spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

doi: 10.1242/10.1242/dev.00204


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brown, J. L.
Right arrow Articles by Kassis, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brown, J. L.
Right arrow Articles by Kassis, J. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 130, 285-294 (2003)
Copyright © 2003 The Company of Biologists Limited

The Drosophila pho-like gene encodes a YY1-related DNA binding protein that is redundant with pleiohomeotic in homeotic gene silencing

J. Lesley Brown1, Cornelia Fritsch2,3, Jürg Mueller2,3 and Judith A. Kassis1,*

1 Laboratory of Molecular Genetics, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892, USA
2 EMBL, Gene Expression Programme, Meyerhofstr. 1, 69117, Heidelberg, Germany
3 Max-Planck-Institut für Entwicklungsbiologie, Spemannstr. 35/III, 72076 Tübingen, Germany

* Author for correspondence (e-mail: jkassis{at}mail.nih.gov)

Accepted 15 October 2002


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Polycomb group proteins (PcG) repress homeotic genes in cells where these genes must remain inactive during Drosophila and vertebrate development. This repression depends on cis-acting silencer sequences, called Polycomb group response elements (PREs). Pleiohomeotic (Pho), the only known sequence-specific DNA-binding PcG protein, binds to PREs but pho mutants show only mild phenotypes compared with other PcG mutants. We characterize pho-like, a gene encoding a protein with high similarity to Pho. Pho-like binds to Pho-binding sites in vitro and pho-like, pho double mutants show more severe misexpression of homeotic genes than do the single mutants. These results suggest that Pho and Pho-like act redundantly to repress homeotic genes. We examined the distribution of five PcG proteins on polytene chromosomes from pho-like, pho double mutants. Pc, Psc, Scm, E(z) and Ph remain bound to polytene chromosomes at most sites in the absence of Pho and Pho-like. At a few chromosomal locations, however, some of the PcG proteins are no longer present in the absence of Pho and Pho-like, suggesting that Pho-like and Pho may anchor PcG protein complexes to only a subset of PREs. Alternatively, Pho-like and Pho may not participate in the anchoring of PcG complexes, but may be necessary for transcriptional repression mediated through PREs. In contrast to Pho and Pho-like, removal of Trithorax-like/GAGA factor or Zeste, two other DNA-binding proteins implicated in PRE function, does not cause misexpression of homeotic genes or reporter genes in imaginal disks.

Key words: Polycomb group genes, Gene silencing, Drosophila


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Polycomb-group (PcG) proteins are conserved transcriptional repressors with important roles during embryonic and post-embryonic development in Drosophila and vertebrates (for reviews, see Brock and van Lohuizen, 2001Go; Francis and Kingston, 2001Go; Mahmoudi and Verrijzer, 2001Go; Simon and Tamkun, 2002Go). Among the best-characterized PcG target genes are the homeotic genes in Drosophila. At least 15 different PcG genes are required to repress homeotic genes in cells in which these genes must remain inactive during development. These PcG proteins exist in at least two distinct multiprotein complexes that do not appear to bind to DNA directly but bind to chromatin (Shao et al., 1999Go; Ng et al., 2000Go; Tie et al., 2001Go; Saurin et al., 2001Go). Antibody staining of polytene chromosomes revealed that PcG proteins are associated with about 80-100 loci in the Drosophila genome (Zink and Paro, 1989Go; DeCamillis et al., 1992Go; Martin and Adler, 1993Go; Rastelli et al., 1993Go; Lonie et al., 1994Go; Carrington and Jones, 1996Go; Peterson et al., 1997Go). Subsequently, chromatin-immunoprecipitation experiments showed that several PcG proteins can be crosslinked with specific DNA sequences, called Polycomb group response elements (PREs), in PcG target genes (Strutt and Paro, 1997Go; Strutt et al., 1997Go; Orlando et al., 1998Go). Recent progress towards understanding how PcG protein complexes may be anchored at PREs has come from the dissection of PREs and the identification of proteins that directly bind to PRE DNA.

PREs were first identified in reporter gene assays as cis-regulatory elements in homeotic genes that render expression of a reporter gene construct sensitive to mutations in PcG genes (Simon et al., 1993Go; Chan et al., 1994Go; Christen and Bienz, 1994Go). Furthermore, addition of a PRE causes unusual silencing of a mini-white reporter gene in transgenic flies and creates a new PcG band on polytene chromosomes at the transgene insertion site (reviewed by Pirrotta, 1997aGo; Pirrotta, 1997bGo; Kassis, 2002Go). Characterization of a PRE from the engrailed gene led to the identification of the PcG protein Pleiohomeotic (Pho) as a PRE-binding factor (Brown et al., 1998Go). Pho is a DNA-binding protein related to the mammalian transcription factor YY1 (Brown et al., 1998Go). Pho-binding sites are found in many different PREs and are required for PRE function in many different reporter constructs (Brown et al., 1998Go; Mihaly et al., 1998Go; Fritsch et al., 1999Go; Shimell et al., 2000Go; Mishra et al., 2001Go; Busturia et al., 2001Go). Despite this requirement for Pho-binding sites in reporter genes, pho mutants only weakly misexpress homeotic genes (Simon et al., 1992Go; Fritsch et al., 1999Go) and die as pharate adults with relatively weak homeotic transformations (Gehring, 1970Go). Thus, if Pho anchors PcG protein complexes on DNA, it most likely is not the only DNA-binding PcG protein that provides this function.

Because of the weak homeotic gene misexpression in pho mutants, we searched the Drosophila genome for pho-related sequences and identified a gene that we call pho-like (phol). The Phol protein binds to the same DNA sequence as Pho. The strong PcG phenotype of phol, pho double mutants shows that Phol is another DNA-binding protein required for PcG repression. We examined the distribution of five different PcG proteins on polytene chromosomes in phol, pho double mutants. Our data show that binding of PcG proteins to a few chromosomal bands requires pho and phol, but that at most chromosomal locations PcG proteins remain bound in the absence of Pho and Phol.

Finally, we analysed the requirement for two other DNA-binding proteins that have recently been implicated in PcG repression: GAGA factor, which is encoded by the gene Trithorax-like (Trl); and Zeste (Horard et al., 2000Go; Mishra et al., 2000; Hodgson et al., 2001Go; Busturia et al., 2001Go; Hur et al., 2002Go). We report experiments aimed at testing the role of these two proteins in PcG repression in imaginal disks. Our results provide no evidence for a requirement of either Trl or zeste in PcG repression in imaginal disks.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Cloning of the Pho-like zinc finger domain into the T7-link expression construct
PCR was performed on the on the EST clone, LD42095 using the rphoBam (5'GCTGGTAATGCCATGGGATCCGCTGGCGCGGCCGGC3') and rphoXhoR (5'CGGTGTCTTGTTGTTCACGAGTTACGGTGCGCGCGGCCA3') primers. rphoBam introduces an inframe BamHI site upstream of the first zinc finger (at amino acid 490) of Phol. rphoXhoR introduces an in-frame stop codon immediately downstream of the fourth zinc finger of Phol (amino acid 624) followed by a new XhoI site. The PCR product was subcloned downstream of the ß-globin 5' UTR and ATG in pT7link (provided by R. Treisman) to generate Pho-like490-624T7. The integrity of the inserted PCR product was confirmed by sequencing.

Gel mobility shift assay
35S-labeled full-length Pho protein was translated in vitro from the Pho2-520pT7 construct (Fritsch et al., 1999Go) and Phol from the Pho-like490-624T7 construct using the TNT reticulocyte lysate system (Promega). Gel mobility shift assays were performed as described previously (Americo et al., 2002Go) using 3 µl of the in vitro translation reaction.

Isolation of phol mutants
Virgin females from the stock EP0559 were crossed to males containing the immobilized transposase insertion, P[ry+({Delta}2, 3)]99B (Robertson et al., 1988Go) to generate deletions of the P-element and flanking DNA. Males of the genotype w; EP0559/ry506 Sb P[ry+({Delta}2, 3)]99B were crossed to w; TM3, Ser/Sb males. Individual w-, Ser male flies resulting from loss of the w+ marker present in the EP were crossed to w; TM3, Ser/Sb virgins and stocks were established that were EP0559(w-)/TM3. DNA was made from homozygous EP0559(w-) flies from 120 lines and checked for loss of the EP element using primers to the 5' and 3' ends of the P-element and flanking sequences. Lines that appeared to be missing phol DNA were subjected to further molecular analyses.

Identification of phol, pho double mutant larvae
phol homozygous (Tb+) male larvae were collected from a stock that was pho1/ciD; phol81A/TM6B, Tb. After removal of the salivary glands, DNA was prepared from the remaining carcass. The pho1 mutation is associated with a DOC element insertion at codon 272 upstream of the zinc finger domain of the Pho protein (Brown et al., 1998Go). To identify homozygous pho1 mutant larvae, we used primers 5'TTTGGCATTGATGGCTTCACG3' and 5'GCATTGCAGATGAATCTCTGA3' in a Long PCR reaction (Brown et al., 1998Go) with the DNA from individual larvae. The ciD chromosome gives a 618 bp PCR product, while the pho1 chromosome (which carries the DOC element insertion) generates a fragment in excess of 5 kb. pho1 homozygotes produce only the larger PCR product. The pho-like mutation was confirmed by the absence of a PCR product using the rpho14 (5'CGGTAGCCTCATCATCCTC3') and rpho23 (5'AGGGTTGCATTGTGG3') primers.

Polytene chromosome staining
Squashes were performed as described elsewhere (Zink et al., 1991Go), except incubation in solution 1 was for 30 seconds and in solution 2 was for 4.0-4.5 minutes. Slides were washed in PBS 10 minutes, incubated in blocking buffer (PBS, 5% BSA, 5% dried milk, 0.4% Tween 20) for 30 minutes, and incubated overnight at 4°C with primary antibody ({alpha}Pc, 1:100; {alpha}Scm, 1:50; {alpha}Psc, 1:50; {alpha}E(z), 1:25; {alpha}Ph, 1:500; {alpha}Ms13, 1:200; and {alpha}Pho, 1:100) in blocking buffer. Slides were rinsed 30 minutes in PBS (adjusted to 300 mM NaCl with 0.4% Tween 20) then incubated with secondary antibody for 1 hour at room temperature. Secondary antibodies were FITC-, Cy2- or Cy3-labelled affinity-purified F(ab')2 fragments (Jackson ImmunoResearch Labs). The slides were washed twice for 30 minutes in PBS (plus 0.1% Tween 20), stained with DAPI for 5 minutes, rinsed with PBS and mounted in 1 mg/ml phenylenediamine/70% glycerol in PBS. In some experiments, antibodies against Ms13, a male-specific protein that coats the male X (reviewed by Kelley and Kuroda, 2000), were used to identify unambiguously the X-chromosome.

Pho antibody
Rabbit polyclonal antibodies were raised against a gel-purified HIS-tag/Pho full-length fusion protein. The crude polyclonal antisera specifically super-shifted a Pho/DNA complex in gel shift assays (data not shown). In western blots the antibody detects a strong band corresponding to Pho and a very weak band corresponding to Phol in 0-12 hour nuclear embryonic extracts (data not shown).

Drosophila strains
The following strains were used in this study (FRT2A is an abbreviation for P{w+mW.hs=FRT(whs)}2A. FRT82B is an abbreviation for P{ry+t7.2=neoFRT}82B):

For analysis of phol81A or TrlR85 mutant clones in pho1 homozygotes, yw hs-flp/+; M(3)i55 hs-nGFP FRT2A/TM6B; pho1/+ virgins were crossed to w; phol81A FRT2A/TM6B; pho1/+ males or w; TrlR85 FRT2A/TM6B; pho1/+ males, respectively. In both cases, clones are marked by the absence of GFP and pho1 homozygotes were identified by their misexpression of Ubx protein.

Clonal analysis
Mitotic clones were generated by crossing the appropriate fly strains listed above and heat-shocking the F1 larvae. Heat shock treatment was for 1 hour in a 37°C water bath; larvae were then allowed to develop for 96 hours at 25°C. Prior to dissection, larvae were subjected to another 1 hour heat shock, followed by a 1 hour recovery period, to induce expression of the GFP marker protein.

Staining procedures
Inverted larval carcasses were fixed and labelled with antibodies against Ubx or Abd-B or ß-gal and, in the case of clonal analyses, double labelled with GFP antibody, followed by incubation with fluorescently labelled secondary antibodies as described (Beuchle et al., 2001Go). X-Gal staining was carried out as described (Christen and Bienz, 1994Go). Embryos were stained with ß-gal antibodies and biotinylated secondary antibodies, followed by DAB staining using standard protocols.

Reporter gene constructs
BP01 females (Müller and Bienz, 1991Go) were crossed to pho1/ciD males and BP01/+; pho1/+ flies were inbred. pho1 homozygotes were identified by the misexpression of the BP01 reporter gene in a quarter of the embryos. Mcp725-P[T8], an insertion on the third chromosome (Busturia et al., 1997Go), was recombined onto a TrlR85 FRT2A chromosome; recombinants were selected and tested for the presence of Mcp725-P[T8], TrlR85 and FRT2A. Males from a TrlR85 FRT2A Mcp725-P[T8]/TM6B stock were crossed with yw flp122; M(3)i5 5hs-nGFP FRT2A virgins and clones in their progeny were analysed for misexpression of the Mcp725-P[T8] transgene using antibodies against ß-gal and GFP.

The PREDGAGAmut reporter gene was obtained by mutating two to three nucleotides per GAGAG motive as indicated on top of the sequence in Fig. 7. Sixteen independent transformant lines were obtained and analysed.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 7. Trl is not required for repression or activation of homeotic genes in imaginal disks. (A,B) Wing (W) and haltere (H) imaginal disks with Trl mutant clones, which are marked by the lack of GFP signal, stained with antibodies against GFP (green) and Ubx (red in A) or ßgal (red in B) protein. In all cases, the Minute technique was used and clones were analysed 96 hours after clone induction. (A) No misexpression of Ubx was observed in Trl mutant clones (left). Trl mutant clones induced in pho homozygotes (right) do not show anymore misexpression of Ubx than is seen in pho homozygotes alone (compare with Fig. 3A). (B) Trl mutant clones induced in transgenic larvae that express the PRE1.6 (left) or MCP725 (right) reporter transgenes. Expression of both reporter transgenes is confined to the posterior half (ps 6; marked by asterisk) of the haltere disk in wild-type animals. No misexpression of the PRE1.6 reporter gene is detected in Trl mutant clones; the MCP reporter gene shows patchy expression of ß-gal in 10-20% of the wing disks, independent of whether the cells are wild-type or mutant for Trl, but is not seen in this disk. (C) Requirement for Pho, but not GAGA-binding sites for silencing. (Top) sequence of the 567 bp PRED fragment containing five GAGAG sites (green) and six binding sites for Pho protein (red). All six Pho-binding sites or all five GAGAG motives were mutated to obtain PREDPhomut and PREDGAGAmut, respectively; base substitutions are indicated above the sequence. (Below) X-Gal staining of wing imaginal disks carrying the indicated reporter transgene. In PRED and PREDGAGAmut transformants, the transgene is silenced in wing disks. No silencing is observed in PREDPhomut, transformants (Fritsch et al., 1999Go). (D) Requirement for trx but not Trl in maintaining homeotic gene expression in imaginal disks. Haltere (H) and third leg (L) imaginal disks with Trl (top) or trx (bottom) mutant clones stained with antibodies against GFP (green) and Ubx (red). In both cases mutant clones are marked by the lack of GFP signal and clones were analysed 96 hours after clone induction, the Minute technique was only used in the case of Trl. Ubx expression is unaffected in Trl mutant clones (white arrowheads), whereas trx mutant clones show a complete loss of Ubx signal (empty arrowheads).

 



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3. Essential role for pho and phol in the repression of homeotic genes in embryos and imaginal disks. (A) Wing imaginal disks from larvae stained with Ubx or Abd-B antibody (red in both cases). No Ubx or Abd-B expression is detected in wing imaginal disks of wild-type larvae or in phol homozygotes. In pho homozygotes, Ubx is misexpressed in some cells in the wing pouch; but Abd-B is not misexpressed. Strong misexpression of Ubx and Abd-B is observed in phol, pho double homozygous disks; misexpression of Ubx is confined to the wing pouch, the lack of misexpression in more peripheral parts of the wing disk is possibly the result of downregulation by Abd-B protein, which is expressed at higher levels in these regions. (B) phol function is required throughout development. Wing (W) and haltere (H) imaginal disks with clones of phol mutant cells, marked by the lack of GFP signal (green), were induced in pho homozygous larvae and disks were analysed 96 hours after clone induction by staining with antibody against Ubx (red). The Minute technique was used in this experiment to generate M+ phol—/M+ phol- cells that carry two copies of a wild-type Minute allele; this gives them a growth advantage relative to their M+ phol-/M- phol+ neighbours. Strong misexpression of Ubx is observed in clones in the wing pouch (filled arrowhead). The lack of misexpression in clones in peripheral regions of the wing disk and the reduction of Ubx signal in clones in peripheral regions of the haltere disk (empty arrowhead) might be due to downregulation by Abd-B. (C) Requirement for pho and Pho-binding sites for silencing in embryos. (Top) Embryos carrying the PRED reporter gene (Fritsch et al., 1999Go) show ß-gal expression restricted to parasegments 6-12 (ps 6-12) in late (stage 13) embryos. In PREDPhomut transformant stage 13 embryos, repression anterior to ps 6 is lost and the reporter gene is active in all segments because of mutation of the six Pho-binding sites in PRED. (Below) Expression of the BP01 reporter gene is restricted to ps 6-12 in wild-type (wt) stage 16 embryos (Müller and Bienz, 1991Go). pho mutant stage 16 embryos show misexpression of the reporter gene in the nervous system (asterisks) and in the epidermis. In all cases, embryos were stained with anti-ß-gal antibodies and are oriented anterior leftwards, dorsal upwards; the anterior boundary of ps 6 is indicated by an arrowhead.

 

    RESULTS AND DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Pho and Phol bind to the same DNA sequence
phol is located on chromosome 3 in polytene subdivision 67B and is designated by the Drosophila genome project as CG3445. This sequence is predicted to encode a protein of 669 amino acids with four zinc fingers that share 80% sequence identity with the four zinc fingers of Pho (Fig. 1A). Although this is less conservation than between Pho and human YY1, which have 96% sequence identity over the zinc-finger region (Brown et al., 1998Go), all amino acids involved in making important DNA contacts (Houbaviy et al., 1996Go) are conserved in Phol. In addition, a short region of the spacer, conserved between Pho and YY1 (Brown et al., 1998Go), is also conserved in Phol, although to a lesser extent (Fig. 1B). No other regions of conservation between Pho and Phol or between Phol and YY1 were detected.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1. Comparison of amino acid conservation and DNA-binding properties of Pho and Pho-like. (A) Amino acid identity (boxed) between Pho and Phol over the four zinc fingers. Amino acids from human YY1 that have been shown by X-ray crystallography to interact with DNA are marked (Houbaviy et al., 1996Go). Black circles represent amino acids that contact the DNA backbone. (+) represents positions that contact the DNA bases. White circles represent amino acids that contact both the DNA backbone and the bases. Cys and His residues of the zinc fingers are in bold. (B) Amino acid conservation within the spacer region between Pho, Phol and human YY1 (hYY1). Bold type indicates amino acids that are conserved between all three proteins. (C) The DNA sequence of the Pho and mutated Pho-binding site oligonucleotides used to test the DNA-binding specificity of the Phol zinc fingers. The mutated bases are denoted by the arrows. The Pho binding site is boxed. (D) Autoradiogram of a gel mobility shift assay showing binding of full-length Pho (lanes 1-3) and Phol zinc-finger protein (lanes 4-6) to the Pho-binding site. Lanes 1 and 4, no competitor DNA; lanes 2 and 5, 100x unlabeled Pho-binding site; lanes 3 and 6, 100x unlabeled mutated Pho-binding site. The specific Pho and Phol complexes are indicated by arrowheads. The broken arrow denotes a faint gel shift due to endogenous YY1 protein in the reticulocyte lysate.

 

As the amino acids contacting the DNA are identical in Pho and Phol, we expected Phol to have the same DNA-binding specificity as Pho. Gel shift assays with the Phol zinc-finger domain showed that this protein specifically bound an oligonucleotide containing a Pho-binding site. Binding was not competed by an oligonucleotide containing a mutated Pho-binding site (Fig. 1C,D). A gel shift using full-length Pho is shown for comparison. Pho and Phol can bind to the same DNA sequence with the same apparent binding specificity.

phol mutants are homozygous viable but female sterile
A Drosophila strain (EP0559) containing a P element insertion in the untranslated leader region of the phol transcription unit was obtained from the Drosophila genome project (Fig. 2A). Flies that are homozygous or hemizygous for this P-element insertion are viable and fertile. Two phol deletion alleles were generated by imprecise excision of the P-element (see Materials and Methods). In the phol81A null mutation, part of the P-element was deleted along with the entire phol-coding region. In phol106C, the EP0559 element was completely deleted along with 1389 bp of the phol transcription unit, but leaving the phol promoter and the zinc-finger region intact. Therefore, it is possible that phol106C encodes a truncated Phol protein. Importantly, the flanking transcription unit, CG3448, is left intact in both alleles. In phol81A, the deletion ends 846 bp upstream of the CG3448 mRNA. phol106C and phol81A are both homozygous and hemizygous viable; males are fertile but females are sterile. The female sterility of both mutant alleles is rescued by a phol transgene (data not shown). Homozygotes for either phol allele look phenotypically normal and the mutants show no obvious homeotic phenotypes. Eggs laid by mothers that are homozygous for either phol allele look normal, are fertilized, but do not develop (Fig. 2B,C). Embryos derived from germline clones from heterozygous phol106C and phol81A mothers have the same phenotype showing that phol is required in the germ cells (data not shown). The requirement for phol in the germline did not allow us to generate embryos that lack Phol protein and we therefore could not examine the role of phol in regulation of homeotic genes in embryos.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 2. Characterization of phol mutants. (A) The thick line indicates genomic DNA. The thin line indicates the extent of the phol transcription unit. The arrows indicate the start and direction of transcription of phol and the flanking transcription unit, CG3348. The transcription start sites are the first nucleotides of the ESTs from the Drosophila genome project. The shaded boxes indicate the extent of DNA deleted in the phol mutants. The approximate location of the start of the coding region (ATG), the conserved spacer region (S), and the zinc finger (zf) region are shown. (B,C) Embryos stained with DAPI and for the presence of the sperm tail (Karr, 1991Go). The embryo in B is from a wild-type mother and the embryo in C is from a phol mutant mother. The sperm tail is evident in both embryos (white arrows), but DAPI staining of nuclear DNA is evident only in the wild-type embryo (bright dots in centre of embryo).

 

Pho and Phol act redundantly to silence homeotic gene expression in imaginal disks
pho homozygotes die as pharate adults with weak homeotic transformations (Gehring, 1970Go), while phol homozygotes survive and are phenotypically normal adults. By contrast, phol, pho double mutants die as third instar larvae and fail to pupate. Examination of phol, pho larvae showed that the brain is smaller than normal, the disks are misshapen and smaller than wild-type disks, and the salivary gland polytene chromosomes were enlarged (data not shown). The larger salivary gland polytene chromosomes may be due to additional rounds of endoreplication in the double mutants. To test whether phol functions in PcG repression, we examined Ubx and Abd-B expression in wing imaginal disks from single and double mutants of phol and pho (Fig. 3A). As expected, no Ubx or Abd-B expression was observed in wild-type or phol mutant wing disks. pho mutants showed misexpression of Ubx in a few cells in the wing pouch, but did not misexpress Abd-B (Fig. 3A) (Fritsch et al., 1999Go). By contrast, phol, pho double mutants strongly misexpress Ubx and Abd-B in the wing disk (Fig. 3A). This suggests that Phol and Pho redundantly repress homeotic genes in imaginal disks and can partially substitute for each other. We note that Ubx misexpression is confined to the wing pouch in phol, pho double mutants; the lack of Ubx misexpression in more peripheral areas of the disk possibly reflects downregulation by Abd-B, which is strongly misexpressed in these regions of the disk (Fig. 3A).

We next tested whether removal of phol during larval development would also cause derepression of Ubx and Abd-B by generating clones of phol mutant cells in imaginal wing disks of pho mutant larvae. In these experiments, phol mutant cells were identified by the absence of a GFP marker. Strong misexpression of Ubx and Abd-B was observed in double mutant cells in the wing pouch similar to the misexpression observed in wing disks from the phol, pho double mutant larvae (Fig. 3B and data not shown). These observations suggest that either Phol or Pho is required throughout development to keep homeotic genes repressed.

A re-examination of the role of pho in embryos
It has recently been suggested that pho may not play a role in PRE function in embryos (Poux et al., 2001aGo). This was surprising to us given previous reports showing misexpression of engrailed, abd-A and Abd-B in pho mutant embryos (Moazed and O'Farrell, 1992Go; Simon et al., 1992Go). In addition, the severe defects observed in embryos lacking maternal pho function suggested a strong requirement for Pho during oogenesis and/or embryogenesis (Breen and Duncan, 1986Go; Girton and Jeon, 1994Go). We therefore re-examined the role of pho in embryos by testing the requirement for pho and Pho binding sites in the regulation of PRE-containing reporter genes.

We did not see any additional mis-expression of Ubx or AdbB in phol, pho double mutant embryos over what was seen in pho single mutants. Thus, we have conducted our embryonic experiment in pho single mutants. We looked at lacZ expression from a Pbx-Bxd-Ubx-lacZ (BP01) reporter gene (Müller and Bienz, 1991Go). This reporter is derepressed in Pc mutant embryos (Müller and Bienz, 1991Go). Similarly, we found that it is derepressed in a pho mutant (Fig. 3C). This shows that Pho protein is required for the silencing of this reporter gene in the embryo. Next, we looked at whether mutation of the Pho-binding sites within a PRE disrupts silencing. We used a construct containing PRED, a 567 bp fragment from the Ubx gene. We have previously shown that mutation of Pho-binding sites in PRED inactivated its silencing capability in imaginal disks (Fritsch et al., 1999Go). Poux et al. (Poux et al., 2001aGo) reported that mutation of Pho-binding sites did not cause a loss of PRED silencing in embryos. However, we obtained different results using the same lines. We looked at expression from three wild-type PRED lines and five PREDPhomut. All wild-type PRED lines gave the expression pattern shown. Two out of five PREDPhomut lines gave expression similar to that shown in Fig. 3C, including two out of three lines examined by Poux et al. (Poux et al., 2001aGo). A third PREDPhomut line also showed unrestricted expression in embryos but the levels were lower compared with the other lines. A fourth line showed no silencing in the embryonic epidermis and in discs, but maintained restricted expression in the embryonic CNS. A fifth line showed restricted expression similar to the wild-type PRED control lines. These results show that Pho protein and Pho-binding sites do play a role in repression during embryogenesis.

Binding of PcG proteins to polytene chromosomes in phol, pho double mutants
The experiments described above suggest that the DNA-binding proteins Pho and Phol play important and redundant roles in PcG repression. One possible role of these two proteins may be to anchor other PcG proteins to PREs. To test this hypothesis, we analysed binding of five different PcG proteins to polytene chromosomes in phol, pho double mutants.

First, we examined the localization of Pho proteins on polytene chromosomes of wild-type larvae. We previously reported binding of Pho to about 35 chromosomal sites (Fritsch et al., 1999Go). Using a new Pho antiserum, combined with immunofluorescent techniques, we now detect Pho binding to about 100 sites on polytene chromosomes (Fig. 4). Psc colocalizes with Pho at about 65% of these sites (Fig. 4). Psc has also been reported to bind to 65% of the Pc sites (Rastelli et al., 1993Go).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4. Pho and Psc colocalize to many sites on polytene chromosomes. This figure shows a partial spread of polytene chromosomes from a wild-type larva labelled with Pho (Cy2 labelled, green) and Psc (Cy3 labelled, red) antibodies. The individual Pho and Psc patterns are shown, together with an overlay of the two patterns in the final panel. Of the Pho sites, roughly 65% of them are also sites for Psc. Almost all of the Psc sites overlap with the Pho sites.

 

Next, we looked at the distribution of the PcG proteins Pc, Psc, Polyhomeotic (Ph), Sex combs on midleg (Scm) and Enhancer of zeste (E(z)) on polytene chromosomes. Pc, Ph and Psc are all core components of the PcG protein complex called PRC1 (Shao et al., 1999Go; Saurin et al., 2001Go; Francis and Kingston, 2001Go). Scm has also been reported to co-purify with PRC1 (Shao et al., 1999Go). Scm and Ph may also be present in protein complexes other than PRC1 (Roseman et al., 2001Go; Hodgson et al., 2001Go). E(z) is a component of the Esc-E(z) complex, which is distinct from PRC1 (Ng et al., 2000Go; Tie et al., 2001Go). We focused our analysis on PcG protein binding sites on the X chromosome and on the right arm of chromosome 3, which includes the bithorax and Antennapedia gene complexes (BXC and ANTC).

Fig. 5A shows binding of Pho, Pc, Psc, Ph and Scm to chromosomal sites in the distal region of the X chromosome in wild type and phol, pho double mutants. Three sites that are bound by all five PcG proteins in wild-type chromosomes are indicated. As expected, in phol, pho double mutants, no Pho protein is detected (Fig. 5A). Binding of Pc, Psc and Scm is lost at polytene subdivision 2D (Fig. 5A, arrow) in phol, pho double mutants; binding of these proteins to all other sites on the X chromosome is unaffected (Fig. 5A and data not shown). Binding of Ph is completely unaffected in phol, pho double mutants. In particular, the Ph signal at 2D is present, suggesting that Ph can bind at this site even if other PcG proteins are removed. We also find that Pc binding to 2D is not lost in either pho or phol single mutants (Fig. 5C), suggesting that the presence of either of these two proteins is sufficient for Pc to bind to this site.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 5. Analysis of PcG protein binding sites on the X chromosome. PcG-binding sites on polytene chromosomes were detected by immunofluorescent staining using primary antibodies directed against specific members of the PcG of genes. Secondary antibodies were Cy3-conjugated at 1:100 dilution (red). The DNA was labelled with DAPI (blue). An asterisks represents binding positions on the end of the X chromosome that do not change in the single or double mutants (with the exception of Pho, since all Pho bands are lost in the phol, pho double mutant). The arrow indicates the position of the 2D subdivision. (A) The binding pattern on chromosomes from wild-type (WT), or phol, pho double mutant larvae are shown for Pho, Pc, Psc, Scm and Ph. The Pc, Psc and Scm bands at the 2D position are lost in the phol, pho double mutants. (B) In E(z), a signal at 2D was seen only in about 20% of the wild-type chromosomes, and is not seen here. (C) Binding of Pc to the end of the X chromosome in pho and phol single mutants. The Pc 2D signal is not lost in pho or phol single mutants.

 

We were particularly interested in knowing whether E(z) protein distribution would change in the double mutants because the vertebrate homologues of Pho and Esc interact in in vitro binding experiments (Satijin et al., 2001) and Pho co-immunoprecipates with Esc in early embryos (Poux et al., 2001bGo). One attractive hypothesis is that Pho might be required for the binding of E(z)/Esc protein complexes to chromatin. However, we did not detect changes in any E(z) chromosomal sites on either the X chromosome (Fig. 5B) or on 3R in phol, pho double mutants (data not shown). It was reported that E(z) bound to chromosomal subdivision 2D (Carrington and Jones, 1996Go); however, we were able to detect E(z) at this site on only about 20% of the wild-type chromosomes. Although we never saw E(z) at 2D on phol, phol double mutant chromosomes, we cannot definitely conclude there is a difference between this and wild type.

The patterns of binding of Psc, Ph, Scm and E(z) proteins on chromosome arm 3R were indistinguishable in wild type and phol, pho double mutants (data not shown). In particular, these PcG proteins were still bound to regions that include the BXC and ANTC loci in phol, pho double mutants. The binding of Pc to the BXC and ANTC, and most other loci was also unaltered in the double mutant, but we found that binding to two specific chromosomal sites was lost (Fig. 6). Interestingly, Psc, Scm and E(z) were not detected at these sites on wild-type chromosomes (data not shown) (Rastelli et al., 1993Go; Carrington and Jones, 1996Go), suggesting that Pc binds independently of these proteins at these sites. Ph was present at one of these two sites, but its binding was not altered in phol, pho double mutants (data not shown).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6. Analysis of Pc binding sites on 3R. This figure shows the telomere end of 3R. Bands that are present in both wild-type and mutant chromosomes are linked with a white line. Bands that are absent in phol, pho double mutants are marked with an asterisk.

 

Taken together, the immunolocalization data suggest that binding of PcG proteins to most sites is unaltered in the absence of Pho and Phol protein, but that these two proteins are redundantly required for PcG protein binding at a few specific sites. Intriguingly, it appears that all PcG proteins tested here are still associated with the BXC and ANTC loci. Nevertheless, we found that the BXC genes Ubx and Abd-B were derepressed in phol, pho double mutant wing disks. We propose several different explanations for this paradox. First, derepression of homeotic genes and binding of PcG proteins were not assayed in the same tissues. We were not able to detect derepression of Ubx in salivary gland cells of phol, pho double mutants (data not shown). Second, Pho and Phol may only be required for anchoring PcG proteins at some PREs in the BXC. Different DNA-binding proteins may provide this function at other PREs. This is supported by our finding that binding of PcG proteins is lost at some sites in phol, pho double mutants (see Figs 5, 6). Moreover, several different PREs have been identified in the Ubx gene (Chan et al., 1994Go; Christen and Bienz, 1994Go; Müller, 1995Go; Chang et al., 1995Go; Orlando et al., 1998Go; Hodgson et al., 2001Go). The resolution of antibody signals on polytene chromosomes is not refined enough to resolve distinct PREs in a single gene and, hence, loss of only a fraction of PcG protein complexes may not be detectable. Finally, Phol and Pho may not be necessary for the anchoring of PcG protein complexes to the DNA, but may confer the actual transcriptional repression mediated by PREs in imaginal disks, while the PcG protein complexes might function in the propagation and memory of the repression. Thus, PcG protein complexes might serve to recruit Phol and Pho or their co-repressors to the DNA.

Trl is not redundant with pho for repression of homeotic genes in imaginal disks
The GAGA factor protein is encoded by the Trithorax-like (Trl) gene. A hypomorphic Trl allele was originally isolated due to mutant phenotypes that suggested a requirement for activation of homeotic gene expression (Farkas et al., 1994Go). The proposal that Trl functions in PcG repression was based on the observations that Trl protein bound to PRE sequences, that it co-immunoprecipitated with Pc, and that mutation of Trl-binding sites caused a loss of mini-white silencing and PRE function in reporter genes (Horard et al., 2000Go; Mishra et al., 2001Go; Busturia et al., 2001Go; Americo et al., 2002Go; Poux et al., 2002Go). These conflicting data prompted us to analyse the role of Trl in homeotic gene regulation by generating clones of Trl mutant cells in imaginal disks. In these experiments, we used TrlR85, a null allele (Farkas et al., 1994Go), and the mutant cells were again marked by the absence of a GFP marker protein.

We first analysed Trl mutant clones in the wing disk for misexpression of Ubx and Abd-B and found no evidence for such misexpression (Fig. 7A and data not shown). As PREs often contain Pho- and Trl-binding sites in close proximity, and Busturia et al. (Busturia et al., 2001Go) reported a weak genetic interaction between pho and Trl heterozygous mutants, we tested whether removal of Trl in pho mutant wing disks would exacerbate the misexpression of Ubx observed in pho mutants. This was not the case. pho mutant wing disks with clones of Trl homozygous cells showed no additional misexpression of Ubx compared with pho single mutants (compare Fig. 7A with Fig. 3A). Thus, we find no evidence for a genetic interaction between Trl and pho.

We also analysed the effects of removing Trl on the silencing capabilities of two different PRE-containing Ubx-LacZ reporter transgenes; PRE1.6 contains a PRE from the Ubx gene (Fritsch et al., 1999Go) and MCP725 contains a PRE from the Abd-B gene (Busturia et al., 1997Go). In wild-type flies, expression of both transgenes was confined to the posterior compartments of the haltere and third leg disks, and both transgenes were misexpressed in a variety of PcG mutants (Busturia et al., 1997Go; Fritsch et al., 1999Go) (M. Bakala, Diploma thesis, University of Tübingen, 2001). By contrast, we observed no misexpression of either transgene in Trl mutant clones in wing imaginal disks (Fig. 7B).

We also tested whether mutation of Trl protein binding sites (i.e. GAGAG sequences) in a PRE from the Ubx gene would compromise its silencing capability. For this experiment we used a previously described reporter gene, PRED, that is stably silenced in the wing imaginal disk due to the presence of the 567 bp long PRE core fragment (Fig. 7C) (Fritsch et al., 1999Go). Previous studies showed that mutation of Pho protein-binding sites within PRED abolished repression of this reporter transgene in wing imaginal disks (Fig. 7C) (Fritsch et al., 1999Go). By contrast, mutation of all five GAGAG motifs in PRED caused no misexpression of this reporter transgene (Fig. 7C). Sixteen lines were obtained, five produced expression caused by positional effects and could not be analysed. The other eleven all showed silencing in the wing disk similar to that shown in Fig. 7C.

Finally, we tested the requirement for Trl in maintaining expression of Ubx and Abd-B in their normal expression domains. Intriguingly, we observed no obvious reduction of Ubx or Abd-B expression in Trl mutant clones in the haltere and third leg disk (Ubx) or in the genital disk (Abd-B) (Fig. 7D and data not shown). By contrast, clones of trithorax (trx) mutant cells showed a dramatic reduction in Ubx protein levels (Fig. 7D).

These results fail to support a role for Trl in PcG repression in imaginal disks. However, we cannot exclude the possibility that Trl is playing a role in the establishment of PcG repression in the embryo. The requirement for Trl function in the germline and the early embryo (Liaw et al., 1995Go; Bhat et al., 1996Go) does not allow an analysis of embryos lacking Trl protein.

zeste is not redundant with Pho for repression of homeotic genes in imaginal disks
Another protein that has been proposed to function in PcG repression is Zeste (Hur et al., 2002Go). zeste (z) null mutants are viable and fertile and show no obvious homeotic phenotypes (Goldberg et al., 1989Go). However, Zeste co-purifies with the PcG protein complex PRC1 (Saurin et al., 2001Go) and Zeste protein binding sites have been implicated in PcG function of an embryonic reporter gene (Hur et al., 2002Go). To test whether z might interact genetically with pho in repression of homeotic genes, we examined the expression of Ubx in zv77h and in zv77h, pho1 double mutant wing disks. Both zv77h and pho1 are presumed null mutants (Goldberg et al., 1989Go; Brown et al., 1998Go). z mutant wing disks showed no misexpression of Ubx (Fig. 8) and z, pho double mutants showed no more misexpression of Ubx than that seen in pho mutant wing disks (compare Fig. 3A with Fig. 8).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 8. zeste is not required for repression of homeotic genes in imaginal disks. Wing imaginal disks from z homozygotes (left) or z, pho double homozygotes (right) stained with antibody against Ubx protein. No misexpression is detected in z mutant disks and z, pho double mutants do not show more misexpression (asterisk) than do pho homozygotes alone (compare with Fig. 3A).

 

Concluding remarks
Our results show a strong requirement for the DNA-binding proteins Pho and Pho-like in homeotic gene silencing in imaginal disks. In fact, the strong misexpression of homeotic genes observed in phol, pho double mutant imaginal cells is comparable with that seen in imaginal disk clones mutant for Pc, Scm, Sce or Pcl (Beuchle et al., 2001Go). The loss of PcG protein binding at only a small number of sites in phol, pho polytene chromosomes is consistent with the idea that Phol and Pho are required to recruit PcG protein complexes at only a subset of PREs. Alternatively, Phol and Pho may be required for transcriptional repression mediated by PREs, but not for anchoring of PcG protein complexes.


    ACKNOWLEDGMENTS
 
We are indebted to many people for the generous gifts of antibodies: Pat O'Farrell and Renato Paro for anti-Pc; Jeff Simon for anti-Scm; Donna Arndt-Jovin for anti-Ph; Paul Adler for anti-Psc; Rick Jones for anti-E(z); Tim Karr for anti-sperm tail (DROP 1.1); and Richard Kelley and Mitzi Kudora for anti-Msl3. We thank Judy Leatherman and Tom Jongens for an open exchange of information and reagents on phol. We thank Jim Kennison for stimulating discussions during the course of this work and comments on this manuscript. We also thank a reviewer for helpful suggestions.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 


Americo, J., Whiteley, M., Brown, J. L., Fujioka, M., Jaynes, J. B. and Kassis, J. A. (2002). A complex array of DNA-binding proteins required for pairing-sensitive silencing by a Polycomb Group Response Element from the Drosophila engrailed gene. Genetics 160,1561 -1571.[Abstract/Free Full Text]
Beuchle, D., Struhl, G. and Müller, J. (2001). Polycomb group proteins and heritable silencing of Drosophila Hox genes. Development 128,993 -1004.[Abstract]
Bhat, K. M., Farkas, G., Karch, F., Gyurkovics, H., Gausz, J. and Schedl, P. (1996). The GAGA factor is required in the early Drosophila embryo not only for transcriptional regulation but also for nuclear division. Development 122,1113 -1124.[Abstract]
Breen, T. R. and Duncan, I. M. (1986). Maternal expression of genes that regulate the Bithorax complex of Drosophila melanogaster. Dev. Biol. 118,442 -456.[CrossRef][Medline]
Brock, H. W. and van Lohuizen, M. (2001). The Polycomb group — no longer an exclusive club? Curr. Opin. Genet. Dev. 11,175 -181.[CrossRef][Medline]
Brown, J. L., Mucci, D., Whiteley, M., Dirksen, M.-L. and Kassis, J. A. (1998). The Drosophila Polycomb group gene pleiohomeotic encodes a sequence-specific DNA binding protein with homology to the multifunctional mammalian transcription factor YY1. Mol. Cell 1,1057 -1064.[CrossRef][Medline]
Busturia, A., Wightman, C. D. and Sakonju, S. (1997). A silencer is required for maintenance of transcriptional repression throughout Drosophila development. Development 124,4343 -4350.[Abstract]
Busturia, A., Lloyd, A., Bejarano, F., Zavortink, M., Xin, H. and Sakonju, S. (2001). The MCP silencer of the Drosophila Abd-B gene requires both Pleiohomeotic and GAGA factor for the maintenance of repression. Development 128,2163 -2173.[Abstract/Free Full Text]
Carrington, E. A. and Jones, R. S. (1996). The Drosophila enhancer of zeste gene encodes a chromosomal protein; examination of wild-type and mutant protein distribution. Development 122,4073 -4083.[Abstract]
Chan, C. S., Rastelli, L. and Pirrotta, V. (1994). A Polycomb response element in the Ubx gene that determines an epigenetically inherited state of repression. EMBO J. 13,2553 -2564.[Medline]
Chang, Y. L., King, B. O., O'Connor, M., Mazo, A. and Huang, D. H. (1995). Functional reconstruction of trans regulation of the Ultrabithorax promoter by the products of two antagonistic genes, trithorax and Polycomb. Mol. Cell. Biol. 15,6601 -6612.[Abstract]
Christen, B. and Bienz, M. (1994). Imaginal disc silencers from Ultrabithorax: evidence for Polycomb response elements. Mech. Dev. 45,255 -266.[CrossRef][Medline]
DeCamillis, M., Cheng, N., Pierre, D. and Brock, H. (1992). The polyhomeotic gene of Drosophila encodes a chromatin protein that shares polytene chromosome binding sites with Polycomb. Genes Dev. 6,223 -232.[Abstract/Free Full Text]
Farkas, G., Guasz, J., Galloni, G., Reuter, H., Gyurkovics, H. and Karch, F. (1994). The trithorax-like gene encodes the Drosophila GAGA factor. Nature 371,806 -808.[CrossRef][Medline]
Francis, N. J. and Kingston, R. E. (2001). Mechanisms of transcriptional memory. Nat. Rev. 2, 409-421.[CrossRef]
Fritsch, C., Brown, J. L., Kassis, J. A. and Müller, J. (1999). The DNA binding Polycomb group protein Pleiohomeotic mediates silencing of a Drosophila homeotic gene. Development 126,3905 -3913.[Abstract]
Gehring, W. J. (1970). A recessive lethal (l(4)29) with a homeotic effect in D.melanogaster. Dros. Inf. Serv. 45,103 .
Girton, J. R. and Jeon, S. H. (1994). Novel embryonic and adult homeotic phenotypes are produced by pleiohomeotic mutations in Drosophila. Dev. Biol. 161,393 -407.[CrossRef][Medline]
Goldberg, M. L., Colvin, R. A. and Mellin, A. F. (1989). The Drosophila zeste locus in nonessential. Genetics 123,145 -155.[Abstract/Free Full Text]
Hodgson, J. W., Argiropoulos, B. and Brock, H. W. (2001). Site-specific recognition of a 70-base-pair element containing d(GA)(n) repeats mediates bithoraxoid polycomb group response element-dependent silencing. Mol. Cell. Biol. 21,4528 -4543.[Abstract/Free Full Text]
Horard, B., Tatout, C., Poux, S. and Pirrotta, V. (2000). Structure of a Polycomb response element and in vitro binding of Polycomb Group complexes containing GAGA factor. Mol. Cell. Biol. 20,3187 -3197.[Abstract/Free Full Text]
Houbaviy, H. B., Usheva, A., Schenk, T. and Burley, S. K. (1996). Co-crystal structure of YY1 bound to the adeno-associated virus P5 initiator. Proc. Natl. Acad. Sci USA 93,13577 -14582.[Abstract/Free Full Text]
Hur, M.-W., Laney, J. D., Jeon, S.-H., Ali, J. and Biggan, M. D. (2002). Zeste maintains repression of Ubx transgenes: support for a new model of Polycomb repression. Development 129,1339 -1343.[Medline]
Karr, T. L. (1991). Intracellular Sperm/egg interactions in Drosophila: a three-dimensional structural analysis of a paternal product in the developing egg. Mech. Dev. 34,101 -112.[CrossRef][Medline]
Kassis, J. A. (2002). Pairing-sensitive silencing, Polycomb group response elements, and transposon homing in Drosophila. Adv. Genet. 46,421 -438.[Medline]
Kelley, R. L. and Kudora, M. I. (2000). The role of chromosomal RNAs in marking the X for dosage compensation. Curr. Opin. Genet. Dev. 10,555 -561.[CrossRef][Medline]
Liaw, G. J., Rudolph, K. M., Huang, J. D., Dubnicoff, T., Courey, A. J. and Lengyel, J. A. (1995). The torso response element binds GAGA and NTF-1/Elf-1, and regulates tailless by relief of repression. Genes Dev. 9,3163 -3176.[Abstract/Free Full Text]
Lonie, A., D'Andrea, R., Paro, R. and Saint, R. (1994). Molecular characterization of the Polycomblike gene of Drosophila melanogaster, a trans-acting negative regulator of homeotic gene expression. Development 120,2629 -2636.[Abstract/Free Full Text]
Mahmoudi, T. and Verrijzer, C. P. (2001). Chromatin silencing and activation by Polycomb and trithorax group proteins. Oncogene 20,3055 -3066.[CrossRef][Medline]
Martin, E. C. and Adler, P. N. (1993). The polycomb group gene Posterior sex Combs encodes a chromosomal protein. Development 117,641 -655.[Abstract]
Mihaly, J., Mishra, R. K. and Karch, F. (1998). A conserved sequence motif in Polycomb-response elements. Mol. Cell 1,1065 -1066.[CrossRef][Medline]
Mishra, R. K., Mihaly, J., Barges, S., Spierer, A., Karch, F., Hagstrom, K., Schweinsberg, S. E. and Schedl, P. (2001). The iab-7 Polycomb response element maps to a nucleosome-free region of chromatin and requires both GAGA and pleiohomeotic for silencing activity. Mol. Cell. Biol. 21,1311 -18.[Abstract/Free Full Text]
Moazed, D. and O'Farrell, P. H. (1992). Maintenance of the engrailed expression pattern by Polycomb group genes in Drosophila. Development 116,805 -810.[Abstract]
Müller, J. (1995). Transcriptional silencing by the Polycomb protein in Drosophila embryos. EMBO J. 14,1209 -1220.[Medline]
Müller, J. and Bienz, M. (1991). Long range repression conferring boundaries of Ultrabithorax expression in the Drosophila embryo. EMBO J. 10,3147 -3155.[Medline]
Ng, J., Hart, C. M., Morgan, K. and Simon, J. A. (2000). A Drosophila ESC-E(Z) protein complex is distinct from other Polycomb group complexes and contains covalently modified ESC. Mol. Cell. Biol. 20,3069 -3078.[Abstract/Free Full Text]
Orlando, V., Jane, E. P., Chinwalla, V., Harte, P. J. and Paro, R. (1998). Binding of Trithorax and Polycomb proteins to the bithorax complex: dynamic changes during early Drosophila embryogenesis. EMBO J. 17,5141 -5150.[CrossRef][Medline]
Perrimon, N., Engstrom, L. and Mahowald, A. P. (1985). Developmental genetics of the 2C-D region of the Drosophila X chromosome. Genetics 111, 23-41.[Abstract/Free Full Text]
Peterson, A. J., Kyba, M., Bornemann, D., Morgan, K., Brock, H. and Simon, J. (1997). A domain shared by the Polycomb group proteins Scm and ph mediates heterotypic and homotypic interactions. Mol. Cell. Biol. 17,6683 -6692.[Abstract]
Pirrotta, V. (1997a). Chromatin-silencing mechanisms in Drosophila maintain patterns of gene expression. Trends Genet. 13,314 -318.[CrossRef][Medline]
Pirrotta, V. (1997b). PcG complexes and chromatin silencing. Curr. Opin. Gen. Dev. 7, 249-258.[CrossRef][Medline]
Poux, S., McCabe, D. and Pirrotta, V. (2001a). Recruitment of components of Polycomb Group chromatin complexes in Drosophila. Development 128, 75-85.[Abstract]
Poux, S., Melfi, R. and Pirrotta, V. (2001b). Establishment of Polycomb silencing requires a transient interaction between PC and ESC. Genes Dev. 15,2509 -2514.[Abstract/Free Full Text]
Poux, S., Horard, B., Sigrist, C. J. A. and Pirrotta, V. (2002). The Drosophila Trithorax protein is a coactivator required to prevent reestablishment of Polycomb silencing. Development 129,2483 -2493.[Medline]
Rastelli, L., Chan, C. S. and Pirrotta, V. (1993). Related chromosome binding sites for zeste, suppressors of zeste and Polycomb group proteins in Drosophila and their dependence on Enhancer of zeste function. EMBO J. 12,1513 -1522.[Medline]
Robertson, H. M., Preston, C. R., Phillis, R. W., Johnson-Schlitz, D. M., Benz, W. K. and Engels, W. R. (1988). A stable genomic source of P-element transposase in Drosophila melanogaster. Genetics 118,461 -470.[Abstract/Free Full Text]
Roseman, R. R., Morgan, K., Mallin, D. R., Roberson, R., Parnell, T. J., Bornemann, D. J., Simon, J. A. and Geyer, P. K. (2001). Long-range repression by multiple Polycomb Group (PcG) proteins targeted by fusion to a defined DNA-binding domain in Drosophila. Genetics 158,291 -307.[Abstract/Free Full Text]
Satijn, D. P. E., Hamer, K. M., den Blaauwen, J. and Otte, A. P. (2001). The polycomb group protein EED interacts with YY1, and both proteins include neural tissue in Xenopus embryos. Mol. Cell. Biol. 21,1360 -1369.[Abstract/Free Full Text]
Saurin, A. J., Shao, Z. Erdjument-Bromage, H., Tempst, P. and Kingston, R. E. (2001). A Dosophila Polycomb group complex includes Zeste and dTAFII proteins. Nature 412,655 -660.[CrossRef][Medline]
Shao, Z., Raible, F., Mollaaghababa, R., Guyon, J. R., Wu, C.-T., Bender, W. and Kingston, R. E. (1999). Stabilization of chromatin structure by PRC1, a Polycomb complex. Cell 147,209 -221.
Shimell, M. J., Peterson, A. J., Burr, J., Simon, J. A. and O'Connor, M. B. (2000). Functional analysis of repressor binding sites in the iab-2 regulatory region of the abdominal-A homeotic gene. Dev. Biol 218, 38-52.[CrossRef][Medline]
Simon, J., Chiang, A. and Bender, W. (1992). Ten different Polycomb group genes are required for spatial control of the abdA and AbdB homeotic products. Development 14,493 -505.
Simon, J., Chaing, A., Bender, W., Shimell, M. J. and O'Connor, M. (1993). Elements of the Drosophila bithorax complex that mediate repression by Polycomb group products. Dev. Biol. 158,131 -144.[CrossRef][Medline]
Simon, J. A. and Tamkun, J. W. (2002). Programming on and off states in chromatin: mechanisms of Polycomb and trithorax group complexes. Curr. Opin. Genet. Dev. 12,210 -218.[CrossRef][Medline]
Strutt, H., Cavelli, G. and Paro, R. (1997). Co-localization of Polycomb protein and GAGA factor on regulatory elements responsible for the maintenance of homeotic gene expression. EMBO J. 16,3621 -3633.[CrossRef][Medline]
Strutt, H. and Paro, R. (1997). The Polycomb group protein complex of Drosophila has a differential composition at different target genes. Mol. Cell. Biol. 17,6773 -6783.[Abstract]
Tie, F., Furuyama, T., Prasad-Sinha, J., Jane, E. and Harte, P. J. (2001). The Drosophila Polycomb group proteins ESC and E(Z) are present in a complex containing the histone-binding protein p55 and the histone deacetylase RPD3. Development 128,275 -286.[Abstract]
Zink, B. and Paro, R. (1989). In vivo binding pattern of a trans-regulator of homeotic genes in Drosophila melanogaster. Nature 337,468 -471.[CrossRef][Medline]
Zink, B., Engstrom, Y., Gehring, W. J. and Paro, R. (1991). Direct interaction of the Polycomb protein with Antennapedia regulatory sequences in polytene chromosomes of Drosophila melanogaster. EMBO J. 10,153 -162.[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
S. Wu, Y.-C. Hu, H. Liu, and Y. Shi
Loss of YY1 Impacts the Heterochromatic State and Meiotic Double-Strand Breaks during Mouse Spermatogenesis
Mol. Cell. Biol., December 1, 2009; 29(23): 6245 - 6256.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
B. Schuettengruber and G. Cavalli
Recruitment of Polycomb group complexes and their role in the dynamic regulation of cell fate choice
Development, November 1, 2009; 136(21): 3531 - 3542.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. B. Emmons, H. Genetti, S. Filandrinos, J. Lokere, and C.-t. Wu
Molecular Genetic Analysis of Suppressor 2 of zeste Identifies Key Functional Domains
Genetics, August 1, 2009; 182(4): 999 - 1013.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Fang, H. Ren, J. Liu, K. M. Cadigan, S. R. Patel, and G. R. Dressler
Drosophila ptip is essential for anterior/posterior patterning in development and interacts with the PcG and trxG pathways
Development, June 1, 2009; 136(11): 1929 - 1938.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Fujioka, G. L. Yusibova, J. Zhou, and J. B. Jaynes
The DNA-binding Polycomb-group protein Pleiohomeotic maintains both active and repressed transcriptional states through a single site
Development, December 15, 2008; 135(24): 4131 - 4139.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
D. Pasini, A.P. Bracken, K. Agger, J. Christensen, K. Hansen, P.A.C. Cloos, and K. Helin
Regulation of Stem Cell Differentiation by Histone Methyltransferases and Demethylases
Cold Spring Harb Symp Quant Biol, November 6, 2008; (2008) sqb.2008.73.009v1.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
A. Villagra, N. Ulloa, X. Zhang, Z. Yuan, E. Sotomayor, and E. Seto
Histone Deacetylase 3 Down-regulates Cholesterol Synthesis through Repression of Lanosterol Synthase Gene Expression
J. Biol. Chem., December 7, 2007; 282(49): 35457 - 35470.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Beisel, A. Buness, I. M. Roustan-Espinosa, B. Koch, S. Schmitt, S. A. Haas, M. Hild, T. Katsuyama, and R. Paro
Comparing active and repressed expression states of genes controlled by the Polycomb/Trithorax group proteins
PNAS, October 16, 2007; 104(42): 16615 - 16620.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. G. de Ayala Alonso, L. Gutierrez, C. Fritsch, B. Papp, D. Beuchle, and J. Muller
A Genetic Screen Identifies Novel Polycomb Group Genes in Drosophila
Genetics, August 1, 2007; 176(4): 2099 - 2108.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
H. Liu, M. Schmidt-Supprian, Y. Shi, E. Hobeika, N. Barteneva, H. Jumaa, R. Pelanda, M. Reth, J. Skok, K. Rajewsky, et al.
Yin Yang 1 is a critical regulator of B-cell development
Genes & Dev., May 15, 2007; 21(10): 1179 - 1189.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
L. Ringrose and R. Paro
Polycomb/Trithorax response elements and epigenetic memory of cell identity
Development, January 15, 2007; 134(2): 223 - 232.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. H. Wilkinson, K. Park, and M. L. Atchison
Polycomb recruitment to DNA in vivo by the YY1 REPO domain
PNAS, December 19, 2006; 103(51): 19296 - 19301.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Fiedler and M. Rehmsmeier
jPREdictor: a versatile tool for the prediction of cis-regulatory elements.
Nucleic Acids Res., July 1, 2006; 34(Web Server issue): W546 - W550.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
T. Klymenko, B. Papp, W. Fischle, T. Kocher, M. Schelder, C. Fritsch, B. Wild, M. Wilm, and J. Muller
A Polycomb group protein complex with sequence-specific DNA-binding and selective methyl-lysine-binding activities
Genes & Dev., May 1, 2006; 20(9): 1110 - 1122.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. Wang, N. Jahren, M. L. Vargas, E. F. Andersen, J. Benes, J. Zhang, E. L. Miller, R. S. Jones, and J. A. Simon
Alternative ESC and ESC-Like Subunits of a Polycomb Group Histone Methyltransferase Complex Are Differentially Deployed during Drosophila Development.
Mol. Cell. Biol., April 1, 2006; 26(7): 2637 - 2647.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. L. Brown, D. J. Grau, S. K. DeVido, and J. A. Kassis
An Sp1/KLF binding site is important for the activity of a Polycomb group response element from the Drosophila engrailed gene
Nucleic Acids Res., September 9, 2005; 33(16): 5181 - 5189.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. Mohd-Sarip, F. Cleard, R. K. Mishra, F. Karch, and C. P. Verrijzer
Synergistic recognition of an epigenetic DNA element by Pleiohomeotic and a Polycomb core complex
Genes & Dev., August 1, 2005; 19(15): 1755 - 1760.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
L. Srinivasan and M. L. Atchison
YY1 DNA binding and PcG recruitment requires CtBP
Genes & Dev., November 1, 2004; 18(21): 2596 - 2601.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. K. Sengupta, A. Kuhrs, and J. Muller
General transcriptional silencing by a Polycomb response element in Drosophila
Development, May 1, 2004; 131(9): 1959 - 1965.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
L. Palko, H. W. Bass, M. J. Beyrouthy, and M. M. Hurt
The Yin Yang-1 (YY1) protein undergoes a DNA-replication-associated switch in localization from the cytoplasm to the nucleus at the onset of S phase
J. Cell Sci., January 22, 2004; 117(3): 465 - 476.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
Y.B. SCHWARTZ, T.G. KAHN, G.I. DELLINO, and V. PIRROTTA
Polycomb Silencing Mechanisms in Drosophila
Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 301 - 308.
[Abstract] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
Y. ZHANG, R. CAO, L. WANG, and R.S. JONES
Mechanism of Polycomb Group Gene Silencing
Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 309 - 318.
[Abstract] [PDF]


Home page
Nucleic Acids ResHome page
T. Mahmoudi, L. M. P. Zuijderduijn, A. Mohd-Sarip, and C. P. Verrijzer
GAGA facilitates binding of Pleiohomeotic to a chromatinized Polycomb response element
Nucleic Acids Res., July 15, 2003; 31(14): 4147 - 4156.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brown, J. L.
Right arrow Articles by Kassis, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brown, J. L.
Right arrow Articles by Kassis, J. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?