
induction, with one convergence point being the lin-39 hox gene
(Eisenmann et al., 1998
). We
find that although activation of EGL-30 can suppress RAS pathway mutations, it
cannot suppress the partially penetrant vulvaless phenotype of the
bar-1(ga80) null allele (Table
4). Moreover, although the bar-1(mu63) loss-of-function
allele does not affect vulval induction on its own, it reduces the ability of
egl-30(tg26gf) to suppress the vulvaless phenotype of
let-23(sy1) (Table 4).
This sensitivity of egl-30(tg26gf) to bar-1(mu63) is
specific because suppression of let-23(sy1) by the RAS pathway
mediator component dpy-22 is not affected by bar-1(mu63)
(Moghal and Sternberg, 2003a
).
These data suggest that one possible model in which EGL-30 promotes vulval
induction is by upregulating bar-1 (ß-catenin) signaling
(Fig. 4). In support of this
model, elevated bar-1 (ß-catenin) signaling resulting from a
loss-of-function mutation in the axin-like gene, pry-1, or from
overexpression of a non-degradable form of BAR-1 suppresses the vulvaless
phenotype of let-23(sy1) (Gleason
et al., 2002
). Mammalian cell culture experiments have suggested
that G
q may be a downstream component of WNT receptors
(Liu et al., 2001
;
Liu et al., 1999
). However,
because transgenic expression of activated EGL-30 in neurons, but not in the
vulval precursor cells, promotes vulval induction
(Table 2), this model is
unlikely to explain our results. Furthermore, BAR-1 is expressed in the vulval
precursor cells, but not in muscles and neurons
(Eisenmann et al., 1998
), and
we have shown that the latter cells mediate the effects of EGL-30.
Excitable cells can act as sensors for an animal's environment. Thus, the existence of pathways by which excitable cells can contribute to the developmental fates of cells may be generally important in ensuring that correct developmental decisions are made under a wide range of conditions. Accordingly, we find that when animals are removed from NG plates, and are placed in a liquid environment, an EGL-30-dependent pathway is activated which promotes vulval induction (Table 5). Because the egl-30(ad805) mutation does not affect vulval induction under conditions in which the RAS and WNT pathways are hyperactivated or compromised by genetic mutation (Table 5), EGL-30-mediated regulation of vulval induction is specific to conditions affecting animal behavior. Similar to our studies with activated EGL-30 on NG plates, we find that growth in liquid media suppresses vulvaless mutations in the RAS pathway, but not the bar-1(ga80) null mutation, and that the bar-1(mu63) loss-of-function mutation blocks the liquid-stimulated pathway (Table 5). Thus, one model for the liquid growth enhancement of vulval induction could also involve the indirect stimulation of BAR-1 (ß-catenin) in the vulval precursor cells by EGL-30 (Fig. 4).
The link between the environment and the EGL-30 modulatory pathway suggests
that some of the other positive and negative regulators of vulval induction,
which have no phenotypes under standard growth conditions on NG plates, might
also play important roles under different environmental conditions. It has
recently been reported that the G-protein-coupled receptor, SRA-13, and the
heterotrimeric G
protein, GPA-5, are inhibitors of vulva development
(Battu et al., 2003
). Although
mutations in these genes can affect vulva development on standard NG plates,
SRA-13 is also necessary for starvation-mediated inhibition of vulva
development. sra-13 and gpa-5 are both expressed in
chemosensory neurons, and sra-13 is additionally expressed in
body-wall muscle (Battu et al.,
2003
; Jansen et al.,
1999
). Thus, in conjunction with our results, it appears that
C. elegans can use its neuromuscular system to both promote and
inhibit vulva development, depending on the environmental context.
Although RAS and WNT signaling are both important for inducing vulval cell
fates, hypomorphic mutations in the let-23 pathway cause more severe
vulvaless phenotypes than a bar-1 null mutation. This difference
raises questions as to why two different signaling pathways are used to
specify vulval cell fates, and why they are used disproportionately. If a cell
fate must be induced at a particular time in development, it might be best
accomplished by robust activation of a pathway that is largely insensitive to
environmental changes. However, should conditions arise that are deleterious
to that pathway, the existence of a second pathway that is modulated by the
environment would ensure that development remains invariant. Under stressful
conditions, the hermaphrodite may use a behavioral response elicited by
excitable cells and G
q signaling to promote the activity of the WNT
pathway, and ultimately enhance RAS-dependent vulval cell differentiation. The
interplay between the environment, neurons, muscles and these signaling
pathways adds a new dimension to the existing paradigms by which growth
factors trigger cell fate changes during animal development.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Molecular Neuropathology Group, RIKEN Brain Science
Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan ![]()
| REFERENCES |
|---|
|
|
|---|
Aroian, R. and Sternberg, P. (1991). Multiple
functions of let-23, a Caenorhabditis elegans receptor
tyrosine kinase gene required for vulval induction.
Genetics 128,251
-267.[Abstract]
Aroian, R. V., Koga, M., Mendel, J. E., Ohshima, Y. and
Sternberg, P. W. (1990). The let-23 gene necessary
for Caenorhabditis elegans vulval induction encodes a tyrosine kinase
of the EGF receptor subfamily. Nature
348,693
-699.[CrossRef][Medline]
Avery, L. (1993). The genetics of feeding in
Caenorhabditis elegans. Genetics
133,897
-917.[Abstract]
Bargmann, C. and Avery, L. (1995). Laser
killing of cells in Caenorhabditis elegans. In Methods in
Cell Biology. Caenorhabditis elegans: Modern Biological Analysis of an
Organism, Vol. 48 (ed. H. F. Epstein and
D. C. Shakes), pp. 225-250. San Diego, CA: Academic
Press.
Bargmann, C. and Horvitz, H. (1991). Control of
larval development by chemosensory neurons in Caenorhabditis elegans.
Science 251,1243
-1246.
Battu, G., Hoier, E. F. and Hajnal, A. (2003).
The C. elegans G-protein-coupled receptor SRA-13 inhibits RAS/MAPK
signalling during olfaction and vulval development.
Development 130,2567
-2577.
Beitel, G., Clark, S. and Horvitz, H. (1990).
Caenorhabditis elegans ras gene let-60 acts as a switch in
the pathway of vulval induction. Nature
348,503
-509.[CrossRef][Medline]
Berset, T., Hoier, E. F., Battu, G., Canevascini, S. and Hajnal,
A. (2001). Notch inhibition of RAS signaling through MAP
kinase phosphatase LIP-1 during C. elegans vulval development.
Science 291,1055
-1058.
Bessou, C., Giugia, J., Franks, C., Holden-Dye, L. and Segalat,
L. (1998). Mutations in the Caenorhabditis elegans
dystrophin-like gene dys-1 lead to hyperactivity and suggest a link
with cholinergic transmission. Neurogenetics
2, 61-72.[CrossRef][Medline]
Boyer, J. L., Graber, S. G., Waldo, G. L., Harden, T. K. and
Garrison, J. C. (1994). Selective activation of phospholipase
C by recombinant G-protein alpha- and beta gamma-subunits. J. Biol.
Chem. 269,2814
-2819.
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Brundage, L., Avery, L., Katz, A., Kim, U.-J., Mendel, J.,
Sternberg, P. and Simon, M. (1996). Mutations in a C.
elegans G(q)alpha gene disrupt movement, egg laying, and viability.
Neuron 16,999
-1009.[CrossRef][Medline]
Daub, H., Weiss, F. U., Wallasch, C. and Ullrich, A.
(1996). Role of transactivation of the EGF receptor in signalling
by G-protein-coupled receptors. Nature
379,557
-560.[CrossRef][Medline]
Doi, M. and Iwasaki, K. (2002). Regulation of
retrograde signaling at neuromuscular junctions by the novel C2 domain protein
AEX-1. Neuron 33,249
-259.[CrossRef][Medline]
Eisenmann, D., Maloof, J., Simske, J., Kenyon, C. and Kim,
S. (1998). The B-catenin homolog BAR-1 and LET-60 Ras
coordinately regulate the Hox gene lin-39 during Caenorhabditis
elegans vulval development. Development
125,3667
-3680.[Abstract]
Epstein, H., Waterston, R. and Brenner, S.
(1974). A mutant affecting the heavy chain of myosin in C.
elegans. J. Mol. Biol.
90,291
-300.[CrossRef][Medline]
Ferguson, E. and Horvitz, H. (1985).
Identification and characterization of 22 genes that affect the vulval cell
lineages of the nematode C. elegans. Genetics
110, 17-72.
Ferguson, E. and Horvitz, H. (1989). The
multivulva phenotype of certain Caenorhabditis elegans mutants
results from defects in two functionally redundant pathways.
Genetics 123,109
-121.
Garcia, L. R., Mehta, P. and Sternberg, P. W.
(2001). Regulation of distinct muscle behaviors controls the
C. elegans Male's copulatory spicules during mating.
Cell 107,777
-788.[CrossRef][Medline]
Gengyo-Ando, K., Kamiya, Y., Yamakawa, A., Kodaira, K.,
Nishiwaki, K., Miwa, J., Hori, I. and Hosono, R. (1993). The
C. elegans unc-18 gene encodes a protein expressed in motor neurons.
Neuron 11,703
-711.[CrossRef][Medline]
Gleason, J. E., Korswagen, H. C. and Eisenmann, D. M.
(2002). Activation of Wnt signaling bypasses the requirement for
RTK/Ras signaling during C. elegans vulval induction.
Genes Dev. 16,1281
-1290.
Granato, M., Schnabel, H. and Schnabel, R.
(1994). pha-1, a selectable marker for gene-transfer in
C. elegans. Nucleic Acids Res.
22,1762
-1763.
Greenwald, I. (1997). Development of the vulva.
In C. Elegans II (ed. D. L. Riddle, T. Blumenthal, B.
J. Meyer and J. R. Priess), pp. 519-541. Cold Spring
Harbor, NY, USA: Cold Spring Harbor Laboratory Press.
Gschwind, A., Zwick, E., Prenzel, N., Leserer, M. and Ullrich,
A. (2001). Cell communication networks: epidermal growth
factor receptor transactivation as the paradigm for interreceptor signal
transmission. Oncogene
20,1594
-1600.[CrossRef][Medline]
Gu, T., Orita, S. and Han, M. (1998).
Caenorhabditis elegans SUR-5, a novel but conserved protein,
negatively regulates LET-60 ras activity during vulval induction.
Mol. Cell. Biol. 18,4556
-4564.
Gutch, M., Flint, A., Keller, J., Tonks, N. and Hengartner,
M. (1998). The Caenorhabditis elegans SH2
domain-containing protein tyrosine phosphatase PTP-2 participates in signal
transduction during oogenesis and vulval development. Genes
Dev. 12,571
-585.
Hajnal, A., Whitfield, C. and Kim, S. (1997).
Inhibition of Caenorhabditis elegans vulval induction by
gap-1 and by let-23 receptor tyrosine kinase.
Genes Dev. 11,2715
-2728.
Han, M., Aroian, R. and Sternberg, P. (1990).
The let-60 locus controls the switch between vulval and nonvulval
cell fates in Caenorhabditis elegans.
Genetics 126,899
-913.[Abstract]
Han, M. and Sternberg, P. (1990).
let-60, a gene that specifies cell fates during C. elegans
vulval induction, encodes a ras protein. Cell
63,921
-931.[CrossRef][Medline]
Han, M. and Sternberg, P. (1991). Analysis of
dominant negative mutations of the Caenorhabditis elegans let-60 ras
gene. Genes Dev. 5,2188
-2198.
Herman, R. (1978). Crossover suppressors and
balanced recessive lethals in C. elegans.
Genetics 88,49
-65.
Hill, R. and Sternberg, P. (1992). The gene
lin-3 encodes an inductive signal for vulval development in C.
elegans. Nature
358,470
-476.[CrossRef][Medline]
Hodgkin, J., Horvitz, H. and Brenner, S.
(1979). Nondisjunction mutants of the nematode C.
elegans. Genetics
91, 67-94.
Hopper, N., Lee, J. and Sternberg, P. (2000).
ARK-1 inhibits EGFR signaling in C. elegans. Mol.
Cell 6,65
-75.[CrossRef][Medline]
Hosono, R., Hirahara, K., Kuno, S. and Kurihara, T.
(1982). Mutants of C. elegans with Dumpy and Rounded
head phenotype. J. Exp. Zool.
224,135
-144.[CrossRef]
Howard, R. M. and Sundaram, M. V. (2002).
C. elegans EOR-1/PLZF and EOR-2 positively regulate Ras and Wnt
signaling and function redundantly with LIN-25 and the SUR-2 Mediator
component. Genes Dev.
16,1815
-1827.
Itoh, H. and Gilman, A. (1991). Expression and
analysis of Gs alpha mutants with decreased ability to activate
adenylylcyclase. J. Biol. Chem.
266,16226
-16231.
Iwasaki, K., Staunton, J., Saifee, O., Nonet, M. and Thomas,
J. (1997). aex-3 encodes a novel regulator of
presynaptic activity in C. elegans. Neuron
18,613
-622.[CrossRef][Medline]
Jansen, G., Thijssen, K., Werner, P., van der Horst, M.,
Hazendonk, E. and Plasterk, R. (1999). The complete family of
genes encoding G proteins of Caenorhabditis elegans. Nat.
Genet. 21,414
-419.[CrossRef][Medline]
Jiang, H., Wu, D. and Simon, M. I. (1994).
Activation of phospholipase C beta 4 by heterotrimeric GTP-binding proteins.
J. Biol. Chem. 269,7593
-7596.
Jongeward, G., Clandinin, T. and Sternberg, P.
(1995). sli-1, a negative regulator of
let-23-mediated signaling in C. elegans.
Genetics 139,1553
-1566.[Abstract]
Jospin, M., Jacquemond, V., Mariol, M.-C., Segalat, L. and
Allard, B. (2002). The L-type voltage-dependent Ca2+ channel
EGL-19 controls body wall muscle function in Caenorhabditis elegans.
J. Cell Biol. 159,337
-348.
Katz, W., Hill, R., Clandinin, T. and Sternberg, P.
(1995). Different levels of the C. elegans growth factor
LIN-3 promote distinct vulval precursor fates. Cell
82,297
-307.[CrossRef][Medline]
Katz, W., Lesa, G., Yannoukakos, D., Clandinin, T.,
Schlessinger, J. and Sternberg, P. (1996). A point mutation
in the extracellular domain activated LET-23, the Caenorhabditis
elegans epidermal growth factor receptor homolog. Mol. Cell.
Biol. 16,529
-537.[Abstract]
Kornfeld, K., Hom, D. and Horvitz, H. (1995).
The ksr-1 gene encodes a novel protein kinase involved in
Ras-mediated signaling in C. elegans. Cell
83,903
-913.[CrossRef][Medline]
Korswagen, H. C., Coudreuse, D. Y., Betist, M. C., Van De Water,
S., Zivkovic, D. and Clevers, H. C. (2002). The Axin-like
protein PRY-1 is a negative regulator of a canonical Wnt pathway in C.
elegans. Genes Dev.
16,1291
-1302.
Lackner, M., Kornfeld, K., Miller, L., Horvitz, H. and Kim,
S. (1994). A MAP kinase homolog, mpk-1, is involved
in ras-mediated induction of vulval cell fates in Caenorhabditis
elegans. Genes Dev.
8, 160-173.
Lackner, M., Nurrish, S. and Kaplan, J. (1999).
Facilitation of synaptic transmission by EGL-30 G(q)alpha and EGL-8 PLC beta:
DAG binding to UNC-13 is required to stimulate acetylcholine release.
Neuron 24,335
-346.[CrossRef][Medline]
Lee, J., Jongeward, G. and Sternberg, P.
(1994). unc-101, a gene required for many aspects of
Caenorhabditis elegans development and behavior, encodes a
clathrin-associated protein. Genes Dev.
8, 60-73.
Lee, R., Lobel, L., Hengartner, M., Horvitz, H. and Avery,
L. (1997). Mutations in the alpha1 subunit of an L-type
voltage-activated Ca2+ channel cause myotonia in Caenorhabditis
elegans. EMBO J.
16,6066
-6076.[CrossRef][Medline]
Linn, C. L. (2000). Second messenger pathways
involved in up-regulation of an L-type calcium channel. Visual
Neurosci. 17,473
-482.[CrossRef][Medline]
Liu, T., Liu, X., Wang, H., Moon, R. T. and Malbon, C. C.
(1999). Activation of rat frizzled-1 promotes Wnt signaling and
differentiation of mouse F9 teratocarcinoma cells via pathways that require
Galpha(q) and Galpha(o) function. J. Biol. Chem.
274,33539
-33544.
Liu, T., DeCostanzo, A. J., Liu, X., Wang, H., Hallagan, S.,
Moon, R. T. and Malbon, C. C. (2001). G protein signaling
from activated rat frizzled-1 to the beta-catenin-Lef-Tcf pathway.
Science 292,1718
-1722.
Lowes, V. L., Ip, N. Y. and Wong, Y. H. (2002).
Integration of signals from receptor tyrosine kinases and g protein-coupled
receptors. Neurosignals
11, 5-19.[CrossRef][Medline]
Maloof, J. and Kenyon, C. (1998). The Hox gene
lin-39 is required during C. elegans vulval induction to
select the outcome of Ras signaling. Development
125,181
-190.[Abstract]
Maloof, J., Whangbo, J., Harris, J., Jongeward, G. and Kenyon,
C. (1999). A Wnt signaling pathway controls Hox gene
expression and neuroblast migration in C. elegans.
Development 126,37
-49.[Abstract]
Maruyama, I. and Brenner, S. (1991). A phorbol
ester/diacylglycerol-binding protein encoded by the unc-13 gene of
Caenorhabditis elegans. Proc. Natl. Acad. Sci.
USA 88,5729
-5733.
Miller, D. and Niemeyer, C. (1995). Expression
of the unc-4 homeoprotein in Caenorhabditis elegans motor
neurons specifies presynaptic input. Development
121,2877
-2886.[Abstract]
Moghal, N. and Sternberg, P. W. (2003a). A
component of the transcriptional mediator complex inhibits RAS-dependent
vulval fate specification in C. elegans.
Development 130,57
-69.
Moghal, N. and Sternberg, P. W. (2003b). The
epidermal growth factor system in Caenorhabditis elegans.
Exp. Cell Res. 284,150
-159.[CrossRef][Medline]
Noel, J., Hamm, H. and Sigler, P. (1993). The
2.2 Å crystal structure of transducin-
complexed with
GTP
S. Nature 366,654
-663.[CrossRef][Medline]
Ogawa, H., Harada, S., Sassa, T., Yamamoto, H. and Hosono,
R. (1998). Functional properties of the unc-64 gene
encoding a Caenorhabditis elegans syntaxin. J. Biol.
Chem. 273,2192
-2198.
Ohmachi, M., Rocheleau, C., Church, D., Lambie, E., Schedl, T.
and Sundaram, M. (2002). C. elegans ksr-1 and
ksr-2 have both unique and redundant functions and are required for
MPK-1 ERK phosphorylation. Curr. Biol.
12,427
-433.[CrossRef][Medline]
Okkema, P., Harrison, S., Plunger, V., Aryana, A. and Fire,
A. (1993). Sequence requirements for myosin gene-expression
and regulation in Caenorhabditis elegans.
Genetics 135,385
-404.[Abstract]
Prenzel, N., Zwick, E., Daub, H., Leserer, M., Abraham, R.,
Wallasch, C. and Ullrich, A. (1999). EGF receptor
transactivation by G-protein-coupled receptors requires metalloproteinase
cleavage of proHB-EGF. Nature
402,884
-888.[Medline]
Richmond, J., Davis, W. and Jorgensen, E.
(1999). UNC-13 is required for synaptic vesicle fusion in C.
elegans. Nat. Neurosci.
2, 959-964.[CrossRef][Medline]
Riddle, D. (1978). The genetics of development
and behavior in C. elegans. J. Nematol.
10, 1-16.[Medline]
Riddle, D. L. and Albert, P. S. (1997). Genetic
and environmental regulation of dauer larva development. In C.
Elegans II (ed. D. L. Riddle, T. Blumenthal, B. J. Meyer and J.
R. Priess), pp. 739-768. Cold Spring Harbor, NY, USA:
Cold Spring Harbor Laboratory Press.
Rogalski, T. and Riddle, D. (1988). A C.
elegans RNA polymerase II gene, ama-1 IV, and nearby essential
genes. Genetics 118,61
-74.
Saifee, O., Wei, L. and Nonet, M. (1998). The
Caenorhabditis elegans unc-64 locus encodes a syntaxin that interacts
genetically with synaptobrevin. Mol. Biol. Cell
9,1235
-1252.
Segalat, L., Elkes, D. and Kaplan, J. (1995).
Modulation of serotonin-controlled behaviors by G(o) in Caenorhabditis
elegans. Science
267,1648
-1651.
Shakir, M., Miwa, J. and Siddiqui, S. (1993). A
role of ADF chemosensory neurones in dauer formation behaviour in C.
elegans. NeuroReport
4,1151
-1154.[Medline]
Sieburth, D., Sun, Q. and Han, M. (1998).
SUR-8, a conserved Ras-binding protein with leucine-rich repeats, positively
regulates Ras-mediated signaling in C. elegans.
Cell 94,119
-130.[CrossRef][Medline]
Sieburth, D., Sundaram, M., Howard, R. and Han, M.
(1999). A PP2A regulatory subunit positively regulates
Ras-mediated signaling during Caenorhabditis elegans vulval
induction. Genes Dev.
13,2562
-2569.
Sigurdson, D., Spanier, G. and Herman, R.
(1984). Caenorhabditis elegans deficiency mapping.
Genetics 108,331
-345.
Simske, J. and Kim, S. (1995). Sequential
signaling during Caenorhabditis elegans vulval induction.
Nature 375,142
-146.[CrossRef][Medline]
Sprang, S. (1997). G protein mechanisms:
insights from structural analysis. Annu. Rev. Biochem.
66,639
-678.[CrossRef][Medline]
Sternberg, P. and Horvitz, H. (1986). Pattern
formation during vulval development in C. elegans.
Cell 44,761
-772.[CrossRef][Medline]
Sulston, J. E. and Horvitz, H. R. (1977).
Post-embryonic cell lineages of the nematode Caenorhabditis elegans.
Dev. Biol. 56,110
-156.[CrossRef][Medline]
Sundaram, M. and Han, M. (1995). The C.
elegans ksr-1 gene encodes a novel Raf-related kinase involved in
Ras-mediated signal transduction. Cell
83,889
-901.[CrossRef][Medline]
Tabish, M., Siddiqui, Z., Nishikawa, K. and Siddiqui, S.
(1995). Exclusive expression of C. elegans osm-3 kinesin
gene in chemosensory neurons open to the external environment. J.
Mol. Biol. 247,377
-389.[CrossRef][Medline]
Tan, P., Lackner, M. and Kim, S. (1998). MAP
kinase signaling specificity mediated by the LIN-1 Ets/LIN-31 WH transcription
factor complex during C. elegans vulval induction.
Cell 93,569
-580.[CrossRef][Medline]
Trent, C., Tsung, N. and Horvitz, H. (1983).
Egg-laying defective mutants of the nematode C. elegans.
Genetics 104,619
-647.
Way, J. and Chalfie, M. (1989). The
mec-3 gene of Caenorhabditis elegans requires its own
product for maintained expression and is expressed in three neuronal cell
types. Genes Dev. 3,1823
-1833.
White, J., Southgate, E., Thomson, J. and Brenner, S.
(1986). The structure of the nervous system of the nematode
Caenorhabditis elegans. Philos. Trans. R. Soc. London Ser.
B 314,1
-340.[CrossRef]
White, J., Southgate, E. and Thomson, J.
(1992). Mutations in the Caenorhabditis elegans unc-4
gene alter the synaptic input to ventral cord motor neurons.
Nature 355,838
-841.[CrossRef][Medline]
Wu, Y. and Han, M. (1994). Suppression of
activated Let-60 Ras protein defines a role of Caenorhabditis elegans
Sur-1 MAP kinase in vulval differentiation. Genes Dev.
8, 147-159.
Yochem, J., Weston, K. and Greenwald, I.
(1988). The Caenorhabditis elegans lin-12 gene encodes a
transmembrane protein with overall similarity to Drosophila Notch.
Nature 335,547
-550.[CrossRef][Medline]
Yoon, C., Lee, J., Jongeward, G. and Sternberg, P.
(1995). Similarity of sli-1, a regulator of vulval
development in C. elegans, to the mammalian proto-oncogene
c-cbl. Science
269,1102
-1105.
This article has been cited by other articles:
![]() |
K. Modzelewska, M. G. Elgort, J. Huang, G. Jongeward, A. Lauritzen, C. H. Yoon, P. W. Sternberg, and N. Moghal An Activating Mutation in sos-1 Identifies Its Dbl Domain as a Critical Inhibitor of the Epidermal Growth Factor Receptor Pathway during Caenorhabditis elegans Vulval Development Mol. Cell. Biol., May 15, 2007; 27(10): 3695 - 3707. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhong and P. W. Sternberg Genome-wide prediction of C. elegans genetic interactions. Science, March 10, 2006; 311(5766): 1481 - 1484. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Gruninger, D. G. Gualberto, B. LeBoeuf, and L. R. Garcia Integration of Male Mating and Feeding Behaviors in Caenorhabditis elegans J. Neurosci., January 4, 2006; 26(1): 169 - 179. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Bastiani, S. Gharib, M. I. Simon, and P. W. Sternberg Caenorhabditis elegans G{alpha}q Regulates Egg-Laying Behavior via a PLC{beta}-Independent and Serotonin-Dependent Signaling Pathway and Likely Functions Both in the Nervous System and in Muscle Genetics, December 1, 2003; 165(4): 1805 - 1822. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||