|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00204
1 Laboratory of Molecular Genetics, National Institute of Child Health and Human
Development, National Institutes of Health, Bethesda, MD 20892, USA
2 EMBL, Gene Expression Programme, Meyerhofstr. 1, 69117, Heidelberg,
Germany
3 Max-Planck-Institut für Entwicklungsbiologie, Spemannstr. 35/III, 72076
Tübingen, Germany
* Author for correspondence (e-mail: jkassis{at}mail.nih.gov)
Accepted 15 October 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Polycomb group genes, Gene silencing, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
PREs were first identified in reporter gene assays as
cis-regulatory elements in homeotic genes that render expression of a
reporter gene construct sensitive to mutations in PcG genes
(Simon et al., 1993
;
Chan et al., 1994
;
Christen and Bienz, 1994
).
Furthermore, addition of a PRE causes unusual silencing of a
mini-white reporter gene in transgenic flies and creates a new PcG
band on polytene chromosomes at the transgene insertion site (reviewed by
Pirrotta, 1997a
;
Pirrotta, 1997b
;
Kassis, 2002
).
Characterization of a PRE from the engrailed gene led to the
identification of the PcG protein Pleiohomeotic (Pho) as a PRE-binding factor
(Brown et al., 1998
). Pho is a
DNA-binding protein related to the mammalian transcription factor YY1
(Brown et al., 1998
).
Pho-binding sites are found in many different PREs and are required for PRE
function in many different reporter constructs
(Brown et al., 1998
;
Mihaly et al., 1998
;
Fritsch et al., 1999
;
Shimell et al., 2000
;
Mishra et al., 2001
;
Busturia et al., 2001
). Despite
this requirement for Pho-binding sites in reporter genes, pho mutants
only weakly misexpress homeotic genes
(Simon et al., 1992
;
Fritsch et al., 1999
) and die
as pharate adults with relatively weak homeotic transformations
(Gehring, 1970
). Thus, if Pho
anchors PcG protein complexes on DNA, it most likely is not the only
DNA-binding PcG protein that provides this function.
Because of the weak homeotic gene misexpression in pho mutants, we searched the Drosophila genome for pho-related sequences and identified a gene that we call pho-like (phol). The Phol protein binds to the same DNA sequence as Pho. The strong PcG phenotype of phol, pho double mutants shows that Phol is another DNA-binding protein required for PcG repression. We examined the distribution of five different PcG proteins on polytene chromosomes in phol, pho double mutants. Our data show that binding of PcG proteins to a few chromosomal bands requires pho and phol, but that at most chromosomal locations PcG proteins remain bound in the absence of Pho and Phol.
Finally, we analysed the requirement for two other DNA-binding proteins
that have recently been implicated in PcG repression: GAGA factor, which is
encoded by the gene Trithorax-like (Trl); and Zeste
(Horard et al., 2000
; Mishra
et al., 2000; Hodgson et al.,
2001
; Busturia et al.,
2001
; Hur et al.,
2002
). We report experiments aimed at testing the role of these
two proteins in PcG repression in imaginal disks. Our results provide no
evidence for a requirement of either Trl or zeste in PcG
repression in imaginal disks.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Gel mobility shift assay
35S-labeled full-length Pho protein was translated in vitro from
the Pho2-520pT7 construct
(Fritsch et al., 1999
) and
Phol from the Pho-like490-624T7 construct using the TNT
reticulocyte lysate system (Promega). Gel mobility shift assays were performed
as described previously (Americo et al.,
2002
) using 3 µl of the in vitro translation reaction.
Isolation of phol mutants
Virgin females from the stock EP0559 were crossed to males containing the
immobilized transposase insertion, P[ry+(
2, 3)]99B
(Robertson et al., 1988
) to
generate deletions of the P-element and flanking DNA. Males of the genotype
w; EP0559/ry506 Sb
P[ry+(
2, 3)]99B were crossed to w; TM3,
Ser/Sb males. Individual w-, Ser male flies resulting
from loss of the w+ marker present in the EP were crossed
to w; TM3, Ser/Sb virgins and stocks were established that were
EP0559(w-)/TM3. DNA was made from homozygous
EP0559(w-) flies from 120 lines and checked for loss of
the EP element using primers to the 5' and 3' ends of the
P-element and flanking sequences. Lines that appeared to be missing
phol DNA were subjected to further molecular analyses.
Identification of phol, pho double mutant larvae
phol homozygous (Tb+) male larvae were
collected from a stock that was pho1/ciD;
phol81A/TM6B, Tb. After removal of the salivary glands, DNA
was prepared from the remaining carcass. The pho1 mutation
is associated with a DOC element insertion at codon 272 upstream of the zinc
finger domain of the Pho protein (Brown et
al., 1998
). To identify homozygous pho1 mutant
larvae, we used primers 5'TTTGGCATTGATGGCTTCACG3' and
5'GCATTGCAGATGAATCTCTGA3' in a Long PCR reaction
(Brown et al., 1998
) with the
DNA from individual larvae. The ciD chromosome gives a 618
bp PCR product, while the pho1 chromosome (which carries
the DOC element insertion) generates a fragment in excess of 5 kb.
pho1 homozygotes produce only the larger PCR product. The
pho-like mutation was confirmed by the absence of a PCR product using
the rpho14 (5'CGGTAGCCTCATCATCCTC3') and rpho23
(5'AGGGTTGCATTGTGG3') primers.
Polytene chromosome staining
Squashes were performed as described elsewhere
(Zink et al., 1991
), except
incubation in solution 1 was for 30 seconds and in solution 2 was for 4.0-4.5
minutes. Slides were washed in PBS 10 minutes, incubated in blocking buffer
(PBS, 5% BSA, 5% dried milk, 0.4% Tween 20) for 30 minutes, and incubated
overnight at 4°C with primary antibody (
Pc, 1:100;
Scm,
1:50;
Psc, 1:50;
E(z), 1:25;
Ph, 1:500;
Ms13,
1:200; and
Pho, 1:100) in blocking buffer. Slides were rinsed 30
minutes in PBS (adjusted to 300 mM NaCl with 0.4% Tween 20) then incubated
with secondary antibody for 1 hour at room temperature. Secondary antibodies
were FITC-, Cy2- or Cy3-labelled affinity-purified F(ab')2
fragments (Jackson ImmunoResearch Labs). The slides were washed twice for 30
minutes in PBS (plus 0.1% Tween 20), stained with DAPI for 5 minutes, rinsed
with PBS and mounted in 1 mg/ml phenylenediamine/70% glycerol in PBS. In some
experiments, antibodies against Ms13, a male-specific protein that coats the
male X (reviewed by Kelley and Kuroda, 2000), were used to identify
unambiguously the X-chromosome.
Pho antibody
Rabbit polyclonal antibodies were raised against a gel-purified HIS-tag/Pho
full-length fusion protein. The crude polyclonal antisera specifically
super-shifted a Pho/DNA complex in gel shift assays (data not shown). In
western blots the antibody detects a strong band corresponding to Pho and a
very weak band corresponding to Phol in 0-12 hour nuclear embryonic extracts
(data not shown).
Drosophila strains
The following strains were used in this study (FRT2A is an
abbreviation for P{w+mW.hs=FRT(whs)}2A. FRT82B
is an abbreviation for P{ry+t7.2=neoFRT}82B):
For analysis of phol81A or TrlR85 mutant clones in pho1 homozygotes, yw hs-flp/+; M(3)i55 hs-nGFP FRT2A/TM6B; pho1/+ virgins were crossed to w; phol81A FRT2A/TM6B; pho1/+ males or w; TrlR85 FRT2A/TM6B; pho1/+ males, respectively. In both cases, clones are marked by the absence of GFP and pho1 homozygotes were identified by their misexpression of Ubx protein.
Clonal analysis
Mitotic clones were generated by crossing the appropriate fly strains
listed above and heat-shocking the F1 larvae. Heat shock treatment
was for 1 hour in a 37°C water bath; larvae were then allowed to develop
for 96 hours at 25°C. Prior to dissection, larvae were subjected to
another 1 hour heat shock, followed by a 1 hour recovery period, to induce
expression of the GFP marker protein.
Staining procedures
Inverted larval carcasses were fixed and labelled with antibodies against
Ubx or Abd-B or ß-gal and, in the case of clonal analyses, double
labelled with GFP antibody, followed by incubation with fluorescently labelled
secondary antibodies as described (Beuchle
et al., 2001
). X-Gal staining was carried out as described
(Christen and Bienz, 1994
).
Embryos were stained with ß-gal antibodies and biotinylated secondary
antibodies, followed by DAB staining using standard protocols.
Reporter gene constructs
BP01 females (Müller and
Bienz, 1991
) were crossed to
pho1/ciD males and BP01/+;
pho1/+ flies were inbred. pho1 homozygotes
were identified by the misexpression of the BP01 reporter gene in a
quarter of the embryos. Mcp725-P[T8], an insertion on the third
chromosome (Busturia et al.,
1997
), was recombined onto a TrlR85 FRT2A
chromosome; recombinants were selected and tested for the presence of
Mcp725-P[T8], TrlR85 and FRT2A. Males from a
TrlR85 FRT2A Mcp725-P[T8]/TM6B stock were crossed with
yw flp122; M(3)i5 5hs-nGFP FRT2A virgins and clones in their progeny
were analysed for misexpression of the Mcp725-P[T8] transgene using
antibodies against ß-gal and GFP.
The PREDGAGAmut reporter gene was obtained by mutating two to three nucleotides per GAGAG motive as indicated on top of the sequence in Fig. 7. Sixteen independent transformant lines were obtained and analysed.
|
|
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
As the amino acids contacting the DNA are identical in Pho and Phol, we expected Phol to have the same DNA-binding specificity as Pho. Gel shift assays with the Phol zinc-finger domain showed that this protein specifically bound an oligonucleotide containing a Pho-binding site. Binding was not competed by an oligonucleotide containing a mutated Pho-binding site (Fig. 1C,D). A gel shift using full-length Pho is shown for comparison. Pho and Phol can bind to the same DNA sequence with the same apparent binding specificity.
phol mutants are homozygous viable but female sterile
A Drosophila strain (EP0559) containing a P element insertion in
the untranslated leader region of the phol transcription unit was
obtained from the Drosophila genome project
(Fig. 2A). Flies that are
homozygous or hemizygous for this P-element insertion are viable and fertile.
Two phol deletion alleles were generated by imprecise excision of the
P-element (see Materials and Methods). In the phol81A null
mutation, part of the P-element was deleted along with the entire
phol-coding region. In phol106C, the EP0559
element was completely deleted along with 1389 bp of the phol
transcription unit, but leaving the phol promoter and the zinc-finger
region intact. Therefore, it is possible that phol106C
encodes a truncated Phol protein. Importantly, the flanking transcription
unit, CG3448, is left intact in both alleles. In phol81A,
the deletion ends 846 bp upstream of the CG3448 mRNA.
phol106C and phol81A are both
homozygous and hemizygous viable; males are fertile but females are sterile.
The female sterility of both mutant alleles is rescued by a phol
transgene (data not shown). Homozygotes for either phol allele look
phenotypically normal and the mutants show no obvious homeotic phenotypes.
Eggs laid by mothers that are homozygous for either phol allele look
normal, are fertilized, but do not develop
(Fig. 2B,C). Embryos derived
from germline clones from heterozygous phol106C and
phol81A mothers have the same phenotype showing that
phol is required in the germ cells (data not shown). The requirement
for phol in the germline did not allow us to generate embryos that
lack Phol protein and we therefore could not examine the role of phol
in regulation of homeotic genes in embryos.
|
Pho and Phol act redundantly to silence homeotic gene expression in
imaginal disks
pho homozygotes die as pharate adults with weak homeotic
transformations (Gehring,
1970
), while phol homozygotes survive and are
phenotypically normal adults. By contrast, phol, pho double mutants
die as third instar larvae and fail to pupate. Examination of phol,
pho larvae showed that the brain is smaller than normal, the disks are
misshapen and smaller than wild-type disks, and the salivary gland polytene
chromosomes were enlarged (data not shown). The larger salivary gland polytene
chromosomes may be due to additional rounds of endoreplication in the double
mutants. To test whether phol functions in PcG repression, we
examined Ubx and Abd-B expression in wing imaginal disks
from single and double mutants of phol and pho
(Fig. 3A). As expected, no Ubx
or Abd-B expression was observed in wild-type or phol mutant wing
disks. pho mutants showed misexpression of Ubx in a few cells in the
wing pouch, but did not misexpress Abd-B
(Fig. 3A)
(Fritsch et al., 1999
). By
contrast, phol, pho double mutants strongly misexpress Ubx and Abd-B
in the wing disk (Fig. 3A).
This suggests that Phol and Pho redundantly repress homeotic genes in imaginal
disks and can partially substitute for each other. We note that Ubx
misexpression is confined to the wing pouch in phol, pho double
mutants; the lack of Ubx misexpression in more peripheral areas of
the disk possibly reflects downregulation by Abd-B, which is strongly
misexpressed in these regions of the disk
(Fig. 3A).
We next tested whether removal of phol during larval development would also cause derepression of Ubx and Abd-B by generating clones of phol mutant cells in imaginal wing disks of pho mutant larvae. In these experiments, phol mutant cells were identified by the absence of a GFP marker. Strong misexpression of Ubx and Abd-B was observed in double mutant cells in the wing pouch similar to the misexpression observed in wing disks from the phol, pho double mutant larvae (Fig. 3B and data not shown). These observations suggest that either Phol or Pho is required throughout development to keep homeotic genes repressed.
A re-examination of the role of pho in embryos
It has recently been suggested that pho may not play a role in PRE
function in embryos (Poux et al.,
2001a
). This was surprising to us given previous reports showing
misexpression of engrailed, abd-A and Abd-B in pho
mutant embryos (Moazed and O'Farrell,
1992
; Simon et al.,
1992
). In addition, the severe defects observed in embryos lacking
maternal pho function suggested a strong requirement for Pho during
oogenesis and/or embryogenesis (Breen and
Duncan, 1986
; Girton and Jeon,
1994
). We therefore re-examined the role of pho in
embryos by testing the requirement for pho and Pho binding sites in
the regulation of PRE-containing reporter genes.
We did not see any additional mis-expression of Ubx or
AdbB in phol, pho double mutant embryos over what was seen
in pho single mutants. Thus, we have conducted our embryonic
experiment in pho single mutants. We looked at lacZ
expression from a Pbx-Bxd-Ubx-lacZ (BP01) reporter gene
(Müller and Bienz, 1991
).
This reporter is derepressed in Pc mutant embryos
(Müller and Bienz, 1991
).
Similarly, we found that it is derepressed in a pho mutant
(Fig. 3C). This shows that Pho
protein is required for the silencing of this reporter gene in the embryo.
Next, we looked at whether mutation of the Pho-binding sites within a PRE
disrupts silencing. We used a construct containing PRED, a
567 bp fragment from the Ubx gene. We have previously shown that
mutation of Pho-binding sites in PRED inactivated its
silencing capability in imaginal disks
(Fritsch et al., 1999
). Poux
et al. (Poux et al., 2001a
)
reported that mutation of Pho-binding sites did not cause a loss of
PRED silencing in embryos. However, we obtained different
results using the same lines. We looked at expression from three wild-type
PRED lines and five PREDPhomut. All
wild-type PRED lines gave the expression pattern shown.
Two out of five PREDPhomut lines gave expression similar
to that shown in Fig. 3C,
including two out of three lines examined by Poux et al.
(Poux et al., 2001a
). A third
PREDPhomut line also showed unrestricted expression in
embryos but the levels were lower compared with the other lines. A fourth line
showed no silencing in the embryonic epidermis and in discs, but maintained
restricted expression in the embryonic CNS. A fifth line showed restricted
expression similar to the wild-type PRED control lines.
These results show that Pho protein and Pho-binding sites do play a role in
repression during embryogenesis.
Binding of PcG proteins to polytene chromosomes in phol, pho
double mutants
The experiments described above suggest that the DNA-binding proteins Pho
and Phol play important and redundant roles in PcG repression. One possible
role of these two proteins may be to anchor other PcG proteins to PREs. To
test this hypothesis, we analysed binding of five different PcG proteins to
polytene chromosomes in phol, pho double mutants.
First, we examined the localization of Pho proteins on polytene chromosomes
of wild-type larvae. We previously reported binding of Pho to about 35
chromosomal sites (Fritsch et al.,
1999
). Using a new Pho antiserum, combined with immunofluorescent
techniques, we now detect Pho binding to about 100 sites on polytene
chromosomes (Fig. 4). Psc
colocalizes with Pho at about 65% of these sites
(Fig. 4). Psc has also been
reported to bind to 65% of the Pc sites
(Rastelli et al., 1993
).
|
Next, we looked at the distribution of the PcG proteins Pc, Psc,
Polyhomeotic (Ph), Sex combs on midleg (Scm) and Enhancer of zeste (E(z)) on
polytene chromosomes. Pc, Ph and Psc are all core components of the PcG
protein complex called PRC1 (Shao et al.,
1999
; Saurin et al.,
2001
; Francis and Kingston,
2001
). Scm has also been reported to co-purify with PRC1
(Shao et al., 1999
). Scm and
Ph may also be present in protein complexes other than PRC1
(Roseman et al., 2001
;
Hodgson et al., 2001
). E(z) is
a component of the Esc-E(z) complex, which is distinct from PRC1
(Ng et al., 2000
;
Tie et al., 2001
). We focused
our analysis on PcG protein binding sites on the X chromosome and on the right
arm of chromosome 3, which includes the bithorax and Antennapedia gene
complexes (BXC and ANTC).
Fig. 5A shows binding of Pho, Pc, Psc, Ph and Scm to chromosomal sites in the distal region of the X chromosome in wild type and phol, pho double mutants. Three sites that are bound by all five PcG proteins in wild-type chromosomes are indicated. As expected, in phol, pho double mutants, no Pho protein is detected (Fig. 5A). Binding of Pc, Psc and Scm is lost at polytene subdivision 2D (Fig. 5A, arrow) in phol, pho double mutants; binding of these proteins to all other sites on the X chromosome is unaffected (Fig. 5A and data not shown). Binding of Ph is completely unaffected in phol, pho double mutants. In particular, the Ph signal at 2D is present, suggesting that Ph can bind at this site even if other PcG proteins are removed. We also find that Pc binding to 2D is not lost in either pho or phol single mutants (Fig. 5C), suggesting that the presence of either of these two proteins is sufficient for Pc to bind to this site.
|
We were particularly interested in knowing whether E(z) protein
distribution would change in the double mutants because the vertebrate
homologues of Pho and Esc interact in in vitro binding experiments (Satijin et
al., 2001) and Pho co-immunoprecipates with Esc in early embryos
(Poux et al., 2001b
). One
attractive hypothesis is that Pho might be required for the binding of
E(z)/Esc protein complexes to chromatin. However, we did not detect changes in
any E(z) chromosomal sites on either the X chromosome
(Fig. 5B) or on 3R in phol,
pho double mutants (data not shown). It was reported that E(z) bound to
chromosomal subdivision 2D (Carrington and
Jones, 1996
); however, we were able to detect E(z) at this site on
only about 20% of the wild-type chromosomes. Although we never saw E(z) at 2D
on phol, phol double mutant chromosomes, we cannot definitely
conclude there is a difference between this and wild type.
The patterns of binding of Psc, Ph, Scm and E(z) proteins on chromosome arm
3R were indistinguishable in wild type and phol, pho double mutants
(data not shown). In particular, these PcG proteins were still bound to
regions that include the BXC and ANTC loci in phol, pho double
mutants. The binding of Pc to the BXC and ANTC, and most other loci was also
unaltered in the double mutant, but we found that binding to two specific
chromosomal sites was lost (Fig.
6). Interestingly, Psc, Scm and E(z) were not detected at these
sites on wild-type chromosomes (data not shown)
(Rastelli et al., 1993
;
Carrington and Jones, 1996
),
suggesting that Pc binds independently of these proteins at these sites. Ph
was present at one of these two sites, but its binding was not altered in
phol, pho double mutants (data not shown).
|
Taken together, the immunolocalization data suggest that binding of PcG
proteins to most sites is unaltered in the absence of Pho and Phol protein,
but that these two proteins are redundantly required for PcG protein binding
at a few specific sites. Intriguingly, it appears that all PcG proteins tested
here are still associated with the BXC and ANTC loci. Nevertheless, we found
that the BXC genes Ubx and Abd-B were derepressed in
phol, pho double mutant wing disks. We propose several different
explanations for this paradox. First, derepression of homeotic genes and
binding of PcG proteins were not assayed in the same tissues. We were not able
to detect derepression of Ubx in salivary gland cells of phol,
pho double mutants (data not shown). Second, Pho and Phol may only be
required for anchoring PcG proteins at some PREs in the BXC. Different
DNA-binding proteins may provide this function at other PREs. This is
supported by our finding that binding of PcG proteins is lost at some sites in
phol, pho double mutants (see Figs
5,
6). Moreover, several different
PREs have been identified in the Ubx gene
(Chan et al., 1994
;
Christen and Bienz, 1994
;
Müller, 1995
;
Chang et al., 1995
;
Orlando et al., 1998
;
Hodgson et al., 2001
). The
resolution of antibody signals on polytene chromosomes is not refined enough
to resolve distinct PREs in a single gene and, hence, loss of only a fraction
of PcG protein complexes may not be detectable. Finally, Phol and Pho may not
be necessary for the anchoring of PcG protein complexes to the DNA, but may
confer the actual transcriptional repression mediated by PREs in imaginal
disks, while the PcG protein complexes might function in the propagation and
memory of the repression. Thus, PcG protein complexes might serve to recruit
Phol and Pho or their co-repressors to the DNA.
Trl is not redundant with pho for repression of
homeotic genes in imaginal disks
The GAGA factor protein is encoded by the Trithorax-like
(Trl) gene. A hypomorphic Trl allele was originally isolated
due to mutant phenotypes that suggested a requirement for activation of
homeotic gene expression (Farkas et al.,
1994
). The proposal that Trl functions in PcG repression
was based on the observations that Trl protein bound to PRE sequences, that it
co-immunoprecipitated with Pc, and that mutation of Trl-binding sites caused a
loss of mini-white silencing and PRE function in reporter genes
(Horard et al., 2000
;
Mishra et al., 2001
;
Busturia et al., 2001
;
Americo et al., 2002
;
Poux et al., 2002
). These
conflicting data prompted us to analyse the role of Trl in homeotic
gene regulation by generating clones of Trl mutant cells in imaginal
disks. In these experiments, we used TrlR85, a null allele
(Farkas et al., 1994
), and the
mutant cells were again marked by the absence of a GFP marker protein.
We first analysed Trl mutant clones in the wing disk for
misexpression of Ubx and Abd-B and found no evidence for
such misexpression (Fig. 7A and
data not shown). As PREs often contain Pho- and Trl-binding sites in close
proximity, and Busturia et al. (Busturia et
al., 2001
) reported a weak genetic interaction between
pho and Trl heterozygous mutants, we tested whether removal
of Trl in pho mutant wing disks would exacerbate the
misexpression of Ubx observed in pho mutants. This was not
the case. pho mutant wing disks with clones of Trl
homozygous cells showed no additional misexpression of Ubx compared
with pho single mutants (compare
Fig. 7A with
Fig. 3A). Thus, we find no
evidence for a genetic interaction between Trl and pho.
We also analysed the effects of removing Trl on the silencing
capabilities of two different PRE-containing Ubx-LacZ reporter
transgenes; PRE1.6 contains a PRE from the Ubx
gene (Fritsch et al., 1999
)
and MCP725 contains a PRE from the Abd-B gene
(Busturia et al., 1997
). In
wild-type flies, expression of both transgenes was confined to the posterior
compartments of the haltere and third leg disks, and both transgenes were
misexpressed in a variety of PcG mutants
(Busturia et al., 1997
;
Fritsch et al., 1999
) (M.
Bakala, Diploma thesis, University of Tübingen, 2001). By contrast, we
observed no misexpression of either transgene in Trl mutant clones in
wing imaginal disks (Fig.
7B).
We also tested whether mutation of Trl protein binding sites (i.e. GAGAG
sequences) in a PRE from the Ubx gene would compromise its silencing
capability. For this experiment we used a previously described reporter gene,
PRED, that is stably silenced in the wing imaginal disk
due to the presence of the 567 bp long PRE core fragment
(Fig. 7C)
(Fritsch et al., 1999
).
Previous studies showed that mutation of Pho protein-binding sites within
PRED abolished repression of this reporter transgene in
wing imaginal disks (Fig. 7C)
(Fritsch et al., 1999
). By
contrast, mutation of all five GAGAG motifs in PRED caused
no misexpression of this reporter transgene
(Fig. 7C). Sixteen lines were
obtained, five produced expression caused by positional effects and could not
be analysed. The other eleven all showed silencing in the wing disk similar to
that shown in Fig. 7C.
Finally, we tested the requirement for Trl in maintaining expression of Ubx and Abd-B in their normal expression domains. Intriguingly, we observed no obvious reduction of Ubx or Abd-B expression in Trl mutant clones in the haltere and third leg disk (Ubx) or in the genital disk (Abd-B) (Fig. 7D and data not shown). By contrast, clones of trithorax (trx) mutant cells showed a dramatic reduction in Ubx protein levels (Fig. 7D).
These results fail to support a role for Trl in PcG repression in
imaginal disks. However, we cannot exclude the possibility that Trl
is playing a role in the establishment of PcG repression in the embryo. The
requirement for Trl function in the germline and the early embryo
(Liaw et al., 1995
;
Bhat et al., 1996
) does not
allow an analysis of embryos lacking Trl protein.
zeste is not redundant with Pho for repression of homeotic
genes in imaginal disks
Another protein that has been proposed to function in PcG repression is
Zeste (Hur et al., 2002
).
zeste (z) null mutants are viable and fertile and show no
obvious homeotic phenotypes (Goldberg et
al., 1989
). However, Zeste co-purifies with the PcG protein
complex PRC1 (Saurin et al.,
2001
) and Zeste protein binding sites have been implicated in PcG
function of an embryonic reporter gene
(Hur et al., 2002
). To test
whether z might interact genetically with pho in repression
of homeotic genes, we examined the expression of Ubx in
zv77h and in zv77h, pho1
double mutant wing disks. Both zv77h and
pho1 are presumed null mutants
(Goldberg et al., 1989
;
Brown et al., 1998
). z
mutant wing disks showed no misexpression of Ubx
(Fig. 8) and z, pho
double mutants showed no more misexpression of Ubx than that seen in
pho mutant wing disks (compare
Fig. 3A with
Fig. 8).
|
Concluding remarks
Our results show a strong requirement for the DNA-binding proteins Pho and
Pho-like in homeotic gene silencing in imaginal disks. In fact, the strong
misexpression of homeotic genes observed in phol, pho double mutant
imaginal cells is comparable with that seen in imaginal disk clones mutant for
Pc, Scm, Sce or Pcl
(Beuchle et al., 2001
). The
loss of PcG protein binding at only a small number of sites in phol,
pho polytene chromosomes is consistent with the idea that Phol and Pho
are required to recruit PcG protein complexes at only a subset of PREs.
Alternatively, Phol and Pho may be required for transcriptional repression
mediated by PREs, but not for anchoring of PcG protein complexes.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Americo, J., Whiteley, M., Brown, J. L., Fujioka, M., Jaynes, J.
B. and Kassis, J. A. (2002). A complex array of DNA-binding
proteins required for pairing-sensitive silencing by a Polycomb Group Response
Element from the Drosophila engrailed gene.
Genetics 160,1561
-1571.
Beuchle, D., Struhl, G. and Müller, J. (2001). Polycomb group proteins and heritable silencing of Drosophila Hox genes. Development 128,993 -1004.[Abstract]
Bhat, K. M., Farkas, G., Karch, F., Gyurkovics, H., Gausz, J. and Schedl, P. (1996). The GAGA factor is required in the early Drosophila embryo not only for transcriptional regulation but also for nuclear division. Development 122,1113 -1124.[Abstract]
Breen, T. R. and Duncan, I. M. (1986). Maternal expression of genes that regulate the Bithorax complex of Drosophila melanogaster. Dev. Biol. 118,442 -456.[CrossRef][Medline]
Brock, H. W. and van Lohuizen, M. (2001). The Polycomb group no longer an exclusive club? Curr. Opin. Genet. Dev. 11,175 -181.[CrossRef][Medline]
Brown, J. L., Mucci, D., Whiteley, M., Dirksen, M.-L. and Kassis, J. A. (1998). The Drosophila Polycomb group gene pleiohomeotic encodes a sequence-specific DNA binding protein with homology to the multifunctional mammalian transcription factor YY1. Mol. Cell 1,1057 -1064.[CrossRef][Medline]
Busturia, A., Wightman, C. D. and Sakonju, S. (1997). A silencer is required for maintenance of transcriptional repression throughout Drosophila development. Development 124,4343 -4350.[Abstract]
Busturia, A., Lloyd, A., Bejarano, F., Zavortink, M., Xin, H.
and Sakonju, S. (2001). The MCP silencer of the
Drosophila Abd-B gene requires both Pleiohomeotic and GAGA factor for
the maintenance of repression. Development
128,2163
-2173.
Carrington, E. A. and Jones, R. S. (1996). The Drosophila enhancer of zeste gene encodes a chromosomal protein; examination of wild-type and mutant protein distribution. Development 122,4073 -4083.[Abstract]
Chan, C. S., Rastelli, L. and Pirrotta, V. (1994). A Polycomb response element in the Ubx gene that determines an epigenetically inherited state of repression. EMBO J. 13,2553 -2564.[Medline]
Chang, Y. L., King, B. O., O'Connor, M., Mazo, A. and Huang, D. H. (1995). Functional reconstruction of trans regulation of the Ultrabithorax promoter by the products of two antagonistic genes, trithorax and Polycomb. Mol. Cell. Biol. 15,6601 -6612.[Abstract]
Christen, B. and Bienz, M. (1994). Imaginal disc silencers from Ultrabithorax: evidence for Polycomb response elements. Mech. Dev. 45,255 -266.[CrossRef][Medline]
DeCamillis, M., Cheng, N., Pierre, D. and Brock, H.
(1992). The polyhomeotic gene of Drosophila encodes a
chromatin protein that shares polytene chromosome binding sites with
Polycomb. Genes Dev. 6,223
-232.
Farkas, G., Guasz, J., Galloni, G., Reuter, H., Gyurkovics, H. and Karch, F. (1994). The trithorax-like gene encodes the Drosophila GAGA factor. Nature 371,806 -808.[CrossRef][Medline]
Francis, N. J. and Kingston, R. E. (2001). Mechanisms of transcriptional memory. Nat. Rev. 2, 409-421.[CrossRef]
Fritsch, C., Brown, J. L., Kassis, J. A. and Müller, J. (1999). The DNA binding Polycomb group protein Pleiohomeotic mediates silencing of a Drosophila homeotic gene. Development 126,3905 -3913.[Abstract]
Gehring, W. J. (1970). A recessive lethal (l(4)29) with a homeotic effect in D.melanogaster. Dros. Inf. Serv. 45,103 .
Girton, J. R. and Jeon, S. H. (1994). Novel embryonic and adult homeotic phenotypes are produced by pleiohomeotic mutations in Drosophila. Dev. Biol. 161,393 -407.[CrossRef][Medline]
Goldberg, M. L., Colvin, R. A. and Mellin, A. F.
(1989). The Drosophila zeste locus in nonessential.
Genetics 123,145
-155.
Hodgson, J. W., Argiropoulos, B. and Brock, H. W.
(2001). Site-specific recognition of a 70-base-pair element
containing d(GA)(n) repeats mediates bithoraxoid polycomb group response
element-dependent silencing. Mol. Cell. Biol.
21,4528
-4543.
Horard, B., Tatout, C., Poux, S. and Pirrotta, V.
(2000). Structure of a Polycomb response element and in vitro
binding of Polycomb Group complexes containing GAGA factor. Mol.
Cell. Biol. 20,3187
-3197.
Houbaviy, H. B., Usheva, A., Schenk, T. and Burley, S. K.
(1996). Co-crystal structure of YY1 bound to the adeno-associated
virus P5 initiator. Proc. Natl. Acad. Sci USA
93,13577
-14582.
Hur, M.-W., Laney, J. D., Jeon, S.-H., Ali, J. and Biggan, M. D. (2002). Zeste maintains repression of Ubx transgenes: support for a new model of Polycomb repression. Development 129,1339 -1343.[Medline]
Karr, T. L. (1991). Intracellular Sperm/egg interactions in Drosophila: a three-dimensional structural analysis of a paternal product in the developing egg. Mech. Dev. 34,101 -112.[CrossRef][Medline]
Kassis, J. A. (2002). Pairing-sensitive silencing, Polycomb group response elements, and transposon homing in Drosophila. Adv. Genet. 46,421 -438.[Medline]
Kelley, R. L. and Kudora, M. I. (2000). The role of chromosomal RNAs in marking the X for dosage compensation. Curr. Opin. Genet. Dev. 10,555 -561.[CrossRef][Medline]
Liaw, G. J., Rudolph, K. M., Huang, J. D., Dubnicoff, T.,
Courey, A. J. and Lengyel, J. A. (1995). The torso response
element binds GAGA and NTF-1/Elf-1, and regulates tailless by relief of
repression. Genes Dev.
9,3163
-3176.
Lonie, A., D'Andrea, R., Paro, R. and Saint, R.
(1994). Molecular characterization of the Polycomblike gene of
Drosophila melanogaster, a trans-acting negative regulator of homeotic gene
expression. Development
120,2629
-2636.
Mahmoudi, T. and Verrijzer, C. P. (2001). Chromatin silencing and activation by Polycomb and trithorax group proteins. Oncogene 20,3055 -3066.[CrossRef][Medline]
Martin, E. C. and Adler, P. N. (1993). The polycomb group gene Posterior sex Combs encodes a chromosomal protein. Development 117,641 -655.[Abstract]
Mihaly, J., Mishra, R. K. and Karch, F. (1998). A conserved sequence motif in Polycomb-response elements. Mol. Cell 1,1065 -1066.[CrossRef][Medline]
Mishra, R. K., Mihaly, J., Barges, S., Spierer, A., Karch, F.,
Hagstrom, K., Schweinsberg, S. E. and Schedl, P. (2001). The
iab-7 Polycomb response element maps to a nucleosome-free region of chromatin
and requires both GAGA and pleiohomeotic for silencing activity.
Mol. Cell. Biol. 21,1311
-18.
Moazed, D. and O'Farrell, P. H. (1992). Maintenance of the engrailed expression pattern by Polycomb group genes in Drosophila. Development 116,805 -810.[Abstract]
Müller, J. (1995). Transcriptional silencing by the Polycomb protein in Drosophila embryos. EMBO J. 14,1209 -1220.[Medline]
Müller, J. and Bienz, M. (1991). Long range repression conferring boundaries of Ultrabithorax expression in the Drosophila embryo. EMBO J. 10,3147 -3155.[Medline]
Ng, J., Hart, C. M., Morgan, K. and Simon, J. A.
(2000). A Drosophila ESC-E(Z) protein complex is
distinct from other Polycomb group complexes and contains covalently modified
ESC. Mol. Cell. Biol.
20,3069
-3078.
Orlando, V., Jane, E. P., Chinwalla, V., Harte, P. J. and Paro, R. (1998). Binding of Trithorax and Polycomb proteins to the bithorax complex: dynamic changes during early Drosophila embryogenesis. EMBO J. 17,5141 -5150.[CrossRef][Medline]
Perrimon, N., Engstrom, L. and Mahowald, A. P.
(1985). Developmental genetics of the 2C-D region of the
Drosophila X chromosome. Genetics
111, 23-41.
Peterson, A. J., Kyba, M., Bornemann, D., Morgan, K., Brock, H. and Simon, J. (1997). A domain shared by the Polycomb group proteins Scm and ph mediates heterotypic and homotypic interactions. Mol. Cell. Biol. 17,6683 -6692.[Abstract]
Pirrotta, V. (1997a). Chromatin-silencing mechanisms in Drosophila maintain patterns of gene expression. Trends Genet. 13,314 -318.[CrossRef][Medline]
Pirrotta, V. (1997b). PcG complexes and chromatin silencing. Curr. Opin. Gen. Dev. 7, 249-258.[CrossRef][Medline]
Poux, S., McCabe, D. and Pirrotta, V. (2001a). Recruitment of components of Polycomb Group chromatin complexes in Drosophila. Development 128, 75-85.[Abstract]
Poux, S., Melfi, R. and Pirrotta, V. (2001b).
Establishment of Polycomb silencing requires a transient interaction between
PC and ESC. Genes Dev.
15,2509
-2514.
Poux, S., Horard, B., Sigrist, C. J. A. and Pirrotta, V. (2002). The Drosophila Trithorax protein is a coactivator required to prevent reestablishment of Polycomb silencing. Development 129,2483 -2493.[Medline]
Rastelli, L., Chan, C. S. and Pirrotta, V. (1993). Related chromosome binding sites for zeste, suppressors of zeste and Polycomb group proteins in Drosophila and their dependence on Enhancer of zeste function. EMBO J. 12,1513 -1522.[Medline]
Robertson, H. M., Preston, C. R., Phillis, R. W.,
Johnson-Schlitz, D. M., Benz, W. K. and Engels, W. R. (1988).
A stable genomic source of P-element transposase in Drosophila
melanogaster. Genetics 118,461
-470.
Roseman, R. R., Morgan, K., Mallin, D. R., Roberson, R.,
Parnell, T. J., Bornemann, D. J., Simon, J. A. and Geyer, P. K.
(2001). Long-range repression by multiple Polycomb Group (PcG)
proteins targeted by fusion to a defined DNA-binding domain in Drosophila.
Genetics 158,291
-307.
Satijn, D. P. E., Hamer, K. M., den Blaauwen, J. and Otte, A.
P. (2001). The polycomb group protein EED interacts with YY1,
and both proteins include neural tissue in Xenopus embryos.
Mol. Cell. Biol. 21,1360
-1369.
Saurin, A. J., Shao, Z. Erdjument-Bromage, H., Tempst, P. and Kingston, R. E. (2001). A Dosophila Polycomb group complex includes Zeste and dTAFII proteins. Nature 412,655 -660.[CrossRef][Medline]
Shao, Z., Raible, F., Mollaaghababa, R., Guyon, J. R., Wu, C.-T., Bender, W. and Kingston, R. E. (1999). Stabilization of chromatin structure by PRC1, a Polycomb complex. Cell 147,209 -221.
Shimell, M. J., Peterson, A. J., Burr, J., Simon, J. A. and O'Connor, M. B. (2000). Functional analysis of repressor binding sites in the iab-2 regulatory region of the abdominal-A homeotic gene. Dev. Biol 218, 38-52.[CrossRef][Medline]
Simon, J., Chiang, A. and Bender, W. (1992). Ten different Polycomb group genes are required for spatial control of the abdA and AbdB homeotic products. Development 14,493 -505.
Simon, J., Chaing, A., Bender, W., Shimell, M. J. and O'Connor, M. (1993). Elements of the Drosophila bithorax complex that mediate repression by Polycomb group products. Dev. Biol. 158,131 -144.[CrossRef][Medline]
Simon, J. A. and Tamkun, J. W. (2002). Programming on and off states in chromatin: mechanisms of Polycomb and trithorax group complexes. Curr. Opin. Genet. Dev. 12,210 -218.[CrossRef][Medline]
Strutt, H., Cavelli, G. and Paro, R. (1997). Co-localization of Polycomb protein and GAGA factor on regulatory elements responsible for the maintenance of homeotic gene expression. EMBO J. 16,3621 -3633.[CrossRef][Medline]
Strutt, H. and Paro, R. (1997). The Polycomb group protein complex of Drosophila has a differential composition at different target genes. Mol. Cell. Biol. 17,6773 -6783.[Abstract]
Tie, F., Furuyama, T., Prasad-Sinha, J., Jane, E. and Harte, P. J. (2001). The Drosophila Polycomb group proteins ESC and E(Z) are present in a complex containing the histone-binding protein p55 and the histone deacetylase RPD3. Development 128,275 -286.[Abstract]
Zink, B. and Paro, R. (1989). In vivo binding pattern of a trans-regulator of homeotic genes in Drosophila melanogaster. Nature 337,468 -471.[CrossRef][Medline]
Zink, B., Engstrom, Y., Gehring, W. J. and Paro, R. (1991). Direct interaction of the Polycomb protein with Antennapedia regulatory sequences in polytene chromosomes of Drosophila melanogaster. EMBO J. 10,153 -162.[Medline]
This article has been cited by other articles:
![]() |
M. Fang, H. Ren, J. Liu, K. M. Cadigan, S. R. Patel, and G. R. Dressler Drosophila ptip is essential for anterior/posterior patterning in development and interacts with the PcG and trxG pathways Development, June 1, 2009; 136(11): 1929 - 1938. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fujioka, G. L. Yusibova, J. Zhou, and J. B. Jaynes The DNA-binding Polycomb-group protein Pleiohomeotic maintains both active and repressed transcriptional states through a single site Development, December 15, 2008; 135(24): 4131 - 4139. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Pasini, A.P. Bracken, K. Agger, J. Christensen, K. Hansen, P.A.C. Cloos, and K. Helin Regulation of Stem Cell Differentiation by Histone Methyltransferases and Demethylases Cold Spring Harb Symp Quant Biol, November 6, 2008; (2008) sqb.2008.73.009v1. [Abstract] [PDF] |
||||
![]() |
A. Villagra, N. Ulloa, X. Zhang, Z. Yuan, E. Sotomayor, and E. Seto Histone Deacetylase 3 Down-regulates Cholesterol Synthesis through Repression of Lanosterol Synthase Gene Expression J. Biol. Chem., December 7, 2007; 282(49): 35457 - 35470. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Beisel, A. Buness, I. M. Roustan-Espinosa, B. Koch, S. Schmitt, S. A. Haas, M. Hild, T. Katsuyama, and R. Paro Comparing active and repressed expression states of genes controlled by the Polycomb/Trithorax group proteins PNAS, October 16, 2007; 104(42): 16615 - 16620. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. de Ayala Alonso, L. Gutierrez, C. Fritsch, B. Papp, D. Beuchle, and J. Muller A Genetic Screen Identifies Novel Polycomb Group Genes in Drosophila Genetics, August 1, 2007; 176(4): 2099 - 2108. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, M. Schmidt-Supprian, Y. Shi, E. Hobeika, N. Barteneva, H. Jumaa, R. Pelanda, M. Reth, J. Skok, K. Rajewsky, et al. Yin Yang 1 is a critical regulator of B-cell development Genes & Dev., May 15, 2007; 21(10): 1179 - 1189. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ringrose and R. Paro Polycomb/Trithorax response elements and epigenetic memory of cell identity Development, January 15, 2007; 134(2): 223 - 232. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. H. Wilkinson, K. Park, and M. L. Atchison Polycomb recruitment to DNA in vivo by the YY1 REPO domain PNAS, December 19, 2006; 103(51): 19296 - 19301. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fiedler and M. Rehmsmeier jPREdictor: a versatile tool for the prediction of cis-regulatory elements. Nucleic Acids Res., July 1, 2006; 34(Web Server issue): W546 - W550. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Klymenko, B. Papp, W. Fischle, T. Kocher, M. Schelder, C. Fritsch, B. Wild, M. Wilm, and J. Muller A Polycomb group protein complex with sequence-specific DNA-binding and selective methyl-lysine-binding activities Genes & Dev., May 1, 2006; 20(9): 1110 - 1122. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, N. Jahren, M. L. Vargas, E. F. Andersen, J. Benes, J. Zhang, E. L. Miller, R. S. Jones, and J. A. Simon Alternative ESC and ESC-Like Subunits of a Polycomb Group Histone Methyltransferase Complex Are Differentially Deployed during Drosophila Development. Mol. Cell. Biol., April 1, 2006; 26(7): 2637 - 2647. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Brown, D. J. Grau, S. K. DeVido, and J. A. Kassis An Sp1/KLF binding site is important for the activity of a Polycomb group response element from the Drosophila engrailed gene Nucleic Acids Res., September 9, 2005; 33(16): 5181 - 5189. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mohd-Sarip, F. Cleard, R. K. Mishra, F. Karch, and C. P. Verrijzer Synergistic recognition of an epigenetic DNA element by Pleiohomeotic and a Polycomb core complex Genes & Dev., August 1, 2005; 19(15): 1755 - 1760. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Srinivasan and M. L. Atchison YY1 DNA binding and PcG recruitment requires CtBP Genes & Dev., November 1, 2004; 18(21): 2596 - 2601. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Sengupta, A. Kuhrs, and J. Muller General transcriptional silencing by a Polycomb response element in Drosophila Development, May 1, 2004; 131(9): 1959 - 1965. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Palko, H. W. Bass, M. J. Beyrouthy, and M. M. Hurt The Yin Yang-1 (YY1) protein undergoes a DNA-replication-associated switch in localization from the cytoplasm to the nucleus at the onset of S phase J. Cell Sci., January 22, 2004; 117(3): 465 - 476. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.B. SCHWARTZ, T.G. KAHN, G.I. DELLINO, and V. PIRROTTA Polycomb Silencing Mechanisms in Drosophila Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 301 - 308. [Abstract] [PDF] |
||||
![]() |
Y. ZHANG, R. CAO, L. WANG, and R.S. JONES Mechanism of Polycomb Group Gene Silencing Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 309 - 318. [Abstract] [PDF] |
||||
![]() |
T. Mahmoudi, L. M. P. Zuijderduijn, A. Mohd-Sarip, and C. P. Verrijzer GAGA facilitates binding of Pleiohomeotic to a chromatinized Polycomb response element Nucleic Acids Res., July 15, 2003; 31(14): 4147 - 4156. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||