|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00213
1 Neurobiotechnology Center and Department of Neuroscience, Ohio State
University, 105 Rightmire Hall, 1060 Carmack Road, Columbus, OH 43210,
USA
2 Department of Pathology, Centre Medical Universitaire 1, Rue Michel-Servet,
1211 Geneva 4, Switzerland
* Author for correspondence (e-mail: henion.1{at}osu.edu)
Accepted 8 October 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Neural crest, Clonal analysis, Lineage, TrkC, C-Kit, Neurogenic, Melanogenic, Quail
| INTRODUCTION |
|---|
|
|
|---|
Clonal and lineage analyses have demonstrated that individual neural crest
cells differ with respect to cell fate. A large number of studies have
unequivocally demonstrated the ability of some neural crest cells to generate
multiple differentiated cell types (for reviews, see
LeDouarin et al., 1993
;
Selleck et al., 1993
;
Stemple and Anderson, 1993
;
Anderson, 1997
). Importantly,
it has also been demonstrated that some cells behave as stem cells, displaying
both self-renewal and multipotent behavior both in vivo and in vitro
(Stemple and Anderson, 1992
;
Shah et al., 1996
;
Morrison et al., 1999
). The
ability to isolate enriched populations of these cells on the basis of antigen
expression has provided a wealth of information about how specific
environmental cues direct their cell fate decisions and differentiation.
Likewise, the ability to ectopically express different relevant molecules in
specific cells and in precise locations has helped resolve the temporal
actions of instructive factors as well as identify the tissues that produce
them (Reissman et al., 1996
;
Schneider et al., 1999
).
By contrast, immunoablation, clonal analysis and lineage studies in vivo
and in vitro have also documented the presence of early neural crest cells
that produce only a single type or class of derivative
(Vogel and Weston, 1988
;
Frank and Sanes, 1991
;
Schilling and Kimmel, 1994
;
Raible and Eisen, 1994
;
Henion and Weston, 1997
). In
addition, the examination of genes selectively expressed in a specific
derivative during earlier stages of development and the affects of
misexpression of these genes have also implied the existence of
fate-restricted precursors (Perez et al.,
1999
; Greenwood et al.,
1999
). However, just as gene expression is not always a faithful
indicator of cell lineage at the level of individual cells, it has also been
argued that even when cell lineage is analyzed at the single cell level, the
interpretation of fate-specification may reflect only a bias in the
differentiative behavior of a multipotent population.
Taken together, the current evidence suggests that the nascent neural crest comprises both multipotent stem cells and fate-restricted precursors, as well as partially restricted precursors. However, the identity of precursor cells with limited or restricted developmental potential has as yet only been inferred from clonal and lineage analysis of randomly selected cells or by inference from gene expression patterns and the manipulation of gene expression. The direct correlation of gene expression by individual neural crest cells and their ultimate fate has remained elusive.
We have now accomplished this correlation by performing clonal analysis of
individual receptor tyrosine kinase-expressing cells present in nascent neural
crest populations in vitro. The receptors TrkC and C-Kit are expressed only by
neurons or melanocytes, respectively, in differentiated cultures and in vivo
(Tessarollo et al., 1993
;
Kahane and Kalcheim, 1994
;
Henion and Weston, 1995; Wehrle-Haller and
Weston, 1997
). We found that TrkC and C-Kit are expressed by
non-overlapping subpopulations of early neural crest cells in culture. The
expression patterns of these receptors raised the possibility that
TrkC-expressing cells may represent a subset of the fate-restricted neuronal
precursors previously identified by clonal analysis of randomly labeled neural
crest cells (Henion and Weston,
1997
), whereas C-Kit-expressing cells may represent
fate-restricted melanocyte precursors. To test this idea, we first identified
TrkC and C-Kit-expressing neural crest cells in live cultures and then
performed clonal analysis of expressing cells by microinjection of lineage dye
into individual cells and subsequently determining the phenotype(s) of their
clonal descendants in differentiated cultures.
| MATERIALS AND METHODS |
|---|
|
|
|---|
All cultures were grown in QMED medium and half the volume of medium was
replaced every day. QMED is a Ham's F12-based medium (Gibco) supplemented with
15% fetal bovine serum (Hyclone) and 4% E10 chicken embryo extract (see
Henion et al., 1995
). Several
batches of serum and extract were tested for their optimal ability to support
the robust survival and differentiation of neurons, glia and melanocytes. The
batch of each selected was used in all experiments.
For the experiments described, we have defined four time points in culture
(Henion and Weston, 1997
). The
1-6 hour time point corresponds to the first 1 to 6 hours after the first
neural crest cell was observed to have segregated from a neural tube explant.
The next interval was 13 to 16 hours after the initial emergence of cells from
explants, and the last interval was 30 to 36 hours after initial emergence of
cells from explants. Cultures were analyzed 108 hours after explantation of
neural tubes, which corresponds to a time in culture when more than 95% of the
cells in populations can be unambiguously identified as neurons, glia or
melanocytes (Henion et al.,
2000
) (see below).
Immunocytochemistry
A monoclonal antibody generated against a fusion protein corresponding to a
region of the extracellular domain of the chicken c-kit receptor (see below)
and an antiserum that recognizes the extracellular domain of the chicken trkC
receptor (gift from Dr Francis Lefcort)
(Lefcort et al., 1996
) were
used to identify cells expressing these proteins in live neural crest
cultures. The monoclonal antibody against chicken C-Kit was obtained by
immunization of a fusion protein consisting of the first three N-terminal
IgG-like domains of the extracellular domain of the chicken C-Kit receptor
linked to the Fc region of human IgG1. The 870 bp N-terminal fragment of a
chicken c-kit cDNA (obtained from Dr Gary Ciment)
(Sasaki et al., 1993
) was
blunt end ligated at a unique BstEII site and cloned in-frame into a
CDM8 expression vector containing the sequence for the Fc part of human IgG1
(obtained from Dr S. Nishikawa)
(Zettlmeissl et al., 1990
).
The construct was transiently expressed in COS-7 cells using lipofectamin
(Gibco) and serum-free conditioned medium was collected from day 2 onwards.
The cC-Kit-IgG1 fusion proteins were purified by Protein A affinity
chromatography using standard protocols. Obtained hybridomas were negatively
selected for their reactivity for a fusion protein consisting of the signal
peptide of chicken C-Kit fused to the same IgG1 sequence. The signal peptide
of chicken c-kit was amplified by PCR with an upstream T7 primer and a reverse
primer: ATAGGATCCTCATGAGGCACTGAACCAC containing an in-frame BamHI
site for integration into the IgG1 vector. This fusion protein was produced as
indicated above. Antibodies reacting with the cC-Kit-IgG1 fusion protein but
not with the SP-IgG1 protein were further tested by immunofluorescence of
pigmented quail neural crest cultures and immunofluorescence of COS-7 cells
transiently transfected with the full length chicken c-kit cDNA
(Sasaki et al., 1993
).
To identify live, receptor-expressing neural crest cells, cultures grown for the desired amount of time (see above) were removed from the incubator, and culture medium was removed from the wells and replaced with medium containing primary antibody. The cultures were incubated at room temperature for 30 minutes. After extensive washes in medium, the cultures were incubated in medium containing the appropriate secondary antiserum and returned to the incubator for 30-45 minutes. The cultures were then rinsed extensively in medium and viewed using a Zeiss Axiovert fluorescence microscope to reveal immunoreactive cells in preparation for microinjection and clonal analysis.
Interestingly, we were able to detect C-Kit expression in neural crest
cells at an earlier time during development than previously reported in avian
embryos and neural crest cultures (Lahav
et al., 1994
; Lecoin et al.,
1995
). Although it is possible that our culture conditions permit
higher expression levels of C-Kit, we attribute our ability to detect C-Kit on
the experimental procedure of immunolabeling live cells. Through interactions
between antigen and primary and secondary antisera, it appears that
antigen-antibody complexes become clustered, rendering them detectable. If
cultures are fixed first and then labeled, virtually no recognizably
immunoreactive cells are observed. This same phenomenon was observed using 3T3
cells expressing avian TrkC (not shown). Therefore, we think that the
clustering of otherwise rare and evenly distributed receptors is critical for
detection of expressing cells.
To determine the phenotype(s) of the clonal progeny of labeled
receptor-expressing cells at the end of the culture period, we used the
neuron-specific antibody 16A11 that recognizes Hu proteins
(Marusich et al., 1994
),
monoclonal antibody 7B3 that specifically recognizes glial cells in neural
crest cultures (Henion et al.,
2000
), and the presence of melanin granules to identify
melanocytes [for a more detailed protocol see Henion and Weston
(Henion and Weston, 1997
)].
Importantly, at the end of these experiments (108 hours after initial
segregation of the first neural crest cells from neural tube explants)
virtually all of the cells in these cultures are identifiable as either
differentiated neurons, glia or melanocytes
(Henion et al., 2000
). Clonal
progeny of injected receptor-expressing progenitors were identified by
rhodamine fluorescence, melanocytes (melanin) by visible light and neurons and
glia by either fluorescein or AMCA fluorescence.
Cell counts of TrkC or C-Kit-expressing neural crest cells at different
times during development in vitro and determination of the proportions of
neurons, glia and melanocytes in control and experimental cultures were
performed as previously described (Vogel
and Weston, 1988
; Henion and
Weston, 1994
). Briefly, randomly selected fields of cultures were
examined and cells counted by a random sampling method
(Chalkley, 1943
) using an
ocular counting reticule (Curtis,
1960
). This procedure provides an estimate of the fraction of an
identified cell type based on the area occupied by their nuclei relative to
the area occupied by the nuclei of all cells in the field. At least 10 fields
were counted for each culture.
Single cell labeling of receptor-expressing cells
In order to determine the differentiative behavior of neural crest cells
expressing either TrkC or C-Kit we intracellularly injected a single
immunoreactive cells per culture well iontophoretically using a glass
microelectrode containing a solution of 6% lyseinated rhodamine dextran
(Fluoro-Ruby; Molecular Probes) in 0.2 M KCl. Briefly, the microelectrode was
lowered into the culture medium and then the microscope was focussed on the
adherent neural crest cells. Using fluorescence, immunoreactive cells were
identified. The electrode was lowered to the level of the cells and a single
immunoreactive cell was injected with lineage dye. Cultures were returned to
the incubator for 2 hours and then re-examined to determine whether the
injected cell survived the procedure. Slightly less than half the cells
survived with no obvious damage and these were subsequently used for clonal
analysis and grown for the remainder of the experimental period. Virtually all
of the cells (>90%) that survived the injection produced clones, similar to
random injections of individual neural crest cells
(Henion and Weston, 1997
). At
the end of experiments, cultures were fixed and processed for
immunocytochemistry with cell type-specific markers (see above).
In some experiments, we determined the differentiative behavior of cells that did not express TrkC or C-Kit. In these experiments, the experimental procedures were identical except individual non-immunoreactive cells were injected and cultured for clonal analysis.
| RESULTS |
|---|
|
|
|---|
|
|
The receptor tyrosine kinases TrkC and C-Kit are expressed in
separate early neural crest cell subpopulations
Using an antiserum that specifically recognizes the extracellular domain of
TrkC (Lefcort et al., 1996
),
we found that TrkC was expressed by a subset of neural crest cells in
populations present within the first 6 hours of segregation from neural tube
explants (Table 1;
Fig. 1A,B). Likewise, a
subpopulation of TrkC-expressing neural crest cells was also present in
populations present after 13-16 hours of dispersal
(Table 1). In differentiated
neural crest cultures, TrkC was selectively expressed by a subpopulation of
neurons (Fig. 1G,H).
|
By contrast, using a monoclonal antibody raised against a peptide within the extracellular domain of C-Kit and specific for C-Kit (see Materials and Methods), we found that the initial neural crest population (1-6 hours, see Materials and Methods) lacked C-Kit-expressing cells (Table 1). However, a significant number of C-Kit-expressing cells were present in neural crest populations at periods 13-16 hours (Fig. 1C,D) and 30-36 hours after the initiation of segregation of neural crest cells from neural tube explants (Table 1). In differentiated cultures, all melanocytes and only melanocytes expressed C-Kit (Fig. 1I,J). Double labeling of neural crest cultures during the 13-16 hour period revealed that TrkC and C-Kit are expressed by entirely distinct subpopulations of early neural crest cells (Fig. 1E,F).
Detection of live TrkC and C-Kit-expressing neural crest cells and
clonal analysis
Both the antiserum directed against TrkC and the monoclonal antibody
directed against C-Kit recognize epitopes within the extracellular domains of
the respective receptors (Lefcort et al.,
1996
) (see Materials and Methods). Therefore, it was possible to
immunolabel live TrkC and C-Kit-expressing cells in neural crest cultures and
detect them using appropriate fluorescent secondary antisera
(Fig. 1A-D). This provided the
opportunity to perform clonal analysis of molecularly identified neural crest
progenitors by microinjection of individual receptor-expressing cells with
fluorescent lineage dye (Fig.
2). In addition, as neural crest cells in culture are accessible
throughout development, we were able to perform clonal analysis of identified
cells at different times to determine whether the fate of receptor-expressing
cells changes with development. Because the lineage dye is inherited by all of
the progeny of an injected clonal progenitor, we could detect clones in
differentiated cultures and determine the phenotype(s) of cells comprising
clones using cell type-specific markers
(Henion and Weston, 1997
) (see
Materials and Methods).
Clonal analysis of neural crest cells by microinjection of lineage dye has
been shown to reflect accurately the diversification of neural crest cell
populations (Henion and Weston,
1997
). One concern with the immuno-detection of
receptor-expressing cells and subsequent clonal analysis is the possibility
that antibody binding to receptors may alter the development of the labeled
cells. To attempt to address this concern, we compared the development of
cultures in which TrkC or C-Kit expressing cells were immunolabeled early
during development to mock-labeled cultures in which all incubations and
washes were performed but without antibodies (see Materials and Methods). As
shown in Table 2, the
proportions of neurons, glia and melanocytes in differentiated cultures
derived from previously immunolabeled or control cultures were equivalent.
This suggests that detection of receptor-expressing cells by immunolabeling
does not affect the development of these cells or non-expressing cells. In
addition, we observed that the persistence of the antibody-receptor complex at
the cell surface appears to be brief, as immunoreactive cells are undetectable
1 hour after immunolabeling. In addition, although it is not known if or
how the C-Kit antibody affects C-Kit function, its continuous presence in the
medium does not noticeably affect differentiation in cultures and nor does the
continuous presence of the TrkC antiserum (not shown). The TrkC antiserum is
known to activate TrkC signaling and can replace the TrkC ligand neurotrophin
3 (NT3) to support cultured neurons
(Lefcort et al., 1996
).
However, our medium is known to contain NT3 and continuous exposure of
cultures under our conditions to NT3 does not affect differentiation
(Henion et al., 1995
), Thus,
the apparent lack of any agonistic affect of brief exposure to the TrkC
antiserum is not surprising. Taken together, it appears that immunolabeling of
receptor-expressing cells is benign and that clonal analysis of immunolabeled
receptor-expressing cells faithfully reflects the normal differentiative
behavior of these cells.
|
TrkC expression defines neurogenic and fate-restricted neuronal
precursor populations during neural crest development
We performed clonal analysis of TrkC-expressing neural crest cells present
at two time periods after the initial emergence of neural crest cells from
neural tube explants. TrkC-expressing cells were visualized with an inverted
fluorescence microscope after immunolabeling and then injected and with
lyseinated rhodamine dextran lineage dye. About half of the clones derived
from TrkC-expressing progenitors present during the 1-6 hour period were
composed entirely of neurons (Table
3). Importantly, 60% of these precursors were mitotically active
and generated multicell clones and thus did not represent postmitotic
neuroblasts. The remaining clones derived from TrkC-expressing precursors
during the 1-6 hour time period generated clones comprised of neurons and
glia, or glia alone. No labeled precursors generated clones containing
melanocytes. Therefore, the TrkC-expressing cells present in the initial
neural crest population represent a neurogenic sublineage. By contrast, these
cells entirely lack melanogenic ability.
|
We then analyzed the development of TrkC-expressing cells present in 13-16
hour populations. In every case these progenitors generated pure neuronal
clones (Table 3;
Fig. 3A,B). Interestingly, the
TrkC subpopulation in 13-16 hour populations lacked the ability to generate
glial cells even though many of the cells in the population as a whole present
at this time retain the ability to do so
(Henion and Weston, 1997
)
(Table 5). Using the Usual
Hypothesis Test for Probability, we calculated the probability of obtaining
this result by chance. That is, we calculated the probability of obtaining our
result (0 glia-containing clones out of 17 total clones, which were all pure
neuronal) given the frequency of observing a glia-containing clone when the
13-16 hour population was surveyed by random labeling of individual cells
(Henion and Weston, 1997
).
This probability was approximately 0.0002. This low probability supports the
interpretation that TrkC-expressing cells in 13-16 hour populations represent
fate-restricted neuronal precursors and that neuronal fate-restricted
TrkC-expressing precursors segregate between the 1-6 hour and 13-16 hour
periods. In addition, over 40% of these were multicell clones, indicating that
many of these cells were mitotically active. Overall, the average clone size
of clones derived from TrkC-expressing precursors was comparable with that of
fate-restricted neuronal precursors labeled at random
(Henion and Weston, 1997
). As
was the case for TrkC-expressing precursors in earlier populations, no
TrkC-expressing precursors in 13-16 hour populations generated clones
containing melanocytes.
|
|
Taken together, TrkC-expressing neural crest cells in initial (1-6 hour)
neural crest populations represent a neurogenic, non-melanogenic subpopulation
of neuron-glial precursor cells. Just a few hours later, TrkC expression
identifies a fate-restricted neuronal precursor subpopulation. Thus, days
before the first neurons will differentiate
(Fig. 2), fate-restricted, but
still mitotic, neuronal precursors are present in cultured crest cell
populations, consistent with clonal analysis of randomly labeled cells
(Henion and Weston, 1997
)
Importantly, a subpopulation of these cells can be identified based on the
expression of TrkC.
C-Kit expression identifies fate-restricted melanocyte
precursors
Using the same methods that we used to perform clonal analysis of
TrkC-expressing neural crest cells, we determined the fate of C-Kit-expressing
neural crest cells present in early undifferentiated cultures. As described
above, neural crest cell populations present 1-6 hours after the onset of
segregation from neural tube explants only rarely included C-Kit-expressing
cells. By contrast, 13-16 hour and 30-36 hour populations contained numerous
C-Kit-expressing neural crest cells (Table
1; Fig. 1C-F).
We analyzed the clonal descendants of 21 C-Kit-expressing neural crest cells labeled in 13-16 hour populations (Table 4). All 21 clones were composed exclusively of melanocytes and two-thirds of the clones contained multiple melanocytes. Likewise, all 28 clones derived from C-Kit-expressing cells present in 30-36 hour cultures were composed entirely of melanocytes and nearly half were multicell clones (Table 4). Based on these results from 49 clones, we conclude that C-Kit-expressing neural crest cells, which are present long before the overt differentiation of melanocytes in our cultures (Fig. 2), represent fate-restricted melanocyte precursors and thus never give rise to neurons or glia.
|
Fates of TrkC- and C-Kit- neural crest
cells
Because the neuronal fate-restricted TrkC-expressing neural crest cells
present in 13-16 hour populations represent a minority of the population of
fate-restricted neuronal precursors present based on random sampling during
this period (Table 1)
(Henion and Weston, 1997
), we
asked what the fates were of cells that did not express TrkC
(TrkC-). To do so, we labeled TrkC- neural crest cells
present in immunolabeled 13-16 hour populations with lineage dye and
determined the phenotype(s) of their clonal descendants in differentiated
cultures (Table 5). A variety
of clones containing different cell types were observed, including neurons,
glia and melanocytes, although no clones containing both neurons and
melanocytes were observed. Importantly, fate-restricted neuronal precursors
were present in the TrkC- population indicating that while
TrkC-expressing cells are fate-restricted neuronal precursors, other
molecularly distinct fate-restricted neuronal precursors are present in the
population.
We also determined the fates of cells that were C-Kit- in populations present in 13-16 hour C-Kit immunolabeled cultures (Table 5). As was the case with TrkC- cells, labeled C-Kit- cells generated clones that consisted of a variety of cell types and no clones containing both neurons and melanocytes. Most notable among these results is the presence of clones containing glia and melanocytes and the complete absence of clones comprising exclusively melanocytes. The presence of C-Kit- precursors that generate glia and melanocytes suggests that cells with melanogenic ability do not express C-Kit until they have been specified to exclusively adopt a melanogenic fate. By contrast, the complete absence of fate-restricted melanocyte precursors among the C-Kit- population suggests that the C-Kit-expressing population represents all or nearly all of the fate-restricted melanocyte precursors present.
| DISCUSSION |
|---|
|
|
|---|
Temporally overlapping patterns of gene expression in neural crest
subpopulations and differentiated neural crest derivatives also suggests
developmental heterogeneity in molecularly distinct subpopulations
(Ma et al., 1996
;
Greenwood et al., 1999
). These
arguments are bolstered by loss- and gain-of-function experiments with
relevant genes (Ma et al.,
1998
; Ma et al.,
1999
; Parras et al.,
2002
). However, although gene expression may very well predict
lineage decisions in many cases, formally, as gene expression is often
dynamic, the expression of gene products cannot be used to infer the fate of
individual cells unequivocally unless independent correlations with cell
lineages can be established.
The methods we have used here have allowed us to make such correlations
because we directly assessed the fate of cells expressing specific gene
products at specific times during neural crest development in vitro. We found
that the expression TrkC and C-Kit by cells in nascent neural crest
populations define distinct fate-restricted subpopulations. Thus, in addition
to identifiable neural crest stem cells in rodents, the early avian neural
crest contains identifiable subpopulations of fate-restricted cells. The
relatively small clone sizes of fate-restricted precursors observed is
consistent with the interpretation that fate-restricted precursors are less
mitotically active over time that their unrestricted counterparts. Because
over 90% of injected cells that survived the labeling procedure (see Materials
and Methods) produced detectable clones, we do not believe lineage dye
dilution resulted in a large number of, if any, undetected clones. This
observation, as well as our control data
(Table 2), also argue against
the possibility that differential rates of cell death occur between
antibody-detected progenitors and unlabeled progenitors. If this were the
case, the fact that almost one-third of the population at 13-16 hours
expresses either TrkC or C-Kit (Table
1) suggests that differential cell death would almost certainly
affect the proportions of different derivatives in differentiated cultures,
which was not the case (Table
2). Although the interesting possibility exists that descendants
of fate-restricted progenitors are more prone to developmentally regulated
cell death than are unrestricted cells, this situation would not fundamentally
alter our conclusions concerning the specification and identity of
fate-restricted precursors. Our results suggest that the proliferative
activity of the population represents an average of precursors with low
proliferation rates (fate-restricted precursors) and those with very high
proliferation rates (unrestricted precursors), consistent with previous
inferences (Henion and Weston,
1997
).
It is important to point out that for the purposes of the current study,
TrkC and C-Kit were used only as markers for distinct neural crest
subpopulations. Although these genes play important roles at least during
later development of neural crest-derived cells (see
Wehrle-Haller and Weston,
1997
; Wehrle-Haller and
Weston, 1999
; Wehrle-Haller et
al., 2001
; Conover and
Yoncopoulos, 1997
; Ernfors,
2001
), any gene products identifiable in living cells by our
methods could potentially have been used. Indeed, because other
fate-restricted and partially-restricted precursors also appear to be present
in nascent neural crest populations
(Henion and Weston, 1997
), it
may be possible to identify these subpopulations using similar methods based
on differentially expressed gene products.
Restriction of neural crest cell fate: a neurogenic subpopulation
that lacks melanogenic ability
When the TrkC-expressing subpopulation of neural crest cells was surveyed
during two periods soon after neural crest cells emerged from neural tube
explants, none of these 40 clonal progenitors generated melanocytes
(Table 3). Although melanogenic
cells are rare in 1-6 hour populations
(Henion and Weston, 1997
) (see
below), they are prominent in 13-16 hour populations. Therefore, the fact that
TrkC-expressing cells in 13-16 hour populations never generate melanocytes
under culture conditions known to support melanogenesis suggests that these
cells lack melanogenic ability. These results demonstrate an early segregation
of a non-melanogenic, neurogenic sublineage early in neural crest
development.
Labeled TrkC-expressing cells present in 1-6 hour populations gave rise to
clones consisting of neurons, glia or a combination of neurons and glia
(Table 3). The fact that glial
cells can be generated by neural crest cells that express TrkC soon after they
emerge from the neural tube demonstrates that these early TrkC-expressing
cells are not necessarily fate-restricted neuronal precursors. Thus, the
initial expression of TrkC in early neural crest cultures is not predictive of
cell fate as TrkC is selectively expressed by neurons in differentiated
cultures. However, all of the TrkC-expressing cells labeled during the 13-16
hour period generated pure neuronal clones
(Table 3,
Fig. 3) indicating that these
cells have become fate-restricted neuronal precursors. Significantly, many of
these TrkC-expressing neural crest cells were still mitotically active
neuronal precursors, whereas their counterparts represent mitotically inactive
neuronal precursors. Comparison of the proportion of the population present at
13-16 hours that expresses TrkC (Table
1) and the proportion of the same population that behave as
fate-restricted precursors as determined by clonal analysis of randomly
labeled cells (Henion and Weston,
1997
) suggests that the TrkC-expressing cells represent a
subpopulation of fate-restricted neuronal precursors. Consistent with this
conclusion is the fact that some TrkC- cells present in 13-16 hour
populations also display fate-restricted neuronal precursor differentiative
behavior (Table 5).
Of interest is the exact type of precursor or precursors that TrkC
identifies in 1-6 hour populations. The most complex possibility is that TrkC
is expressed by subsets of fate-restricted neuronal precursors,
fate-restricted glial precursors and partially restricted neuron-glial
precursors. One argument against this scenario, in addition to its inherent
complexity, is the observation that no cells express TrkC in non-neurogenic
populations that result when dispersal of cells from neural tube explants is
delayed (not shown) even though these populations retain gliagenic ability
(Vogel and Weston, 1988
;
Henion et al., 1995
). Perhaps
the simplest explanation would be that TrkC is expressed by neuron-glial (NG)
precursors; cells able to generate neurons, glia or both. In this case, the
single cell type clones (N or G) result from an early fate restriction of
neuron-glial precursors to either a neuronal or glial fate. In addition, as
TrkC-expressing cells a short time later (13-16 hours) only generate neurons,
cells derived from 1-6 hour TrkC-expressing cells that are specified to adopt
a glial fate must have become specified soon after injection of the lineage
dye. Presumably, they extinguished expression of TrkC at the same time, but in
any case had done so by 13-16 hours. This scenario would suggest that
TrkC-expressing neuron-glial precursors undergo a progressive restriction in
cell fate by losing gliagenic ability and being specified as fate-restricted
neuronal precursors. In addition, it is also possible that some neuronal
fate-restricted TrkC-expressing cells present in 13-16 hour cultures represent
cells that dispersed from the neural tube after the 1-6 hour period.
Taken together, the most compelling model for the fate of TrkC-expressing neural crest cells present in 1-6 hour populations is that they represent a subset of neuron-glial precursors that become progressively restricted to a neuronal fate. Gliagenic descendants of TrkC-expressing neuron-glial precursors must extinguish expression of TrkC soon after specification, but at least by 13-16 hours. By contrast, neurogenic descendants retain expression and constitute at least a proportion of the fate-restricted neuronal precursor population identified in 13-16 hour populations (Table 3; Fig. 3).
Restriction of neural crest cell fate: melanocyte fate-restricted
precursors
All of the C-Kit-expressing neural crest cells analyzed generated pure
melanocyte clones (Table 4;
Fig. 3). Given the large body
of knowledge about the functions of C-Kit in the regulation of melanocyte
migration, proliferation and survival during development (see
Wehrle-Haller and Weston,
1997
) this is not a surprising result. However, it is important to
emphasize that it has not previously been demonstrated at the level of
individual cells that C-Kit-expressing cells present in early neural crest
populations are uniformly restricted to a melanocyte fate. Unlike the case for
TrkC, the initial selective expression of C-Kit in early neural crest cultures
accurately predicts their fates as C-Kit-expressing melanocytes in
differentiated cultures.
In contrast to TrkC-expressing cells, there are essentially no
C-Kit-expressing cells present in 1-6 hour populations. The absence of
C-Kit-expressing cells could be because C-Kit expression has yet to be induced
in the cells present in the population or because C-Kit-expressing neural
crest cells have yet to emerge from the neural tube. The prevailing evidence
favors the latter interpretation. When neural crest cells are labeled at
random during this period, very few behave as fate-restricted melanocyte
precursors (Henion and Weston,
1997
). In addition, when 1-6 hour populations were isolated by
removal of neural tube explants 6 hours after the first crest cells had
emerged and cultured, they produced very small numbers of melanocytes
(Henion and Weston, 1997
;
Reedy et al., 1998
). In
contrast, when 6-16 hour populations were isolated by replating in separate
cultures neural tubes removed from the initial cultures at 6 hours, these
populations gave rise to disproportionately large numbers of melanocytes
compared to control 24 hour outgrowth cultures
(Henion and Weston, 1997
;
Reedy et al., 1998
). Thus, 1-6
hour populations generally lack melanogenic precursors. If, as inferred here,
C-Kit-expressing cells are fate-restricted melanocyte precursors, it is not
surprising that very few such cells are present in the initial 1-6 hour
population. Taken together, our results indicate that the specification of
fate-restricted melanocyte precursors occurs before, or just as, they emerge
from the neural tube.
Importantly, no C-Kit-expressing cells in either 13-16 or 30-36 hour
populations generated glial cells, despite the fact that many cells in these
populations produce clones containing glial cells as well as melanocytes
(Henion and Weston, 1997
). The
fact that C-Kit- populations contained cells that produced mixed
glial-melanocyte clones (Table
5) suggests that melanogenic cells during neural crest development
do not express C-Kit until they have been specified as fate-restricted
melanocyte precursors.
Neural crest heterogeneity and diversification
Taken together, our results demonstrate that distinct neurogenic and
melanogenic sublineages are specified before or soon after neural crest cells
emerge from the neural tube. In addition, although it is clear that many
neural crest cells are multipotent, it is now equally clear that a significant
proportion of early neural crest populations are composed of fate-restricted
precursors, some of which we have identified in this study. The existence and
molecular identification of fate-restricted precursors provides a means of
determining how pluripotent stem cells give rise to multiple derivatives.
Furthermore, because the fates of neural crest stem cell populations can be
regulated by instructive growth factors
(Anderson, 1997
;
LeDouarin and Kalcheim, 1999
)
and Notch activation (Morrison et al.,
2000
; Wakamatsu et al.,
2000
; Maynard et al.,
2000
), fate-restricted precursors, in addition to non-neural crest
tissues (Reissman et al.,
1996
; Schneider et al.,
1999
), present an intriguing potential source of fate-regulating
signaling.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Anderson, D. J. (1997). Cellular and molecular biology of neural crest cell lineage determination. Trends Genet. 13,276 -280.[CrossRef][Medline]
Barald, K. F. (1988). Monoclonal antibodies made to neural crest cells and to ciliary ganglion neurons identify a common antigen on the neurons and a neural crest subpopulation. J. Neurosci. Res. 36,46 -57.
Chalkley, H. W. (1943). Methods for the quantitative morphological analysis of tissues. J. Natl. Cancer Inst. 4,47 -53
Conover, J. C. and Yoncopoulos, G. D. (1997). Neurotrophin regulation of the developing nervous system: analysis of knockout mice. Rev. Neurosci. 8,13 -27.[Medline]
Curtis, A. S. G. (1960). Area and volume measurements by random sampling methods. Med. Biol. Illust. 10,261 -266.
Ernfors, P. (2001). Local and target-derived actions of neurotrophins during peripheral nervous system development. Cell Mol. Life Sci. 58,1036 -1044.[CrossRef][Medline]
Frank, E. and Sanes, J. R. (1991). Lineage of
neurons and glia in chick dorsal root ganglia: analysis in vivo with a
recombinant retrovirus. Development
111,895
-908.
Greenwood, A. L., Turner, E. E. and Anderson, D. J. (1999). Identification of dividing, determined sensory neuron precursors in the mammalian neural crest. Development 126,3545 -3559.[Abstract]
Henion, P. D. and Weston, J. A. (1994). Retinoic acid promotes the survival and proliferation of neurogenic precursors in cultured neural crest cell populations. Dev. Biol. 161,243 -250.[CrossRef][Medline]
Henion, P. D. and Weston, J. A. (1997). Timing and pattern of cell fate restrictions in the neural crest lineage. Development 124,4351 -4359.[Abstract]
Henion, P. D., Garner, A. S., Large, T. H. and Weston, J. A. (1995). trkC-mediated NT-3 signaling is required for the early development of a subpopulation of neurogenic neural crest cells. Dev. Biol. 172,602 -613.[CrossRef][Medline]
Henion, P. D., Blyss, G. K., Luo, R., An, M., Maynard, T. M., Cole, G. J. and Weston, J. A. (2000). Avian transitin expression mirrors glial cell fate restrictions during neural crest development. Dev. Dyn. 218,150 -159.[CrossRef][Medline]
Kahane, N. and Kalcheim, C. (1994). Expression of trkC mRNA during development of the avian nervous system. J. Neurobiol. 25,571 -584.[CrossRef][Medline]
Lahav, R., Lecoin, L., Ziller, C., Nataf, V., Carnahan, J. F., Martin, F. H. and LeDouarin, N. M. (1994). Effect of the Steel gene product on melanogenesis in avian neural crest cell cultures. Differentiation 58,133 -139.[CrossRef][Medline]
Lecoin, L., Lahav, R., Martin, F. H., Teillet, A. and LeDouarin, N. M. (1995). Steel and c-kit in the development of avian melanocytes: a study of normally pigmented birds and of the hyperpigmented mutant silky fowl. Dev. Dyn. 203,106 -118.[Medline]
LeDouarin, N. M., Ziller, C. and Couly, G. (1993). Patterning of neural crest derivatives in the avian embryo: In vivo and in vitro studies. Dev. Biol. 159, 24-49.[CrossRef][Medline]
LeDouarin, N. M. and Kalcheim, C. (1999). The Neural Crest, 2nd edn. Cambridge: Cambridge University Press.
Lefcort, F., Clary, D. O., Rusoff, A. C. and Reichardt, L.
F. (1996). Inhibition of the NT-3 receptor trkC,
early in chick embryogenesis, results in severe reductions in multiple
neuronal subpopulations in the dorsal root ganglia. J.
Neurosci. 16,3704
-3713.
Ma, Q., Kintner, C. and Anderson, D. J. (1996). Identification of neurogenin, a vertebrate neuronal determination gene. Cell 87,43 -52.[CrossRef][Medline]
Ma, Q., Chen, Z., del Barco Barrantes, I., de la Pompa, J. L. and Anderson, D. J. (1998). neurogenin1 is essential for the determination of neuronal precursors for proximal cranial sensory ganglia. Neuron 20,469 -482.[CrossRef][Medline]
Ma, Q., Fode, C., Guillemot, F. and Anderson, D. J.
(1999). neurogenin1 and neurogenin2 control two
distinct waves of neurogenesis in developing dorsal root ganglia.
Genes Dev. 13,1717
-1728.
Marusich, M. F., Furneaux, H. M., Henion, P. D. and Weston, J. A. (1994). Hu neuronal proteins are expressed in proliferating neurogenic cells. J. Neurobiol. 25,143 -155.[CrossRef][Medline]
Maxwell, G. D., Forbes, M. E. and Christie, D. S. (1988). Analysis of the development of cellular subsets present in the neural crest using cell sorting and cell culture. Neuron 1,557 -568.[CrossRef][Medline]
Maynard, T. M., Wakamatsu, Y. and Weston, J. A. (2000). Cell interactions within nascent neural crest populations transiently promote death of neurogenic precursors. Development 127,4561 -4572.[Abstract]
Morrison, S. J., White, P. M., Zock, C. and Anderson, D. J. (1999). Prospective identification, isolation by flow cytometry, and in vivo selfrenewal of multipotent mammalian neural crest stem cells. Cell 96,737 -749.[CrossRef][Medline]
Morrison, S. J., Perez, S. E, Qiao, Z., Verdi, J. M., Hicks, C., Weinmaster, G. and Anderson, D. J. (2000). Transient notch activation initiates an irreversible switch from neurogenesis to gliogenesis by neural crest stem cells. Cell 101,499 -510.[CrossRef][Medline]
Parras, C. M., Schuurmans, C., Scardigli, R., Kim, J., Anderson,
D. J. and Guillemot, F. (2002). Divergent functions of the
proneural genes Mash1 and Ngn2 in the specification of
neuronal subtype identity. Genes Dev.
16,324
-338.
Perez, S. E., Rebelo, S. and Anderson, D. J. (1999). Early specification of sensory neuron fate revealed by expression and function of neurogenins in the chick embryo. Development 126,1715 -1728.[Abstract]
Raible, D. W. and Eisen, J. S. (1994). Restriction of neural crest cell fate in the trunk of the embryonic zebrafish. Development 120,495 -503.[Abstract]
Reedy, M. V., Faraco, C. D. and Erickson, C. A. (1998). The delayed entry of thoracic neural crest cells into the dorsolateral path is a consequence of the late emigration of melanogenic neural crest cells from the neural tube. Dev. Biol. 200,234 -246.[CrossRef][Medline]
Reissman, E., Ernsberger, U., Francis-West, P. H., Rueger, D., Brickell, P. D. and Rohrer, H. (1996). Involvement of bone morphogenetic protein-4 and bone morphogenetic protein-7 in the differentiation of the adrenergic phenotype in developing sympathetic neurons. Development 122,2079 -2088.[Abstract]
Sasaki, E., Okamura, H., Chikamune, T., Kanai, Y., Watanabe, M., Naito, M. and Sakurai, M. (1993). Cloning and expression of the chicken c-kit proto-oncogene. Gene 128,257 -261.[CrossRef][Medline]
Schilling, T. F. and Kimmel, C. B. (1994). Segment and cell type lineage restrictions during pharyngeal arch development in the zebrafish embryo. Development 120,483 -494.[Abstract]
Schneider, C., Wicht, H., Enderich, J., Wegner, M. and Rohrer, H. (1999). Bone morphogenetic proteins are required in vivo for the generation of sympathetic neurons. Neuron 24,861 -870.[CrossRef][Medline]
Selleck, M., Scherson, T. and Bronner-Fraser, M. (1993). Origins of neural crest cell diversity. Dev. Biol. 159,1 -11.[CrossRef][Medline]
Shah, N. M., Groves, A. and Anderson, D. J. (1996). Alternative neural crest cell fates are instructively promoted by TGFß superfamily members. Cell 85,331 -343.[CrossRef][Medline]
Sieber-Blum, M. (1989). SSEA-1 is a specific marker for the spinal sensory neuron lineage in the quail embryo and in neural crest cell cultures. Dev. Biol. 134,363 -375.
Stemple, D. L. and Anderson, D. J. (1992). Isolation of a stem cell for neurons and glia from the mammalian neural Crest. Cell 71,973 -985.[CrossRef][Medline]
Stemple, D. L. and Anderson, D. J. (1993). Lineage diversification of the neural crest: In vitro investigations. Dev. Biol. 159,12 -23.[CrossRef][Medline]
Tessarollo, L., Tsoulfas, P., Martin-Zanca, D., Gilbert, D. J., Jenkins, N. A., Copeland, N. G. and Parada, L. F. (1993). trkC, a receptor for neurotrophin-3, is widely expressed in the developing nervous system and in non-neuronal tissues. Development 118,463 -475.[Abstract]
Vogel, K. S. and Weston, J. A. (1988). A subpopulation of cultured avian neural crest cells has transient neurogenic potential. Neuron 1,569 -577.[CrossRef][Medline]
Wakamatsu, Y., Maynard, T. M. and Weston, J. A. (2000). Fate determination of neural crest cells by NOTCH-mediated lateral inhibition and asymmetrical cell division during gangliogenesis. Development 127,2811 -2821.[Abstract]
Wehrle-Haller, B. and Weston, J. A. (1997). Receptor tyrosine kinase-dependent neural crest migration in response to differentially localized growth factors. BioEssays 19,337 -345.[CrossRef][Medline]
Wehrle-Haller, B. and Weston, J. A. (1999). Altered cell-surface targeting of stem cell factor causes a loss of melanocyte precursors in Steel17H mutant mice. Dev. Biol. 210, 71-86.[CrossRef][Medline]
Wehrle-Haller, B., Meller, M. and Weston, J. A. (2001) Analysis of melanocyte precursors in Nf1 mutants reveals that MGF/KIT signaling promotes directed cell migration independent of its function in cell survival. Dev. Biol. 232,471 -483.[CrossRef][Medline]
Zacchei, A. M. (1961). Lo sviluppo embrionale della quaglia giapponese (Coturnix coturnix japonica). Arch. Ital. Anat. Embriol. 66,36 -72.
Zettlmeissl, G., Gregersen, J. P., Duport, J. M., Mehdi, S., Reiner, G. and Seed, B. (1990). Expression and characterization of human CD4:immunoglobulin fusion proteins. DNA Cell Biol. 9,347 -353.[Medline]
This article has been cited by other articles:
![]() |
T. Motohashi, K. Yamanaka, K. Chiba, H. Aoki, and T. Kunisada Unexpected Multipotency of Melanoblasts Isolated from Murine Skin Stem Cells, April 1, 2009; 27(4): 888 - 897. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Harris, R. Hall, and C. A. Erickson Directing pathfinding along the dorsolateral path - the role of EDNRB2 and EphB2 in overcoming inhibition Development, December 15, 2008; 135(24): 4113 - 4122. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. F. McGraw, A. Nechiporuk, and D. W. Raible Zebrafish Dorsal Root Ganglia Neural Precursor Cells Adopt a Glial Fate in the Absence of Neurogenin1 J. Neurosci., November 19, 2008; 28(47): 12558 - 12569. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J.L Fernandes, J. G Toma, and F. D Miller Multipotent skin-derived precursors: adult neural crest-related precursors with therapeutic potential Phil Trans R Soc B, January 12, 2008; 363(1489): 185 - 198. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Motohashi, H. Aoki, K. Chiba, N. Yoshimura, and T. Kunisada Multipotent Cell Fate of Neural Crest-Like Cells Derived from Embryonic Stem Cells Stem Cells, February 1, 2007; 25(2): 402 - 410. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamazaki, M. Tsuneto, M. Yoshino, K.-I. Yamamura, and S.-I. Hayashi Potential of Dental Mesenchymal Cells in Developing Teeth Stem Cells, January 1, 2007; 25(1): 78 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamazaki, E. Sakata, T. Yamane, A. Yanagisawa, K. Abe, K.-I. Yamamura, S.-I. Hayashi, and T. Kunisada Presence and distribution of neural crest-derived cells in the murine developing thymus and their potential for differentiation Int. Immunol., May 1, 2005; 17(5): 549 - 558. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kleber, H.-Y. Lee, H. Wurdak, J. Buchstaller, M. M. Riccomagno, L. M. Ittner, U. Suter, D. J. Epstein, and L. Sommer Neural crest stem cell maintenance by combinatorial Wnt and BMP signaling J. Cell Biol., April 25, 2005; 169(2): 309 - 320. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Kasemeier-Kulesa, P. M. Kulesa, and F. Lefcort Imaging neural crest cell dynamics during formation of dorsal root ganglia and sympathetic ganglia Development, January 15, 2005; 132(2): 235 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. M. Wilson, K. L. Richards, M. L. Ford-Perriss, J.-J. Panthier, and M. Murphy Neural crest cell lineage segregation in the mouse neural tube Development, December 15, 2004; 131(24): 6153 - 6162. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Planque, G. Raposo, L. Leconte, O. Anezo, P. Martin, and S. Saule Microphthalmia Transcription Factor Induces Both Retinal Pigmented Epithelium and Neural Crest Melanocytes from Neuroretina Cells J. Biol. Chem., October 1, 2004; 279(40): 41911 - 41917. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||