|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00207
1 Section of Cell and Developmental Biology, University of California, San
Diego, 9500 Gilman Drive, La Jolla, CA 92093-0349, USA
2 Albert-Ludwigs-Universität Freiburg, Institut für Biologie I,
Hauptstrasse 1, D-79104 Freiburg, Germany
3 Department of Biology, Dickinson College, PO Box 1773, Carlisle, PA 17013,
USA
4 Max-Planck-Institut für biophysikalische Chemie, Abt. Molekulare
Entwicklungsbiologie, Am Fassberg 11, D-37077 Göttingen, Germany
* Author for correspondence (e-mail: bier{at}biomail.ucsd.edu)
Accepted 3 October 2002
| SUMMARY |
|---|
|
|
|---|
Key words: knirps, radius incompletus, L2 vein, wing, Drosophila melanogaster, Patterning, Morphogenesis
| INTRODUCTION |
|---|
|
|
|---|
Wing vein development in Drosophila can be subdivided into two
temporally distinct stages: initiation and differentiation. Vein initiation
begins during the mid-third larval instar
(Waddington, 1940
;
García-Bellido, 1977
;
García-Bellido and de Celis,
1992
; Sturtevant et al.,
1993
; Sturtevant and Bier,
1995
; Bier, 2000
)
when the wing imaginal disc is a monolayer of cells. The wing blade proper
derives from an oval region of the wing disc known as the wing pouch, while
the remainder of the disc generates elements of the wing hinge and thoracic
body wall. Vein differentiation, the second phase of vein development, occurs
during metamorphosis as the wing disc buds out (or everts), folding along the
future wing margin. Ultimately, this eversion leads to the apposition of the
dorsal and ventral surfaces of the wing during pupal development, creating the
bilayer of cells comprising the mature wing blade.
Genes involved in initiating wing vein development (vein genes) are
expressed during the third larval instar in narrow stripes, corresponding to
vein primordia, or in broader `provein' stripes, consisting of cells that are
competent to become vein cells (Biehs et
al., 1998
). Some vein genes are expressed in all vein primordia,
while others are expressed in subsets of veins or in single veins. For example
rhomboid (rho), which encodes an integral membrane protein
(Bier et al., 1990
;
Sturtevant et al., 1996
), is
expressed in all vein primordia and promotes vein formation throughout wing
development by locally activating the Egfr signaling pathway
(Sturtevant et al., 1993
;
Noll et al., 1994
;
Bier, 1998a
;
Bier, 1998b
;
Guichard et al., 1999
).
caupolican (caup) and the neighboring gene araucan
(ara) encode related homeobox genes that promote expression of other
vein genes such as rho in odd numbered veins. Proneural genes such as
achaete (ac) and scute (sc) promote neural
development in the L1 and L3 primordium
(Gomez-Skarmata et al., 1996
).
Delta (Dl) encodes a ligand for the Notch (N) receptor,
which mediates lateral inhibitory interactions among cells in vein-competent
domains during pupal development
(Shellenbarger and Mohler,
1978
; Kooh et al.,
1993
; Parody and Muskavitch,
1993
). Delta is also expressed earlier during larval
stages of wing development in all longitudinal veins except L2, and is likely
to play a role in limiting vein thickness at this stage as well, since loss of
Notch function during larval development leads to greatly broadened expression
of the vein marker rho
(Sturtevant and Bier, 1995
).
kni and knrl, which encode related zinc finger transcription
factors in the steroid hormone superfamily
(Nauber et al., 1988
;
Oro et al., 1988
;
Rothe et al., 1989
), are
expressed in a single stripe corresponding to the L2 primordium beginning in
the mid-third larval instar, and are required to initiate L2 development
(Lunde et al., 1998
).
kni also functions as a gap gene in early embryonic development
(Nüsslein-Volhard and Wieschaus,
1980
; Nauber et al.,
1988
).
The L2 stripe of kni/knrl-expressing cells forms along the
anterior border of a broad domain of cells expressing high levels of the
related and functionally overlapping spalt-major (salm)
(Kühnlein et al., 1994
)
and spalt-related (salr)
(Barrio et al., 1996
) zinc
finger transcription factors. A variety of evidence indicates that central
domain cells expressing the patterning genes salm and salr
(together referred to as sal) induce their anterior neighbors, which
express very low levels of sal, to become the L2 primordium
(Sturtevant et al., 1997
;
Lunde et al., 1998
). For
example, in wings containing salm-mutant clones, ectopic branches of
L2 are induced that track along and inside the salm- clone
borders, mimicking the normal situation in which an L2 vein forms just outside
the domain of high-level sal-expressing cells
(Sturtevant et al., 1997
).
This ability of sal-expressing cells to induce their anterior
low-level sal-expressing neighbors to initiate L2 development
requires the activity of the kni locus
(Lunde et al., 1998
). The
induction of kni/knrl expression in the L2 primordium therefore
provides an excellent system for studying the transition from spatial
patterning to tissue morphogenesis.
Once activated along the anterior sal border, kni and
knrl organize development of the L2 vein, in part by activating
expression of the key vein-promoting gene rho and by suppressing
expression of the intervein gene blistered (bs)
(Montagne et al., 1996
;
Lunde et al., 1998
). The
kni locus is highly selective in regulating downstream gene
expression in the L2 primordium as revealed by the observation that several
genes expressed in other veins, such as caup and ara, ac and
sc, and Delta, are excluded from the L2 primordium. Thus,
the kni locus links patterning to vein-specific morphogenesis by
functioning downstream of sal and upstream of genes involved in vein
versus intervein development.
The role of the kni locus in L2 formation has been clarified by
analysis of likely regulatory alleles of the kni locus, previously
known as radius incompletus (ri)
(Arajärvi and Hannah-Alava,
1969
; Lunde et al.,
1998
). Flies with this mutation lack large sections of the L2
vein. kniri mutants are homozygous viable, in contrast to
kni null mutants, which die as embryos with a gap gene phenotype
(Nüsslein-Volhard and Wieschaus,
1980
; Nauber et al.,
1988
). In support of kniri mutations being
wing-specific regulatory alleles of the kni/knrl locus, expression of
kni and knrl in the L2 primordium is absent in
kniri[1] mutants, and the L2 vein-loss phenotype can be
partially rescued by ubiquitous expression of kni in the wing
(Lunde et al., 1998
).
The findings summarized above suggest that kni and knrl organize the L2 vein developmental program by orchestrating expression of genes that execute distinct subsets of functions required for proper L2 development. Several important unanswered questions remain, including: what function(s) are disrupted in kniri[1] and other existing kniri mutants?; do these mutations eliminate the function of an L2-specific cis-regulatory element in the kni locus?; and finally, with respect to the definition of L2 versus other veins, is it important to exclude expression of genes expressed in veins other than the L2 primordium?
In this study we report the identification of an enhancer element upstream of the kni coding region that selectively directs gene expression in the L2 primordium in third instar larval wing discs. We show that three separate ri alleles have defects mapping within a minimal 1.4 kb L2 enhancer element. We demonstrate that two of these mutations eliminate activity of the L2 enhancer, kniri[1], which contains a 252 bp deletion, and kniri[53j], which harbors a single base-pair substitution. We find that truncation of the minimal L2 enhancer to a 0.69 kb fragment leads to ectopic reporter gene expression in the extreme anterior and posterior regions of the wing, indicating that repression contributes to restricting activation of the L2 enhancer. In addition, we show that the general wing promoting transcription factor Scalloped (Sd) binds with high affinity to several sites in the L2 enhancer and that sd is required for kni expression in the wing disc. We have also employed the L2 enhancer element as a tool to drive expression of various UAS transgenes in the L2 primordium. We find that the loss of the L2 vein in ri mutants can be rescued by L2-specific expression of either the kni or knrl genes, or the downstream target gene rho. In addition, we find that misexpression of genes in the L2 primordium that are normally expressed in veins other than L2 results in abnormal L2 development. These results provide a framework for understanding how positional information is converted into morphogenesis of the L2 wing vein by `vein organizing genes' such as kni and knrl.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Vector construction
Genomic fragments spanning the majority of the putative regulatory region
of the kni locus (Fig.
1) delimited by Df(3L)kniri[XT2]
(Nauber et al., 1988
) were
subcloned into the pC4PLZ expression vector
(Wharton and Crews, 1993
).
EcoRI fragments F, E, S, R and Q (isolated from phages provided by U.
Nauber) were inserted into pBluescript II KS (+/-)
(pBS, Stratagene) with the NotI and T7 promoter containing
the side of the vector most proximal to the knirps coding region. The
constructs were subcloned into the lacZ transformation vector
pC4PLZ. Subfragments of the 4.8 kb EcoRI fragment (fragment
E in Fig. 1) that drive
expression in the L2 primordium were then subcloned into pC4PLZ to
define a minimal L2 enhancer element. To assay fragments of E, pBS-E
was digested; the proximal most EcoRI-SalI (ES, 2.0 kb),
EcoRI-XhoI (EX, 1.4 kb), and EcoRI-HincII
(EC, 0.69 kb) fragments isolated and re-inserted into pBS. The 4.8 kb
fragment E was also subcloned into the pC4PG4 expression vector, in
which the lacZ gene in pC4PLZ has been replaced by
GAL4 (Emery, 1996
),
and was used to drive expression of various UAS transgenes in the L2
primordium.
|
Mapping of kni and ri breakpoints
Restriction fragments isolated from a lambda phage walk
(Nauber et al., 1988
) covering
over 50 kb of the kni upstream region, delimited by the
Df(3L)kniri[XT2] deletion, were used as probes to
determine the locations of potential chromosomal abnormalities such as
deletions or rearrangements in ri mutants on Southern blots
(Southern, 1975
). Several
different restriction enzymes were used to scan each region to distinguish
single nucleotide polymorphisms from larger scale abnormalities such as those
present in the kniri[1] and kniri[M3]
mutants.
Isolation of kniri genomic fragments and
construction of the E[ri]-lacZ vectors
Primers AA and RK were used to amplify a region surrounding the proximal
EcoRI-BglII (1.197 kb) fragment of E from
kniri[1], kniri[92f],
kniri[M*], and kniri[53j]
genomic DNA (AA=GACACAATGCTCCGAATTCC, the 5' end is in F, the 3'
end contains the EcoRI site; RK=CCCAATGGACCCCAATCTGGTTGGGG, the
5' end is at 1.231 kb in E. Note that TGGGG was added to produce a
KpnI site at the distal end of the resulting fragment). PCR fragments
were purified for sequencing using the QIAquick PCR Purification kit. The
blunt ended kniri[1] fragment was cloned into
pCR-BluntII-TOPO (TOPO) and oriented so that the NotI site
within TOPO and the BglII site within the fragment (N, B)
are on opposite sides. The resulting TOPO-N,B construct and
pBS-E were digested with NotI and BglII, fragments
isolated and ligated to form pBS-E
ri[1]. The
E
ri[1] insert was sequenced to confirm that it differed from
the wild-type sequence by only the 252 bp deletion. KpnI and
NotI were used to remove E
ri[1], and it was cloned
into the corresponding sites of C4PLZ to form
E
ri[1]-lacZ. Similarly, primers ECO-ri and
XBA-ri were used to PCR amplify the EcoRI-XhoI
fragment of E (termed EX) from kniri[53j] genomic DNA
(ECO-ri=GAATTCCAACGCGAAGCGTC; XBA-ri=TCTAGATGGGGCTGCTGCCA).
The resulting 1.4 kb product was cloned into the TOPO vector. The
EX(ri53j) fragment was digested with EcoRI and
XbaI and subcloned into the corresponding sites of pC4PLZ to
form EX(ri53j)-lacZ. A single subclone
was sequenced to verify that only the single nucleotide change (C596A) had
been incorporated.
Generation and analysis of sd- clones
Generation of reduction-of-function sd58 clones and
immunohistochemical analysis were performed as described previously
(Guss et al., 2001
).
Analysis of Sd binding sites in the L2 enhancer
Identification and analysis of Sd binding sites was performed as described
by Guss et al. (Guss et al.,
2001
). Sequences of the upper strand of oligonucleotides used as
probes for gel mobility shift assays and as PCR primers to introduce mutations
into the Sd binding sites of the kni 0.69 kb element (fragment EC in
Fig. 1F) are listed below in
the 5' to 3' orientation. Altered bases are shown in lowercase in
the mutant version, and the corresponding bases are underlined in the native
sequence as follows:
Reporter constructs with three mutated Sd binding sites were made by cloning PCR-generated fragments of fragment EC into the Hsp lacZ-CaSpeR plasmid (Nelson and Laughton, 1993). Four independent EC-3Sdmut-lacZ transformants were recovered and tested for lacZ expression.
Mounting fly wings
Wings from adult flies were dissected in isopropanol and mounted in 100%
Canada Balsam mounting medium (Aldrich #28,292-8) as described previously
(Roberts, 1986
).
In situ hybridization to whole-mount larval wing discs
In situ hybridization using digoxigenin-labeled antisense RNA probes
(O'Neill and Bier, 1994
) was
performed alone or in combination with anti-ß galactosidase (Promega)
labeling as described previously
(Sturtevant et al., 1993
).
| RESULTS |
|---|
|
|
|---|
The studies mentioned above suggested that there might be an L2-specific
wing vein enhancer that controls expression of kni and knrl
in the L2 primordium. We searched for such an enhancer element in two ways.
First, we screened for the ability of genomic fragments upstream of the
kni coding region to drive lacZ expression in the L2
primordium (summarized in Fig.
1E). Second, we used Southern blot analysis to identify deletions
or rearrangement breakpoints in the genomic DNA of ri mutants in the
kni upstream region uncovered by Df(3L)kniri[XT2]
(Fig. 1E, see below). As a
result of the former effort, we identified a single 4.8 kb EcoRI
fragment (fragment E in Fig.
1E-G) that drives lacZ reporter gene expression in a
sharp stripe (Fig. 2B) similar
to that of endogenous kni expression in the L2 primordium
(Fig. 2A). Double label
experiments confirm that lacZ expression driven by the
E-lacZ construct coincides with that of endogenous kni
expression (Fig. 2C).
Additionally, the E-lacZ expression pattern includes a weaker stripe
in the posterior region of the wing (Fig.
2B, arrow). A faint endogenous kni stripe can also be
observed in this location in overstained preparations of wildtype discs (data
not shown). Consistent with previous studies
(Lunde et al., 1998
), the
E-lacZ L2 stripe is located just anterior to the broad domain of
strong salm expression (Fig.
2D). Notably, the weaker posterior E-lacZ stripe forms
immediately adjacent to the posterior border of the salm domain
(Fig. 2D).
|
In order to delimit a minimal L2 enhancer element, we tested the ability of 5' truncated derivatives of the 4.8 kb fragment E (Fig. 1G) to drive reporter gene expression in larval wing imaginal discs. We observed that subfragments of 2.0 kb (EcoRI-SalI, data not shown) and 1.4 kb (the EcoRI-XhoI fragment EX, Fig. 1G) drive expression of lacZ (Fig. 2E) in patterns nearly indistinguishable from that of the 4.8 kb E-lacZ construct (Fig. 2B). Further truncation generating a 0.69 kb EcoRI-HincII fragment (EC, Fig. 1G), however, results in high levels of ectopic lacZ expression in broad anterior and posterior domains (Fig. 2F). This observation indicates that regulatory element(s) required to repress gene expression in the extreme anterior and posterior domains of the wing primordium reside between the distal 0.69 kb and 1.4 kb of fragment EX (repression domain, Fig. 3B), and that sequences sufficient for activation are contained within the proximal 0.69 kb fragment EC (activation domain, Fig. 3A). As discussed below, we have identified sequences necessary for L2 activity in the activation domain as well as potential repressor binding sites in the proposed repression domain (Fig. 3A,B, Fig. 7).
|
|
ri mutants have lesions in the L2 enhancer that disrupt its
function
As a complement to screening genomic fragments upstream of the kni
locus for the ability to drive gene expression in the L2 primordium using
lacZ promoter fusion constructs, we scanned the approximately 50 kb
region deleted in the Df(3L)kniri[XT2] allele for
detectable aberrations in five putative independently isolated ri
alleles. Using a series of probes spanning that complete genomic region
(Fig. 1E), we found that a
single EcoRI fragment (the same fragment E that drives expression in
the L2 primordium) contains aberrations in the kniri[1],
kniri[92f], kniri[M*] and
kniri[M3] mutants. For each of these alleles, mutations
map within the minimal 1.4 kb L2 enhancer element (see
Fig. 1F). Although no
large-scale lesions were detected by Southern blot analysis within fragment E
of the kniri[53j] mutant, subsequent sequence analysis
identified a single base pair alteration within the minimal L2 enhancer
element EX (see below). The kniri[53j] allele is also
associated with a small deletion (approx. 50 bp) in fragment R.
Further molecular analysis of the various ri alleles revealed that
the putative independently derived kniri[1],
kniri[92f], and kniri[M*]
alleles all contain the same 252 bp deletion. As this deletion is not flanked
by duplicated sequences that could promote frequent identical recombination
events, it may be that the kniri[92f] and
kniri[M*] alleles are actually re-isolates of
the original kniri[1] mutation. Consistent with these
three alleles having a common origin, they also share a restriction enzyme
polymorphism (i.e. loss of a HindIII site) in fragment Q
(Fig. 1E) that is not shared by
the other ri mutants or our white- control stock.
To test whether the 252 bp deletion within the minimal L2 enhancer element is
responsible for the loss of kni and knrl gene expression in
kniri[1] mutants, we made a kniri[1]-
mutated E-lacZ construct. We amplified genomic DNA containing the
kniri[1] mutation and substituted it for the corresponding
part of the original E-lacZ construct to generate
E
ri1-lacZ
(Fig. 1G) and transformed this
construct into flies. We examined lacZ expression in third instar
larval wing discs of E
ri1-lacZ flies and
found that they failed to express lacZ in the L2 primordium or
anywhere else in the wing pouch (Fig.
2G), indicating that the 252 bp deletion in
kniri[1] mutants eliminates the activity of the L2
enhancer element.
Since Southern blot analysis did not reveal any obvious lesions in fragment
E of the kniri[53j] allele, we considered the possibility
that this allele might have a subtler lesion in the L2 enhancer region.
Accordingly, we PCR amplified and sequenced the 1.4 kb fragment (EX,
Fig. 1G) corresponding to the
minimal L2 enhancer from kniri[53j]. We found only a
single nucleotide difference between the sequence of this mutant allele and
the wild-type fragment EX (C596A, Fig.
3A), which lies within the same 252 bp region deleted in
kniri[1]. Although it has been observed that single
nucleotide mutations can eliminate endogenous enhancer function
(Shimell et al., 1994
), such
cases are sufficiently rare that it was important, as in the case of
kniri[1], to demonstrate whether this point mutation was
responsible for the loss of enhancer function. We used the EX
kniri[53j] PCR fragment to make a lacZ construct,
confirmed the sequence of the mutant construct, generated four independent
transformants, and tested these flies for lacZ expression in third
instar wing discs. We found that
EX(ri53j)-lacZ mutant wing discs fail to
express lacZ in the L2 primordium
(Fig. 2H), strongly suggesting
that this single base pair mutation is responsible for the observed L2 vein
loss phenotype observed in kniri[53j] flies. One notable
difference between the EX(ri53j)-lacZ
and E
ri1-lacZ mutant wing discs is that in
the point mutant construct (ri53j), lacZ
expression is lost selectively in the L2 primordium and in the weaker
posterior stripe (note the normal levels and pattern of expression in extreme
anterior and posterior regions of the disc,
Fig. 2H), while in the deletion
mutant construct (E
ri1), reporter gene expression
is eliminated throughout the wing disc
(Fig. 2G).
As noted above, the kniri[53j] mutant is also
associated with a deletion of
50 bp in fragment R, which lies
approximately 15 kb 5' to fragment E within predicted intron sequences
of a putative transcription unit (see kni locus map,
Fig. 1E). As the ubiquitous
expression of this transcription unit is not affected in
kniri[53j] mutants (K. L., unpublished observations) and
fusion of fragment R with lacZ does not result in gene expression in
the L2 primordium, we have no evidence to suggest that this aberration has any
relevance to the L2 vein loss phenotype of kniri[53j]
mutants.
Analysis of the kniri[M3] allele indicates that this mutation involves an insertion and possibly rearrangements within fragment E. One breakpoint of the kniri[M3] allele falls within the 1.4 kb EX minimal L2 enhancer element (Fig. 1F). Because this is a relatively weak ri allele and is associated with a complex lesion, we did not characterize the nature of this rearrangement further.
The wing selector protein Scalloped binds to the L2 enhancer and is
required for its activity
The 4.8 kb L2 enhancer fragment E and truncated derivatives (fragments EX
and EC) drive reporter gene expression specifically in the wing pouch. Recent
work has shown that gene expression in the wing primordium is controlled by
Sd, which functions with Vestigial (Vg) to define wing identity
(Kim et al., 1996
;
Kim et al., 1997
;
Halder et al., 1998
;
Simmonds et al., 1998
;
Guss et al., 2001
;
Halder and Carroll, 2001
). We
tested whether Sd might similarly be required to activate endogenous
kni expression by generating clones of cells homozygous for a strong
hypomorphic allele of sd using FLP-FRT mediated mitotic recombination
(Golic, 1991
). In sd
clones, ß-galactosidase expression driven by the E-lacZ element
is reduced (Fig. 3D). In clones
falling along the future wing margin, however, reporter gene expression is
unaffected (not shown; see Discussion). These results indicate that Sd plays
an in vivo role in activating kni expression within the wing
blade.
Because Sd, a TEA-domain protein, functions as a direct transcriptional
regulator of several key developmental genes expressed in the wing disc
(Halder et al., 1998
;
Guss et al., 2001
), we tested
whether Sd binds to the kni L2 enhancer. We searched for specific Sd
DNA binding sites in the 0.69 kb EC activation domain using DNAse I
footprinting and gel shift analysis (Fig.
3G and data not shown) and identified five sites bound by the Sd
TEA domain, which conform well to the known Sd consensus binding site and
consist of a tandem doublet of Sd binding sites and four single binding sites
(Fig. 3A). The four single Sd
sites are removed by the 252 bp deletion in the kniri[1]
allele, however, none of them covers the kniri[53j] point
mutation. To determine whether Sd plays a direct role in activating the L2
enhancer, we mutated a subset of these Sd binding sites in the context of the
EC-lacZ construct, transformed these mutated constructs into flies
and stained for lacZ expression in third instar wing discs. We found
that mutation of the doublet at 271 in combination with the two single sites
at 570 and 640 resulted in a complete loss of lacZ expression in the
wing disc (Fig. 3H). These
results indicate that Sd is required for activation of kni expression
in the wing disc.
kniri[1] mutants can be rescued by kni, knrl or the
downstream target gene rho
Having shown that the minimal L2 enhancer is mutated in several
independently derived ri alleles (kniri[1],
kniri[M3], and kniri[53j]), we wished
to know whether driving expression of either the kni or knrl
genes with this element could rescue the ri vein-loss phenotype. We
addressed this question using the conditional GAL4/UAS expression system of
Brand and Perrimon (Brand and Perrimon,
1993
). We created transgenic flies that carry fragment E driving
GAL4 expression (L2-GAL4) and used this driver to activate expression of
UAS-kni or UAS-knrl transgenes in the L2 primordium of
kniri[1] mutants. As expected, GAL4 RNA is
expressed in the L2 primordium of L2-GAL4 wing discs
(Fig. 4A). We placed this
L2-GAL4 driver and the UAS-kni and UAS-knrl transgenes into
the kniri[1] mutant background and generated flies of the
genotype L2-GAL4>UAS-kni;
kniri[1]/kniri[1]
(Fig. 4B) and
L2-GAL4>UAS-knrl;
kniri[1]/kniri[1]
(Fig. 4C). These flies have
fully restored L2 veins that resemble wild-type L2 veins in that the bulk of
the vein is formed on the ventral surface of the wing.
|
Since rho is known to play a critical role in activating Egfr signaling in all vein primordia, we also determined whether expression of this downstream effector of the kni locus could bypass the requirement for kni in kniri[1] mutants. We found that L2 formation is indeed rescued in L2-GAL4>UAS-rho; kniri[1]/kniri[1] flies (Fig. 4D). As in the case of rescue by kni or knrl, the rescued L2 vein forms primarily on the ventral surface of the wing.
Misexpression of genes expressed in veins other than L2 alters L2
development
As mentioned above (see Introduction), several genes that are important for
vein development are expressed in veins other than L2. For example, the vein-
and sensory organ-promoting gene ara is expressed in the odd numbered
veins (L1, L3, and L5), the proneural genes ac and sc are
expressed in L1 and L3, and the Notch ligand Delta is expressed in L1 and
L3-L5, but not in L2. We were interested to know whether it is necessary to
exclude expression of these genes from the L2 primordium for normal L2
development. To address this question, we misexpressed UAS-transgene copies of
these genes in the L2 primordium with the L2-GAL4 driver and examined the L2
vein in adult wings. In each case, we observed defects in L2 development.
Misexpression of the lateral inhibitory signal Delta in
L2-GAL4>UAS-Dl flies results in modest truncation of the L2 vein
in females (Fig. 5A) and almost
entirely eliminates the L2 vein in sibling males
(Fig. 5B), which are the
consistently more severely affected sex. The near elimination of L2
development in severely affected Dl-misexpressing males is
accompanied by a loss of rho expression in the L2 primordium of third
instar larval wing discs (Fig.
5D), compare with wild-type rho expression in
Fig. 5C). Misexpression of the
proneural gene sc in the L2 primordium of L2-GAL4>UAS-sc
flies results in L2 veins covered with ectopic bristles
(Fig. 5E). The great majority
of these ectopic bristles are strictly confined to the L2 primordium,
consistent with the double label experiments
(Fig. 2C) indicating that the
L2-enhancer element drives gene expression precisely in the L2 primordium. In
addition, ectopic bristles form sporadically in a broad posterior domain of
the wing, which derives from a region of the wing disc in which the L2
enhancer element is also expressed in a weak diffuse pattern
(Fig. 2B,D). Finally,
misexpression of the ara gene in L2-GAL4>UAS-ara flies
causes a reproducible thinning of the L2 vein
(Fig. 5F). Cumulatively, these
results underscore the importance of excluding expression of non-L2 vein genes
from the L2 primordium.
|
The L2-GAL4 driver can be used as a tool to dissect gene function and
range of action
As discussed above, the L2-GAL4 driver activates UAS transgene expression
precisely in the L2 primordium. The ability to drive highly localized
expression of genes in a non-essential tissue with L2-GAL4 suggests that this
driver could be used as an effective tool to dissect the function and range of
action of various genes. For example, since the eagle (eg)
gene encodes a steroid hormone receptor closely related to Kni and Knrl
(Rothe et al., 1989
) we
wondered whether this gene could substitute for kni or knrl
in rescuing kniri[1] mutants. eg is involved in
neuroblast specification during embryogenesis
(Higashijima et al., 1996
;
Dittrich et al., 1997
;
Lundell and Hirsh, 1998
), but
is not expressed in the wing pouch (data not shown) and is not known to play a
role in development of the wing proper. We found that, as in
L2-GAL4>UAS-kni;
kniri[1]/kniri[1] individuals, L2
formation is rescued in L2-GAL4>UAS-eg;
kniri[1]/kniri[XT2] flies, however,
this restored `L2' vein is decorated with a line of ectopic sensory bristles
(Fig. 6A). As the same ectopic
bristles are observed in L2-GAL4>UAS-eg individuals (data not
shown), this phenotype can be attributed to misexpressing eg in the
L2 primordium. By employing the L2 expression system it should now be possible
to map the domain in Eg that is responsible for inducing ectopic bristles
using chimeric Eg/Kni receptors.
|
The L2 expression system should also be useful in distinguishing
cell-autonomous from non cell-autonomous gene activity. As a test of this idea
we compared the phenotypes resulting from driving expression of an activated
form of the Egfr (
top) in the L2 primordium versus expression of the
secreted Egf-like ligands Vein (Schnepp et
al., 1996
) and sSpitz
(Schweitzer et al., 1995
;
Schnepp et al., 1998
).
Consistent with
top acting in a cell autonomous fashion to promote
vein versus intervein development, expression of this gene in the L2
primordium of L2-GAL4>UAS-
top wings
(Fig. 6B) had no effect on the
development of the L2 vein or neighboring intervein cells. In contrast, when
secreted Egf ligands were expressed in a similar fashion in
L2-GAL4>UAS-vn wings (Fig.
6C) or in L2-GAL4>UAS-sspi wings
(Fig. 6D), we observed ectopic
veins that formed 2-3 cell diameters away from the L2 vein. Similarly, when we
co-expressed rho and Star in the L2 primordium (e.g. in
L2-GAL4>UAS-rho; UAS-Star wings;
Fig. 6E), which also generates
a potent secreted Egfr promoting activity
(Guichard et al., 1999
), we
observed ectopic veins that were displaced from the endogenous L2 vein by a
few cells. The ability of secreted ligands, but not the
top
construct, to induce ectopic vein formation at a distance cannot be attributed
simply to the latter being a weaker activator of Egfr signaling since
UAS-
top is considerably more effective at generating ectopic
veins than UAS-vn when other wing-GAL4 drivers are used (e.g.
MS1096-GAL4 or CY2-GAL4, data not shown).
We also observed a non cell-autonomous activity of the Wingless (Wg) ligand in L2-GAL4>UAS-wg wings (Fig. 6F), which had ectopic veins displaced from the endogenous L2 as well as ectopic marginal bristles near the intersection of L2 with the margin. These ectopic marginal bristles always formed on the appropriate surface of the wing (Fig. 6F, insert), suggesting that this phenotype may result from the inappropriate activation of the wing margin genetic program.
| DISCUSSION |
|---|
|
|
|---|
ri mutants are L2-enhancer specific regulatory alleles of
the kni locus
The results described in this study demonstrate definitively that
ri mutations are regulatory alleles of the kni locus
disrupting the function of a cis-regulatory enhancer element that
drives gene expression in the L2 primordium of wing imaginal discs. A crucial
line of evidence supporting this conclusion is that mutant versions of the L2
enhancer incorporating either the 252 bp deletion present in
kniri[1] or the single base pair substitution present in
kniri[53j] eliminate the ability of this element to direct
gene expression in the L2 primordium. In addition, it is possible to
completely rescue the vein-loss phenotype of kniri[1] by
expressing either the UAS-kni or UAS-knrl transgenes with an
L2-GAL4 driver. Consistent with activation of rho being one of the
key effectors of kni/knrl function, it is also possible to rescue the
L2 vein-loss phenotype of kniri[1] by expressing a
UAS-rho transgene in L2, although rescue is less complete and
penetrant than that observed with UAS-kni or UAS-knrl.
The isolation of the L2 enhancer also addresses an unresolved question
regarding the basis for the failure of Df(3L)kniri[XT2]
and Df(3L)kniFC82 to complement
(Lunde et al., 1998
). As these
two deletions have endpoints that break within the same 1.7 kb EcoRI
fragment (indicated by the dashed vertical lines in
Fig. 1E), one explanation for
the failure of complementation could be that this 1.7 kb fragment contains the
L2 enhancer. The alternative explanation for the ri phenotype of
Df(3L)kniri[XT2]/Df(3L)kniFC82 is that
transvection (Lewis, 1954
;
Geyer et al., 1990
;
Pirrotta, 1999
), which
normally occurs between regulatory and coding region alleles of the
kni locus (Lunde et al.,
1998
), is interrupted by the large divergent deletions that have
little if any overlap. Since the 4.8 EcoRI fragment containing the L2
enhancer maps nearly 10 kb upstream of the 1.7 kb EcoRI fragment, and
a lacZ fusion construct (abd-lacZ,
Fig. 1E) containing the 1.7 kb
EcoRI fragment does not drive any gene expression in the wing disc
(Lunde et al., 1998
), the
latter hypothesis that Df(3L)kniri[XT2] and
Df(3L)kniFC82 are unable to engage in effective
transvection is the most likely explanation for the failure of these two
mutations to complement.
Global activation, regional repression and localized induction
restrict L2-enhancer activity to a narrow stripe of cells
The results of these and previous studies of L2 vein initiation lead to a
model in which localized vein inductive signaling acts against a background of
regional repression and global wing-specific activation
(Fig. 7A). Previous genetic
experiments have suggested a model in which sal-expressing cells
produce a short-range L2 inducing signal (X) to which sal-expressing
cells themselves cannot respond
(Sturtevant et al., 1997
;
Lunde et al., 1998
). According
to this `for export only' signaling model, the signal X diffuses into adjacent
anterior cells and activates expression of the kni/knrl genes in the
L2 primordium, in much the same fashion as Hh, expressed from the refractory
posterior compartment, activates expression of target genes such as
dpp or ptc in the anterior compartment (reviewed by
Bier, 2000
). Based on the
analysis of the L2 enhancer element described in this study, the 252 bp region
deleted in kniri[1] mutants may contain response
element(s) to this putative factor X. It is worth noting, however, that
lacZ expression is lost in all cells of the wing disc (posterior and
circumferential cells as well as the L2 primordium) when these sequences are
deleted from the 4.8 kb fragment. This observation suggests that sequences
mediating more general activation (e.g. Sd binding sites, see below) may also
be contained within this 252 bp region. The sequence surrounding the single
nucleotide alteration in kniri[53j] mutants (C596A),
however, is a particularly intriguing candidate for mediating the L2-specific
activation of kni since introducing this mutation in the context of
the minimal 1.4 kb enhancer leads to selective loss of lacZ
expression only in the stripe of cells adjacent to the sal
domain.
The hypothetical transcription factor X'
(Fig. 7B) that binds to the
region surrounding the kniri[53j] point mutation and
mediates the inductive signal X presumably collaborates with the more
generally required wing selector Sd
(Halder et al., 1998
;
Guss et al., 2001
), since
mutation of four of the Sd binding sites (the doublet and two single sites) in
the L2 activation domain completely eliminates enhancer activity in the wing
disc. Clonal analysis with a hypomorphic sd allele also indicates
that sd is required for high-level expression of the full 4.8 kb L2
enhancer element in the wing disc. It is notable that the reduction in
lacZ expression in these clones is not as dramatic as the complete
loss of L2 activity observed when Sd binding sites in the activation domain
are mutated. There are several possible explanations for this discrepancy.
Firstly, the sd mutation used in these experiments is a hypomorphic
allele and therefore has residual activity. Unfortunately, stronger
sd alleles produce even smaller viable clones in the wing disc and
thus were not used. Secondly, as only small clones can be generated, they must
typically have been produced with only two or three intervening cycles of cell
division. Consequently, the sd cells may still
contain functional levels of wild type Sd (protein perdurance). Another
possibility is that other activators can partially substitute for Sd, at least
in certain regions of the wing. Based on the absence of L2 activity when Sd
binding sites are mutated and the reduction in L2 activity in
sd hypomorphic clones, we conclude that Sd plays an
important role as an activator of the L2 enhancer. These results support the
view that Sd functions as a general transcriptional activator of genes
expressed in the wing field.
Repression also plays a key role in restricting L2 enhancer expression to a
narrow stripe of wing disc cells. It has been shown previously that
salm and salr, which are expressed strongly in the central
region of the wing, repress expression of kni and knrl
(Lunde et al., 1998
), although
low levels of sal may also be required to activate kni
expression (de Celis and Barrio,
2000
). In the current study we also find evidence for repression
of L2-enhancer activity in peripheral wing disc cells abutting those
expressing high levels of sal. Truncation of the minimal 1.4 kb
(fragment EX) L2 enhancer element results in reporter gene expression
expanding to fill the anterior and posterior regions of the wing pouch in a
pattern complementary to that of sal. The region deleted from the EX
fragment contains several consensus binding sites for Brinker
(Fig. 3B,
Fig. 7B)
(Rushlow et al., 2001
;
Zhang et al., 2001
), which may
mediate this repression since the pattern of brinker (brk)
expression in the wing pouch (Campbell and
Tomlinson, 1999
; Jazwinska et
al., 1999
) is very similar to that of lacZ expression
driven by the 0.69 kb fragment EC. One way to integrate the action of the
localized inductive signal X
X' pathway with that of abutting
central and peripheral repressive factors is to propose that the
signal-dependent activator X' can overcome the repressive action of the
peripheral inhibitor but not repression by Salm/Salr (see legend to
Fig. 7). One feature common to
several prominent signaling pathways is that activation of the pathway
converts a resting repressor into a transcriptional activator
(Barolo and Posakony, 2002
). In
the kni L2 enhancer, activation of the hypothetical signal X pathway
may relieve repression by a heterologous repressor since the putative
activator (i.e. X') and repressor (e.g. Brk?) sequences in the L2
enhancer are separable. One example of a signaling pathway that functions by
relieving inhibition by a heterologous repressor is the recent report of Egfr
signaling inactivating repression by Suppressor of Hairless (Su(H))
(Tsuda et al., 2002
). In
addition to central and peripheral repression in the wing disc, there may also
be a repressor in posterior compartment cells (e.g. En,
Fig. 7A,B) to prevent
activation of the L2 enhancer in cells posterior to the sal
expression domain. Perhaps the 4.8 kb L2 enhancer element lacks some sites for
this putative repressor since E-lacZ drives significantly higher
levels of gene expression in the posterior stripe than that observed for
endogenous kni or knrl expression.
Expression of non-L2 vein genes must be excluded from the L2
primordium
All longitudinal veins share several morphological characteristics such as
being composed of densely packed cells on both the dorsal and ventral surfaces
of the wing that secrete a thickened cuticle. The primordia of all
longitudinal veins also express the rhomboid gene, which is required
for activating the Egfr pathway in vein but not in intervein cells. In
addition to these shared properties, each vein can be distinguished by
expression of other vein genes (Biehs et
al., 1998
). For example, vein L2-specific characteristics include:
expression of kni and knrl, lack of Delta expression, lack
of cauplara expression, and lack of ac/sc expression. Given
that all veins are ultimately quite similar morphologically, it is relevant to
ask whether the differences in gene expression patterns observed in different
veins are important.
In this study, we examined the necessity of excluding expression of non-L2 vein genes in the L2 primordium by forcing expression of genes such as Dl, ara, ac and sc in L2 and asking whether this manipulation had any impact on L2 development. These experiments strongly suggest that exclusion of non-L2 vein genes from the L2 primordium is indeed important since misexpression of each of these genes resulted in abnormal L2 development. The phenotypes resulting from misexpressing non-L2 vein genes in the L2 primordium can largely be reconciled with the normal functions of these genes. For example, forced expression of Dl leads to loss of L2, consistent with suppression of vein formation by Notch signaling. The ectopic bristles that form strictly along the L2 vein in wings misexpressing ac or sc are also consistent with the neural promoting function of proneural genes. It is less clear why misexpression of the ara gene causes thinning of the L2 primordium, since this gene normally activates expression of the vein-promoting gene rho in odd numbered veins and ac and sc in the L3 primordium. Perhaps expression of a gene normally involved in development of the odd numbered dorsal veins is somehow incompatible with development of the ventral L2 vein.
The L2 expression system provides a localized assay for gene function
in the wing
The sharp stripe of gene expression driven by L2-GAL4 can also be used as a
rapid assay to test the function or range of action of various genes in the
wing. For example, in the case of the Egfr pathway, it is possible to
distinguish components exerting cell-autonomous versus non cell-autonomous
functions. In line with the fact that activation of the Egfr pathway in the
wing leads to the formation of veins, L2-GAL4-driven expression of the
secreted ligand sSpi generates ectopic veins in the neighborhood of L2 while
expression of the equally potent constitutively active
top form of the
EGF receptor does not result in a non-autonomous phenotype. The L2 expression
system may also be used to compare the functions of related genes such as the
nuclear receptors Kni, Knrl, and Eg. Although these three transcription
factors share nearly identical DNA binding domains and can all rescue the
vein-loss phenotype of ri mutants, they differ in that misexpression
of eg in the L2 primordium induces the formation of ectopic bristles
along L2. This distinct activity of eg may relate to its normal
embryonic function in directing cell fate choices in the CNS. Using the L2
expression system as an assay, it should be straightforward to map the domain
in eg that is responsible for its neural inducing capacity by
constructing chimeric molecules composed of different domains of Eg and Kni.
Finally, the observation that L2-driven expression of Dl leads to a
highly penetrant loss of L2 in males and a consistently weaker phenotype in
females provides the basis for a modifier screen to identify mutations that
either suppress the phenotype in males or enhance the phenotype in females.
Some of the modifier loci identified in such a screen, which are not
specifically involved in Notch signaling, may encode components of the
hypothesized factor X
X' pathway.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ades, S. E. and Sauer, R. T. (1994).
Differential DNA-binding specificity of the Engrailed homeodomain: the role of
residue 50. Biochemistry
33,9187
-9194.[CrossRef][Medline]
Arajärvi, P. and Hannah-Alava, A. (1969).
Cytogenetic mapping of in and ri. Dros. Inf.
Serv. 44,73
-74.
Barolo, S. and Posakony, J. (2002). Three
habits of highly effective signaling pathways: principles of transcriptional
control by developmental cell signaling. Genes Dev.
16,1167
-1181.
Barrio, R., Shea, M. J., Carulli, J., Lipkow, K., Gaul, U.,
Frommer, G., Schuh, R., Jäckle, H. and Kafatos, F. C.
(1996). The spalt-related gene of Drosophila
melanogaster is a member of an ancient gene family, defined by the
adjacent, region-specific homeotic gene spalt. Dev. Genes
Evol. 206,315
-325.[CrossRef]
Biehs, B., Sturtevant, M. A. and Bier, E.
(1998). Boundaries in the Drosophila wing imaginal discs
organize vein-specific genetic programs. Development
125,4245
-4257.[Abstract]
Bier, E. (1998a). Localized activation of
RTK/MAPK pathways during development. BioEssays
20,189
-194.[CrossRef][Medline]
Bier, E. (1998b). EGF-Receptor and
TGF-ß-like Dpp signaling during Drosophila development. In
Hormones and Growth Factors in Development and
Neoplasia (ed. R. B. Dickson and D. S. Solomon), pp.19
-43. New York: Wiley & Sons.
Bier, E. (2000). Drawing lines in the
Drosophila wing: initiation of wing vein development.
Curr. Opin. Genet. Dev.
10,393
-398.[CrossRef][Medline]
Bier, E., Jan, L. Y. and Jan, Y. N. (1990).
rhomboid, a gene required for dorsoventral axis establishment and
peripheral nervous system development in Drosophila melanogaster.Genes Dev. 4,190
-203.
Brand, A. H. and Perrimon, N. (1993). Targeted
gene expression as a means of altering cell fates and generating dominant
phenotypes. Development
118,401
-415.[Abstract]
Campbell, G. and Tomlinson, A. (1999).
Transducing the Dpp morphogen gradient in the wing of Drosophila:
regulation of Dpp targets by brinker. Cell
96,553
-562.[CrossRef][Medline]
Chien, C. T., Hsiao, C. D., Jan, L. Y. and Jan, Y. N.
(1996). Neuronal type information encoded in the
basic-helix-loop-helix domain of proneural genes. Proc. Natl. Acad.
Sci. USA 93,13239
-13244.
de Celis, J. F. and Barrio, R. (2000). Function
of the spalt/spalt-related gene complex in positioning the veins in
the Drosophila wing. Mech. Dev.
91, 31-41.[CrossRef][Medline]
de Celis, J. F., Bray, S. and García-Bellido, A.
(1997). Notch signaling regulates veinlet expression and
establishes boundaries between veins and interveins in the Drosophila
wing. Development 124,1919
-1928.[Abstract]
Dittrich, R., Bossing, T., Gould, A. P., Technau, G. M. and
Urban, J. (1997). The differentiation of the serotonergic
neurons in the Drosophila ventral nerve cord depends on the combined function
of the zinc finger proteins Eagle and Huckebein.
Development 124,2515
-2525.[Abstract]
Emery, J. (1996). An Analysis of
Cis-Regulatory Regions of Pan-Neural Genes in Drosophila
melanogaster. Ph.D. Thesis, University of California, San Diego, La
Jolla, CA.
García-Bellido, A. (1977). Inductive
mechanisms in the process of wing vein formation in Drosophila.Wilhelm Roux's Arch. Dev. Biol.
182,93
-106.[CrossRef]
García-Bellido, A. and de Celis, J. F.
(1992). Developmental genetics of the venation pattern of
Drosophila. Annu. Rev. Genet.
26,277
-304.[CrossRef][Medline]
Geyer, P. K., Green, M. M. and Corces, V. G.
(1990). Tissue-specific enhancers may act in trans on the gene
located in the homologous chromosome: the molecular basis of transvection in
Drosophila. EMBO J. 9,2247
-2256.[Medline]
Golic, K. G. (1991). Site-specific
recombination between homologous chromosomes in Drosophila.Science 252,958
-961.
Gomez-Skarmata, J. L., del Corral, R. D., de la Calle-Mustienes,
E., Ferre-Marco, D. and Modolell, J. (1996). araucan
and caupolican, two members of the novel iroquois complex,
encode homeoproteins that control proneural and vein-forming genes.
Cell 85,95
-105.[CrossRef][Medline]
Guichard, A., Biehs, B., Sturtevant, M. A., Wickline, L.,
Chacko, J., Howard, K. and Bier, E. (1999). rhomboid
and Star interact synergistically to promote EGF-R/MAPK signaling
during Drosophila wing vein development.
Development 126,2663
-2676.[Abstract]
Guss, K. A., Nelson, C. E., Hudson, A., Kraus, M. E. and
Carroll, S. B. (2001). Control of a genetic regulatory
network by a selector gene. Science
292,1164
-1167.
Halder, G., Polaczyk, P., Kraus, M. E., Hudson, A., Kim, J.,
Laughon, A. and Carroll, S. (1998). The Vestigial and
Scalloped proteins act together to directly regulate wing-specific gene
expression in Drosophila. Genes Dev.
12,3900
-3909.
Halder, G. and Carroll, S. (2001). Binding of
the Vestigial co-factor switches the DNA-target selectivity of the Scalloped
selector protein. Development
128,3295
-3305.
Higashijima, S., Shishido, E., Matsuzaki, M. and Saigo, K.
(1996). eagle, a member of the steroid receptor gene
superfamily, is expressed in a subset of neuroblasts and regulates the fate of
their putative progeny in the Drosophila CNS.
Development 122,527
-536.[Abstract]
Jazwinska, A., Kirov, N., Wieschaus, E., Roth, S. and Rushlow,
C. (1999). The Drosophila gene brinker
reveals a novel mechanism of Dpp target gene regulation.
Cell 96,563
-573.[CrossRef][Medline]
Kim, J., Sebring, A., Esch, J. J., Kraus, M. E., Vorwerk, K.,
Magee, J. and Carroll, S. B. (1996). Integration of
positional signals and regulation of wing formation and identity by Drosophila
vestigial gene. Nature
382,133
-138.[CrossRef][Medline]
Kim, J., Johnson, K., Chen, H. J., Carroll, S. and Laughon,
A. (1997). Drosophila Mad binds to DNA and directly
mediates activation of vestigial by Decapentaplegic.
Nature 388,304
-308.[CrossRef][Medline]
Kinzler, K. W. and Vogelstein, B. (1990). The
GLI gene encodes a nuclear proten which binds specific sequences in the human
genome. Mol. Cell Biol.
10,634
-642.
Klein, T. (2001). Wing disc development in the
fly: the early stages. Curr Opin. Genet. Dev.
4, 470-475.
Kooh, P. J., Fehon, R. G. and Muskavitch, M. A.
(1993). Implications of dynamic patterns of Delta and Notch
expression for cellular interactions during Drosophila development.
Development 117,493
-507.[Abstract]
Kühnlein, R. P., Frommer, G., Friedich, M.,
González-Gaitán, M., Weber, A., Wagner-Bernholz, J. F., Gehring,
W. J., Jäckle, H. and Schuh, R. (1994). spalt
encodes an evolutionarily conserved zinc finger protein of novel structure
which provides homeotic gene function in the head and tail region of the
Drosophila embryo. EMBO J.
13,168
-179.[Medline]
Lawrence, P. A. and Struhl, G. (1996).
Morphogens, compartments, and pattern: lessons from Drosophila?Cell 85,951
-961.[CrossRef][Medline]
Lehmann, R. (1985).Regionsspezifische Segmentierungsmutanten bei Drosophila
melanogaster Meigen
. Ph.D. Thesis, University of Tübingen,
Germany.
Lewis, E. B. (1954). The theory and application
of a new method of detecting chromosomal rearrangements in Drosophila
melanogaster. Am. Nat. 88,225
-239.[CrossRef]
Lindsley, D. L. and Grell, E. H. (1968).Genetic Variations in Drosophila melanogaster
.
Washington, D.C.: Carnegie Institute of Washington.
Lindsley, D. L. and Zimm, G. G. (1992).
The Genome of Drosophila melanogaster. San Diego:
Academic Press Inc.
Lunde, K., Biehs, B., Nauber, U. and Bier, E.
(1998). The knirps and knirps-related genes
organize development of the second wing vein in Drosophila.Development 125,4145
-4154.[Abstract]
Lundell, M. J. and Hirsh, J. (1998).
eagle is required for the specification of serotonin neurons and
other neuroblast 7-3 progeny in the Drosophila CNS.
Development 125,463
-472.[Abstract]
Montagne, J., Groppe, J., Guillemin, K., Krasnow, M. A.,
Gehring, W. J. and Affolter, M. (1996). The
Drosophila Serum Response Factor gene is required for the formation
of intervein tissue of the wing and is allelic to blistered.
Development 122,2589
-2597.[Abstract]
Müller, H. J. (1941). Induced mutations in
Drosophila. Cold Spring Harbor Symp. Quant. Biol.
9, 151-167.
Nauber, U., Pankratz, M. J., Kienlin, A., Seifert, E., Klemm, U.
and Jäckle, H. (1988). Abdominal segmentation of the
Drosophila embryo requires a hormone receptor-like protein encoded by
the gap gene knirps. Nature
336,489
-492.[CrossRef][Medline]
Nelson, H. and Laughon, A. (1993).
Drosophila glial architecture and development: analysis using a
collection of new cell-specific markers. Roux's Arch. Dev.
Biol. 202,341
-354.[CrossRef]
Noll, R., Sturtevant, M. A., Gollapudi, R. R. and Bier, E.
(1994). New functions of the Drosophila rhomboid gene
during embryonic and adult development are revealed by a novel genetic method,
enhancer piracy. Development
120,2329
-2338.[Abstract]
Nüsslein-Volhard, C. and Wieschaus, E.
(1980). Mutations affecting segment number and polarity in
Drosophila. Nature 287,795
-801.[CrossRef][Medline]
O'Neill, J. W. and Bier, E. (1994).
Double-label in situ hybridization using biotin and digoxigenin
tagged RNA probes. BioTechniques
17,870
-875.
Oro, A. E., Ong, E. S., Margolis, J. S., Posakony, J. W.,
McKeown, M. and Evans, R. M. (1988). The Drosophila
gene knirps-related is a member of the steroid-receptor gene
superfamily. Nature 336,493
-496.[CrossRef][Medline]
Pankratz, M. J., Busch, M., Hoch, M., Seifert, E. and Jackle,
H. (1992). Spatial control of the gap gene knirps in
the Drosophila embryo by posterior morphogen system.
Science 255,986
-989.
Parody, T. R. and Muskavitch, M. A. (1993). The
pleiotropic function of Delta during postembryonic development of
Drosophila melanogaster. Genetics
135,527
-539.[Abstract]
Pirrotta, V. (1999). Transvection and
chromosomal trans-interaction effects. Biochim. Biophys.
Acta 1424,M1
-M8.[Medline]
Roberts, D. B. (1986). Basic
Drosophila care and techniques. In Drosophila: A Practical
Approach (ed. D. B. Roberts), pp. 1-38.
Washington, DC: IRL Press.
Rothe, M., Nauber, U. and Jäckle, H.
(1989). Three hormone receptor-like Drosophila genes
encode an identical DNA-binding finger. EMBO J.
8,3087
-3094.[Medline]
Rothe, M., Pehl, M., Taubert, H. and Jackle, H.
(1992). Loss of gene function through rapid mitotic cycles in the
Drosophila embryo. Nature
359,156
-159.[CrossRef][Medline]
Rushlow, C., Colosimo, P. F., Lin, M. C., Xu, M. and Kirov,
N. (2001). Transcriptional regulation of the
Drosophila gene zen by competing Smad and Brinker inputs.
Genes Dev. 15,340
-351.
Schnepp, B., Grumbling, G., Donaldson, T. and Simcox, A.
(1996). Vein is a novel component in the Drosophila
epidermal growth factor receptor pathway with similarity to the neuregulins.
Genes Dev. 10,2302
-2313.
Schnepp, B., Donaldson, T., Grumbling, G., Ostrowski, S.,
Schweitzer, R., Shilo, B.-Z. and Simcox, A. (1998). EGF
domain swap converts a Drosophila EGF receptor activator into an
inhibitor. Genes Dev.
12,908
-913.
Schweitzer, R., Shaharabany, M., Seger, R. and Shilo, B.-Z.
(1995). Secreted Spitz triggers the DER signaling pathway and is
a limiting component in embryonic ventral ectoderm determination.
Genes Dev. 9,1518
-1529.
Shellenbarger, D. L. and Mohler, J. D. (1978).
Temperature-sensitive periods and autonomy of pleiotropic effects of
l(1)Nts 1, a conditional Notch
lethal in Drosophila. Dev. Biol.
62,423
-446.
Shimell, M. J., Simon, J., Bender, W. and O'Connor, M. B.
(1994). Enhancer point mutation results in a homeotic
transformation in Drosophila. Science
264,968
-971.
Simcox, A., Grumbling, G., Schnepp, B., Bennington-Mathias, C.,
Hersperger, E. and Shearn, A. (1996). Molecular, phenotypic,
and expression analysis of vein, a gene required for growth of the
Drosophila wing disc. Dev. Biol.
177,475
-489.[CrossRef][Medline]
Simmonds, A. J., Liu, X., Soanes, K. H., Krause, H. M., Irvine,
K. D. and Bell, J. B. (1998). Molecular interactions between
Vestigial and Scalloped promote wing formation in Drosophila. Genes
Dev. 12,3815
-3820.
Small, S., Blair, A. and Levine, M. (1996).
Regulation of two pair-rule stripes by a single enhancer in the
Drosophila embryo. Dev. Biol.
175,314
-324.[CrossRef][Medline]
Southern, E. M. (1975). Detection of specific
sequences among DNA fragments separated by gel electrophoresis. J.
Mol. Biol. 98,503
-517.[CrossRef][Medline]
Strigini, M. and Cohen, S. M. (1999). Formation
of morphogen gradients in the Drosophila wing. Semin. Cell
Dev. Biol. 3,335
-344.
Sturtevant, M. A., Roark, M. and Bier, E.
(1993). The Drosophila rhomboid gene mediates the
localized formation of wing veins and interacts genetically with components of
the EGF-R signaling pathway. Genes Dev.
7, 961-973.
Sturtevant, M. A. and Bier, E. (1995). Analysis
of the genetic hierarchy guiding wing vein formation in Drosophila.Development 121,785
-801.[Abstract]
Sturtevant, M. A., Roark, M., O'Neill, J. W., Biehs, B., Colley,
N. and Bier, E. (1996). The Drosophila Rhomboid
protein is concentrated in patches at the apical cell surface. Dev.
Biol. 174,298
-309.[CrossRef][Medline]
Sturtevant, M. A., Biehs, B., Marin, E. and Bier, E.
(1997). The spalt gene links the A/P compartment
boundary to a linear adult structure in the Drosophila wing.
Development 124,21
-32.[Abstract]
Tsuda, L., Nagaraj, R., Zipursky, S. L. and Banerjee, U.
(2002). An EGFR/Ebi/Sno pathway promotes Delta expression by
inactivating Su(H)/SMRTER repression during inductive Notch signaling.
Cell 110,625
-637.[CrossRef][Medline]
Waddington, C. H. (1940). The genetic control
of wing development in Drosophila. J. Genet.
41, 75-139.
Wharton, K. and Crews, S. (1993). CNS midline
enhancers of the Drosophila slit and Toll genes.
Mech. Dev. 40,141
-154.[CrossRef][Medline]
Zhang, H., Levine, M. and Ashe, H. L. (2001).
Brinker is a sequence-specific transcriptional repressor in the
Drosophila embryo. Genes Dev.
15,261
-266.
This article has been cited by other articles:
![]() |
A. Guichard, J. M. Park, B. Cruz-Moreno, M. Karin, and E. Bier From The Cover: Anthrax lethal factor and edema factor act on conserved targets in Drosophila PNAS, February 28, 2006; 103(9): 3244 - 3249. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Anderson, R. Bhandari, and J. P. Kumar A Genetic Screen Identifies Putative Targets and Binding Partners of CREB-Binding Protein in the Developing Drosophila Eye Genetics, December 1, 2005; 171(4): 1655 - 1672. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Mezey, D. Houle, and S. V. Nuzhdin Naturally Segregating Quantitative Trait Loci Affecting Wing Shape of Drosophila melanogaster Genetics, April 1, 2005; 169(4): 2101 - 2113. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Angulo, M. Corominas, and F. Serras Activation and repression activities of ash2 in Drosophila wing imaginal discs Development, October 15, 2004; 131(20): 4943 - 4953. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kwon, R. Hays, J. Fetting, and T. V. Orenic Opposing inputs by Hedgehog and Brinker define a stripe of hairy expression in the Drosophila leg imaginal disc Development, June 1, 2004; 131(11): 2681 - 2692. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Cook, B. Biehs, and E. Bier brinker and optomotor-blind act coordinately to initiate development of the L5 wing vein primordium in Drosophila Development, May 1, 2004; 131(9): 2113 - 2124. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||