|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 18, 2003
doi: 10.1242/10.1242/dev.00671

1 Institute of Neuroscience, University of Oregon, Eugene, OR 97403, USA
2 Department of Environmental, Population and Organismic Biology, University of
Colorado, Boulder, CO 80309, USA
Author for correspondence (e-mail:
draper{at}fred.fhcrc.org)
Accepted 12 June 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Fibroblast growth factor, fgf24, fgf8, acerebellar, no tail, spadetail, Mesoderm, Posterior development, Limb development, Zebrafish
| Introduction |
|---|
|
|
|---|
To date, 23 Fgf ligands (Fgf1-23) have been described in tetrapods
(reviewed by Ornitz and Itoh,
2001
) and several of these ligands are known to be expressed in
early mesodermal progenitors in mice, including Fgf3
(Wilkinson et al., 1988
),
Fgf4 (Niswander and Martin,
1992
; Drucker and Goldfarb,
1993
), Fgf5 (Haub and
Goldfarb, 1991
; Hébert
et al., 1991
) and Fgf8
(Heikinheimo et al., 1994
;
Ohuchi et al., 1994
;
Crossley and Martin, 1995
).
Mutational analyses in mice, however, suggest that not all of these ligands
are required for the development of mesoderm. For example, embryos mutant for
Fgf3 and Fgf5 have only slight (Fgf3)
(Mansour et al., 1993
) or no
(Fgf5) (Hébert et al.,
1994
) defects in posterior development. Conversely, Fgf8
mutant embryos do not form posterior mesoderm, indicating that Fgf8
activity can account for the majority of Fgf signaling required for posterior
development in mice. A role for Fgf4 in posterior mesodermal
development in mice has yet to be established, as Fgf4 mutants die
prior to mesoderm formation (Feldman et
al., 1995
).
In addition to Fgf signaling, T-box genes, which function as
transcriptional regulators, are also required for formation of the posterior
body during vertebrate embryogenesis. The founding member of the T-box gene
family, mouse T or Brachyury is expressed early in
mesodermal precursors and then in the developing notochord
(Herrmann et al., 1990
).
T is required for the development of these tissues, as T
mutant embryos fail to form a notochord and lack posterior body structures
(reviewed by Smith, 1999
;
Papaioannou, 2001
). The role
of T in mesodermal development appears to be evolutionarily conserved
in vertebrates, as T orthologs in several organisms have been shown
to have similar expression patterns and functions. For example, T
orthologs in Xenopus and zebrafish, called Xbra and no
tail (ntl), respectively are expressed in mesodermal precursors
and in the developing notochord (Smith, et
al., 1991
; Schulte-Merker et
al., 1992
), and are required
(Halpern et al., 1993
;
Conlon et al., 1996
) and
sufficient (Cunliff and Smith, 1992;
O'Reilly et al., 1995
) for
notochord and posterior mesodermal development.
The T-box gene VegT/spt has also been implicated in mesodermal
specification in vertebrate embryos. VegT in Xenopus is
expressed in mesodermal precursors and in developing posterior paraxial
mesoderm, and is also expressed maternally
(Horb and Thomsen, 1997
;
Lustig et al., 1996
;
Stennard et al., 1996
;
Zhang and King, 1996
).
Inhibition of maternal VegT function results in embryos that fail to
form both mesoderm and endoderm, showing that VegT has an early role
in germ layer formation (Zang et al., 1998). The function of zygotically
expressed VegT has not been determined. In zebrafish,
spadetail (spt; tbx16 - Zebrafish Information
Network) is an ortholog of VegT and is similarly expressed in
mesodermal precursors and in developing paraxial mesoderm. In contrast to
VegT, however, spt is not expressed maternally
(Griffin et al., 1998
).
spt mutant embryos lack paraxial mesoderm in the trunk, but not in
the tail, and form a relatively normal notochord
(Kimmel et al., 1989
;
Amacher et al., 2002
). Thus,
spt mutants have a phenotype that is nearly reciprocal to that of
ntl mutants. Although both spt and ntl mutants form
lateral and ventral mesodermal cell types, spt;ntl double mutant
embryos fail to form all posterior mesoderm
(Amacher et al., 2002
). These
results suggest that spt and ntl have distinct roles in
promoting the development of specific mesodermal subtypes, as well as a
presumed earlier, and redundant role in the specification of all posterior
mesodermal precursors.
A link between Fgf signaling and T-box gene function in posterior
mesodermal development was revealed when it was shown that T-box gene
expression in mesodermal precursors is dependent on Fgf signaling. In
Xenopus and zebrafish, expression of Xbra/ntl is
inhibited when Fgf signaling is blocked
(Amaya et al., 1991
;
Isaacs et al., 1994
;
Schulte-Merker and Smith,
1995
; Griffin et al.,
1995
) and ectopic activation of the Fgf signaling pathway leads to
ectopic Xbra/ntl expression
(Isaacs et al., 1994
;
Schulte-Merker and Smith,
1995
; Griffin et al.,
1995
). These and other results have led to the model that Fgf
signaling and T-box genes form an auto-regulatory feedback loop during early
mesodermal development, where the function of one component is necessary for
the continued expression of the other. These interactions are thought to
promote posterior development by maintaining and regulating the growth and
morphogenesis of mesodermal precursors in the posterior region of the embryo
(reviewed by Isaacs,
1997
).
In zebrafish, inhibiting Fgf signaling leads to a phenotype that is
strikingly similar to that of spt;ntl double mutant embryos
(Griffin et al., 1995
;
Amacher et al., 2002
). Because
expression of both spt and ntl in mesodermal precursors is
Fgf dependent (Griffin et al.,
1995
; Griffin et al.,
1998
), it is possible to explain the mesodermal defects associated
with blocking Fgf signaling as a loss of spt and ntl
function. Although spt and ntl are key regulators of
posterior development in zebrafish, little is known about which Fgf signaling
components are required to maintain their expression.
The zebrafish fgf8 gene is expressed in mesodermal precursors and
is therefore a candidate Fgf ligand for regulating posterior development. A
mutation in fgf8 (or acerebellar)
(Reifers et al., 1998
), has
been identified, but unlike embryos injected with a dnFgfr
(Griffin et al., 1995
),
fgf8 mutants (Reifers et al.,
1998
), or embryos in which fgf8 function has been
inhibited with morpholino oligonucleotides
(Araki and Brand, 2001
;
Draper et al., 2001
) have
relatively mild defects in posterior development. A hypothesis that we explore
here is that additional Fgf ligands function together with Fgf8 during
development of the posterior body in zebrafish.
We have identified and characterized a second Fgf ligand-encoding gene in
zebrafish that is expressed in mesodermal precursors. This ligand is a new,
but distinct, member of the fgf8/17/18 subclass of Fgf ligands, for
which there is no ortholog among the 23 known Fgfs in tetrapods. We therefore
designate this gene fgf24. We show that fgf24 is expressed
in a domain that overlaps extensively with that of fgf8, ntl and
spt in mesodermal precursors during gastrulation, and that
fgf8 and fgf24 are together required for the formation of
most posterior mesoderm. Furthermore, we present both gene expression and
genetic data showing that interactions between the Fgf signaling pathway and
the ntl and spt T-box genes are essential for posterior
mesoderm development in zebrafish. Last, we show that fgf24 is also
required for initiation of the pectoral fin bud, a role that appears similar
to that of Fgf10 in mice (reviewed by
Martin, 1998
).
| Materials and methods |
|---|
|
|
|---|
Sequence alignment and phylogenetic analysis
Phylogenetic relatedness of fgf24 and fgf18 were
determined by aligning sequences with the ClustalX program, and constructing
trees from the alignments using the neighbor-joining method. Prior to
alignment, we used the Signal IP program
(Nielsen et al., 1997
) to
identify the most probable cleavage site of the signal peptide that comprises
the N-terminal 25-30 amino acids of the proteins. The tree was then
constructed using an alignment that contained only those sequences that were
predicted to be present in the mature Fgf proteins. As an outgroup, the
distantly related zebrafish Fgf10 protein sequence was used.
Mapping
The positions of fgf18, fgf24 and the EST fi43f07 (GenBank
Accession Number AW174476; M. Clark and S. Johnson, WUZGR;
http://zfish.wustl.edu)
in the zebrafish genome were determined by mapping on the Goodfellow T51
radiation hybrid (RH) panel (Kwok et al.,
1998
) (Research Genomics) using the following primers pairs
(5' primer/3' primer): fgf18,
CCGGGACTCAAACCAGCGACC/GTCCTGCTGGTTGGGAAGCG (411 bp fragment); fgf24,
same primers as those used for PAC isolation (see above); fi43f07,
GTTCACCGACGGGTTTCCATTTTCA/TCCTGCATCTTTAGCCCGCGTTTAC (199 bp fragment).
Following PCR, fragments were separated by electrophoresis and scored as
described by Geisler et al. (Geisler et
al., 1999
). The RH data was converted to a map position using the
Instant Mapping program
(http://134.174.23.167/zonrhmapper/instantMapping.htm).
Fish stocks and maintenance
Adult zebrafish stocks and embryos were maintained at 28.5°C as
described previously (Westerfield,
1995
). Embryos were produced by natural matings of the appropriate
adult fish. Embryos were collected and sorted at early cleavage stages and
maintained in embryo medium (Westerfield et al., 1995) at 28.5°C until the
desired developmental stages according to Kimmel et al.
(Kimmel et al., 1995
). The
following alleles were used for this study:
fgf8/acerebellarti282,
sptb104 and ntlb195.
The sptb104
(Griffin et al., 1998
) and
ntlb195
(Schulte-Merker et al., 1994
)
alleles are null, while the fgf8ti282 allele is
probably a hypomorph (Draper et al.,
2001
). spt maps to LG8 (S. L. Amacher, unpublished),
Fgf8 maps to LG13 (Woods et al.,
2000
) and ntl maps to LG19
(Postlethwait et al.,
1998
).
Fish doubly heterozygous for sptb104 and fgf8ti282, or for fgf8ti282 and ntlb195 were generated by crossing single heterozygotes of the appropriate genotype to produce F1 offspring. The genotypes of adult F1 fish were scored by crossing to tester fish of known genotype. Homozygous double mutant embryos were then produced by crossing doubly heterozygous fish. Embryos from such crosses were sorted into phenotypic classes based on morphology at 24 hpf using a dissecting microscope. For two unlinked mutations segregating in a Mendelian fashion, four phenotypic classes should be obtained in a ratio of 9:3:3:1 (wild type:mut1-/-:mut2-/-:mut1-/-:mut2-/-). In crosses between spt+/-;fgf8+/- fish, the following phenotypic classes were found in the ratios of 9.07:3.08:2.91:0.94 (wild type:spt-:fgf8-:spt-;fgf8-, n=1,076, x2=0.612, P>0.80). In crosses between fgf8+/-;ntl+/- fish, the following phenotypic classes were obtained in the ratios of 8.83:3.13:2.94:1.10 (wild type:fgf8-:ntl-:fgf8-;ntl-, n=609, x2=0.76, P>0.80). In crosses between fgf8+/-;ntl+/- double heterozygotes and fgf8+/- single heterozygous fish, the following phenotypic classes were obtained in the ratios of 6.03:0.94:1.03 (wild type:fgf8-:fgf8- short tail, n=382, x2=0.196, P>0.90).
Tissue labeling
Riboprobes for in situ hybridization were synthesized using the MaxiScript
kit according to the manufacturer's instructions (Ambion, Austin, TX). With
the exception of fgf24 (this paper), the probes used have been
described previously as follows: pax2.1
(Krauss et al., 1991
),
krx20 (egr2 - Zebrafish Information Network)
(Oxtoby and Jowett, 1993
),
myod (Weinberg et al.,
1996
), ntl
(Schulte-Merker et al., 1992
),
spt (Griffin et al.,
1998
), fgf8
(Fürthauer et al., 1997
;
Reifers et al., 1998
) and
shh (Krauss et al.,
1993
). The fgf24 in situ probe was transcribed from the
full length cDNA. Immunohistochemical staining with anti-Ntl
(Schulte-Merker et al., 1992
)
and anti-Spt (Amacher et al.,
2002
) were preformed as detailed by Amacher et al.
(Amacher et al., 2002
). For in
situ hybridization experiments using embryos older than 24 hpf, melanogenesis
was inhibited by raising embryos in embryo medium containing 0.003% PTU
(1-phenyl 2-thiourea) (Westerfield,
1995
). For sectioning, embryos were embedded in epon and 7.5 µm
sections were cut.
Morpholino injection and RNase protection assays
The splice-site targeted morpholino oligonucleotide (MO)
fgf24-E3I3 was obtained from GeneTools (Corvalis, OR) and has the
following sequence: 5'-AGGAGACTCCCGTACCGTACTTGCC-3'. MO injections
were performed as previously described
(Draper et al., 2001
). RT-PCR
analysis shown in Fig. 3 was
performed essentially as described above, but using the fgf24
specific PCR primer pair (5' primer/3' primer):
CGGCAAACGCTGGAAACAGG/GTCTCTGTCTCCACCACAAGC (wild-type fragment 300 bp). RNase
protection assays were performed using the RPA III kit (Ambion, Austin, TX) as
previously described (Draper et al.,
2001
). A template for making antisense fgf24 probe was
generated by amplifying a fragment of the fgf24 cDNA using the primer
pair ATGTCTGTTCTGCCGTCAAGG/GTCTCTGTCTCCACCACAAGC, and cloning into the
pCRIITOPO TA vector (Invitrogen, Carlsbad, CA).
|
| Results |
|---|
|
|
|---|
To further characterize these two genes, we identified and sequenced cDNAs,
and used their conceptually translated protein sequences to construct a
phylogenetic tree (Fig. 1A,B).
Sequence comparison to the 22 known human FGF ligands confirmed that these two
genes are members of the FGF8/17/18 subfamily (henceforth referred to
as 'Fgf8 subfamily') (reviewed by Ornitz
and Itoh, 2001
) and are most closely related to FGF18
(not shown). Of the two zebrafish proteins, one shared 73% amino acid identity
with human FGF18, while the other shared only 65% identity
(Fig. 1A,B). For simplicity, we
shall refer to these genes as fgf18 and fgf24 respectively.
To better determine the relationship of fgf18 and fgf24 to
known genes, we mapped them using the T51 radiation hybrid panel
(Kwok et al., 1998
) and found
that they both localized to LG14,
18 cM apart
(Fig. 1C). Human FGF18
has been mapped to chromosome 5q34
(Whitmore et al., 2000
), and
previous studies have found that LG14 contains regions with conserved synteny
to human 5q31-5q35 (Woods et al.,
2000
). Using these data, together with the map positions of
additional zebrafish orthologs of human genes known to map in the 5q31-5q35
interval, we determined that there was significant conserved synteny between
regions containing zebrafish fgf18 and human FGF18. For
example, the human gene encoding the F-box WD40 protein FBXWB1, and
its zebrafish ortholog, referred to by its GenBank Accession Number AW174476,
are closely linked to fgf18 (Fig.
1C). By contrast, we found no significant syntenic conservation
between the map location of fgf24 and any region of the human genome.
Because Fgf24 protein sequence is as distantly related to Fgf18 orthologs as
Fgf8 orthologs are to Fgf17 (Fig.
1B), we propose that Fgf24 defines a new clade in the Fgf8/17/18
subfamily, and for which a tetrapod ortholog has not been described.
|
Analysis of the Fgf24 protein sequence using the SignaIP program
(Nielsen et al., 1997
)
indicates that the C-terminal 30 amino acids encode a probable signal
sequence, arguing that fgf24 is a secreted protein. We determined the
intron/exon boundaries of the fgf24 gene by partial sequencing of the
genomic locus and found that they are in positions that are conserved within
the Fgf8 subfamily (Xu et al., 1999) (Fig.
1A).
fgf8 and fgf24 are co-expressed in mesodermal
progenitors during gastrulation
We determined the expression pattern of fgf24 transcripts in
gastrula-stage embryos by whole-mount in situ hybridization. We first detected
localized fgf24 transcripts at the beginning of epiboly (6 hpf) in
the dorsalmost cells of the blastula margin (not shown) and, soon after,
expression extends completely around the margin with no obvious dorsoventral
bias (Fig. 2A,B).
fgf24 expression continues in marginal cells throughout gastrulation
(Fig. 2C-F) and by the end of
gastrulation is localized to the tail bud
(Fig. 2G). Thus, fgf24
has a similar expression pattern to that of fgf8 in early embryos
(Fürthauer et al., 1997
;
Reifers et al., 1998
).
|
In addition to the germ ring, fgf8 is also expressed in the
presumptive brain beginning at 8 hpf in a domain that spans from the future
midhindbrain junction (MHB) posteriorly to rhombomere 4
(Fig. 2I,M)
(Reifers et al., 1998
;
Maves et al., 2002
). At this
stage of development, fgf24 is not expressed in the presumptive
brain, though weak staining can be seen in dispersed cells within the
presumptive spinal cord (Fig.
2E). Thus, the co-expression of fgf8 and fgf24
in the germ ring, but not in the presumptive brain, supports the hypothesis
that fgf24 functions with fgf8 during posterior mesoderm
production and can readily explain why fgf8 mutant embryos have only
mild defects in the development of posterior mesoderm, yet have significant
defects in the development of the MHB
(Reifers et al., 1998
).
fgf24 splice-blocking morpholino oligos knock-down
fgf24 gene function
We directly tested the hypothesis that fgf24 and fgf8
function redundantly during the development of posterior mesoderm by knocking
down fgf24 gene function with antisense morpholino oligonucleotides
(MOs) (Nasevicicius and Ekker,
2000
) targeted to a splice junction site in the fgf24
pre-mRNA. Splice site-targeted MOs have been shown to alter pre-mRNA splicing
when injected into zebrafish embryos, and have the advantage that their
efficacy can be quantified by ribonuclease protection
(Draper et al., 2001
). We
obtained a MO targeted to the splice donor site located at the junction of
exon 3 and intron 3 (henceforth referred to as fgf24-E3I3;
Fig. 3A). We first asked if
fgf24-E3I3 could alter splicing of fgf24 pre-mRNA using
RTPCR. We injected 5 ng of fgf24-E3I3 into one- to four-cell stage
embryos and harvested RNA at 24 hpf. Using primers that span exon 3
(Fig. 3A), we found that
injection of fgf24-E3I3 results in two aberrant splice forms, one of
which causes an
100 bp deletion in the fgf24 cDNA when compared
with cDNA amplified from control embryos
(Fig. 3B). We sequenced this
RT-PCR product and found that the deletion results from the aberrant use of a
cryptic splice donor site located 98 bp upstream of the correct exon 3 splice
donor (Fig. 3C). Splicing at
this cryptic splice donor shifts the reading frame of fgf24 mRNA such
that only 19 of the 178 amino acids that are predicted to form the secreted
Fgf24 protein are encoded. This severely truncated form of Fgf24 is predicted
to be non-functional (Fig.
3C).
We next quantified the ability of fgf24-E3I3 to reduce the amount of correctly spliced fgf24 mRNA by ribonuclease protection. We injected fgf24-E3I3 into one- to four-cell stage embryos at doses ranging from 1.3-5.0 ng MO/embryo and harvested RNA at 24 hpf. Using a riboprobe that detects correctly spliced message (Fig. 3D) we found that injection of fgf24-E3I3 reduced the amount of wild-type fgf24 mRNA in a dose-dependent manner (Fig. 3E,F). Because injection of 5 ng fgf24-E3I3 per embryo reduced the amount of wild-type message to levels that were undetectable in our assay, we chose this amount for all subsequent experiments involving MO-induced knockdown of fgf24.
fgf8 and fgf24 are together required for the
production of posterior mesoderm
We asked what effect reducing fgf24 gene function had on the
development of posterior mesoderm by injecting fgf24-E3I3 into one-
to four-cell stage wild-type embryos to generate
fgf24MO embryos. We compared the amount of
posterior mesoderm produced by injected and control siblings at the 12-somite
stage by staining fixed embryos for marker genes that are expressed in
restricted domains of posterior mesoderm. We assayed the production of axial
mesoderm using anti-Ntl antibodies, which reveal cells in the notochord and
tail bud (Schulte-Merker et al.,
1992
), and paraxial and intermediate mesoderm by in situ
hybridization using probes specific for myod
(Weinberg et al., 1996
) and
pax2.1 (Krause et al., 1991), respectively
(Fig. 4A). We found that we
could not detect differences in marker gene expression when comparing
fgf24MO embryos with wild-type control embryos
(compare Fig. 4A with 4B). In
addition, we compared the morphology of live
fgf24MO embryos and wild-type embryos at 24 hpf
and again could not detect any significant differences (compare
Fig. 4E with 4F). Thus,
reducing the level of fgf24 mRNA to undetectable levels in early
zebrafish embryos appears to have no detectable effect on the development of
posterior mesoderm under our assay conditions.
|
fgf8 and fgf24 are together required for
maintaining ntl and spt expression in posterior
mesoderm
Because the phenotype of
fgf8-;fgf24MO embryos is similar to
that of spt;ntl double mutants, we asked if the defects in posterior
mesoderm development were associated with defects in the expression of
ntl and spt. We first compared the expression patterns of
ntl transcripts and Spt protein in eight-somite stage
fgf8-;fgf24MO embryos with those of
wild-type, fgf8- and fgf24MO
embryos. We found that in comparison with wild-type embryos
(Fig. 5A),
fgf8- (Fig.
5B), but not fgf24MO embryos (data
not shown), had reduced numbers of Spt protein-expressing cells in the
presomitic mesoderm, and nearly 1/3 of the embryos had gaps in the axial
mesodermal expression domain of ntl
(Fig. 5B). Thus, loss of
fgf8 function alone, but not fgf24, is sufficient to cause
reduced levels of spt and ntl expression in developing
posterior mesoderm, an observation that could explain why fgf8 single
mutants have defects in somitogenesis (Fig.
4C) (Reifers et al.,
1998
). In contrast to single mutant embryos, we found that all
fgf8-;fgf24MO embryos had severe
defects in spt and ntl expression in posterior mesoderm.
Although all of fgf8-;fgf24MO embryos
had expression of ntl in anterior notochord cells
(Fig. 4D,
Fig. 5C), we could not detect
expression of either ntl or Spt in more posterior regions
(Fig. 5C) (see also
supplemental Fig. S1 at
http://dev.biologists.org/supplemental/).
These data together suggest that
fgf8-;fgf24MO embryos at the 10-somite
stage do not contain mesodermal precursors in the tail bud.
|
ntl and spt are required for some, but not all, of
the expression of fgf8 and fgf24 in the germ ring
It had been proposed that Fgf signaling and T-box genes form an
auto-regulatory feedback loop, where the expression of one maintains the
expression of the other (reviewed by
Smith, 1999
). We therefore
asked what effect loss of spt and ntl function had on the
expression of fgf8 and fgf24 during gastrulation. We found
that mid-gastrula-stage (8 hpf) ntl mutants had reduced expression of
both fgf8 (Fig. 5I)
and fgf24 (Fig. 5M) in
axial, but not ventral mesoderm compared with wild-type embryos
(Fig. 5H and 5L, respectively).
Surprisingly, spt mutant embryos also failed to express fgf8
in axial mesoderm, but had apparently normal expression of fgf8 in
non-axial domains (Fig. 5J). By
contrast, expression of fgf24 in spt mutant embryos was
reduced ventrally, but not dorsally (Fig.
5N). Finally, we examined the expression of fgf8 and
fgf24 in spt;ntl double mutant embryos, and found that
expression levels of fgf8 were further reduced in the dorsal and
lateral but not the ventral, germ ring
(Fig. 5K). By contrast, we
found that expression of fgf24 was reduced both dorsally and
ventrally, but not laterally in spt;ntl double mutants (Fig. 50).
These data show that wild-type function of spt and ntl are
required for some, but not all, fgf8 and fgf24 expression in
mesodermal precursors.
fgf8 interacts with ntl and spt in
vivo
We have so far provided only indirect evidence based on phenotypic analysis
and gene expression that interactions between the Fgf ligands Fgf8 and Fgf24,
and the T-box genes spt and ntl are required for posterior
mesoderm development in zebrafish. We tested this hypothesis more directly by
asking if we could detect genetic interactions between the Fgf ligands and the
T-box genes. We therefore constructed and analyzed fgf8;ntl and
spt;fgf8 double mutants and used fgf24-E3I3 MO to create
fgf24MO;ntl and spt;fgf24MO
mutant embryos. In comparison with wild-type embryos
(Fig. 6A), embryos single
mutant for either fgf8 (Fig.
6B) or ntl (Fig.
6D) produce significant amounts of paraxial mesoderm, as revealed
by the expression of myod at the 12-somite stage
(Reifers et al., 1998
;
Halpern et al., 1993
). By
contrast, we found that fgf8;ntl double mutants produced
significantly less paraxial mesoderm than would have been expected from simple
addition of their single mutant phenotypes
(Fig. 6E). Similarly, in
comparison with wild-type embryos (Fig.
6K), embryos mutant for either fgf8
(Fig. 6L) or spt
(Fig. 6M) produce significant
amounts of axial mesoderm, as revealed by the expression of Ntl protein in the
nuclei of notochord cells (Fig.
6I-K). By contrast, we found that spt;fgf8 double mutants
produce significantly less axial mesoderm than would have been expected from
simple addition of their single mutant phenotypes
(Fig. 6N).
Fig. 6F-J,O-R give
representative examples of live embryos at 24 hpf for each genotypic class
(see Materials and methods for segregation frequencies). We did not observe
significant differences in the amount of mesoderm produced by either
fgf24MO;ntl or spt;fgf24MO
embryos when compared with ntl or spt single mutants,
respectively (see supplemental Fig. S2 at
http://dev.biologists.org/supplemental/).
These data provide direct evidence that fgf8 genetically interacts
with ntl and spt during the development of posterior
mesoderm.
|
fgf24 expression in later development
After the completion of gastrulation, fgf24 expression can be
detected in a variety of tissues during somitogenesis and larval development.
Expression of fgf24 in the tail bud mesenchyme can be detected in
12-18 hpf embryos (Fig.
7A,D,F), but it is no longer expressed in this domain at 24 hpf
(Fig. 7H). fgf24 is
expressed in the otic placode beginning around the twosomite stage (10.5 hpf,
not shown) and is clearly visible at 12 hpf
(Fig. 7A) as bilateral patches
adjacent to rhombomere 5 (Fig.
7B). Co-labeling with the otic placode marker pax2.1
(Krauss et al., 1991
)
indicates that fgf24 is uniformly expressed in the otic placode at 12
hpf (Fig. 7C). Expression of
fgf24 in the developing ear is dynamic and by 24 hpf is localized to
a discrete domain in the posterior otic epithelium
(Fig. 7I). In addition to the
otic placode, fgf24 is expressed in anterior neuroectoderm at 12 hpf,
in a location that has been fate mapped to form the olfactory placode
(Fig. 7A) (Whitlock and Westerfield,
2000
) and in 18 hpf embryos, expression can be seen in the forming
nasal organs (Fig. 7E).
Expression of fgf24 persists in the nasal organ through 52 hpf (the
latest time point analyzed), at which point expression can also be detected in
the olfactory bubs (Fig. 7M,O).
Last, at 12 hpf, fgf24 expression is detected in bilateral stripes of
cells that appear to be located in lateral mesoderm
(Fig. 7A). We correlated this
expression domain with the expression of pax2.1, which at this stage
also labels the forming pronephric ducts, an intermediate mesodermal
derivative (Krauss et al.,
1991
), and found that cells expressing fgf24 lay medial
to, and do not appear to overlap with, those expressing pax2.1
(Fig. 7D). This expression
domain may identify precursors of regions of the gut because, at later stages,
fgf24 is also expressed in the developing gut
(Fig. 7F,H,J).
|
fgf24 is required for pectoral fin formation
We used the fgf24-E3I3 MO to address the function of
fgf24 in later development. As shown previously,
fgf24MO embryos at 24 hpf are morphologically
indistinguishable from their control siblings
(Fig. 3E,F). We therefore
allowed fgf24MO embryos to develop to various
stages past 24 hpf, and assayed for morphological phenotypes. We found that at
33 hpf, fgf24MO embryos were indistinguishable
form their control sibling embryos, with the exception that they did not have
visible pectoral fin buds, which are easily scored at this stage of
development as discrete epidermal bumps on the dorsal yolk (not shown)
(Kimmel et al., 1995
;
Grandel and Schulte-Merker,
1998
), or by their expression of shh
(Fig. 8A,B)
(Krauss et al., 1993
).
Surprisingly, we found that injected embryos could survive to adulthood, but
they never develop pectoral fins.
|
| Discussion |
|---|
|
|
|---|
fgf24 and its relationship to the fgf8/17/18
subfamily of Fgf ligands
With the addition of fgf24, at least 22 distinct Fgf-encoding
genes have been identified in vertebrates (human FGF19 and mouse
Fgf15 may be orthologous genes). Based on sequence relatedness, the
Fgf superfamily can be subdivided into seven subfamilies of more closely
related genes (reviewed by Ornitz and
Itoh, 2001
). The genes encoding the ligands Fgf8, Fgf17,
Fgf18, and Fgf24 define one such subfamily and mouse members of this
subfamily have been shown to have very similar Fgf receptor specificity
profiles (Xu et al., 2000
). It
is therefore likely that in zebrafish Fgf8 and Fgf24 have similar
activities.
Because Fgf24 so far appears to be unique to zebrafish, it is necessary to
consider its origin. There is increasing evidence that a whole-genome
duplication event occurred in the rayfinned fish lineage after it diverged
form the terrestrial vertebrate lineage
(Amores et al., 1998
;
Postlethwait et al., 1998
;
Force et al., 1999
;
Postlethwait et al., 2000
). It
is therefore possible that fgf18 and fgf24 are paralogs that
arose by duplication of an ancestral fgf18 during this proposed
event. However we have shown that fgf24 and fgf18 are
closely linked on LG14, whereas paralogs that resulted from a genome
duplication event are expected to be unlinked (see
Woods et al., 2000
). In
addition, we found compelling evidence of conserved gene synteny around the
zebrafish and human Fgf18 loci. By contrast, the fgf24 locus does not
appear to be in a region with conserved synteny with any region of the human
genome. Finally, the grouping of zebrafish Fgf24 with zebrafish Fgf18 is
contradicted by a node with 97% bootstrap support in our phylogenetic analysis
of Fgf protein sequences. Thus, our data argues that fgf24 and
fgf18 are not paralogous genes that resulted from the ray-finned
fish-specific genome duplication.
We instead favor the model that fgf24 and fgf18 are
paralogs that resulted from a gene duplication event that predates the
divergence of ray-finned fish and terrestrial vertebrate lineages. Based on
protein sequence relatedness, Fgf24 is as similar to Fgf18 orthologs,
as Fgf17 orthologs are to Fgf8. It is therefore possible
that a single ancestral gene, following two sequential duplication events,
gave rise to the four members of the Fgf8 subfamily. A similar
hypothesis has been proposed for the origin of the four tetapod Hox clusters
(discussed by Furlong and Holland,
2001
). In support of this model, a probable fgf24
ortholog has been identified in a shark (D.W.S., unpublished), arguing that
fgf24 arose early in gnathostome (jawed vertebrate) evolution. It is
therefore likely that an fgf24 ortholog was lost at some point in the
terrestrial vertebrate lineage after its divergence from ray-finned fishes.
Similar examples of lineage-specific gene loss have already been described,
including the loss of functional copies of the hox paralogs
hoxb10, hoxc1 and hoxc3 in the mammalian lineage, but not in
zebrafish (Amores et al., 1998
;
Prince et al., 1998
;
Postlethwait et al.,
1998
).
Fgf8 and Fgf24 are components of the Fgf signaling pathway that is
required for posterior mesoderm development in zebrafish
Our results show that fgf8 and fgf24 are components of
the Fgf signaling pathway that regulates posterior mesoderm development in
zebrafish. We found that fgf8 and fgf24 are expressed in
mesodermal precursors and that
fgf8-;fgf24MO embryos produce very
little posterior mesoderm. Although the function of fgf8 and
fgf24 can account for much of the Fgf signaling activity that is
known to be required for posterior mesoderm development in zebrafish, we
observed that fgf8-;fgf24MO embryos
produce significantly more mesoderm than do embryos overexpressing the dnFgfr
(Griffin et al., 1995
).
Because the dnFgfr is likely to block all Fgf signaling in early embryos
(Ueno et al., 1992
), ligands
in addition to Fgf8 and Fgf24 are likely to contribute to early mesoderm
formation in zebrafish. In addition to fgf8 and fgf24, fgf3
is the only other Fgf gene in zebrafish that is known to be expressed in
mesodermal precursors during gastrulation
(Fürthauer et al., 2001
).
Although fgf3 may account for some of the Fgf activity present in
fgf8-;fgf24MO embryos, it is not
likely to account for all; injection of fgf3 MO
(Maves et al., 2002
) into
fgf8-;fgf24MO embryos does not appear
to decrease the amount of posterior mesoderm produced relative to
fgf8-;fgf24MO embryos alone (L. Maves
and B.W.D., unpublished).
We cannot rule out the possibility that the mesoderm produced by
fgf8-;fgf24 MO embryos is due to
residual activity of fgf8 and/or fgf24 in these embryos. The
single fgf8 allele that has been isolated,
fgf8ti282
(Reifers et al., 1998
), is
likely to be a hypomorph (Draper et el.,
2001
). However, using fgf8 MOs, which reduce the
expression of functional fgf8 below the level produced by the
fgf8 mutation (Draper et al.,
2001
), in combination with the fgf24 MO, does not appear
to increase the severity of the phenotype relative to the
fgf8-;fgf24MO embryos (B.W.D.,
unpublished). Similarly, it is possible that our fgf24 MO does not
completely eliminate fgf24 function, although our RNase protection
results argue against this. Last, fgf8
(Reifers et al., 1998
;
Draper et al., 2001
),
fgf24 and fgf18 (this study) are expressed maternally and
these maternal mRNAs persist for several hours after fertilization. It is
therefore possible that sufficient amounts of Fgf protein are produced from
wild-type maternal transcripts to allow partial mesoderm development in the
absence of zygotic fgf8 and fgf24 function. As only a few
orthologs of the known vertebrate Fgf ligands have been identified in
zebrafish, it remains to be seen how many other ligands participate in
posterior mesodermal development.
Fgf8 and Fgf24 maintain spt and ntl expression
during posterior development
Current models for how Fgfs and T-box genes interact during mesodermal
development have proposed that they form an auto-regulatory feedback loop,
where the function of one component maintains the expression of the other
(reviewed by Isaacs, 1997
).
Although it is not yet clear how Fgf signaling regulates T-box gene
expression, there is evidence in Xenopus that Xbra, the
ortholog of ntl, can directly regulate the expression of embryonic
(e)Fgf, an Fgf4 ortholog
(Casey et al., 1998
). This
model predicts that wild-type expression patterns of fgf8 and
fgf24 should require ntl and spt function, and
indeed we found this to be true. However, ntl and spt can
not be the only regulators of fgf8 and fgf24 expression
during early mesoderm formation, as expression of fgf8 and
fgf24 persist in the germ ring of early spt;ntl double
mutant embryos. In addition to spt and ntl, the
spt-related gene tbx6 is also expressed in mesodermal
precursors during gastrulation (Hug et
al., 1997
). tbx6 is unlikely to contribute to Fgf
regulation in the absence of spt and ntl function, however,
because it is not expressed in spt;ntl double mutants
(Griffin et al., 1998
).
The expression patterns we observed for fgf8 and fgf24 in wild-type embryos and in embryos mutant for either ntl or spt suggest that their expression in the germ ring is not regulated by an identical genetic network. First, the expression patterns of fgf8 and fgf24 in wild-type embryos, while overlapping, are not identical. We found that cells expressing the highest levels of fgf8 localize to the epiblast layer (similar to ntl), whereas those expressing the highest levels of fgf24 localize to the hypoblast layer (similar to spt). As might be expected from these expression patterns, expression of fgf8 and fgf24 also have non-identical requirements for ntl and spt function. However, we did not observe a simple one-to-one correlation between an Fgf expression domain and a T-box gene. Instead, we found that the expression of fgf8 in dorsal mesodermal precursors requires both ntl and spt function, while neither gene was required for fgf8 expression in ventral precursors. By contrast, expression of fgf24 in dorsal mesodermal precursors requires ntl, but not spt, whereas ventral expression requires spt, but not ntl. Although it is not possible at present to derive an accurate pathway that explains the regulatory relationships that exist between these Fgfs and T-box genes, our data are consistent with the proposed feedback loop because we have found that reduction of Fgf signaling leads to a reduction of T-box gene expression and vice versa.
fgf8 genetically interacts with ntl and
spt
Data supporting the model that posterior development is promoted by a
regulatory network between Fgfs and T-box genes has come largely from
analyzing gene expression defects in single mutant embryos (e.g.
Yamaguchi et al., 1994
;
Deng et al., 1994
;
Sun et al., 1999
) or in
embryos overexpressing single network components (e.g.
Isaacs et al., 1994
;
Schulte-Merker and Smith,
1995
). We have provided genetic evidence that directly links Fgf
signaling and T-box gene function in a genetic pathway that promotes posterior
development. We have shown that fgf8;ntl and spt;fgf8 double
mutants had phenotypes that were more severe than would be expected from the
simple addition of either single mutant phenotype. For example, neither
fgf8 nor ntl has severe defects in trunk somite formation,
as assayed by myod expression, whereas fgf8;ntl double
mutants produce few myod-positive cells. Because trunk somite
formation is known to require spt function cell-autonomously
(Ho and Kane, 1990
), we
propose that the muscle phenotype observed in fgf8;ntl embryos
results from attenuated spt function. Similarly, we found that
spt;fgf8 double mutant embryos appear to have attenuated ntl
function as notochord development was reduced in double mutant embryos, but
not in spt or fgf8 single mutant embryos. These results
indicate that fgf8 cooperates with ntl to maintain
spt function, and similarly with spt to maintain
ntl function.
It is interesting that the expression of pax2.1, which marks the
developing pronephric tubules (Krauss et
al., 1991
), is largely unaffected in either fgf8;ntl or
spt;fgf8 mutants. Pronephric tubules develop from intermediate
mesoderm and spt and ntl are redundantly required for their
formation (Amacher et al.,
2002
). It is possible that pronephric development requires lower
levels of T-box gene activity relative to that required for the development of
the notochord and somites. Alternatively, Fgf8 signaling may promote the
expression of dorsal-specific factors that function in combination with
ntl and spt to promote the development of dorsal mesodermal
derivatives, such as notochord and somites, but not the development of more
intermediate derivatives, such as pronephros. In support of this,
fgf8 is expressed at higher levels in dorsal mesoderm than ventral
mesoderm and fgf8 overexpression can strongly dorsalize early
zebrafish embryos (Fürthauer et al.,
1997
).
In addition to the interactions described above, we found that ntl
mutations dominantly enhance the phenotype of fgf8 homozygotes:
fgf8-/-;ntl+/- embryos produced less
posterior mesoderm than fgf8-/-;ntl+/+
embryos. Because ntl heterozygotes alone are phenotypically wild
type, this result suggests that ntl function is attenuated in
fgf8 single mutants, and consistent with this, we found that a third
of the fgf8 single mutants have reduced ntl expression in
axial mesoderm. These results imply that in the absence of fgf8
function, fgf24 function alone is not sufficient to maintain
wild-type levels of ntl activity. Interestingly, T null
mutations in mice, but not in zebrafish, are semi-dominant as
T+/- heterozygotes have shorter tails than do wild-type
mice (Dobrovolskaïa-Zavadskaïa,
1927
). Because wild-type expression of T in mouse
mesodermal precursors is known to be dependent on Fgf8 function
(Sun et al., 1999
), it is
possible that the apparent differences between the phenotypes of
T/ntl heterozygotes in mice and zebrafish are due simply to
differences in the quantitative levels of Fgf signaling in posterior tissue
between these two organisms. In contrast to dominant interactions between
ntl and fgf8, we could not find evidence that reduction of
spt function could dominantly enhance the phenotype of fgf8
mutant embryos, suggesting that the interactions between fgf8 and
ntl are stronger than those between fgf8 and spt.
Genetic interactions between the Fgf signaling pathway and T-box transcription
factors is becoming a common theme in vertebrate development, as similar
interactions have been proposed to play key roles in development of limbs
(Ng et al, 2002
) the
cardiovascular system (Vitelli et al.,
2002
) and lungs (Cebra-Thomas
et al., 2003
).
Fgf24 is required for pectoral fin development
Last, we have shown that fgf24 expression is not restricted to
developing posterior mesoderm, but is also expressed in a wide variety of
tissues during larval growth. However, the only defect we could identify in
fgf24MO embryos was in the development of
pectoral fins. We found that fgf24MO fish never
produced a morphological fin bud, nor did they produce any skeletal elements
of the external pectoral fin. Thus, the phenotype of fgf24 appears
similar to that of mice mutant for either fgf10
(Min et al., 1998
; Sekine et
al., 1998) or its likely receptor, Fgfr2
(Xu et al., 1998
).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
* Present address: Basic Sciences Division, Fred Hutchinson Cancer Research
Center, Seattle, WA 98109, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Amacher, S. L., Draper, B. W., Summers, B. R. and Kimmel, C.
B. (2002). The zebrafish T-box genes no tail and spadetail
are required for development of trunk and tail mesoderm and medial floor
plate. Development 129,3311
-3323.[Medline]
Amaya, E., Musci, T. J. and Kirschner, M. W.
(1991). Expression of a dominant negative mutant of the FGF
receptor disrupts mesoderm formation in Xenopus embryos.
Cell 66,257
-270.[CrossRef][Medline]
Amaya, E., Stein, P. A., Musci, T. J. and Kirschner, M. W.
(1993). FGF signaling in the early specification of mesoderm in
Xenopus. Development
118,477
-487.[Abstract]
Amemiya, C. T. and Zon, L. I. (1999).
Generation of a zebrafish P1 artificial chromosome library.
Genomics 58,211
-213.[CrossRef][Medline]
Amores, A., Force, A., Yan, Y. L., Joly, L., Amemiya, C., Fritz,
A., Ho, R. K., Langeland, J., Prince, V., Wang, Y. L. et al.
(1998). Zebrafish hox clusters and vertebrate genome evolution.
Science 282,1711
-1714.
Araki, I. and Brand, M. (2001).
Morpholino-induced knockdown of fgf8 efficiently phenocopies the
acerebellar (ace) phenotype. Genesis
30,157
-159.[CrossRef][Medline]
Casey, E. S., O'Reilly, J. M.-A., Conlon, F. L. and Smith, J.
C. (1998). The T-box transcription factor Brachyury regulates
expression of eFGF through binding to a non-palindromic response
element. Development
125,3887
-3894.[Abstract]
Cebra-Thomas, J. A., Bromer, J., Gardner, R., Lam, G. K.,
Sheipe, H. and Gilbert, S. F. (2003). T-box gene products are
required for mesenchymal induction of epithelial branching in the embryonic
mouse lung. Dev Dyn.
226, 82-90.[CrossRef][Medline]
Ciruna, B. G., Schwartz, L., Harpal, K., Yamaguchi, T. P. and
Rossant, J. (1997). Chimeric analysis of fibroblast growth
factor receptor-1 (Fgfr1) function: a role for FGFR1 in morphogenetic movement
through the primitive streak. Development
124,2829
-2841.[Abstract]
Ciruna, B. and Rossant, J. (2001). FGF
signaling regulates mesoderm cell fate specification and morphogenetic
movement at the primitive streak. Dev Cell.
1, 37-49.[CrossRef][Medline]
Conlon, F. L., Sedgwick, S. G., Weston, K. M. and Smith, J.
C. (1996). Inhibition of Xbra transcription activation causes
defects in mesodermal patterning and reveals autoregulation of Xbra in dorsal
mesoderm. Development
122,2427
-2435.[Abstract]
Crossley, P. H. and Martin, G. R. (1995). The
mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions
that direct outgrowth and patterning in the developing embryo.
Development 121,439
-451.[Abstract]
Cunliffe, V. and Smith, J. C. (1992). Ectopic
mesoderm formation in Xenopus embryos caused by widespread expression of a
Brachyury homologue. Nature
358,427
-430.[CrossRef][Medline]
Davis, R. L. and Kirschner, M. W. (2000). The
fate of cells in the tail bud of Xenopus laevis.
Development 127,255
-267.[Abstract]
Deng, C. X., Wynshaw-Boris, A., Shen, M. M., Daugherty, C.,
Ornitz, D. M. and Leder, P. (1994). Murine FGFR-1 is required
for early postimplantation growth and axial organization. Genes
Dev. 8,3045
-3057.
Dobrovolskaïa-Zavadskaïa, N. (1927).
Sur la mortification spontanée de la queue la souris nouveau-née
et sur l'existence d'un caractére (facteur) héréditaire
'non-viable'. C. R. Seanc. Soc. Biol.
97,114
-116.
Draper, B. W., Morcos, P. A. and Kimmel, C. B.
(2001). Inhibition of zebrafish fgf8 pre-mRNA splicing
with morpholino oligos: a quantifiable method for gene knockdown.
Genesis 30,154
-156.[CrossRef][Medline]
Drucker, B. J. and Goldfarb, M. (1993). Murine
FGF-4 gene expression is spatially restricted within embryonic skeletal muscle
and other tissues. Mech. Dev.
40,155
-163.[CrossRef][Medline]
Feldman, B., Poueymirou, W., Papaioannou, V. E., DeChiara, T. M.
and Goldfarb, M. (1995). Requirement of FGF-4 for
postimplantation mouse development. Science
267,246
-249.
Fischer, S., Draper, B. W. and Neumann C. J.
(2003). The zebrafish fgf24 mutant identifies an
additional level of Fgf signaling involved in vertebrate limb initiation
Development 130,3515
-3524.
Force, A., Lynch, M., Pickett, F. B., Amores, A., Yan, Y. L. and
Postlethwait, J. (1999). Preservation of duplicate genes by
complementary, degenerative mutations. Genetics
151,1531
-1545.
Furlong, R. F. and Holland, P. W. H. (2001).
Were vertebrates octoploid? Philos. Trans. R. Soc. Lond. B. Biol.
Sci. 357,531
-544.
Fürthauer, M., Thisse, C. and Thisse, B.
(1997). A role for FGF-8 in the dorsoventral patterning of the
zebrafish gastrula. Development
124,4253
-4264.[Abstract]
Fürthauer, M., Reifers, F., Brand, M., Thisse, B. and
Thisse, C. (2001). sprouty4 acts in vivo as a
feedback-induced antagonist of FGF signaling in zebrafish.
Development 128,2175
-2186.[Medline]
Geisler, R., Rauch, G. J., Baier, H., van Bebber, F., Brobeta,
L., Dekens, M. P., Finger, K., Fricke, C., Gates, M. A., Geiger, H. et al.
(1999). A radiation hybrid map of the zebrafish genome.
Nat. Genet. 23,86
-89.[CrossRef][Medline]
Grandel, H. and Schulte-Merker, S. (1998). The
development of the paired fins in the zebrafish (Danio rerio).
Mech. Dev. 79,99
-120.[CrossRef][Medline]
Griffin, K., Patient, R. and Holder, N. (1995).
Analysis of FGF function in normal and no tail zebrafish embryos reveals
separate mechanisms for formation of the trunk and the tail.
Development 121,2983
-2994.[Abstract]
Griffin, K. J., Amacher, S. L., Kimmel, C. B. and Kimelman,
D. (1998). Molecular identification of spadetail: regulation
of zebrafish trunk and tail mesoderm formation by T-box genes.
Development 125,3379
-3388.[Abstract]
Halpern, M. E., Ho, R. K., Walker, C. and Kimmel, C. B.
(1993). Induction of muscle pioneers and floor plate is
distinguished by the zebrafish no tail mutation. Cell
75, 99-111.[CrossRef][Medline]
Haub, O. and Goldfarb, M. (1991). Expression of
the fibroblast growth factor-5 gene in the mouse embryo.
Development 112,397
-406.[Abstract]
Hébert, J. M., Boyle, M. and Martin, G. R.
(1991). mRNA localization studies suggest that murine fibroblast
growth factor-5 plays a role in gastrulation.
Development 112,407
-415.[Abstract]
Hébert, J. M., Rosenquist, T., Götz, J. and Martin,
G. R. (1994). FGF5 as a regulator of the hair growth cycle:
evidence from targeted and spontaneous mutations. Cell
78,1017
-1025.[CrossRef][Medline]
Heikinheimo, M., Lawshe, A., Shackleford, G. M., Wilson, D. B.
and MacArthur, C. A. (1994). Fgf-8 expression in the
post-gastrulation mouse suggests roles in the development of the face, limbs
and central nervous system. Mech. Dev.
48,129
-138.[CrossRef][Medline]
Herrmann, B. G., Labeit, S., Poustka, A., King T. R. and
Lehrach, H. (1990). Cloning of the T gene required in
mesoderm formation in the mouse. Nature
343,617
-622.[CrossRef][Medline]
Ho, R. K. and Kane, D. A. (1990).
Cell-autonomus action of the zebrafish spt-1 mutation in specifying
mesodermal precursors. Nature
348,728
-730.[CrossRef][Medline]
Horb, M. E. and Thomsen, G. H. (1997). A
vegetally localized T-box transcription factor in Xenopus eggs
specifies mesoderm and endoderm and is essential for embryonic mesoderm
formation. Development
124,1689
-1698.[Abstract]
Hu, M. C.-T., Wang, Y. and Qiu, W. R. (1999).
Human fibroblast growth factor-18 stimulates fibroblast cell proliferation and
is mapped to chromosome 14p11. Oncogene
18,2635
-2642.[CrossRef][Medline]
Hug, B., Walter, V. and Grunwald, D. J. (1997).
tbx6, a Brachyury-related gene expressed by ventral mesendodermal precursors
in the zebrafish embryo. Dev. Biol.
183, 61-73.[CrossRef][Medline]
Isaacs, H. V. (1997). New perspectives on the
role of the fibroblast growth factor family in amphibian development.
Cell. Mol. Life Sci. 53,350
-361.[CrossRef][Medline]
Isaacs, H. V., Pownall, M. E. and Slack, J. M.
(1994). eFGF regulates Xbra expression during Xenopus
gastrulation. EMBO J.
13,4469
-4481.[Medline]
Kanki, J. P. and Ho, R. K. (1997). The
development of the posterior body in zebrafish.
Development 124,881
-893.[Abstract]
Kimmel, C. B., Kane, D. A., Walker, C., Warga, R. M. and
Rothman, M. B. (1989). A mutation that changes cell movement
and cell fate in the zebrafish embryo. Nature
337,358
-362.[CrossRef][Medline]
Kimmel, C. B., Warga, R. M. and Schilling, T. F.
(1990). Origin and organization of the zebrafish fate map.
Development 108,581
-594.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and
Schilling, T. F. (1995). Stages of embryonic development of
the zebrafish. Dev. Dyn.
203,253
-310.[Medline]
Krauss, S., Johansen, T., Korzh, V. and Fjose, A.
(1991). Expression of the zebrafish paired box gene pax[zf-b]
during early neurogenesis. Development
113,1193
-1206.[Abstract]
Krauss, S., Concordet, J. P. and Ingham, P. W.
(1993). A functionally conserved homolog of the Drosophila
segment polarity gene hh is expressed in tissues with polarizing activity in
zebrafish embryos. Cell
75,1431
-1444.[CrossRef][Medline]
Kwok, C., Korn, R. M., Davis, M. E., Burt, D. W., Critcher, R.,
McCarthy, L., Paw, B. H., Zon, L. I., Goodfellow, P. N. and Schmitt, K.
(1998). Characterization of whole genome radiation hybrid mapping
resources for non-mammalian vertebrates. Nucleic Acids
Res. 26,3562
-3566.
Lustig, K. D., Kroll, K. L., Sun, E. E. and Kirschner, M. W.
(1996). Expression cloning of a Xenopus T-related gene
(Xombi) involved in mesodermal patterning and blastopore lip
formation. Development
122,4001
-4012.[Abstract]
Mansour, S. L., Goddard, J. M. and Capecchi, M. R.
(1993). Mice homozygous for a targeted disruption of the
proto-oncogene int-2 have developmental defects in the tail and inner
ear. Development 117,13
-28.
Martin, G. R. (1998). The role of FGFs in the
early development of the vertebrate limb. Genes Dev.
12,1571
-1586.
Maves, L., Jackman, W. and Kimmel, C. B.
(2002). FGF3 and FGF8 mediate a rhombomere 4 signaling activity
in the zebrafish hindbrain. Development
29,3825
-3837.
Min, H., Danilenko, D. M., Scully, S. A., Bolon, B., Ring, B.
D., Tarpley, J. E., DeRose, M. and Simonet, W. S. (1998).
Fgf-10 is required for both limb and lung development and exhibits striking
functional similarity to Drosophila branchless. Genes
Dev. 12,3156
-3161.
Nasevicicius, A. and Ekker, S. C. (2000).
Effective targeted gene 'knockdown' in zebrafish. Nat.
Genet. 26,216
-220.[CrossRef][Medline]
Ng, J. K., Kawakami, Y., Buscher, D., Raya, A., Itoh, T., Koth,
C. M., Rodriguez Esteban, C., Rodriguez-Leon, J., Garrity, D. M., Fishman, M.
C. and Izpisua Belmonte, J. C. (2002). The limb identity gene
Tbx5 promotes limb initiation by interacting with Wnt2b and Fgf10.
Development 129,5161
-5170.[Medline]
Nielsen, H., Engelbrecht, J., Brunak, S. and von Heijne, G.
(1997). Identification of prokaryotic and eukaryotic signal
peptides and prediction of their cleavage sites. Prot.
Engineering 10,1
-6.[Medline]
Niswander, L. and Martin, G. R. (1992). Fgf-4
expression during gastrulation, myogenesis, limb and tooth development in the
mouse. Development 114,755
-768.[Abstract]
Ohbayashi, N., Hoshikawa, M., Kimura, S., Yamasaki, M., Fukui,
S. and Itoh, N. (1998). Structure and expression of the mRNA
encoding a novel fibroblast growth factor, FGF-18. J. Biol.
Chem. 273,18161
-18164.
Ohuchi, H., Yoshioka, H., Tanaka, A., Kawakami, Y., Nohno, T.
and Noji, S. (1994). Involvement of androgen-induced growth
factor (FGF-8) gene in mouse embryogenesis and morphogenesis.
Biochem. Biophys. Res. Commun.
204,882
-888.[CrossRef][Medline]
O'Reilly, M. A., Smith, J. C. and Cunliffe, V.
(1995). Patterning of the mesoderm in Xenopus:
dose-dependent and synergistic effects of Brachyury and
Pintallavis. Development
121,1351
-1359.[Abstract]
Ornitz, D. M. and Itoh, N. (2001). Fibroblast
growth factors. Genome Biol.
2, 2-12.
Oxtoby, E. and Jowett, T. (1993). Cloning of
the zebrafish krox-20 gene (krx-20) and its expression during hindbrain
development. Nucleic Acids Res.
21,1087
-1095.
Papaioannou, V. E. (2001). T-box genes in
development: from hydra to humans. Int. Rev. Cytol.
207, 1-70.[Medline]
Postlethwait, J. H, Yan, Y.-L., Gates, M. A., Horne, S., Amores,
A., Brownlie, A., Donovan, A., Egan, E. S., Force, A., Gong, Z. et al.
(1998). Vertebrate genome evolution and the zebrafish gene map.
Nat. Genet. 18,345
-349.[CrossRef][Medline]
Postlethwait, J. H., Woods, I. G., Ngo-Hazelett, P., Yan, Y. L.,
Kelly, P. D., Chu, F., Huang, H., Hill-Force, A. and Talbot, W.
(2000). Zebrafish comparative genomics and the origin of
vertebrate chromosomes. Genome Res.
10,1890
-1902.
Prince, V. E. (2002). The hox paradox: more
complex(es) than imagined. Dev. Biol.
249, 1-15.[CrossRef][Medline]
Prince, V. E., Joly, L., Ekker, M. and Ho, R. K.
(1998). Zebrafish hox genes: genomic organization and modified
colinear expression patterns in the trunk. Development
125,407
-420.[Abstract]
Reifers, F., Bohli, H., Walsh, E. C., Crossley, P. H., Stainier,
D. Y. and Brand, M. (1998). Fgf8 is mutated in zebrafish
acerebellar (ace) mutants and is required for maintenance of
midbrain-hindbrain boundary development and somitogenesis.
Development 125,2381
-2395.[Abstract]
Reifers, F., Adams, J., Mason, I. J., Schulte-Merker, S. and
Brand, M. (2000). Overlapping and distinct functions provided
by fgf17, a new zebrafish member of the Fgf8/17/18 subgroup of Fgfs.
Mech. Dev. 99,39
-49.[CrossRef][Medline]
Schulte-Merker, S., Ho, R. K., Herrmann, B. G. and
Nusslein-Volhard, C. (1992). The protein product of the
zebrafish homologue of the mouse T gene is expressed in nuclei of the
germ ring and the notochord of the early embryo.
Development 116,1021
-1032.[Abstract]
Schulte-Merker, S., van Eeden, F. J., Halpern, M. E., Kimmel, C.
B. and Nusslein-Volhard, C. (1994). no tail (ntl) is
the zebrafish homologue of the mouse T (Brachyury) gene.
Development 120,1009
-1015.[Abstract]
Schulte-Merker, S. and Smith, J. C. (1995).
Mesoderm formation in response to Brachyury requires FGF signalling.
Curr. Biol. 5,62
-67.[CrossRef][Medline]
Sekine, K., Ohuchi, H., Fujiwara, M., Yamasaki, M., Yoshizawa,
T., Sato, T., Yagishita, N., Matsui, D., Koga, Y., Itoh, N. and Kato, S.
(1999). Fgf10 is essential for limb and lung formation.
Nat. Genet. 21,138
-141.[CrossRef][Medline]
Smith, J. (1999). T-box genes: what they do and
how they do it. Trends Genet.
15,154
-158.[CrossRef][Medline]
Smith, J. C., Price, B. M. J., Green, J. B. A., Weigel, D. and
Herrmann, B. G. (1991). Expression of a Xenopus
homolog of Brachyury (T) is an immediate-early response to mesoderm
induction. Cell 67,79
-87.[CrossRef][Medline]
Stennard, F., Carnac, G., and Gurdon, J. B.
(1996). The Xenopus T-box gene, Antipodean,
encodes a vegetally localised maternal mRNA and can trigger mesoderm
formation. Development
122,4179
-4188.[Abstract]
Sun, X., Meyers, E. N., Lewandoski, M. and Martin, G. R.
(1999). Targeted disruption of Fgf8 causes failure of cell
migration in the gastrulating mouse embryo. Genes Dev.
13,1834
-1846.
Ueno, H., Gunn, M., Dell, K., Tseng, A. and Williams, L. T.
(1992). A truncated form of fibroblast growth factor receptor 1
inhibits signal transduction by multiple types of fibroblast growth factor
receptors. J. Biol. Chem.
267,1470
-1476.
Vitelli, F., Taddei, I., Morishima, M., Meyers, E. N., Lindsay,
E. A. and Baldini, A. (2002). A genetic link between Tbx1 and
fibroblast growth factor signaling. Development
129,4605
-4611.
Wall, N. A. and Hogan, B. L. M. (1995).
Expression of bone morphogenetic protein-4 (BMP-4), bone morphogenetic protein
7 (BMP-7), fibroblast growth factor-8 (FGF-8) and sonic hedgehog (SHH) during
branchial arch development in the chick. Mech. Dev.
53,383
-392.[CrossRef][Medline]
Warga, R. M. and Kimmel, C. B. (1990). Cell
movements during epiboly and gastrulation in zebrafish.
Development 108,569
-580.
Warga, R. M. and Nusslein-Volhard, C. (1999).
Origin and development of the zebrafish endoderm.
Development 126,827
-838.[Abstract]
Weinberg, E. S., Allende, M. L., Kelly, C. S., Abdelhamid, A.,
Murakami, T., Andermann, P., Doerre, O. G., Grunwald, D. J. and Riggleman,
B. (1996). Developmental regulation of zebrafish MyoD in
wild-type, no tail and spadetail embryos.
Development 122,271
-280.[Abstract]
Westerfield, M. (1995). The
Zebrafish Book. University of Oregon; Eugene, OR.
Whitlock, K. E. and Westerfield, M. (2000). The
olfactory placodes of the zebrafish form by convergence of cellular fields at
the edge of the neural plate. Development
127,3645
-3653.[Abstract]
Whitmore, T. E., Maurer, M. F., Sexson, S., Raymond, F.,
Conklin, D. and Deisher, T. A. (2000). Assignment of
fibroblast growth factor 18 (FGF18) to human chromosome 5q34 by use of
radiation hybrid mapping and fluorescence in situ hybridization.
Cytogenet Cell Genet.
90,231
-233.[CrossRef][Medline]
Wilkinson, D. G., Peters, G., Dickson, C. and McMahon, A.
(1988). Expression of the FGF-related proto-oncogene
int-2 during gastrulation ans neurulation in the mouse.
EMBO J. 7,691
-695.[Medline]
Woods, I. G., Kelly, P. D., Chu, F., Ngo-Hazelett, P., Yan,
Y.-L., Huang, H., Postlethwait, J. H. and Talbot, W. S.
(2000). A comparative map of the zebrafish genome.
Genome Res. 10,1903
-1914.
Xu, J., Liu, Z. and Ornitz, D. M. (2000).
Temporal and spatial gradient of Fgf8 and Fgf17 regulate
proliferation and differentiation of midline cerebellar structures.
Development 127,1833
-1843.[Abstract]
Xu, X., Weinstein, M., Li, C., Naski, M., Cohen, R. I., Ornitz,
D. M., Leder, P. and Deng, C. (1998). Fibroblast growth
factor receptor 2 (FGFR2)-mediated reciprocal regulation loop between FGF8 and
FGF10 is essential for limb induction. Development
125,753
-765.[Abstract]
Yamaguchi, T. P., Harpal, K., Henkemeyer, M. and Rossant, J.
(1994). fgfr-1 is required for embryonic growth and
mesodermal patterning during mouse gastrulation. Genes
Dev. 8,3032
-3044.
Zhang, J. and King, M. L. (1996). Xenopus
VegT RNA is localized to the vegetal cortex during oogenesis and encodes
a novel T-box transcription factor involved in mesodermal patterning.
Development 122,4119
-4129.[Abstract]
Zhang, J., Houston, D. W., King, M. L., Payne, C., Wylie, C. and
Heasman, J. (1998). The role of maternal VegT in establishing
the primary germ layers in Xenopus embryos.
Cell 94,515
-524.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
M. Zhu and X. Yu Stem sarcopterygians have primitive polybasal fin articulation Biol Lett, June 23, 2009; 5(3): 372 - 375. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Morley, K. Lachani, D. Keefe, M. J. Gilchrist, P. Flicek, J. C. Smith, and F. C. Wardle A gene regulatory network directed by zebrafish No tail accounts for its roles in mesoderm formation PNAS, March 10, 2009; 106(10): 3829 - 3834. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ochi, S. Hans, and M. Westerfield Smarcd3 Regulates the Timing of Zebrafish Myogenesis Onset J. Biol. Chem., February 8, 2008; 283(6): 3529 - 3536. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Manfroid, F. Delporte, A. Baudhuin, P. Motte, C. J. Neumann, M. L. Voz, J. A. Martial, and B. Peers Reciprocal endoderm-mesoderm interactions mediated by fgf24 and fgf10 govern pancreas development Development, November 15, 2007; 134(22): 4011 - 4021. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Skromne, D. Thorsen, M. Hale, V. E. Prince, and R. K. Ho Repression of the hindbrain developmental program by Cdx factors is required for the specification of the vertebrate spinal cord Development, June 1, 2007; 134(11): 2147 - 2158. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Patterson, M. Gering, C. E. Eckfeldt, A. R. Green, C. M. Verfaillie, S. C. Ekker, and R. Patient The transcription factors Scl and Lmo2 act together during development of the hemangioblast in zebrafish Blood, March 15, 2007; 109(6): 2389 - 2398. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Kim, I-H. Liu, Y. Song, J.-A. Lee, W. Halfter, R. J. Balice-Gordon, E. Linney, and G. J. Cole Agrin is required for posterior development and motor axon outgrowth and branching in embryonic zebrafish Glycobiology, February 1, 2007; 17(2): 231 - 247. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Aggarwal, J. Liao, A. Bondarev, T. Schimmang, M. Lewandoski, J. Locker, A. Shanske, M. Campione, and B. E. Morrow Dissection of Tbx1 and Fgf interactions in mouse models of 22q11DS suggests functional redundancy Hum. Mol. Genet., November 1, 2006; 15(21): 3219 - 3228. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Maegawa, M. Varga, and E. S. Weinberg FGF signaling is required for {beta}-catenin-mediated induction of the zebrafish organizer Development, August 15, 2006; 133(16): 3265 - 3276. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mercader, S. Fischer, and C. J. Neumann Prdm1 acts downstream of a sequential RA, Wnt and Fgf signaling cascade during zebrafish forelimb induction Development, August 1, 2006; 133(15): 2805 - 2815. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Holley Anterior-posterior differences in vertebrate segments: specification of trunk and tail somites in the zebrafish blastula Genes & Dev., July 15, 2006; 20(14): 1831 - 1837. [Full Text] [PDF] |
||||
![]() |
D. P. Szeto and D. Kimelman The regulation of mesodermal progenitor cell commitment to somitogenesis subdivides the zebrafish body musculature into distinct domains Genes & Dev., July 15, 2006; 20(14): 1923 - 1932. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Poulain, M. Furthauer, B. Thisse, C. Thisse, and T. Lepage Zebrafish endoderm formation is regulated by combinatorial Nodal, FGF and BMP signalling Development, June 1, 2006; 133(11): 2189 - 2200. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Fletcher, J. C. Baker, and R. M. Harland FGF8 spliceforms mediate early mesoderm and posterior neural tissue formation in Xenopus Development, May 1, 2006; 133(9): 1703 - 1714. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Harvey and M. P. O. Logan sall4 acts downstream of tbx5 and is required for pectoral fin outgrowth. Development, March 1, 2006; 133(6): 1165 - 1173. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Lee, S. Grill, A. Sanchez, M. Murphy-Ryan, and K. D. Poss Fgf signaling instructs position-dependent growth rate during zebrafish fin regeneration Development, December 1, 2005; 132(23): 5173 - 5183. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. H. J. Norton, J. Ledin, H. Grandel, and C. J. Neumann HSPG synthesis by zebrafish Ext2 and Extl3 is required for Fgf10 signalling during limb development Development, November 15, 2005; 132(22): 4963 - 4973. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Picker and M. Brand Fgf signals from a novel signaling center determine axial patterning of the prospective neural retina Development, November 15, 2005; 132(22): 4951 - 4962. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Groves, C. L. Hammond, and S. M. Hughes Fgf8 drives myogenic progression of a novel lateral fast muscle fibre population in zebrafish Development, October 1, 2005; 132(19): 4211 - 4222. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Delfino-Machin, J. S. Lunn, D. N. Breitkreuz, J. Akai, and K. G. Storey Specification and maintenance of the spinal cord stem zone Development, October 1, 2005; 132(19): 4273 - 4283. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nechiporuk, T. Linbo, and D. W. Raible Endoderm-derived Fgf3 is necessary and sufficient for inducing neurogenesis in the epibranchial placodes in zebrafish Development, August 15, 2005; 132(16): 3717 - 3730. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shimada, T. Ishii, T. Imada, K. Takaba, Y. Sasaki, K. Maruyama-Takahashi, Y. Maekawa-Tokuda, H. Kusaka, S. Akinaga, A. Tanaka, et al. A Neutralizing Anti-Fibroblast Growth Factor 8 Monoclonal Antibody Shows Potent Antitumor Activity against Androgen-Dependent Mouse Mammary Tumors In vivo Clin. Cancer Res., May 15, 2005; 11(10): 3897 - 3904. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zakin, B. Reversade, H. Kuroda, K. M. Lyons, and E. M. De Robertis Sirenomelia in Bmp7 and Tsg compound mutant mice: requirement for Bmp signaling in the development of ventral posterior mesoderm Development, May 15, 2005; 132(10): 2489 - 2499. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Patterson, M. Gering, and R. Patient Scl is required for dorsal aorta as well as blood formation in zebrafish embryos Blood, May 1, 2005; 105(9): 3502 - 3511. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Thorpe, G. Weidinger, and R. T. Moon Wnt/{beta}-catenin regulation of the Sp1-related transcription factor sp5l promotes tail development in zebrafish Development, April 15, 2005; 132(8): 1763 - 1772. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rhinn, K. Lun, M. Luz, M. Werner, and M. Brand Positioning of the midbrain-hindbrain boundary organizer through global posteriorization of the neuroectoderm mediated by Wnt8 signaling Development, March 15, 2005; 132(6): 1261 - 1272. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Bottcher and C. Niehrs Fibroblast Growth Factor Signaling during Early Vertebrate Development Endocr. Rev., February 1, 2005; 26(1): 63 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kudoh, M. L. Concha, C. Houart, I. B. Dawid, and S. W. Wilson Combinatorial Fgf and Bmp signalling patterns the gastrula ectoderm into prospective neural and epidermal domains Development, August 1, 2004; 131(15): 3581 - 3592. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Szeto and D. Kimelman Combinatorial gene regulation by Bmp and Wnt in zebrafish posterior mesoderm formation Development, August 1, 2004; 131(15): 3751 - 3760. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tsang, S. Maegawa, A. Kiang, R. Habas, E. Weinberg, and I. B. Dawid A role for MKP3 in axial patterning of the zebrafish embryo Development, June 15, 2004; 131(12): 2769 - 2779. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Furthauer, J. Van Celst, C. Thisse, and B. Thisse Fgf signalling controls the dorsoventral patterning of the zebrafish embryo Development, June 15, 2004; 131(12): 2853 - 2864. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Stathopoulos, B. Tam, M. Ronshaugen, M. Frasch, and M. Levine pyramus and thisbe: FGF genes that pattern the mesoderm of Drosophila embryos Genes & Dev., March 15, 2004; 18(6): 687 - 699. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||