spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

doi: 10.1242/10.1242/dev.00207


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lunde, K.
Right arrow Articles by Bier, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lunde, K.
Right arrow Articles by Bier, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 130, 235-248 (2003)
Copyright © 2003 The Company of Biologists Limited

Activation of the knirps locus links patterning to morphogenesis of the second wing vein in Drosophila

Karen Lunde1,2, Jennifer L. Trimble1, Annabel Guichard1, Kirsten A. Guss3, Ulrich Nauber4 and Ethan Bier1,*

1 Section of Cell and Developmental Biology, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0349, USA
2 Albert-Ludwigs-Universität Freiburg, Institut für Biologie I, Hauptstrasse 1, D-79104 Freiburg, Germany
3 Department of Biology, Dickinson College, PO Box 1773, Carlisle, PA 17013, USA
4 Max-Planck-Institut für biophysikalische Chemie, Abt. Molekulare Entwicklungsbiologie, Am Fassberg 11, D-37077 Göttingen, Germany

* Author for correspondence (e-mail: bier{at}biomail.ucsd.edu)

Accepted 3 October 2002


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The adjacent knirps (kni) and knirps-related (knrl) genes encode functionally related zinc finger transcription factors that collaborate to initiate development of the second longitudinal wing vein (L2). kni and knrl are expressed in the third instar larval wing disc in a narrow stripe of cells just anterior to the broad central zone of cells expressing high levels of the related spalt genes. Here, we identify a 1.4 kb cis-acting enhancer element from the kni locus that faithfully directs gene expression in the L2 primordium. We find that three independent ri alleles have alterations mapping within the L2-enhancer element and show that two of these observed lesions eliminate the ability of the enhancer element to direct gene expression in the L2 primordium. The L2 enhancer can be subdivided into distinct activation and repression domains. The activation domain mediates the combined action of the general wing activator Scalloped and a putative locally provided factor, the activity of which is abrogated by a single nucleotide alteration in the ri53j mutant. We also find that misexpression of genes in L2 that are normally expressed in veins other than L2 results in abnormal L2 development. These experiments provide a mechanistic basis for understanding how kni and knrl link AP patterning to morphogenesis of the L2 vein by orchestrating the expression of a selective subset of vein-promoting genes in the L2 primordium.

Key words: knirps, radius incompletus, L2 vein, wing, Drosophila melanogaster, Patterning, Morphogenesis


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
One of the important remaining questions in developmental biology is to understand how positional information is linked to the genesis of specific morphological structures in different locations of the organism. The Drosophila wing is a system that is particularly well suited for studying the relationship between patterning and morphogenesis. For example, mechanisms for establishing positional information along the anterior-posterior (AP) axis have been analyzed in detail (reviewed by Lawrence and Struhl, 1996Go; Strigini and Cohen, 1999Go; Klein, 2001Go) and morphological structures such as the five major longitudinal veins (L1-L5) form at invariant positions along the AP axis of the adult wing (reviewed by García-Bellido and de Celis, 1992Go; Bier, 2000Go). As described below, the five wing veins can be distinguished from one another by several criteria including: expression of specific combinations of genes during development; whether they are located primarily on the dorsal or ventral surfaces of the wing (odd versus even numbered veins respectively); and by the types or absence of sensory organs that form along them (e.g. sensory organs form on the L1 and L3 veins, but not on the L2, L4 or L5 veins). An interesting question then, is how vein-specific as well as more general vein developmental programs are initiated at various locations in response to different positional information.

Wing vein development in Drosophila can be subdivided into two temporally distinct stages: initiation and differentiation. Vein initiation begins during the mid-third larval instar (Waddington, 1940Go; García-Bellido, 1977Go; García-Bellido and de Celis, 1992Go; Sturtevant et al., 1993Go; Sturtevant and Bier, 1995Go; Bier, 2000Go) when the wing imaginal disc is a monolayer of cells. The wing blade proper derives from an oval region of the wing disc known as the wing pouch, while the remainder of the disc generates elements of the wing hinge and thoracic body wall. Vein differentiation, the second phase of vein development, occurs during metamorphosis as the wing disc buds out (or everts), folding along the future wing margin. Ultimately, this eversion leads to the apposition of the dorsal and ventral surfaces of the wing during pupal development, creating the bilayer of cells comprising the mature wing blade.

Genes involved in initiating wing vein development (vein genes) are expressed during the third larval instar in narrow stripes, corresponding to vein primordia, or in broader `provein' stripes, consisting of cells that are competent to become vein cells (Biehs et al., 1998Go). Some vein genes are expressed in all vein primordia, while others are expressed in subsets of veins or in single veins. For example rhomboid (rho), which encodes an integral membrane protein (Bier et al., 1990Go; Sturtevant et al., 1996Go), is expressed in all vein primordia and promotes vein formation throughout wing development by locally activating the Egfr signaling pathway (Sturtevant et al., 1993Go; Noll et al., 1994Go; Bier, 1998aGo; Bier, 1998bGo; Guichard et al., 1999Go). caupolican (caup) and the neighboring gene araucan (ara) encode related homeobox genes that promote expression of other vein genes such as rho in odd numbered veins. Proneural genes such as achaete (ac) and scute (sc) promote neural development in the L1 and L3 primordium (Gomez-Skarmata et al., 1996Go). Delta (Dl) encodes a ligand for the Notch (N) receptor, which mediates lateral inhibitory interactions among cells in vein-competent domains during pupal development (Shellenbarger and Mohler, 1978Go; Kooh et al., 1993Go; Parody and Muskavitch, 1993Go). Delta is also expressed earlier during larval stages of wing development in all longitudinal veins except L2, and is likely to play a role in limiting vein thickness at this stage as well, since loss of Notch function during larval development leads to greatly broadened expression of the vein marker rho (Sturtevant and Bier, 1995Go). kni and knrl, which encode related zinc finger transcription factors in the steroid hormone superfamily (Nauber et al., 1988Go; Oro et al., 1988Go; Rothe et al., 1989Go), are expressed in a single stripe corresponding to the L2 primordium beginning in the mid-third larval instar, and are required to initiate L2 development (Lunde et al., 1998Go). kni also functions as a gap gene in early embryonic development (Nüsslein-Volhard and Wieschaus, 1980Go; Nauber et al., 1988Go).

The L2 stripe of kni/knrl-expressing cells forms along the anterior border of a broad domain of cells expressing high levels of the related and functionally overlapping spalt-major (salm) (Kühnlein et al., 1994Go) and spalt-related (salr) (Barrio et al., 1996Go) zinc finger transcription factors. A variety of evidence indicates that central domain cells expressing the patterning genes salm and salr (together referred to as sal) induce their anterior neighbors, which express very low levels of sal, to become the L2 primordium (Sturtevant et al., 1997Go; Lunde et al., 1998Go). For example, in wings containing salm-mutant clones, ectopic branches of L2 are induced that track along and inside the salm- clone borders, mimicking the normal situation in which an L2 vein forms just outside the domain of high-level sal-expressing cells (Sturtevant et al., 1997Go). This ability of sal-expressing cells to induce their anterior low-level sal-expressing neighbors to initiate L2 development requires the activity of the kni locus (Lunde et al., 1998Go). The induction of kni/knrl expression in the L2 primordium therefore provides an excellent system for studying the transition from spatial patterning to tissue morphogenesis.

Once activated along the anterior sal border, kni and knrl organize development of the L2 vein, in part by activating expression of the key vein-promoting gene rho and by suppressing expression of the intervein gene blistered (bs) (Montagne et al., 1996Go; Lunde et al., 1998Go). The kni locus is highly selective in regulating downstream gene expression in the L2 primordium as revealed by the observation that several genes expressed in other veins, such as caup and ara, ac and sc, and Delta, are excluded from the L2 primordium. Thus, the kni locus links patterning to vein-specific morphogenesis by functioning downstream of sal and upstream of genes involved in vein versus intervein development.

The role of the kni locus in L2 formation has been clarified by analysis of likely regulatory alleles of the kni locus, previously known as radius incompletus (ri) (Arajärvi and Hannah-Alava, 1969Go; Lunde et al., 1998Go). Flies with this mutation lack large sections of the L2 vein. kniri mutants are homozygous viable, in contrast to kni null mutants, which die as embryos with a gap gene phenotype (Nüsslein-Volhard and Wieschaus, 1980Go; Nauber et al., 1988Go). In support of kniri mutations being wing-specific regulatory alleles of the kni/knrl locus, expression of kni and knrl in the L2 primordium is absent in kniri[1] mutants, and the L2 vein-loss phenotype can be partially rescued by ubiquitous expression of kni in the wing (Lunde et al., 1998Go).

The findings summarized above suggest that kni and knrl organize the L2 vein developmental program by orchestrating expression of genes that execute distinct subsets of functions required for proper L2 development. Several important unanswered questions remain, including: what function(s) are disrupted in kniri[1] and other existing kniri mutants?; do these mutations eliminate the function of an L2-specific cis-regulatory element in the kni locus?; and finally, with respect to the definition of L2 versus other veins, is it important to exclude expression of genes expressed in veins other than the L2 primordium?

In this study we report the identification of an enhancer element upstream of the kni coding region that selectively directs gene expression in the L2 primordium in third instar larval wing discs. We show that three separate ri alleles have defects mapping within a minimal 1.4 kb L2 enhancer element. We demonstrate that two of these mutations eliminate activity of the L2 enhancer, kniri[1], which contains a 252 bp deletion, and kniri[53j], which harbors a single base-pair substitution. We find that truncation of the minimal L2 enhancer to a 0.69 kb fragment leads to ectopic reporter gene expression in the extreme anterior and posterior regions of the wing, indicating that repression contributes to restricting activation of the L2 enhancer. In addition, we show that the general wing promoting transcription factor Scalloped (Sd) binds with high affinity to several sites in the L2 enhancer and that sd is required for kni expression in the wing disc. We have also employed the L2 enhancer element as a tool to drive expression of various UAS transgenes in the L2 primordium. We find that the loss of the L2 vein in ri mutants can be rescued by L2-specific expression of either the kni or knrl genes, or the downstream target gene rho. In addition, we find that misexpression of genes in the L2 primordium that are normally expressed in veins other than L2 results in abnormal L2 development. These results provide a framework for understanding how positional information is converted into morphogenesis of the L2 wing vein by `vein organizing genes' such as kni and knrl.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Fly stocks
The weak kniri[M3] allele isolated by J. Díaz-Benjumea was kindly provided by Antonio Gárcia-Bellido (Universidad Autonoma de Madrid); Ruth Lehmann (Skirball Institute, New York) provided the strong viable Df(3L)kniri[XT2] allele and the Df(3L)kniFC82 stock (Lehmann, 1985Go); Peter Portin (University of Turku) provided the kniri[92f] allele; Yuh Nung Jan provided the UAS-scute stock (Chien et al., 1996Go); Juan Modolell (Universidad Autonoma De Madrid) provided the UAS-ara and UAS-caup stocks; Amanda Simcox (Ohio State University) provided the UAS-vein stock (Simcox et al., 1996Go); Joachim Urban (Universitat Mainz) provided the UAS-eg stock (Dittrich et al., 1997Go); Ken Irvine (Waksman Institute) provided the w sd58 P{ry+, hs-neo, FRT} 18A stock, and Seth Blair (University of Wisconsin-Madison) provided the hsflp3MKRS/TM6B stock. kniri[M*] and kniri[53j] were obtained from the Bowling Green Stock Center, where they have since been abandoned. kniri[53j] is a medium-strength homozygous viable allele isolated by Irwin Oster, a student of H. J. Müller, and kniri[M*] is a medium-strength homozygous ri allele from the collection of H. J. Müller (Müller, 1941Go). Other mutant lines, including the medium-strength kniri[1] allele, balancers and chromosomal markers were obtained from either the Bloomington Indiana Stock Center or the Tübingen Stock Center and are described by Lindsley and Grell (Lindsley and Grell, 1968Go) and Lindsley and Zimm (Lindsley and Zimm, 1992Go).

Vector construction
Genomic fragments spanning the majority of the putative regulatory region of the kni locus (Fig. 1) delimited by Df(3L)kniri[XT2] (Nauber et al., 1988Go) were subcloned into the pC4PLZ expression vector (Wharton and Crews, 1993Go). EcoRI fragments F, E, S, R and Q (isolated from phages provided by U. Nauber) were inserted into pBluescript II KS (+/-) (pBS, Stratagene) with the NotI and T7 promoter containing the side of the vector most proximal to the knirps coding region. The constructs were subcloned into the lacZ transformation vector pC4PLZ. Subfragments of the 4.8 kb EcoRI fragment (fragment E in Fig. 1) that drive expression in the L2 primordium were then subcloned into pC4PLZ to define a minimal L2 enhancer element. To assay fragments of E, pBS-E was digested; the proximal most EcoRI-SalI (ES, 2.0 kb), EcoRI-XhoI (EX, 1.4 kb), and EcoRI-HincII (EC, 0.69 kb) fragments isolated and re-inserted into pBS. The 4.8 kb fragment E was also subcloned into the pC4PG4 expression vector, in which the lacZ gene in pC4PLZ has been replaced by GAL4 (Emery, 1996Go), and was used to drive expression of various UAS transgenes in the L2 primordium.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1. Map of knirps locus and ri alleles. (A) A wild-type adult male wing. Longitudinal wing veins (L1-L5), and margin (M) are indicated. (B) A kniri[1] homozygous adult male wing, with an incomplete L2 vein. Note that this phenotype is somewhat milder than that of Df(3L)kniri[XT2] mutants (C). (C) A Df(3L)kniri[XT2] homozygous adult male wing. Note the virtual absence of the L2 vein. (D) A kniri[53j] homozygous adult male wing. (E) Diagram of region 77E1 in the left arm of the third chromosome showing kni and knrl transcripts, the regions deleted in Df(3L)kniri[XT2] and Df(3L)kniFC82 as well as lacZ test constructs (EcoRI fragments) E (red), F (green), S (orange), R (brown), and Q (pink). The fragment labeled abd-lacZ (white box) has been shown to contain an embryonic enhancer (yellow box) driving expression in abdominal segments (Pankratz et al., 1992Go). This fragment does not drive gene expression in the wing primordium. Genomic DNA fragments between E and S were not tested in lacZ fusions. The 4.8 kb fragment E drives reporter gene expression in L2. abd (yellow box), embryonic abdominal enhancer (Pankratz et al., 1992Go); CG13252, a predicted protein-coding transcript that is expressed ubiquitously in both wild-type and kniri[53j] wing discs (data not shown). The knrl transcript, which comprises 23 kb of genomic DNA (Rothe et al., 1992Go), is not drawn to scale. The 5' end of the knrl gene is at -74.8 kb on this map. (F) Expanded map of 4.8 kb fragment E, showing the 1.4 kb minimal L2 driver (black), 252 bp kniri[1] deletion (dark blue), C to A base substitution at 0.596 kb in E in kniri[53j] (light blue), and the region of insertion(s) or rearrangements in kniri[M3] (turquoise), from 0.098 to 0.686, and from 1.99 to 3.44 kb. E, EcoRI; B, BamHI; C, HincII; X, XhoI; S, SalI; H, HindIII. (G) lacZ transgenic constructs made to assay expression driven by a region containing the kniri[1] deficiency substituted into E (E{Delta}ri[1]), and successively smaller 3' subfragments of E: EX, 1.4 kb; and EC, 0.69 kb.

 

Mapping of kni and ri breakpoints
Restriction fragments isolated from a lambda phage walk (Nauber et al., 1988Go) covering over 50 kb of the kni upstream region, delimited by the Df(3L)kniri[XT2] deletion, were used as probes to determine the locations of potential chromosomal abnormalities such as deletions or rearrangements in ri mutants on Southern blots (Southern, 1975Go). Several different restriction enzymes were used to scan each region to distinguish single nucleotide polymorphisms from larger scale abnormalities such as those present in the kniri[1] and kniri[M3] mutants.

Isolation of kniri genomic fragments and construction of the E[ri]-lacZ vectors
Primers AA and RK were used to amplify a region surrounding the proximal EcoRI-BglII (1.197 kb) fragment of E from kniri[1], kniri[92f], kniri[M*], and kniri[53j] genomic DNA (AA=GACACAATGCTCCGAATTCC, the 5' end is in F, the 3' end contains the EcoRI site; RK=CCCAATGGACCCCAATCTGGTTGGGG, the 5' end is at 1.231 kb in E. Note that TGGGG was added to produce a KpnI site at the distal end of the resulting fragment). PCR fragments were purified for sequencing using the QIAquick PCR Purification kit. The blunt ended kniri[1] fragment was cloned into pCR-BluntII-TOPO (TOPO) and oriented so that the NotI site within TOPO and the BglII site within the fragment (N, B) are on opposite sides. The resulting TOPO-N,B construct and pBS-E were digested with NotI and BglII, fragments isolated and ligated to form pBS-E{Delta}ri[1]. The E{Delta}ri[1] insert was sequenced to confirm that it differed from the wild-type sequence by only the 252 bp deletion. KpnI and NotI were used to remove E{Delta}ri[1], and it was cloned into the corresponding sites of C4PLZ to form E{Delta}ri[1]-lacZ. Similarly, primers ECO-ri and XBA-ri were used to PCR amplify the EcoRI-XhoI fragment of E (termed EX) from kniri[53j] genomic DNA (ECO-ri=GAATTCCAACGCGAAGCGTC; XBA-ri=TCTAGATGGGGCTGCTGCCA). The resulting 1.4 kb product was cloned into the TOPO vector. The EX(ri53j) fragment was digested with EcoRI and XbaI and subcloned into the corresponding sites of pC4PLZ to form EX(ri53j)-lacZ. A single subclone was sequenced to verify that only the single nucleotide change (C596A) had been incorporated.

Generation and analysis of sd- clones
Generation of reduction-of-function sd58 clones and immunohistochemical analysis were performed as described previously (Guss et al., 2001Go).

Analysis of Sd binding sites in the L2 enhancer
Identification and analysis of Sd binding sites was performed as described by Guss et al. (Guss et al., 2001Go). Sequences of the upper strand of oligonucleotides used as probes for gel mobility shift assays and as PCR primers to introduce mutations into the Sd binding sites of the kni 0.69 kb element (fragment EC in Fig. 1F) are listed below in the 5' to 3' orientation. Altered bases are shown in lowercase in the mutant version, and the corresponding bases are underlined in the native sequence as follows:

Reporter constructs with three mutated Sd binding sites were made by cloning PCR-generated fragments of fragment EC into the Hsp lacZ-CaSpeR plasmid (Nelson and Laughton, 1993). Four independent EC-3Sdmut-lacZ transformants were recovered and tested for lacZ expression.

Mounting fly wings
Wings from adult flies were dissected in isopropanol and mounted in 100% Canada Balsam mounting medium (Aldrich #28,292-8) as described previously (Roberts, 1986Go).

In situ hybridization to whole-mount larval wing discs
In situ hybridization using digoxigenin-labeled antisense RNA probes (O'Neill and Bier, 1994Go) was performed alone or in combination with anti-ß galactosidase (Promega) labeling as described previously (Sturtevant et al., 1993Go).


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
An L2 enhancer element lies upstream of the knirps coding region
In a previous study, we presented genetic evidence that the kniri[1] mutation, as well as an approximately 50 kb deletion of kni upstream sequences (Df(3L)kniri[XT2]), disrupt the function of a wing-specific regulatory element in the kni locus that is responsible for driving expression of the kni and knrl genes in the L2 primordium (Lunde et al., 1998Go). As a consequence of the loss of kni/knrl expression, kniri[1] (Fig. 1B) and Df(3L)kniri[XT2] (Fig. 1C) flies have severely truncated L2 veins (compare with the wild-type vein pattern in Fig. 1A). As a first step in extending these studies, we gathered and characterized four other putative independently generated viable ri alleles of the kni locus, which lack portions of the L2 vein, including kniri[53j] (Fig. 1D), kniri[M3], kniri[92f], and kniri[M*] (not shown). As in kniri[1] wing discs, we found that kni expression is eliminated in the L2 primordium of each of these kniri alleles (data not shown).

The studies mentioned above suggested that there might be an L2-specific wing vein enhancer that controls expression of kni and knrl in the L2 primordium. We searched for such an enhancer element in two ways. First, we screened for the ability of genomic fragments upstream of the kni coding region to drive lacZ expression in the L2 primordium (summarized in Fig. 1E). Second, we used Southern blot analysis to identify deletions or rearrangement breakpoints in the genomic DNA of ri mutants in the kni upstream region uncovered by Df(3L)kniri[XT2] (Fig. 1E, see below). As a result of the former effort, we identified a single 4.8 kb EcoRI fragment (fragment E in Fig. 1E-G) that drives lacZ reporter gene expression in a sharp stripe (Fig. 2B) similar to that of endogenous kni expression in the L2 primordium (Fig. 2A). Double label experiments confirm that lacZ expression driven by the E-lacZ construct coincides with that of endogenous kni expression (Fig. 2C). Additionally, the E-lacZ expression pattern includes a weaker stripe in the posterior region of the wing (Fig. 2B, arrow). A faint endogenous kni stripe can also be observed in this location in overstained preparations of wildtype discs (data not shown). Consistent with previous studies (Lunde et al., 1998Go), the E-lacZ L2 stripe is located just anterior to the broad domain of strong salm expression (Fig. 2D). Notably, the weaker posterior E-lacZ stripe forms immediately adjacent to the posterior border of the salm domain (Fig. 2D).



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 2. Expression of wild-type and mutant L2 enhancer constructs. (A) kni expression in a wild-type mid-third instar larval wing disc. The L2 primordium (L2) and margin (M) are indicated. (B) lacZ expression driven by the E-lacZ construct in a mid-third instar larval wing disc. Note the lower levels of lacZ expression in a diffuse stripe in the posterior region of the wing pouch (arrow). (C) E-lacZ expression relative to endogenous kni expression in a mid-third instar larval wing disc double-stained for kni mRNA expression (blue) and anti-ß-galactosidase protein (brown). Note the high degree of coincidence of these two expression patterns. (D) E-lacZ expression relative to salm expression in a mid-third instar larval wing disc double-stained for anti-ß-galactosidase protein (brown) and salm expression (blue). Note the abutting and mutually exclusive expression of these two genes. (E) EX-lacZ expression driven by fragment EX (1.4 kb 3' subfragment of E; see Fig. 1G) in a mid-third instar larval wing disc. (F) EC-lacZ expression driven by fragment EC (0.69 kb 3' subfragment of E; see Fig. 1G) in a mid-third instar larval wing disc. Note the broad anterior and posterior domains of ectopic lacZ expression relative to that driven by the E-lacZ and EX-lacZ constructs. (G) E-{Delta}ri[1]-lacZ expression driven by the fragment E-{Delta}ri[1], which is deleted for the same 252 bp segment that is missing in the ri[1] allele, in a mid-third instar larval wing disc. Note the entire absence of patterned staining, including that observed in the posterior region of the wings discs (e.g. compare with staining in panel D). (H) EX(ri53j)-lacZ expression driven by the fragment EX(ri53j), which contains the same single base pair alteration present in the kniri[53j] allele, in a mid-third instar larval wing disc. Note that L2 staining is selectively lost while expression in extreme anterior and posterior domains of the wing pouch is retained (arrowheads: compare with staining in G).

 

In order to delimit a minimal L2 enhancer element, we tested the ability of 5' truncated derivatives of the 4.8 kb fragment E (Fig. 1G) to drive reporter gene expression in larval wing imaginal discs. We observed that subfragments of 2.0 kb (EcoRI-SalI, data not shown) and 1.4 kb (the EcoRI-XhoI fragment EX, Fig. 1G) drive expression of lacZ (Fig. 2E) in patterns nearly indistinguishable from that of the 4.8 kb E-lacZ construct (Fig. 2B). Further truncation generating a 0.69 kb EcoRI-HincII fragment (EC, Fig. 1G), however, results in high levels of ectopic lacZ expression in broad anterior and posterior domains (Fig. 2F). This observation indicates that regulatory element(s) required to repress gene expression in the extreme anterior and posterior domains of the wing primordium reside between the distal 0.69 kb and 1.4 kb of fragment EX (repression domain, Fig. 3B), and that sequences sufficient for activation are contained within the proximal 0.69 kb fragment EC (activation domain, Fig. 3A). As discussed below, we have identified sequences necessary for L2 activity in the activation domain as well as potential repressor binding sites in the proposed repression domain (Fig. 3A,B, Fig. 7).



View larger version (71K):
[in this window]
[in a new window]
 
Fig. 3. The L2-enhancer element is activated by Sd. (A) Sequence of the EcoRI-HincII fragment (EC) of E, which contains sites necessary for activation of the minimal L2 enhancer (0 to 0.691 kb of fragment E). (B) Sequence of the HincII-XhoI fragment, which contains sequences required to repress ectopic activity of the L2 enhancer element (0.692 to 1.361 kb of fragment EX). Key: The deletion in the kniri[1] mutant is indicated by blue text and the nucleotide mutated in the kniri[53j] mutant (C to A at 596) highlighted in turquoise. Sd binding sites in fragment EC (underlined in brown) were determined empirically by footprinting and gel shifts. A tandem doublet of binding sites begins at 271 [TACATTTGTCGCATAGTT], while the sites beginning at 463 [TGTATGTAT] (opposite strand), 523 [AAAATGTCG], 570 [GAAATGCGT], and 640 [ACTATTTCT] (opposite strand) are single sites. These experimentally determined sites define a consensus [(A/T)(A/G)NAT(G/T)TNT], which matches well with the consensus [WRVWATKYR] derived for Sd binding to other wing enhancers that require vestigial and sd function such as bs=DSRF (Halder et al., 1998Go), cut, sal and the vg quadrant element (Guss et al., 2001Go). Other predicted DNA binding sites are indicated based on matches to known consensus sequences. Engrailed (En) [TAATTA — yellow type]: (Ades and Sauer, 1994Go); Spalt-related (Salr) [TTATGa/tAa/cT — pink type]: (Barrio et al., 1996Go); Brinker (Brk) [c/tGCCAg/c — green type]: (Rushlow et al., 2001Go; Zhang et al., 2001Go). No predicted DNA binding sites were identified in fragment EX for Mad (Kim et al., 1997Go), Ci (Kinzler and Vogelstein, 1990Go), or Kni (Small et al., 1996Go). (C-F) Reporter gene expression driven by the 4.8 kb element E is dependent upon sd function. (C) A mitotic clone homozygous for the hypomorphic sd58 allele located in the wing pouch is marked by the absence of the MYC epitope tag and is outlined in red. (D) Expression of the E-lacZ reporter gene is eliminated or reduced by the reduction of sd function, except in clones along the wing margin, where it is unaffected (data not shown). The yellow arrowhead indicates the position of the sd- clone. (E) The position of cells is marked by the nuclear dye TOPRO. (F) Merged image of panels A-C. (G) Gel mobility shift assays of oligonucleotide probes spanning the tandem binding sites at 271, and the single sites at 570 and 640, with the Sd TEA domain (left panels of each pair). Mutations introduced at these sites (right panels of each pair), reduce Sd binding. F, free probe; 1, probe with one Sd TEA domain bound; 2, probe with two Sd TEA domains bound. (H) A wing disc from one of the transformant lines in which the 271 doublet, and 570, 640 single Sd sites were mutated in the context of fragment EC.

 


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 7. A model for L2 initiation: global activation, regional repression and local induction. (A) Activation of kni expression in the L2 primordium as a consequence of the action of patterning genes initiates morphogenesis of the L2 vein. Analysis of the kni/knrl locus L2 enhancer element reveals that this element is activated in a narrow stripe by a combination of global wing specific activation, regional repression, and localized signal mediated activation. Global wing-specific activation is provided at least in part by Sd/Vg (this study). Regional repression is mediated either directly or indirectly by Salm/Salr (Sal) in central wing cells (Lunde et al., 1998Go), and by a repressor(s) acting in peripheral wing cells (green domain) — possibly Brk (this study). In addition, a short range signal X (blue), which is produced by Sal-expressing cells (pink domain) is required to induce kni/knrl expression (blue line) in cells just anterior to sal-expressing cells. Since kni/knrl expression is activated in cells just anterior to the sal expression domain, but not in posterior cells adjacent to the sal domain (dashed blue line), there must be either a repressor (e.g. En?) acting in the posterior compartment (hatched) or an activator acting in the anterior compartment together with X' which provides this AP specificity in kni/knrl activation. The AP compartment border is indicated (solid black line). (B) The kni/knrl L2 enhancer can be subdivided into separate domains mediating at least certain components of activation (black region) and repression (red region). Global wing-specific activation, which requires Sd/Vg function (this study), is mediated by some combination of the empirically determined Sd binding sites (brown ovals) of which there are four single sites and one double site in the activation region. The action of the hypothetical signal X is presumably mediated by a transcription factor X', which binds to sequences in the activation domain. The binding site for factor X' (blue circle) may include sequences containing the single nucleotide mutated in the kniri[53j] mutant (C596A) since L2 enhancer activity is selectively lost in the L2 primordium of these flies. This site is also eliminated in the 252 bp deletion in the kniri[1] mutant (dark blue region), as are additional sequences required for activity of the enhancer throughout the wing (e.g. four single Sd sites). The repression domain contains five predicted binding sites for the repressor Brk (green diamonds), two sites for En (hatched yellow triangles), and one site for Salr (pink diamond). Since the reporter gene expression driven by the activation region alone is repressed in central cells, this fragment must also contain some yet unidentified binding sites for Salm, Salr, or some other factor mediating the repressive effect of Salm/Salr.

 

ri mutants have lesions in the L2 enhancer that disrupt its function
As a complement to screening genomic fragments upstream of the kni locus for the ability to drive gene expression in the L2 primordium using lacZ promoter fusion constructs, we scanned the approximately 50 kb region deleted in the Df(3L)kniri[XT2] allele for detectable aberrations in five putative independently isolated ri alleles. Using a series of probes spanning that complete genomic region (Fig. 1E), we found that a single EcoRI fragment (the same fragment E that drives expression in the L2 primordium) contains aberrations in the kniri[1], kniri[92f], kniri[M*] and kniri[M3] mutants. For each of these alleles, mutations map within the minimal 1.4 kb L2 enhancer element (see Fig. 1F). Although no large-scale lesions were detected by Southern blot analysis within fragment E of the kniri[53j] mutant, subsequent sequence analysis identified a single base pair alteration within the minimal L2 enhancer element EX (see below). The kniri[53j] allele is also associated with a small deletion (approx. 50 bp) in fragment R.

Further molecular analysis of the various ri alleles revealed that the putative independently derived kniri[1], kniri[92f], and kniri[M*] alleles all contain the same 252 bp deletion. As this deletion is not flanked by duplicated sequences that could promote frequent identical recombination events, it may be that the kniri[92f] and kniri[M*] alleles are actually re-isolates of the original kniri[1] mutation. Consistent with these three alleles having a common origin, they also share a restriction enzyme polymorphism (i.e. loss of a HindIII site) in fragment Q (Fig. 1E) that is not shared by the other ri mutants or our white- control stock. To test whether the 252 bp deletion within the minimal L2 enhancer element is responsible for the loss of kni and knrl gene expression in kniri[1] mutants, we made a kniri[1]- mutated E-lacZ construct. We amplified genomic DNA containing the kniri[1] mutation and substituted it for the corresponding part of the original E-lacZ construct to generate E{Delta}ri1-lacZ (Fig. 1G) and transformed this construct into flies. We examined lacZ expression in third instar larval wing discs of E{Delta}ri1-lacZ flies and found that they failed to express lacZ in the L2 primordium or anywhere else in the wing pouch (Fig. 2G), indicating that the 252 bp deletion in kniri[1] mutants eliminates the activity of the L2 enhancer element.

Since Southern blot analysis did not reveal any obvious lesions in fragment E of the kniri[53j] allele, we considered the possibility that this allele might have a subtler lesion in the L2 enhancer region. Accordingly, we PCR amplified and sequenced the 1.4 kb fragment (EX, Fig. 1G) corresponding to the minimal L2 enhancer from kniri[53j]. We found only a single nucleotide difference between the sequence of this mutant allele and the wild-type fragment EX (C596A, Fig. 3A), which lies within the same 252 bp region deleted in kniri[1]. Although it has been observed that single nucleotide mutations can eliminate endogenous enhancer function (Shimell et al., 1994Go), such cases are sufficiently rare that it was important, as in the case of kniri[1], to demonstrate whether this point mutation was responsible for the loss of enhancer function. We used the EX kniri[53j] PCR fragment to make a lacZ construct, confirmed the sequence of the mutant construct, generated four independent transformants, and tested these flies for lacZ expression in third instar wing discs. We found that EX(ri53j)-lacZ mutant wing discs fail to express lacZ in the L2 primordium (Fig. 2H), strongly suggesting that this single base pair mutation is responsible for the observed L2 vein loss phenotype observed in kniri[53j] flies. One notable difference between the EX(ri53j)-lacZ and E{Delta}ri1-lacZ mutant wing discs is that in the point mutant construct (ri53j), lacZ expression is lost selectively in the L2 primordium and in the weaker posterior stripe (note the normal levels and pattern of expression in extreme anterior and posterior regions of the disc, Fig. 2H), while in the deletion mutant construct (E{Delta}ri1), reporter gene expression is eliminated throughout the wing disc (Fig. 2G).

As noted above, the kniri[53j] mutant is also associated with a deletion of {approx}50 bp in fragment R, which lies approximately 15 kb 5' to fragment E within predicted intron sequences of a putative transcription unit (see kni locus map, Fig. 1E). As the ubiquitous expression of this transcription unit is not affected in kniri[53j] mutants (K. L., unpublished observations) and fusion of fragment R with lacZ does not result in gene expression in the L2 primordium, we have no evidence to suggest that this aberration has any relevance to the L2 vein loss phenotype of kniri[53j] mutants.

Analysis of the kniri[M3] allele indicates that this mutation involves an insertion and possibly rearrangements within fragment E. One breakpoint of the kniri[M3] allele falls within the 1.4 kb EX minimal L2 enhancer element (Fig. 1F). Because this is a relatively weak ri allele and is associated with a complex lesion, we did not characterize the nature of this rearrangement further.

The wing selector protein Scalloped binds to the L2 enhancer and is required for its activity
The 4.8 kb L2 enhancer fragment E and truncated derivatives (fragments EX and EC) drive reporter gene expression specifically in the wing pouch. Recent work has shown that gene expression in the wing primordium is controlled by Sd, which functions with Vestigial (Vg) to define wing identity (Kim et al., 1996Go; Kim et al., 1997Go; Halder et al., 1998Go; Simmonds et al., 1998Go; Guss et al., 2001Go; Halder and Carroll, 2001Go). We tested whether Sd might similarly be required to activate endogenous kni expression by generating clones of cells homozygous for a strong hypomorphic allele of sd using FLP-FRT mediated mitotic recombination (Golic, 1991Go). In sd clones, ß-galactosidase expression driven by the E-lacZ element is reduced (Fig. 3D). In clones falling along the future wing margin, however, reporter gene expression is unaffected (not shown; see Discussion). These results indicate that Sd plays an in vivo role in activating kni expression within the wing blade.

Because Sd, a TEA-domain protein, functions as a direct transcriptional regulator of several key developmental genes expressed in the wing disc (Halder et al., 1998Go; Guss et al., 2001Go), we tested whether Sd binds to the kni L2 enhancer. We searched for specific Sd DNA binding sites in the 0.69 kb EC activation domain using DNAse I footprinting and gel shift analysis (Fig. 3G and data not shown) and identified five sites bound by the Sd TEA domain, which conform well to the known Sd consensus binding site and consist of a tandem doublet of Sd binding sites and four single binding sites (Fig. 3A). The four single Sd sites are removed by the 252 bp deletion in the kniri[1] allele, however, none of them covers the kniri[53j] point mutation. To determine whether Sd plays a direct role in activating the L2 enhancer, we mutated a subset of these Sd binding sites in the context of the EC-lacZ construct, transformed these mutated constructs into flies and stained for lacZ expression in third instar wing discs. We found that mutation of the doublet at 271 in combination with the two single sites at 570 and 640 resulted in a complete loss of lacZ expression in the wing disc (Fig. 3H). These results indicate that Sd is required for activation of kni expression in the wing disc.

kniri[1] mutants can be rescued by kni, knrl or the downstream target gene rho
Having shown that the minimal L2 enhancer is mutated in several independently derived ri alleles (kniri[1], kniri[M3], and kniri[53j]), we wished to know whether driving expression of either the kni or knrl genes with this element could rescue the ri vein-loss phenotype. We addressed this question using the conditional GAL4/UAS expression system of Brand and Perrimon (Brand and Perrimon, 1993Go). We created transgenic flies that carry fragment E driving GAL4 expression (L2-GAL4) and used this driver to activate expression of UAS-kni or UAS-knrl transgenes in the L2 primordium of kniri[1] mutants. As expected, GAL4 RNA is expressed in the L2 primordium of L2-GAL4 wing discs (Fig. 4A). We placed this L2-GAL4 driver and the UAS-kni and UAS-knrl transgenes into the kniri[1] mutant background and generated flies of the genotype L2-GAL4>UAS-kni; kniri[1]/kniri[1] (Fig. 4B) and L2-GAL4>UAS-knrl; kniri[1]/kniri[1] (Fig. 4C). These flies have fully restored L2 veins that resemble wild-type L2 veins in that the bulk of the vein is formed on the ventral surface of the wing.



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 4. Rescue of L2 in kniri[1] by targeted gene expression in the L2 primordium. (A) GAL4 expression in an L2-GAL4 mid-third instar larval wing disc. (B) Rescue of the L2 vein (arrow) in an L2-GAL4>UAS-kni; kniri[1] male adult wing. (C) Rescue of the L2 vein in an L2-GAL4>UAS-knrl; kniri[1] male adult wing. (D) Rescue of the L2 vein in an L2-GAL4>UAS-rho; kniri[1] male adult wing.

 

Since rho is known to play a critical role in activating Egfr signaling in all vein primordia, we also determined whether expression of this downstream effector of the kni locus could bypass the requirement for kni in kniri[1] mutants. We found that L2 formation is indeed rescued in L2-GAL4>UAS-rho; kniri[1]/kniri[1] flies (Fig. 4D). As in the case of rescue by kni or knrl, the rescued L2 vein forms primarily on the ventral surface of the wing.

Misexpression of genes expressed in veins other than L2 alters L2 development
As mentioned above (see Introduction), several genes that are important for vein development are expressed in veins other than L2. For example, the vein- and sensory organ-promoting gene ara is expressed in the odd numbered veins (L1, L3, and L5), the proneural genes ac and sc are expressed in L1 and L3, and the Notch ligand Delta is expressed in L1 and L3-L5, but not in L2. We were interested to know whether it is necessary to exclude expression of these genes from the L2 primordium for normal L2 development. To address this question, we misexpressed UAS-transgene copies of these genes in the L2 primordium with the L2-GAL4 driver and examined the L2 vein in adult wings. In each case, we observed defects in L2 development. Misexpression of the lateral inhibitory signal Delta in L2-GAL4>UAS-Dl flies results in modest truncation of the L2 vein in females (Fig. 5A) and almost entirely eliminates the L2 vein in sibling males (Fig. 5B), which are the consistently more severely affected sex. The near elimination of L2 development in severely affected Dl-misexpressing males is accompanied by a loss of rho expression in the L2 primordium of third instar larval wing discs (Fig. 5D), compare with wild-type rho expression in Fig. 5C). Misexpression of the proneural gene sc in the L2 primordium of L2-GAL4>UAS-sc flies results in L2 veins covered with ectopic bristles (Fig. 5E). The great majority of these ectopic bristles are strictly confined to the L2 primordium, consistent with the double label experiments (Fig. 2C) indicating that the L2-enhancer element drives gene expression precisely in the L2 primordium. In addition, ectopic bristles form sporadically in a broad posterior domain of the wing, which derives from a region of the wing disc in which the L2 enhancer element is also expressed in a weak diffuse pattern (Fig. 2B,D). Finally, misexpression of the ara gene in L2-GAL4>UAS-ara flies causes a reproducible thinning of the L2 vein (Fig. 5F). Cumulatively, these results underscore the importance of excluding expression of non-L2 vein genes from the L2 primordium.



View larger version (93K):
[in this window]
[in a new window]
 
Fig. 5. Misexpression of non-L2 vein genes in the L2 primordium alters L2 development. (A) An L2-GAL4>UAS-Dl adult female wing. The distal tip of the L2 vein is typically missing (arrow). (B) An L2-GAL4>UAS-Dl adult male wing. The L2 vein is consistently truncated to this severe extent. (C) rho expression in a wild type mid third larval instar disc. Vein primordia L2-L5 and the margin are indicated. (D) rho expression in a 2X L2-GAL4>UAS-Dl mid-third instar larval wing disc is lost selectively in the L2 primordium (arrow). (E) An L2-GAL4>UAS-sc adult male wing. Ectopic bristles are largely confined to the L2 vein as well as to a broad posterior domain, which presumably corresponds to cells in L2-GAL4 wing discs expressing high (L2) or moderate (posterior domain) levels of GAL4 (e.g. see Fig. 4A). (F) An L2-GAL4>UAS-ara adult male wing. Note that the width of the L2 vein is reduced in the middle (arrowhead). This thinning of L2 by misexpression of ara is a consistent phenotype that we have not observed when we misexpress the related gene caup in the same pattern (not shown).

 

The L2-GAL4 driver can be used as a tool to dissect gene function and range of action
As discussed above, the L2-GAL4 driver activates UAS transgene expression precisely in the L2 primordium. The ability to drive highly localized expression of genes in a non-essential tissue with L2-GAL4 suggests that this driver could be used as an effective tool to dissect the function and range of action of various genes. For example, since the eagle (eg) gene encodes a steroid hormone receptor closely related to Kni and Knrl (Rothe et al., 1989Go) we wondered whether this gene could substitute for kni or knrl in rescuing kniri[1] mutants. eg is involved in neuroblast specification during embryogenesis (Higashijima et al., 1996Go; Dittrich et al., 1997Go; Lundell and Hirsh, 1998Go), but is not expressed in the wing pouch (data not shown) and is not known to play a role in development of the wing proper. We found that, as in L2-GAL4>UAS-kni; kniri[1]/kniri[1] individuals, L2 formation is rescued in L2-GAL4>UAS-eg; kniri[1]/kniri[XT2] flies, however, this restored `L2' vein is decorated with a line of ectopic sensory bristles (Fig. 6A). As the same ectopic bristles are observed in L2-GAL4>UAS-eg individuals (data not shown), this phenotype can be attributed to misexpressing eg in the L2 primordium. By employing the L2 expression system it should now be possible to map the domain in Eg that is responsible for inducing ectopic bristles using chimeric Eg/Kni receptors.



View larger version (106K):
[in this window]
[in a new window]
 
Fig. 6. Use of the L2-GAL4 expression system to assay gene function in the wing. (A) Rescue of the L2 vein in an L2-GAL4>UAS-eg; kniri[1]/kniri[XT2] male adult wing. Note the ectopic sensory bristles along the reinstated L2 vein. (B) An L2-GAL4>UAS-{lambda}top adult male wing. (C) An L2-GAL4>UAS-vein adult male wing. Note the minor degree of ectopic venation (e.g. anterior to L2 and at the junction of L2 with the margin). (D) An L2-GAL4>UAS-secreted-spitz adult female wing. Note the ectopic vein running parallel and anterior to L2. (E) An L2-GAL4>UAS-rho+UAS-Star wing. Note patches of ectopic vein material anterior to L2. (F) An L2-GAL4>UAS-wingless adult male wing. Note change in shape of the margin, ectopic vein material both anterior and posterior to L2 and ectopic bristles near the junction of L2 with the margin (magnified in insert).

 

The L2 expression system should also be useful in distinguishing cell-autonomous from non cell-autonomous gene activity. As a test of this idea we compared the phenotypes resulting from driving expression of an activated form of the Egfr ({lambda}top) in the L2 primordium versus expression of the secreted Egf-like ligands Vein (Schnepp et al., 1996Go) and sSpitz (Schweitzer et al., 1995Go; Schnepp et al., 1998Go). Consistent with {lambda}top acting in a cell autonomous fashion to promote vein versus intervein development, expression of this gene in the L2 primordium of L2-GAL4>UAS-{lambda}top wings (Fig. 6B) had no effect on the development of the L2 vein or neighboring intervein cells. In contrast, when secreted Egf ligands were expressed in a similar fashion in L2-GAL4>UAS-vn wings (Fig. 6C) or in L2-GAL4>UAS-sspi wings (Fig. 6D), we observed ectopic veins that formed 2-3 cell diameters away from the L2 vein. Similarly, when we co-expressed rho and Star in the L2 primordium (e.g. in L2-GAL4>UAS-rho; UAS-Star wings; Fig. 6E), which also generates a potent secreted Egfr promoting activity (Guichard et al., 1999Go), we observed ectopic veins that were displaced from the endogenous L2 vein by a few cells. The ability of secreted ligands, but not the {lambda}top construct, to induce ectopic vein formation at a distance cannot be attributed simply to the latter being a weaker activator of Egfr signaling since UAS-{lambda}top is considerably more effective at generating ectopic veins than UAS-vn when other wing-GAL4 drivers are used (e.g. MS1096-GAL4 or CY2-GAL4, data not shown).

We also observed a non cell-autonomous activity of the Wingless (Wg) ligand in L2-GAL4>UAS-wg wings (Fig. 6F), which had ectopic veins displaced from the endogenous L2 as well as ectopic marginal bristles near the intersection of L2 with the margin. These ectopic marginal bristles always formed on the appropriate surface of the wing (Fig. 6F, insert), suggesting that this phenotype may result from the inappropriate activation of the wing margin genetic program.


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
An important step in understanding the link between patterning and morphogenesis is to identify key cis-regulatory elements that lie at the interface of these sequential processes. Formation of the L2 vein provides a potential paradigm for connecting patterning initiated by a morphogen (e.g. a centrally positioned BMP activity gradient) to the activation of a vein differentiation program in a narrow stripe of cells in the wing imaginal disc (e.g. controlled by kni/knrl). In this study we have identified a cis-acting regulatory element that drives expression of the kni locus in the L2 primordium. We found that three distinct mutations causing L2 vein truncations alter this regulatory element and that in at least two of these cases the mutations disrupt the function of the enhancer. Dissection of this enhancer element indicates that a locally provided activating signal acts in conjunction with broadly distributed activating (sd dependent) and repressive systems to limit activation of the L2 enhancer to a sharp stripe of cells in the wing imaginal disc. We also found that excluding expression of non L2 vein genes from the L2 primordium is essential for normal L2 development.

ri mutants are L2-enhancer specific regulatory alleles of the kni locus
The results described in this study demonstrate definitively that ri mutations are regulatory alleles of the kni locus disrupting the function of a cis-regulatory enhancer element that drives gene expression in the L2 primordium of wing imaginal discs. A crucial line of evidence supporting this conclusion is that mutant versions of the L2 enhancer incorporating either the 252 bp deletion present in kniri[1] or the single base pair substitution present in kniri[53j] eliminate the ability of this element to direct gene expression in the L2 primordium. In addition, it is possible to completely rescue the vein-loss phenotype of kniri[1] by expressing either the UAS-kni or UAS-knrl transgenes with an L2-GAL4 driver. Consistent with activation of rho being one of the key effectors of kni/knrl function, it is also possible to rescue the L2 vein-loss phenotype of kniri[1] by expressing a UAS-rho transgene in L2, although rescue is less complete and penetrant than that observed with UAS-kni or UAS-knrl.

The isolation of the L2 enhancer also addresses an unresolved question regarding the basis for the failure of Df(3L)kniri[XT2] and Df(3L)kniFC82 to complement (Lunde et al., 1998Go). As these two deletions have endpoints that break within the same 1.7 kb EcoRI fragment (indicated by the dashed vertical lines in Fig. 1E), one explanation for the failure of complementation could be that this 1.7 kb fragment contains the L2 enhancer. The alternative explanation for the ri phenotype of Df(3L)kniri[XT2]/Df(3L)kniFC82 is that transvection (Lewis, 1954Go; Geyer et al., 1990Go; Pirrotta, 1999Go), which normally occurs between regulatory and coding region alleles of the kni locus (Lunde et al., 1998Go), is interrupted by the large divergent deletions that have little if any overlap. Since the 4.8 EcoRI fragment containing the L2 enhancer maps nearly 10 kb upstream of the 1.7 kb EcoRI fragment, and a lacZ fusion construct (abd-lacZ, Fig. 1E) containing the 1.7 kb EcoRI fragment does not drive any gene expression in the wing disc (Lunde et al., 1998Go), the latter hypothesis that Df(3L)kniri[XT2] and Df(3L)kniFC82 are unable to engage in effective transvection is the most likely explanation for the failure of these two mutations to complement.

Global activation, regional repression and localized induction restrict L2-enhancer activity to a narrow stripe of cells
The results of these and previous studies of L2 vein initiation lead to a model in which localized vein inductive signaling acts against a background of regional repression and global wing-specific activation (Fig. 7A). Previous genetic experiments have suggested a model in which sal-expressing cells produce a short-range L2 inducing signal (X) to which sal-expressing cells themselves cannot respond (Sturtevant et al., 1997Go; Lunde et al., 1998Go). According to this `for export only' signaling model, the signal X diffuses into adjacent anterior cells and activates expression of the kni/knrl genes in the L2 primordium, in much the same fashion as Hh, expressed from the refractory posterior compartment, activates expression of target genes such as dpp or ptc in the anterior compartment (reviewed by Bier, 2000Go). Based on the analysis of the L2 enhancer element described in this study, the 252 bp region deleted in kniri[1] mutants may contain response element(s) to this putative factor X. It is worth noting, however, that lacZ expression is lost in all cells of the wing disc (posterior and circumferential cells as well as the L2 primordium) when these sequences are deleted from the 4.8 kb fragment. This observation suggests that sequences mediating more general activation (e.g. Sd binding sites, see below) may also be contained within this 252 bp region. The sequence surrounding the single nucleotide alteration in kniri[53j] mutants (C596A), however, is a particularly intriguing candidate for mediating the L2-specific activation of kni since introducing this mutation in the context of the minimal 1.4 kb enhancer leads to selective loss of lacZ expression only in the stripe of cells adjacent to the sal domain.

The hypothetical transcription factor X' (Fig. 7B) that binds to the region surrounding the kniri[53j] point mutation and mediates the inductive signal X presumably collaborates with the more generally required wing selector Sd (Halder et al., 1998Go; Guss et al., 2001Go), since mutation of four of the Sd binding sites (the doublet and two single sites) in the L2 activation domain completely eliminates enhancer activity in the wing disc. Clonal analysis with a hypomorphic sd allele also indicates that sd is required for high-level expression of the full 4.8 kb L2 enhancer element in the wing disc. It is notable that the reduction in lacZ expression in these clones is not as dramatic as the complete loss of L2 activity observed when Sd binding sites in the activation domain are mutated. There are several possible explanations for this discrepancy. Firstly, the sd mutation used in these experiments is a hypomorphic allele and therefore has residual activity. Unfortunately, stronger sd alleles produce even smaller viable clones in the wing disc and thus were not used. Secondly, as only small clones can be generated, they must typically have been produced with only two or three intervening cycles of cell division. Consequently, the sd cells may still contain functional levels of wild type Sd (protein perdurance). Another possibility is that other activators can partially substitute for Sd, at least in certain regions of the wing. Based on the absence of L2 activity when Sd binding sites are mutated and the reduction in L2 activity in sd hypomorphic clones, we conclude that Sd plays an important role as an activator of the L2 enhancer. These results support the view that Sd functions as a general transcriptional activator of genes expressed in the wing field.

Repression also plays a key role in restricting L2 enhancer expression to a narrow stripe of wing disc cells. It has been shown previously that salm and salr, which are expressed strongly in the central region of the wing, repress expression of kni and knrl (Lunde et al., 1998Go), although low levels of sal may also be required to activate kni expression (de Celis and Barrio, 2000Go). In the current study we also find evidence for repression of L2-enhancer activity in peripheral wing disc cells abutting those expressing high levels of sal. Truncation of the minimal 1.4 kb (fragment EX) L2 enhancer element results in reporter gene expression expanding to fill the anterior and posterior regions of the wing pouch in a pattern complementary to that of sal. The region deleted from the EX fragment contains several consensus binding sites for Brinker (Fig. 3B, Fig. 7B) (Rushlow et al., 2001Go; Zhang et al., 2001Go), which may mediate this repression since the pattern of brinker (brk) expression in the wing pouch (Campbell and Tomlinson, 1999Go; Jazwinska et al., 1999Go) is very similar to that of lacZ expression driven by the 0.69 kb fragment EC. One way to integrate the action of the localized inductive signal X->X' pathway with that of abutting central and peripheral repressive factors is to propose that the signal-dependent activator X' can overcome the repressive action of the peripheral inhibitor but not repression by Salm/Salr (see legend to Fig. 7). One feature common to several prominent signaling pathways is that activation of the pathway converts a resting repressor into a transcriptional activator (Barolo and Posakony, 2002Go). In the kni L2 enhancer, activation of the hypothetical signal X pathway may relieve repression by a heterologous repressor since the putative activator (i.e. X') and repressor (e.g. Brk?) sequences in the L2 enhancer are separable. One example of a signaling pathway that functions by relieving inhibition by a heterologous repressor is the recent report of Egfr signaling inactivating repression by Suppressor of Hairless (Su(H)) (Tsuda et al., 2002Go). In addition to central and peripheral repression in the wing disc, there may also be a repressor in posterior compartment cells (e.g. En, Fig. 7A,B) to prevent activation of the L2 enhancer in cells posterior to the sal expression domain. Perhaps the 4.8 kb L2 enhancer element lacks some sites for this putative repressor since E-lacZ drives significantly higher levels of gene expression in the posterior stripe than that observed for endogenous kni or knrl expression.

Expression of non-L2 vein genes must be excluded from the L2 primordium
All longitudinal veins share several morphological characteristics such as being composed of densely packed cells on both the dorsal and ventral surfaces of the wing that secrete a thickened cuticle. The primordia of all longitudinal veins also express the rhomboid gene, which is required for activating the Egfr pathway in vein but not in intervein cells. In addition to these shared properties, each vein can be distinguished by expression of other vein genes (Biehs et al., 1998Go). For example, vein L2-specific characteristics include: expression of kni and knrl, lack of Delta expression, lack of cauplara expression, and lack of ac/sc expression. Given that all veins are ultimately quite similar morphologically, it is relevant to ask whether the differences in gene expression patterns observed in different veins are important.

In this study, we examined the necessity of excluding expression of non-L2 vein genes in the L2 primordium by forcing expression of genes such as Dl, ara, ac and sc in L2 and asking whether this manipulation had any impact on L2 development. These experiments strongly suggest that exclusion of non-L2 vein genes from the L2 primordium is indeed important since misexpression of each of these genes resulted in abnormal L2 development. The phenotypes resulting from misexpressing non-L2 vein genes in the L2 primordium can largely be reconciled with the normal functions of these genes. For example, forced expression of Dl leads to loss of L2, consistent with suppression of vein formation by Notch signaling. The ectopic bristles that form strictly along the L2 vein in wings misexpressing ac or sc are also consistent with the neural promoting function of proneural genes. It is less clear why misexpression of the ara gene causes thinning of the L2 primordium, since this gene normally activates expression of the vein-promoting gene rho in odd numbered veins and ac and sc in the L3 primordium. Perhaps expression of a gene normally involved in development of the odd numbered dorsal veins is somehow incompatible with development of the ventral L2 vein.

The L2 expression system provides a localized assay for gene function in the wing
The sharp stripe of gene expression driven by L2-GAL4 can also be used as a rapid assay to test the function or range of action of various genes in the wing. For example, in the case of the Egfr pathway, it is possible to distinguish components exerting cell-autonomous versus non cell-autonomous functions. In line with the fact that activation of the Egfr pathway in the wing leads to the formation of veins, L2-GAL4-driven expression of the secreted ligand sSpi generates ectopic veins in the neighborhood of L2 while expression of the equally potent constitutively active {lambda}top form of the EGF receptor does not result in a non-autonomous phenotype. The L2 expression system may also be used to compare the functions of related genes such as the nuclear receptors Kni, Knrl, and Eg. Although these three transcription factors share nearly identical DNA binding domains and can all rescue the vein-loss phenotype of ri mutants, they differ in that misexpression of eg in the L2 primordium induces the formation of ectopic bristles along L2. This distinct activity of eg may relate to its normal embryonic function in directing cell fate choices in the CNS. Using the L2 expression system as an assay, it should be straightforward to map the domain in eg that is responsible for its neural inducing capacity by constructing chimeric molecules composed of different domains of Eg and Kni. Finally, the observation that L2-driven expression of Dl leads to a highly penetrant loss of L2 in males and a consistently weaker phenotype in females provides the basis for a modifier screen to identify mutations that either suppress the phenotype in males or enhance the phenotype in females. Some of the modifier loci identified in such a screen, which are not specifically involved in Notch signaling, may encode components of the hypothesized factor X->X' pathway.


    ACKNOWLEDGMENTS
 
We thank Orna Cook and Margaret Roark for critical comments on the manuscript, and Dan Ang for help with preparing figures. This work was supported by NIH grant NIH R01 GM60585 and NSF grant NSF IBN-0094634. K. A. G. acknowledges the support of Sean B. Carroll, in whose lab the studies on the role of sd were performed. This work was funded by NIH 1F32HD08326 to K. A. G., and the Howard Hughes Medical Institute, of which Sean B. Carroll is an Investigator.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Ades, S. E. and Sauer, R. T. (1994). Differential DNA-binding specificity of the Engrailed homeodomain: the role of residue 50. Biochemistry 33,9187 -9194.[CrossRef][Medline]
Arajärvi, P. and Hannah-Alava, A. (1969). Cytogenetic mapping of in and ri. Dros. Inf. Serv. 44,73 -74.
Barolo, S. and Posakony, J. (2002). Three habits of highly effective signaling pathways: principles of transcriptional control by developmental cell signaling. Genes Dev. 16,1167 -1181.[Free Full Text]
Barrio, R., Shea, M. J., Carulli, J., Lipkow, K., Gaul, U., Frommer, G., Schuh, R., Jäckle, H. and Kafatos, F. C. (1996). The spalt-related gene of Drosophila melanogaster is a member of an ancient gene family, defined by the adjacent, region-specific homeotic gene spalt. Dev. Genes Evol. 206,315 -325.[CrossRef]
Biehs, B., Sturtevant, M. A. and Bier, E. (1998). Boundaries in the Drosophila wing imaginal discs organize vein-specific genetic programs. Development 125,4245 -4257.[Abstract]
Bier, E. (1998a). Localized activation of RTK/MAPK pathways during development. BioEssays 20,189 -194.[CrossRef][Medline]
Bier, E. (1998b). EGF-Receptor and TGF-ß-like Dpp signaling during Drosophila development. In Hormones and Growth Factors in Development and Neoplasia (ed. R. B. Dickson and D. S. Solomon), pp.19 -43. New York: Wiley & Sons.
Bier, E. (2000). Drawing lines in the Drosophila wing: initiation of wing vein development. Curr. Opin. Genet. Dev. 10,393 -398.[CrossRef][Medline]
Bier, E., Jan, L. Y. and Jan, Y. N. (1990). rhomboid, a gene required for dorsoventral axis establishment and peripheral nervous system development in Drosophila melanogaster.Genes Dev. 4,190 -203.[Abstract/Free Full Text]
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Campbell, G. and Tomlinson, A. (1999). Transducing the Dpp morphogen gradient in the wing of Drosophila: regulation of Dpp targets by brinker. Cell 96,553 -562.[CrossRef][Medline]
Chien, C. T., Hsiao, C. D., Jan, L. Y. and Jan, Y. N. (1996). Neuronal type information encoded in the basic-helix-loop-helix domain of proneural genes. Proc. Natl. Acad. Sci. USA 93,13239 -13244.[Abstract/Free Full Text]
de Celis, J. F. and Barrio, R. (2000). Function of the spalt/spalt-related gene complex in positioning the veins in the Drosophila wing. Mech. Dev. 91, 31-41.[CrossRef][Medline]
de Celis, J. F., Bray, S. and García-Bellido, A. (1997). Notch signaling regulates veinlet expression and establishes boundaries between veins and interveins in the Drosophila wing. Development 124,1919 -1928.[Abstract]
Dittrich, R., Bossing, T., Gould, A. P., Technau, G. M. and Urban, J. (1997). The differentiation of the serotonergic neurons in the Drosophila ventral nerve cord depends on the combined function of the zinc finger proteins Eagle and Huckebein. Development 124,2515 -2525.[Abstract]


Emery, J. (1996). An Analysis of Cis-Regulatory Regions of Pan-Neural Genes in Drosophila melanogaster. Ph.D. Thesis, University of California, San Diego, La Jolla, CA.
García-Bellido, A. (1977). Inductive mechanisms in the process of wing vein formation in Drosophila.Wilhelm Roux's Arch. Dev. Biol. 182,93 -106.[CrossRef]
García-Bellido, A. and de Celis, J. F. (1992). Developmental genetics of the venation pattern of Drosophila. Annu. Rev. Genet. 26,277 -304.[CrossRef][Medline]
Geyer, P. K., Green, M. M. and Corces, V. G. (1990). Tissue-specific enhancers may act in trans on the gene located in the homologous chromosome: the molecular basis of transvection in Drosophila. EMBO J. 9,2247 -2256.[Medline]
Golic, K. G. (1991). Site-specific recombination between homologous chromosomes in Drosophila.Science 252,958 -961.[Abstract/Free Full Text]
Gomez-Skarmata, J. L., del Corral, R. D., de la Calle-Mustienes, E., Ferre-Marco, D. and Modolell, J. (1996). araucan and caupolican, two members of the novel iroquois complex, encode homeoproteins that control proneural and vein-forming genes. Cell 85,95 -105.[CrossRef][Medline]
Guichard, A., Biehs, B., Sturtevant, M. A., Wickline, L., Chacko, J., Howard, K. and Bier, E. (1999). rhomboid and Star interact synergistically to promote EGF-R/MAPK signaling during Drosophila wing vein development. Development 126,2663 -2676.[Abstract]
Guss, K. A., Nelson, C. E., Hudson, A., Kraus, M. E. and Carroll, S. B. (2001). Control of a genetic regulatory network by a selector gene. Science 292,1164 -1167.[Abstract/Free Full Text]
Halder, G., Polaczyk, P., Kraus, M. E., Hudson, A., Kim, J., Laughon, A. and Carroll, S. (1998). The Vestigial and Scalloped proteins act together to directly regulate wing-specific gene expression in Drosophila. Genes Dev. 12,3900 -3909.[Abstract/Free Full Text]
Halder, G. and Carroll, S. (2001). Binding of the Vestigial co-factor switches the DNA-target selectivity of the Scalloped selector protein. Development 128,3295 -3305.[Abstract/Free Full Text]
Higashijima, S., Shishido, E., Matsuzaki, M. and Saigo, K. (1996). eagle, a member of the steroid receptor gene superfamily, is expressed in a subset of neuroblasts and regulates the fate of their putative progeny in the Drosophila CNS. Development 122,527 -536.[Abstract]
Jazwinska, A., Kirov, N., Wieschaus, E., Roth, S. and Rushlow, C. (1999). The Drosophila gene brinker reveals a novel mechanism of Dpp target gene regulation. Cell 96,563 -573.[CrossRef][Medline]
Kim, J., Sebring, A., Esch, J. J., Kraus, M. E., Vorwerk, K., Magee, J. and Carroll, S. B. (1996). Integration of positional signals and regulation of wing formation and identity by Drosophila vestigial gene. Nature 382,133 -138.[CrossRef][Medline]
Kim, J., Johnson, K., Chen, H. J., Carroll, S. and Laughon, A. (1997). Drosophila Mad binds to DNA and directly mediates activation of vestigial by Decapentaplegic. Nature 388,304 -308.[CrossRef][Medline]
Kinzler, K. W. and Vogelstein, B. (1990). The GLI gene encodes a nuclear proten which binds specific sequences in the human genome. Mol. Cell Biol. 10,634 -642.[Abstract/Free Full Text]
Klein, T. (2001). Wing disc development in the fly: the early stages. Curr Opin. Genet. Dev. 4, 470-475.
Kooh, P. J., Fehon, R. G. and Muskavitch, M. A. (1993). Implications of dynamic patterns of Delta and Notch expression for cellular interactions during Drosophila development. Development 117,493 -507.[Abstract]
Kühnlein, R. P., Frommer, G., Friedich, M., González-Gaitán, M., Weber, A., Wagner-Bernholz, J. F., Gehring, W. J., Jäckle, H. and Schuh, R. (1994). spalt encodes an evolutionarily conserved zinc finger protein of novel structure which provides homeotic gene function in the head and tail region of the Drosophila embryo. EMBO J. 13,168 -179.[Medline]
Lawrence, P. A. and Struhl, G. (1996). Morphogens, compartments, and pattern: lessons from Drosophila?Cell 85,951 -961.[CrossRef][Medline]
Lehmann, R. (1985).Regionsspezifische Segmentierungsmutanten bei Drosophila melanogaster Meigen . Ph.D. Thesis, University of Tübingen, Germany.
Lewis, E. B. (1954). The theory and application of a new method of detecting chromosomal rearrangements in Drosophila melanogaster. Am. Nat. 88,225 -239.[CrossRef]
Lindsley, D. L. and Grell, E. H. (1968).Genetic Variations in Drosophila melanogaster . Washington, D.C.: Carnegie Institute of Washington.
Lindsley, D. L. and Zimm, G. G. (1992). The Genome of Drosophila melanogaster. San Diego: Academic Press Inc.
Lunde, K., Biehs, B., Nauber, U. and Bier, E. (1998). The knirps and knirps-related genes organize development of the second wing vein in Drosophila.Development 125,4145 -4154.[Abstract]
Lundell, M. J. and Hirsh, J. (1998). eagle is required for the specification of serotonin neurons and other neuroblast 7-3 progeny in the Drosophila CNS. Development 125,463 -472.[Abstract]
Montagne, J., Groppe, J., Guillemin, K., Krasnow, M. A., Gehring, W. J. and Affolter, M. (1996). The Drosophila Serum Response Factor gene is required for the formation of intervein tissue of the wing and is allelic to blistered. Development 122,2589 -2597.[Abstract]
Müller, H. J. (1941). Induced mutations in Drosophila. Cold Spring Harbor Symp. Quant. Biol. 9, 151-167.[Abstract/Free Full Text]
Nauber, U., Pankratz, M. J., Kienlin, A., Seifert, E., Klemm, U. and Jäckle, H. (1988). Abdominal segmentation of the Drosophila embryo requires a hormone receptor-like protein encoded by the gap gene knirps. Nature 336,489 -492.[CrossRef][Medline]
Nelson, H. and Laughon, A. (1993). Drosophila glial architecture and development: analysis using a collection of new cell-specific markers. Roux's Arch. Dev. Biol. 202,341 -354.[CrossRef]
Noll, R., Sturtevant, M. A., Gollapudi, R. R. and Bier, E. (1994). New functions of the Drosophila rhomboid gene during embryonic and adult development are revealed by a novel genetic method, enhancer piracy. Development 120,2329 -2338.[Abstract]
Nüsslein-Volhard, C. and Wieschaus, E. (1980). Mutations affecting segment number and polarity in Drosophila. Nature 287,795 -801.[CrossRef][Medline]
O'Neill, J. W. and Bier, E. (1994). Double-label in situ hybridization using biotin and digoxigenin tagged RNA probes. BioTechniques 17,870 -875.
Oro, A. E., Ong, E. S., Margolis, J. S., Posakony, J. W., McKeown, M. and Evans, R. M. (1988). The Drosophila gene knirps-related is a member of the steroid-receptor gene superfamily. Nature 336,493 -496.[CrossRef][Medline]
Pankratz, M. J., Busch, M., Hoch, M., Seifert, E. and Jackle, H. (1992). Spatial control of the gap gene knirps in the Drosophila embryo by posterior morphogen system. Science 255,986 -989.[Abstract/Free Full Text]
Parody, T. R. and Muskavitch, M. A. (1993). The pleiotropic function of Delta during postembryonic development of Drosophila melanogaster. Genetics 135,527 -539.[Abstract]
Pirrotta, V. (1999). Transvection and chromosomal trans-interaction effects. Biochim. Biophys. Acta 1424,M1 -M8.[Medline]
Roberts, D. B. (1986). Basic Drosophila care and techniques. In Drosophila: A Practical Approach (ed. D. B. Roberts), pp. 1-38. Washington, DC: IRL Press.
Rothe, M., Nauber, U. and Jäckle, H. (1989). Three hormone receptor-like Drosophila genes encode an identical DNA-binding finger. EMBO J. 8,3087 -3094.[Medline]
Rothe, M., Pehl, M., Taubert, H. and Jackle, H. (1992). Loss of gene function through rapid mitotic cycles in the Drosophila embryo. Nature 359,156 -159.[CrossRef][Medline]
Rushlow, C., Colosimo, P. F., Lin, M. C., Xu, M. and Kirov, N. (2001). Transcriptional regulation of the Drosophila gene zen by competing Smad and Brinker inputs. Genes Dev. 15,340 -351.[Abstract/Free Full Text]
Schnepp, B., Grumbling, G., Donaldson, T. and Simcox, A. (1996). Vein is a novel component in the Drosophila epidermal growth factor receptor pathway with similarity to the neuregulins. Genes Dev. 10,2302 -2313.[Abstract/Free Full Text]
Schnepp, B., Donaldson, T., Grumbling, G., Ostrowski, S., Schweitzer, R., Shilo, B.-Z. and Simcox, A. (1998). EGF domain swap converts a Drosophila EGF receptor activator into an inhibitor. Genes Dev. 12,908 -913.[Abstract/Free Full Text]
Schweitzer, R., Shaharabany, M., Seger, R. and Shilo, B.-Z. (1995). Secreted Spitz triggers the DER signaling pathway and is a limiting component in embryonic ventral ectoderm determination. Genes Dev. 9,1518 -1529.[Abstract/Free Full Text]
Shellenbarger, D. L. and Mohler, J. D. (1978). Temperature-sensitive periods and autonomy of pleiotropic effects of l(1)Nts 1, a conditional Notch lethal in Drosophila. Dev. Biol. 62,423 -446.
Shimell, M. J., Simon, J., Bender, W. and O'Connor, M. B. (1994). Enhancer point mutation results in a homeotic transformation in Drosophila. Science 264,968 -971.[Abstract/Free Full Text]
Simcox, A., Grumbling, G., Schnepp, B., Bennington-Mathias, C., Hersperger, E. and Shearn, A. (1996). Molecular, phenotypic, and expression analysis of vein, a gene required for growth of the Drosophila wing disc. Dev. Biol. 177,475 -489.[CrossRef][Medline]
Simmonds, A. J., Liu, X., Soanes, K. H., Krause, H. M., Irvine, K. D. and Bell, J. B. (1998). Molecular interactions between Vestigial and Scalloped promote wing formation in Drosophila. Genes Dev. 12,3815 -3820.[Abstract/Free Full Text]
Small, S., Blair, A. and Levine, M. (1996). Regulation of two pair-rule stripes by a single enhancer in the Drosophila embryo. Dev. Biol. 175,314 -324.[CrossRef][Medline]
Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98,503 -517.[CrossRef][Medline]
Strigini, M. and Cohen, S. M. (1999). Formation of morphogen gradients in the Drosophila wing. Semin. Cell Dev. Biol. 3,335 -344.
Sturtevant, M. A., Roark, M. and Bier, E. (1993). The Drosophila rhomboid gene mediates the localized formation of wing veins and interacts genetically with components of the EGF-R signaling pathway. Genes Dev. 7, 961-973.[Abstract/Free Full Text]
Sturtevant, M. A. and Bier, E. (1995). Analysis of the genetic hierarchy guiding wing vein formation in Drosophila.Development 121,785 -801.[Abstract]
Sturtevant, M. A., Roark, M., O'Neill, J. W., Biehs, B., Colley, N. and Bier, E. (1996). The Drosophila Rhomboid protein is concentrated in patches at the apical cell surface. Dev. Biol. 174,298 -309.[CrossRef][Medline]
Sturtevant, M. A., Biehs, B., Marin, E. and Bier, E. (1997). The spalt gene links the A/P compartment boundary to a linear adult structure in the Drosophila wing. Development 124,21 -32.[Abstract]
Tsuda, L., Nagaraj, R., Zipursky, S. L. and Banerjee, U. (2002). An EGFR/Ebi/Sno pathway promotes Delta expression by inactivating Su(H)/SMRTER repression during inductive Notch signaling. Cell 110,625 -637.[CrossRef][Medline]
Waddington, C. H. (1940). The genetic control of wing development in Drosophila. J. Genet. 41, 75-139.
Wharton, K. and Crews, S. (1993). CNS midline enhancers of the Drosophila slit and Toll genes. Mech. Dev. 40,141 -154.[CrossRef][Medline]
Zhang, H., Levine, M. and Ashe, H. L. (2001). Brinker is a sequence-specific transcriptional repressor in the Drosophila embryo. Genes Dev. 15,261 -266.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Guichard, J. M. Park, B. Cruz-Moreno, M. Karin, and E. Bier
From The Cover: Anthrax lethal factor and edema factor act on conserved targets in Drosophila
PNAS, February 28, 2006; 103(9): 3244 - 3249.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Anderson, R. Bhandari, and J. P. Kumar
A Genetic Screen Identifies Putative Targets and Binding Partners of CREB-Binding Protein in the Developing Drosophila Eye
Genetics, December 1, 2005; 171(4): 1655 - 1672.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. G. Mezey, D. Houle, and S. V. Nuzhdin
Naturally Segregating Quantitative Trait Loci Affecting Wing Shape of Drosophila melanogaster
Genetics, April 1, 2005; 169(4): 2101 - 2113.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Angulo, M. Corominas, and F. Serras
Activation and repression activities of ash2 in Drosophila wing imaginal discs
Development, October 15, 2004; 131(20): 4943 - 4953.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
C. Kwon, R. Hays, J. Fetting, and T. V. Orenic
Opposing inputs by Hedgehog and Brinker define a stripe of hairy expression in the Drosophila leg imaginal disc
Development, June 1, 2004; 131(11): 2681 - 2692.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
O. Cook, B. Biehs, and E. Bier
brinker and optomotor-blind act coordinately to initiate development of the L5 wing vein primordium in Drosophila
Development, May 1, 2004; 131(9): 2113 - 2124.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lunde, K.
Right arrow Articles by Bier, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lunde, K.
Right arrow Articles by Bier, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?