|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 18, 2003
doi: 10.1242/10.1242/dev.00684
Department of Genetics, Cell Biology and Development, Howard Hughes Medical Institute, University of Minnesota, Minneapolis, MN 55455, USA
* Author for correspondence (e-mail: moconnor{at}mail.med.umn.edu)
Accepted 23 June 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Tld, Dpp, Morphogen, Bmp
| Introduction |
|---|
|
|
|---|
Among the Drosophila zygotic genes, dpp is thought to
play a pivotal role because, in its absence, all dorsal cells assume ventral
lateral fates (Arora and Nusslein-Volhard,
1992
). When the expression levels of dpp are manipulated
by either genetic or physical means, tissue fate along the DV axis is assigned
in a dose-dependent manner consistent with Dpp acting as a morphogen
(Ferguson and Anderson, 1992
;
Wharton et al., 1993
). Thus,
high levels of Dpp specify the dorsalmost amnioserosa, while lower levels
instruct development of dorsal ectoderm.
The formation of the Dpp gradient appears to come about through a
post-transcriptional/translational mechanism that involves a dynamic interplay
of Dpp with the products of the other zygotic DV gene family members. A key
component in this process is Sog (Biehs et
al., 1996
), which is related to vertebrate chordin and contains
four cysteine rich (CR) domains. For chordin these CR domains mediate binding
to Bmp ligands, and when Bmps are bound to Chordin, they are unable to bind to
and activate receptors (Piccolo et al.,
1996
). As Sog is produced by ventral lateral cells that abut the
Dpp expression domain, graded Dpp activity is thought to arise by diffusion of
Sog from its ventrolateral site of synthesis into the dorsal domain
(Biehs et al., 1996
). This
produces a gradient in which lateral regions contain relatively high levels of
Sog while dorsal regions have low levels. The net effect of the lateral-high
to dorsal-low Sog gradient is production of an inverse Dpp activity gradient
where lateral cells experience low levels of Dpp, while dorsal cells see the
highest levels. The recent direct visualization of the Sog gradient in
Drosophila blastoderm embryos is consistent with this model
(Srinivasan et al., 2002
).
Genetic and biochemical experiments suggest that Sog does not act alone to
produce the Dpp activity gradient. Both Sog and vertebrate chordin form
tripartite complexes with Bmp ligands and Tsg proteins
(Oelgeschlager et al., 2000
;
Chang et al., 2001
;
Ross et al., 2001
;
Scott et al., 2001
). In
Drosophila, Tsg appears to be necessary for strong binding of Sog to
Dpp (Ross et al., 2001
), while
in vertebrates, chordin alone can bind Bmp4 but its binding is significantly
enhanced by Tsg protein (Piccolo et al.,
1996
; Oelgeschlager et al.,
2000
; Larrain et al.,
2001
). The complex of Sog and Tsg is a much stronger inhibitor of
Dpp signaling in Drosophila than either is alone, and the same
appears to be true for the zebrafish counterparts
(Ross et al., 2001
). In frogs,
however, the ratio of Tsg and chordin is crucial for determining the
phenotypic outcome (Larrain et al.,
2001
; Ross et al.,
2001
). At low concentrations, Tsg enhances the inhibitory action
of chordin, whereas at high concentrations it blocks chordin action. This
effect has recently been shown to be the result of enhanced degradation of
chordin in the presence of high levels of Tsg
(Larrain et al., 2001
).
One mechanism that contributes to the degradation of chordin and Sog is
proteolytic processing by members of the Tld family of metalloproteases. This
cleavage results in the liberation of the Bmp ligand such that it is then free
to bind and activate receptor. A major distinction between the vertebrate
system and Drosophila is that cleavage of Sog by Tld is dramatically
stimulated by the presence of ligand in Drosophila, while, to date,
this has not been found to be the case for the vertebrate homologs
(Marques et al., 1997
). This
biochemical difference may be the key to explaining one of the unusual aspects
of the Drosophila system which is that Sog and Tsg do not act as
simple inhibitors to produce a monotonic gradient of Dpp activity. Instead,
both are required to generate a peak of Dpp activity in the dorsalmost 8-10
cells that form the amnioserosa. This activity peak is inferred by high level
nuclear accumulation of the phosphorylated form of Mad, the primary transducer
of the Dpp signal, in dorsal midline cells
(Dorfman and Shilo, 2001
;
Ross et al., 2001
). Thus, the
Dpp activity gradient is not smooth but instead assumes the shape of a step
function with a very sharp transition between cells receiving high and very
low signals. In sog or tsg mutant embryos, this sharp
transition does not take place, and instead all dorsal cells receive a
moderate level of Dpp signal and do not form amnioserosa
(Ross et al., 2001
). One model
that explains this dichotomy is that Sog and Tsg not only block Dpp signaling
laterally, but also help promote its diffusion, through a cyclic binding and
cleavage process, from dorsal lateral cells to the dorsal midline
(Holley et al., 1995
;
Marques et al., 1997
;
Decotto and Ferguson, 2001
).
According to this model, in the absence of Sog and Tsg, Dpp is not free to
diffuse within the dorsal domain as receptor binding would trap it. However,
in the presence of Sog and Tsg, Dpp is unable to bind its receptor and could
diffuse. The net diffusion of Sog from ventrolateral cells would carry Dpp
towards the dorsal side until Tld processes the complex. At the time of
processing, the Dpp could either be recaptured by Sog and Tsg, or could bind
to its receptor. In dorsolateral regions where the Sog concentration is high,
Dpp would be more likely to be recaptured by a second Tsg-Sog complex, further
promoting its diffusion. This model has recently received mathematical as well
as additional genetic support (Eldar et
al., 2002
).
Despite the appeal of the transport model, several issues remain to be tested. In particular, this model requires that the rate of Sog cleavage by Tld must be such that it can keep up with the net flux of Sog to establish a sharp transition zone between bound and unbound Dpp. How is this transition zone established? A second issue that needs to be examined is whether the tsg mutant phenotype could potentially be explained by another model in which the presence of Tsg, in addition to promoting Sog binding to Dpp, also reduces the kinetics of Sog cleavage. Accordingly, the similarity in the tsg and sog loss-of-function phenotypes is brought about Tld overdigesting Sog in the absence of Tsg.
We examine in more detail the biochemical and genetic interplay between Sog, Tsg and Dpp. Using double mutants, we find that Tld function is epistatic to Tsg, suggesting that Tsg does not act to downregulate Tld activity. Instead, in vitro biochemical data suggest that Tsg actually enhances the rate of Sog processing at low Dpp concentrations. Furthermore, using proteolysis assays coupled with a cell-based signaling system, we find that both signaling and processing exhibit similar Dpp concentration sensitivities. This suggests that the cell culture model is physiologically relevant to the in vivo situation. We find that within a 10-fold Dpp concentration ranging from 10-10 to 10-9 M, both signaling and cleavage vary from background to maximum levels. We suggest that this steep Dpp concentration dependence is key to the Dpp transport process in that it provides a positive and negative reinforcement loop that contributes to the formation of a sharp transition zone in the early embryo between cells receiving Dpp signal and those that do not. In this view, as Sog diffusion helps redistribute Dpp from lateral regions to the dorsal side, the rate of Sog cleavage in lateral regions declines resulting in a further increase in Sog concentration and greater inhibition. Simultaneously, as the Dpp concentration rises within the dorsal cells, the rate of Sog cleavage increases and thereby further reduces Sog concentration in these cells enhancing signaling. In this way a sharp signaling transition zone is established. These data also suggest that Tsg acts to sensitize Sog binding and cleavage to low levels of Dpp. This reinforces the robustness of the sharp signaling transition zones that are predicted to occur in the embryo as a result of Dpp transport by the combined action of Tsg, Sog and Tld.
| Materials and methods |
|---|
|
|
|---|
In situ hybridization
In situ hybridization to whole-mount embryos was performed with
digoxigenin-labeled RNA probes and visualized with alkaline phosphatase
precipitates as previously described
(Nguyen et al., 1994
).
Production of recombinant proteins and antibodies
Drosophila S2 cells were used for producing recombinant proteins
as described previously (Yu et al.,
2000
; Ross et al.,
2001
). For antigen production GST-Sog CR1 [GST-Sog
(E86-E275)] fusion proteins were expressed in E.
coli BL21 cells, and inclusion bodies were recovered using 50 mM Tris
HCl, pH 7.4, 150 mM NaCl and 6 M Urea. The solubilized fraction was mixed with
an equal volume of complete adjuvant solution and injected into the rabbits
subcutaneously. After five injections, the collected serum was precipitated
with 50% saturated ammonium sulfate. Affinity purified serum was derived by
applying the PBS dialysate to Actigel ALD (Sterogene Bioseparations) beads
coupled to GST-Sog (E86-E275). The beads were washed and
eluted according to vendor recommendations.
Immunoblotting
Protein samples were heated at 80°C for 10 minutes and electrophoresed
on 4-12% gradient NuPAGE gels (Invitrogen) or 10% SDS-PAGE gels, and
transferred to a PVDF membrane (Millipore). Blots were pre-incubated with 5%
skim milk to block non-specific binding and incubated with the following
primary antibodies: anti-HA 12CA5 (Roche), anti-Myc A14 (Santa Cruz),
anti-Flag M2 (Sigma), anti-Sog-CR1 or anti-phosphoMad (1:5000 courtesy of P.
ten Dijike). The blots were then incubated with the following secondary
antibodies: HRP-conjugated goat anti-rabbit IgG for anti-Myc, anti-Sog-CR1 and
anti-phosphomad antibodies, or HRP-conjugated goat anti-mouse IgG for anti-HA
and anti-Flag antibodies (Jackson Immuno Research Laboratories) and developed
using Super Signal (Pierce).
Cell based signaling assay and RNA interference
A cell based assay for Dpp signaling was described previously
(Ross et al., 2001
). Briefly,
purified Dpp protein (R&D systems) was pre-incubated with various
combinations of Tld, Sog and Tsg for 6 hours at room temperature. After
pre-incubation, the mix of proteins was incubated with flag-mad
transfected S2 cells for another 3 hours. Samples were then analyzed for Sog
cleavage and P-Mad levels by western blots.
For RNA interference, PCR primers for the receptors were designed that carrying the 19 base T7 promoter sequence at the 5' end. The sequences of the primer are as follows: TAATACGACTCACTATAGGGAAAGCACATCGGCAGCAGAG and TAATACGACTCACTATAGGGATCAGCATAAACACGGACAGGG for Tkv; TAATACGACTCACTATAGGGACTCAATGGCAAGGAGCTACCG and TAATACGACTCACTATAGGGACGAGCCCAGTGGATAGTAGTG for Sax; and TAATACGACTCACTATAGGGAGAGACAACGGGCATCCTGCGC and TAATACGACTCACTATAGGGAGCCGCAGGGCTTGCCTGGCTG for Punt. PCR products carrying T7 promoter sequences at both ends were used as templates. In vitro transcribed RNA was produced using the MEGAscript kit (Ambion). The reaction products were annealed to produce double stranded RNA by incubating the products at 65°C for 15 minutes followed by an additional incubation at 37°C for 30 minutes. RNAi treatment was carried out by transfections of 1 µg of flag-mad plasmid with or without 10 µg of dsRNA into S2 cells. Cells were transfected at a density of 2x106 cells per well of a 12-well plate. After 3 days of transfection, the cells were divided into two fractions. One was used for a Dpp signaling assay by incubating with 10-9 M of Dpp for 3 hours at 25°C, and the extracts of the cells were used to detect the phosphomad levels by western blotting. The other half of the sample was used for RT-PCR. RNA was extracted with TRIzol (Invitrogen) and cDNA synthesis was performed using oligo-dT primer in Thermoscript RT-PCR system (Invitrogen). PCR was carried out using cDNA as a template, and the primers are as follows: CTTTGGCTCCATCATCATCTCC and TTCCGAAAATCTCGTCGTGC for Tkv; CCGGATCAACTGCCCATGATC and CATGTCAGAGCCGATGAATCC for Sax; CCACGGCAGGGAAACATTCAC and GGTCTTTGATGCCGGGATCTC for Punt; CTGGCACCACACCTTCTACAATG and GCTTCTCCTTGATGTCACGGAC for Actin as a control.
In vitro cleavage assays
Mixtures of purified Sog-Myc and Tld-HA were incubated with the indicated
amounts of Dpp and Tsg-His for the indicated times at 25°C in the presence
of 1x reaction buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2.5 mM
CaCl2, 1 mM MgCl2, 1 µM ZnCl2 and 1x
completeTM, EDTA-free protease inhibitor cocktail, Roche). Reaction
products were analyzed by immunoblotting using anti-Sog-CR1 or anti-Myc
antibody.
| Results |
|---|
|
|
|---|
|
|
20 kDa) is barely detectable using the CR1
antibody, although we can detect it using an N-terminal HA tagged form of Sog
(data not shown). Interestingly, we see accumulation of substantial amounts of
N-terminal fragments corresponding to processing at sites II and III,
indicating that once processed at these sites, further cleavage at site I is
relatively slow. These fragments should contain the N-terminal CR1 repeat and
regions of the spacer region and are therefore very similar in structure to
the Supersog-like molecules reported by Yu et al.
(Yu et al., 2000
|
|
|
We also examined if Tsg affected the rate of Sog cleavage by Tld. To examine this issue, time course experiments were carried out. When Sog was incubated with Tld in the presence of high concentrations of Dpp (10-8 M), cleaved fragments were detected at 15 minutes and the cleavage pattern showed the same time dependency with or without Tsg (data not shown). However, when Sog was incubated with Tld in the presence of 3x10-10 M of Dpp, then cleavage fragments are produced very slowly and are just barely detectable after four hours of incubation (Fig. 6A). By contrast, processing was detected in as little at 15 minutes in the presence of Tsg (Fig. 6B). These results demonstrate that the rate of Sog processing is dependent on the Dpp concentration and that Tsg sensitizes the processing of Sog to lower Dpp concentrations.
|
|
| Discussion |
|---|
|
|
|---|
In order for the transport model to produce a Dpp concentration peak, the
proper balance between binding affinities, diffusion rates and proteolytic
processing is needed (see Eldar et al.,
2002
). Tsg has been suggested to have several activities that
could influence this balance. In one model, Tsg would act to slow down the
intrinsic rate of Sog cleavage by Tld. In this case, loss of Tsg is predicted
to result in elevated processing of Sog. This should produce a sog
loss-of-function phenotype, as is observed when molecular markers are examined
(Yu et al., 2000
;
Ross et al., 2001
). In this
report, we present data that argues strongly against this possibility. First,
we demonstrate that Tsg function is epistatic to Tld. If the tsg
mutant phenotype was caused by excess Tld activity, then eliminating Tld
should produce a tld loss-of-function phenotype. However, we observe
a tsg-like phenotype where there is a general lowering and flattening
of the Dpp activity gradient, as assayed by marker gene expression. In
addition, biochemical studies reveal that Tsg actually enhances the ability of
Tld to cleave Sog. Taken together, we conclude that Tsg does not function
during DV patterning to retard Tld proteolytic activity.
A second property that has been attributed to Tsg is that it alters the
selection of Tld cleavage sites in Sog thereby producing novel Sog fragments
with unique properties (Yu et al.,
2000
). In particular, a Sog fragment termed Supersog containing
the first CR domain and a region of the spacer between CR1 and CR2 appeared to
be produced in vitro by the action of Tsg and Tld. Although we continue to see
the production of Supersog-like fragments under our present reaction
conditions, we do not see any enhancement in their production upon Tsg
addition. This may reflect loss of an unidentified component during
purification or differences in the sensitivities of the CR1 antibodies used in
the two studies. These issues are presently under examination. Whether
Supersog-type molecules contribute to DV patterning in vivo is unclear. The
fact that overexpression of Supersog can partially rescue tsg mutant
embryos suggests that they could be important. A full resolution of the role
of Supersog will need to await the results of in vivo rescue experiments
employing mutants of the different Sog cleavage sites, especially those that
lead to the production of Supersog-like fragments.
Tsg sensitizes the DV patterning system to low levels of Dpp
One of the primary findings in this report is that the rate of Sog cleavage
is very sensitive to the level of the Dpp protein and varies substantially
over a 10-fold range. Interestingly, this is the same Dpp concentration range
within which low to maximal signaling occurs in S2 cell culture. We find that
Tsg sensitizes the system such that both the binding of Dpp to Sog as well as
the rate of cleavage of Sog by Tld is stimulated by Tsg protein. Because in
the invertebrate system, the binding of ligand to Sog is required for
efficient processing of Sog, it is not surprising that the rate of Sog
processing goes up in the presence of Tsg. This follows because, at a given
concentration of Sog and Dpp, more complex will be formed in the presence of
Tsg leading to a higher substrate concentration for the Tld protease. We
speculate that this system evolved in part to enable the embryo to produce a
patterning mechanism that functions within the context of a very short
developmental window. In Drosophila, the time between initial
transcription of dpp during the early blastoderm stage and assignment
of fate required for proper gastrulation is only about 40 minutes. In this
short time-window, Dpp concentration must reach an effective signaling level.
However, using a genomic Dpp-HA construct, we have been able to visualize Dpp
in the early embryo and it is present at much lower levels than in other
tissues, such as the epidermis, at later stages of embryogenesis (O.S. and
M.B.O'C., unpublished). We propose that under these conditions of low Dpp
concentration, the presence of Tsg is required to enable Sog to bind to Dpp
and to stimulate Sog cleavage in order to create a cyclic binding and release
process that enables Dpp to be carried towards the dorsal midline.
Furthermore, we propose that the intrinsic sensitivity of the cleavage
reaction to the Dpp concentration is crucial for formation of a sharp
signaling boundary. Thus, as illustrated in
Fig. 8, as the Dpp
concentration drops in the lateral regions as a consequence of Dpp movement
towards the dorsal side, the rate of Sog cleavage drops allowing more Sog to
enter this region further reducing signaling in lateral regions. The movement
of Dpp will simultaneously raise Dpp concentration in the dorsal region
further stimulating cleavage and clearance of Sog and thereby reinforcing Dpp
signaling at the dorsal midline. This built-in positive and negative
reinforcement mechanism should help establish sharp signaling boundaries by
formation of steep ligand gradients, instead of the more gradual gradients
that would form if Sog cleavage was not sensitive to the Dpp
concentration.
|
The second major difference between the Drosophila and
Xenopus systems is that in Drosophila processing of Sog is
dependant on prior binding of Sog to Dpp, while in Xenopus this is
not the case. Rather, Chordin cleavage by Xolloid appears to be constitutive
and is not enhanced by any tested ligand
(Piccolo et al., 1997
).
Without ligand dependent cleavage, net movement of Bmps by Chordin diffusion
may not readily occur nor would there be a mechanism to both positively and
negatively reinforce the processing reaction. Indeed, recent studies have
demonstrated that in the Drosophila embryo, Chordin does not have the
ability to promote Dpp signaling at a distance, whereas Sog does
(Decotto and Ferguson, 2001
).
As a result, spatially enhanced Bmp concentrations and sharp signaling
boundaries that result from net ligand movement by the activities of the
Chordin, Xolloid and Tsg proteins may not occur in Xenopus. In fact
there is no evidence in Xenopus that loss of Chordin activity
actually results in a reduction in Bmp signaling in select regions of the
embryo as occurs in Drosophila.
Despite these differences, Tsg may, nevertheless, play both positive and
negative roles in modulating Bmp signaling; however, its mechanism is somewhat
different. As processed fragments of Chordin still have reasonable affinity
for ligand, they may need to be dislodged to allow for signaling. Tsg binding
to Bmps appears to help promote this dislodgment and their ultimate
degradation (Oelgeschlager et al.,
2000
; Larrain et al.,
2001
). In Drosophila, as Sog binds poorly to ligand in
the absence of Tsg there is no need for Tsg to help promote dissociation of
Sog fragments. Rather, it is its ability to help promote association of Sog
with Dpp that is key to understanding its function. Tsg appears also to alter
the rate of chordin proteolysis (Larrain
et al., 2001
). Thus, at a high Tsg-to-chordin ratio, Chordin may
be degraded and in this way Tsg might help promote signaling
(Ross et al., 2001
;
Larrain et al., 2001
). It is
possible that some combination of these properties is used in other
vertebrates. For example, in zebrafish it has recently been shown that loss of
chordin can enhance a phenotype that results from haplo-insufficiency
for swirl a gene that encodes Bmp2b
(Wagner and Mullins, 2002
).
This paradoxical observation, that loss of an inhibitor exacerbates a
phenotype resulting from loss of a ligand, is exactly analogous to the case of
amnioserosa development in Drosophila where loss of Sog (an
inhibitor) leads to less Dpp signaling in the dorsal domain. Detailed studies
examining the ligand dependence of Chordin cleavage in zebrafish by
minifin, the gene encoding a Tld homolog, have not been reported. It
is possible therefore, that like Drosophila, this system may also
employ a transport mechanism involving Tsg, Chordin and Tld that acts to boost
Bmp signaling in specific tissues. It is interesting to note that the mouse
homologs of Tsg, Chordin and Tld also exhibit their own distinct biochemical
properties. Thus, a new Tld processing site in Chordin is induced by the
presence of Tsg (Scott et al.,
2001
) but this is not seen when the Xenopus components
are used (Larrain et al., 2002). Thus, it seems probable that the inherent
complexity of this multi-component regulatory mechanism has provided numerous
targets for evolutionary change. We speculate that these changes account for
the remarkable diversity that this mechanism exhibits with respect to the
actual details by which it regulates Bmp signaling in different organisms.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Arora, K., Levine, M. S. and O'Connor, M. B.
(1994). The screw gene encodes a ubiquitously expressed member of
the TGF-beta family required for specification of dorsal cell fates in the
Drosophila embryo. Genes Dev.
8,2588
-2601.
Arora, K. and Nusslein-Volhard, C. (1992).
Altered mitotic domains reveal fate map changes in Drosophila embryos mutant
for zygotic dorsoventral patterning genes. Development
114,1003
-1024.[Abstract]
Biehs, B., Francois, V. and Bier, E. (1996).
The Drosophila short gastrulation gene prevents Dpp from autoactivating and
suppressing neurogenesis in the neuroectoderm. Genes
Dev. 10,2922
-2934.
Blader, P., Rastegar, S., Fischer, N. and Strahle, U.
(1997). Cleavage of the BMP-4 antagonist chordin by zebrafish
tolloid. Science 278,1937
-1940.
Brummel, T. J., Twombly, V., Marques, G., Wrana, J. L., Newfeld,
S. J., Attisano, L., Massague, J., O'Connor, M. B. and Gelbart, W.
M. (1994). Characterization and relationship of Dpp receptors
encoded by the saxophone and thick veins genes in
Drosophila. Cell 78,251
-261.[CrossRef][Medline]
Caplen, N. J., Fleenor, J., Fire, A. and Morgan, R. A.
(2000). dsRNA-mediated gene silencing in cultured Drosophila
cells: a tissue culture model for the analysis of RNA interference.
Gene 252,95
-105.[CrossRef][Medline]
Chang, C., Holtzman, D. A., Chau, S., Chickering, T., Woolf, E.
A., Holmgren, L. M., Bodorova, J., Gearing, D. P., Holmes, W. E. and
Brivanlou, A. H. (2001). Twisted gastrulation can function as
a BMP antagonist. Nature
410,483
-487.[CrossRef][Medline]
Clemens, J. C., Worby, C. A., Simonson-Leff, N., Muda, M.,
Maehama, T., Hemmings, B. A. and Dixon, J. E. (2000).
Use of double-stranded RNA interference in Drosophila cell lines to dissect
signal transduction pathways. Proc. Natl. Acad. Sci.
USA 97,6499
-6503.
Decotto, E. and Ferguson, E. L. (2001). A
positive role for Short gastrulation in modulating BMP signaling during
dorsoventral patterning in the Drosophila embryo.
Development 128,3831
-3841.
DeRobertis, E. M. and Sasai, Y. (1996). A
common plan for dorsoventral patterning in Bilateria.
Nature 380,37
-40.[CrossRef][Medline]
Dorfman, R. and Shilo, B. Z. (2001). Biphasic
activation of the BMP pathway patterns the Drosophila embryonic dorsal region.
Development 128,965
-972.[Abstract]
Eldar, A., Dorfman, R., Weiss, D., Ashe, H., Shilo, B. Z. and
Barkai, N. (2002). Robustness of the BMP morphogen gradient
in Drosophila embryonic patterning. Nature
419,304
-308.[CrossRef][Medline]
Ferguson, E. L. and Anderson, K. V. (1992).
Decapentaplegic acts as a morphogen to organize dorsal-ventral pattern in the
Drosophila embryo. Cell
71,451
-461.[CrossRef][Medline]
Haerry, T. E., Khalsa, O., O'Connor, M. B. and Wharton, K.
A. (1998). Synergistic signaling by two BMP ligands through
the SAX and TKV receptors controls wing growth and patterning in Drosophila.
Development 125,3977
-3987.[Abstract]
Hammond, S. M., Bernstein, E., Beach, D. and Hannon, G. J.
(2000). An RNA-directed nuclease mediates post-transcriptional
gene silencing in Drosophila cells. Nature
404,293
-296.[CrossRef][Medline]
Holley, S. A., Jackson, P. D., Sasai, Y., Lu, B., de Robertis,
E. M., Hoffmann, F. M. and Ferguson, E. L. (1995). A
conserved system for dorsal-ventral patterning in insects and vertebrates
involving sog and chordin. Nature
376,249
-253.[CrossRef][Medline]
Larrain, J., Oelgeschlager, M., Ketpura, N. I., Reversade, B.,
Zakin, L. and de Robertis, E. M. (2001). Proteolytic cleavage
of Chordin as a switch for the dual activities of Twisted gastrulation in BMP
signaling. Development
128,4439
-4447.
Letsou, A., Arora, K., Wrana, J. L., Simin, K., Twombly, V.,
Jamal, J., Staehling-Hampton, K., Hoffmann, F. M., Gelbart, W. M.,
Massague, J. et al. (1995). Drosophila Dpp signaling is
mediated by the punt gene product: a dual ligand-binding type II receptor of
the TGF beta receptor family. Cell
80,899
-908.[CrossRef][Medline]
Marques, G., Musacchio, M., Shimell, M. J.,
Wunnenberg-Stapleton, K., Cho, K. W. and O'Connor, M. B.
(1997). Production of a DPP activity gradient in the early
Drosophila embryo through the opposing actions of the SOG and TLD proteins.
Cell 91,417
-426.[CrossRef][Medline]
Mason, E. D., Konrad, K. D., Webb, C. D. and Marsh, J. L.
(1994). Dorsal midline fate in Drosophila embryos requires
twisted gastrulation, a gene encoding a secreted protein related to human
connective tissue growth factor. Genes Dev.
8,1489
-1501.
Neul, J. L. and Ferguson, E. L. (1998).
Spatially restricted activation of the SAX receptor by SCW modulates DPP/TKV
signaling in Drosophila dorsalventral patterning. Cell
95,483
-494.[CrossRef][Medline]
Nguyen, M., Park, S., Marques, G. and Arora, K.
(1998). Interpretation of a BMP activity gradient in Drosophila
embryos depends on synergistic signaling by two type I receptors, SAX and TKV.
Cell 95,495
-506.[CrossRef][Medline]
Nguyen, T., Jamal, J., Shimell, M. J., Arora, K. and O'Connor,
M. B. (1994). Characterization of tolloid-related-1: a
BMP-1-like product that is required during larval and pupal stages of
Drosophila development. Dev. Biol.
166,569
-586.[CrossRef][Medline]
Oelgeschlager, M., Larrain, J., Geissert, D. and de Robertis, E.
M. (2000). The evolutionarily conserved BMP-binding protein
Twisted gastrulation promotes BMP signalling. Nature
405,757
-763.[CrossRef][Medline]
Padgett, R. W., St Johnston, R. D. and Gelbart, W. M.
(1987). A transcript from a Drosophila pattern gene predicts a
protein homologous to the transforming growth factor-beta family.
Nature 325,81
-84.[CrossRef][Medline]
Penton, A., Chen, Y., Staehling-Hampton, K., Wrana, J. L.,
Attisano, L., Szidonya, J., Cassill, J. A., Massague, J. and Hoffmann,
F. M. (1994). Identification of two bone morphogenetic
protein type I receptors in Drosophila and evidence that Brk25D is a
decapentaplegic receptor. Cell
78,239
-250.[CrossRef][Medline]
Piccolo, S., Sasai, Y., Lu, B. and de Robertis, E. M.
(1996). Dorsoventral patterning in Xenopus: inhibition of ventral
signals by direct binding of chordin to BMP-4. Cell
86,589
-598.[CrossRef][Medline]
Piccolo, S., Agius, E., Lu, B., Goodman, S., Dale, L. and de
Robertis, E. M. (1997). Cleavage of Chordin by Xolloid
metalloprotease suggests a role for proteolytic processing in the regulation
of Spemann organizer activity. Cell
91,407
-416.[CrossRef][Medline]
Ross, J. J., Shimmi, O., Vilmos, P., Petryk, A., Kim, H.,
Gaudenz, K., Hermanson, S., Ekker, S. C., O'Connor, M. B. and Marsh, J.
L. (2001). Twisted gastrulation is a conserved extracellular
BMP antagonist. Nature
410,479
-483.[CrossRef][Medline]
Scott, I. C., Blitz, I. L., Pappano, W. N., Maas, S. A., Cho, K.
W. and Greenspan, D. S. (2001). Homologues of Twisted
gastrulation are extracellular cofactors in antagonism of BMP signalling.
Nature 410,475
-478.[CrossRef][Medline]
Shimell, M. J., Ferguson, E. L., Childs, S. R. and O'Connor, M.
B. (1991). The Drosophila dorsal-ventral patterning gene
tolloid is related to human bone morphogenetic protein 1.
Cell 67,469
-481.[CrossRef][Medline]
Srinivasan, S., Rashka, K. E. and Bier, E.
(2002). Creation of a Sog morphogen gradient in the Drosophila
embryo. Dev. Cell 2,91
-101.[CrossRef][Medline]
St Johnston, D. and Nusslein-Volhard, C.
(1992). The origin of pattern and polarity in the Drosophila
embryo. Cell 68,201
-219.[CrossRef][Medline]
Ui-Tei, K., Zenno, S., Miyata, Y. and Saigo, K.
(2000). Sensitive assay of RNA interference in Drosophila and
Chinese hamster cultured cells using firefly luciferase gene as target.
FEBS Lett. 479,79
-82.[CrossRef][Medline]
Wagner, D. S. and Mullins, M. C. (2002).
Modulation of BMP activity in dorsal-ventral pattern formation by the chordin
and ogon antagonists. Dev. Biol.
245,109
-123.[CrossRef][Medline]
Wharton, K. A., Ray, R. P. and Gelbart, W. M.
(1993). An activity gradient of decapentaplegic is necessary for
the specification of dorsal pattern elements in the Drosophila embryo.
Development 117,807
-822.[Abstract]
Xie, T., Finelli, A. L. and Padgett, R. W.
(1994). The Drosophila saxophone gene: a
serine-threonine kinase receptor of the TGF-
superfamily.
Science 263,1756
-1759.
Yu, K., Srinivasan, S., Shimmi, O., Biehs, B., Rashka, K. E.,
Kimelman, D., O'Connor, M. B. and Bier, E. (2000).
Processing of the Drosophila Sog protein creates a novel BMP inhibitory
activity. Development
127,2143
-2154.[Abstract]
This article has been cited by other articles:
![]() |
D. M. Umulis Analysis of dynamic morphogen scale invariance J R Soc Interface, December 6, 2009; 6(41): 1179 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Umulis, M. B. O'Connor, and S. S. Blair The extracellular regulation of bone morphogenetic protein signaling Development, November 15, 2009; 136(22): 3715 - 3728. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Plouhinec and E. M. De Robertis Systems Biology of the Self-regulating Morphogenetic Gradient of the Xenopus Gastrula Cold Spring Harb Perspect Biol, August 1, 2009; 1(2): a001701 - a001701. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kunnapuu, I. Bjorkgren, and O. Shimmi The Drosophila DPP signal is produced by cleavage of its proprotein at evolutionary diversified furin-recognition sites PNAS, May 26, 2009; 106(21): 8501 - 8506. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Geach and L. Dale Molecular Determinants of Xolloid Action in Vivo J. Biol. Chem., October 3, 2008; 283(40): 27057 - 27063. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Serpe and M. B. O'Connor The metalloprotease Tolloid-related and its TGF-{beta}-like substrate Dawdle regulate Drosophila motoneuron axon guidance. Development, December 1, 2006; 133(24): 4969 - 4979. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Umulis, M. Serpe, M. B. O'Connor, and H. G. Othmer Robust, bistable patterning of the dorsal surface of the Drosophila embryo PNAS, August 1, 2006; 103(31): 11613 - 11618. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lin, S. R. Patel, M. Wang, and G. R. Dressler The Cysteine-Rich Domain Protein KCP Is a Suppressor of Transforming Growth Factor {beta}/Activin Signaling in Renal Epithelia Mol. Cell. Biol., June 15, 2006; 26(12): 4577 - 4585. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. G. Canty, L. Garrigue-Antar, and K. E. Kadler A Complete Domain Structure of Drosophila Tolloid Is Required for Cleavage of Short Gastrulation J. Biol. Chem., May 12, 2006; 281(19): 13258 - 13267. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Rentzsch, J. Zhang, C. Kramer, W. Sebald, and M. Hammerschmidt Crossveinless 2 is an essential positive feedback regulator of Bmp signaling during zebrafish gastrulation Development, March 1, 2006; 133(5): 801 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. O'Connor, D. Umulis, H. G. Othmer, and S. S. Blair Shaping BMP morphogen gradients in the Drosophila embryo and pupal wing Development, January 15, 2006; 133(2): 183 - 193. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Serpe, A. Ralston, S. S. Blair, and M. B. O'Connor Matching catalytic activity to developmental function: Tolloid-related processes Sog in order to help specify the posterior crossvein in the Drosophila wing Development, June 1, 2005; 132(11): 2645 - 2656. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xu, N. Kirov, and C. Rushlow Peak levels of BMP in the Drosophila embryo control target genes by a feed-forward mechanism Development, April 1, 2005; 132(7): 1637 - 1647. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xie and S. Fisher Twisted gastrulation enhances BMP signaling through chordin dependent and independent mechanisms Development, January 15, 2005; 132(2): 383 - 391. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Zhu and M. P. Scott Incredible journey: how do developmental signals travel through tissue? Genes & Dev., December 15, 2004; 18(24): 2985 - 2997. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Little and M. C. Mullins Twisted gastrulation promotes BMP signaling in zebrafish dorsal-ventral axial patterning Development, December 1, 2004; 131(23): 5825 - 5835. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yu, K.-H. Kang, P. Heine, U. Pyati, S. Srinivasan, B. Biehs, D. Kimelman, and E. Bier Cysteine Repeat Domains and Adjacent Sequences Determine Distinct Bone Morphogenetic Protein Modulatory Activities of the Drosophila Sog Protein Genetics, March 1, 2004; 166(3): 1323 - 1336. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zakin and E. M. De Robertis Inactivation of mouse Twisted gastrulation reveals its role in promoting Bmp4 activity during forebrain development Development, January 15, 2004; 131(2): 413 - 424. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||