|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00222
1 Departamento de Fisiología Molecular y Genética del Desarrollo,
Instituto de Biotecnología, UNAM, Cuernavaca, Morelos 62250,
México
2 Laboratory of Molecular Genetics, National Institute of Child Health and Human
Development, National Institutes of Health, Bethesda, MD 20892, USA
* Author for correspondence (e-mail: mvazquez{at}ibt.unam.mx)
Accepted 21 October 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Homeotic gene regulation, brahma, Trithorax group, Sumoylation, Chromatin remodeling, SWI/SNF, taranis, tonalli, Drosophila melanogaster
| INTRODUCTION |
|---|
|
|
|---|
Several trithorax groups genes in Drosophila encode proteins
involved in chromatin remodeling, including moira
(Brizuela and Kennison, 1997
;
Crosby et al., 1999
),
snr1 (Dingwall et al.,
1995
; Rozenblatt-Rosen et al.,
1998
), osa (Collins
et al., 1999
; Collins and
Treisman, 2000
; Treisman et
al., 1997
; Vázquez et
al., 1999
), and kismet
(Daubresse et al., 1999
;
Therrien et al., 2000
). The
Brm, Mor, and Snr1 proteins are probably part of a core complex that is
required for chromatin remodeling activity, whereas other subunits probably
regulate and/or target this activity
(Collins et al., 1999
;
Kal et al., 2000
;
Papoulas et al., 1998
).
In addition to chromatin remodeling complexes, the initiation of
transcription in eukaryotes also requires the function of several other large
protein complexes that may act to either relieve repression or allow
transcriptional activators to interact with RNA polymerase and other basal
transcription factors. Among these other protein complexes, the Mediator and
TATA-binding protein (TBP)-associated factors (TAF)s function as coactivators
by relaying transcriptional activation signals from DNA-bound activators to
the basal transcription machinery. The Mediator complex is found from yeast to
human and functions as an interface between activators and RNA polymerase II
to transduce regulatory information from enhancers to promoters. There is also
some in vitro evidence to suggest that some specific Mediator subcomplexes act
as transcriptional corepressors (Balciunas
et al., 1999
; Song and
Carlson, 1998
; Sun et al.,
1998
). In flies, the Mediator complex has been purified and its
interactions with different promoters, sequence-specific transcription factors
and basal transcription machinery has been characterized to some extent
(Park et al., 2001
). In
addition, many subunits have been identified in the Drosophila
genomic DNA sequence by their similarity to yeast or human Mediator subunits
(Boube et al., 2000
;
Rachez and Freedman, 2001
).
The TRAP230 and TRAP240 subunits of the Mediator complex are encoded by the
trithorax group genes: kohtalo (kto)
(Treisman, 2001
) and
skuld (skd) [described as blind spot (bli)
(Treisman, 2001
) and poils
aux pattes (pap) (Boube et
al., 2000
) (J. W. Southworth and J. A. Kennison, unpublished
results)]. kto and skd were first identified in the same
genetic screen for regulators of homeotic genes as brm
(Kennison and Tamkun,
1988
).
In order to identify additional proteins that are required for the proper
regulation of homeotic gene expression, we have screened for mutations that
show genetic interactions with brm mutations in regulation of the
Antennapedia (Antp) P2 promoter. We have previously
described the isolation of mutations in the trithorax group gene osa
in these screens (Vázquez et al.,
1999
). Here we report the isolation of mutations in two other
genes, taranis (tara) and tonalli (tna).
tara has been recently characterized as a new trithorax group gene
required for homeotic gene expression
(Calgaro et al., 2002
;
Fauvarque et al., 2001
). In
this work we show that tna is a novel trithorax group gene that is
required to regulate the expression of the Sex combs reduced
(Scr) and Antp homeotic genes. We also show that
tna function is required at several developmental stages. The
molecular characterization of two Tna protein isoforms reveals that
tna could function in postranslational modification of
chromatin-modifiers and/or transcriptional activator proteins.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mutant phenotypes
The `held-out wings' phenotype was scored if flies had both wings extended
(Fig. 1A). For
Pc3, Pc4, and
ScrMsc, the penetrance of the homeotic
transformation was measured by the presence of ectopic sex comb teeth on the
second and third legs of adult males. The expressivity of the homeotic
transformation was determined by counting the number of ectopic sex comb teeth
on the second and third legs and comparing it to control first legs, which
have an average of 10.8 sex comb teeth per leg
(Kennison and Russell, 1987
).
Wing extension, transformation of haltere to wing
(Fig. 1B), and reductions in
the numbers of sex comb teeth on the male first legs
(Fig. 1C) were used to evaluate
Antp, Ultrabithorax (Ubx) and Scr expressions,
respectively.
|
Lethality of individuals carrying homozygous or heteroallelic combinations of tna alleles was determined by counting the Tb+ progeny from crosses between tna alleles balanced with TM6B, Hu e Tb.
Isolation of DNA from the tna genomic region
We identified three P-element insertion strains
(tna2, tna3 and
tna4) that failed to complement
tna1 for viability. The insertion sites of these
three P elements were mapped in contig Dm3049
(Adams et al., 2000
) located in
the 67F1-68A1 region. To isolate genomic DNA from the tna locus we
carried out a standard plasmid rescue of genomic DNA adjacent to the P element
from the tna2 and
tna3 strains
(Sullivan et al., 2000
). Both
isolates were [32P]dCTP-labeled and used as probes for Southern
analyses of P1 clones from the 67F1-68A1 region. After standard restriction
mapping and Southern hybridization of the positive P1 clones, we carried out
further restriction mapping and Southern analysis of approximately 32 kb of
the chromosomal region surrounding the tna2 and
tna3 insertion sites in the DS04626 P1 clone.
Several fragments of this P1 clone were used as probes to analyze the
transcripts from the tna genomic region and to screen cDNA
libraries.
Nucleic acids analyses
To identify cDNAs representing the tna transcripts, we screened a
cDNA library in the Uni-ZAP XR vector from 2- to 14-hour Canton-S embryos
(Stratagene). Three positive clones were recovered and in vivo excised to
isolate the phagemids containing the cloned insert. The largest cDNA clone
(ZAP1 in Results, Fig. 3A) was
sequenced to confirm its identity.
|
Several expressed sequenced tags (ESTs) were identified by identity
searches carried out using the BLASTN and BLASTX programs
(Altschul et al., 1997
) as
provided by the NCBI and BDGP databases. The cDNA clone LD16921 (from 0-22 h
embryos) was reported with the nucleotide sequence from the 5' and
3' ends. With primers from these 5' and 3' sequences we
amplified an RT-PCR fragment named PCR1 (see
Fig. 3A). This fragment joins
the most 5' untranslated exon to the Tna coding exons. PCR1 was
amplified with the Expand High Fidelity polymerase (Roche) according to
manufacturer's instructions with poly(A)+ RNA from 0-3-hour
embryos, using as 5' and 3' 24mers primers with the sequences
5'CTGTCGCTTCTTCTTCTTCTTCAC3' and
5'TGCCTCCGTAACCATTTCCTGCTC3', respectively.
Southern and northern analyses were done as previously described
(Vázquez et al., 1999
).
Five micrograms of poly(A)+ RNA from the indicated developmental
stages were fractionated on a 1% agarose Mops/formaldehyde gel and transferred
to a HybondTM N+ nylon membrane (Amersham). RNA blots were
probed with purified DNA fragments labeled with [32P]dCTP by the
random primer method (Prime-It II kit from Stratagene) and washed under
conditions of high stringency (0.1 x SSC, 0.1% sodium dodecyl sulfate,
at 65°C).
We searched for tna-related proteins in the human genome using the
http://www.ensembl.org/Homo_sapiens/
and Online Mendelian Inheritance in ManTM
(McKusick, 2000
)
databases.
To identify the molecular lesion in the tna1 mutant allele, we purified genomic DNA from individuals with the genotypes tna1 red e/Df(3L)vin2 or tna+ red e/Df(3L)vin2. Df(3L)vin2 is a chromosomal deletion that lacks the entire tna gene. The tna coding region was PCR amplified with Expand High Fidelity polymerase (Roche) using as 5' and 3' primers oligonucleotides with the sequences 5'ATGAACCAGCAGGCGGGCTCCTCAAGGGCG3' and 5'CTAGTCGAATAACGTGGCCAGCAAGTCGT3', respectively. These primers amplify a 4.4 kb fragment with the entire tna open reading frame. One fragment from tna1 and tna+ (the wild-type chromosome in which the tna1 mutation was induced) was sequenced in both strands and the sequences were compared. To verify the identity of the tna1 mutation, a 578 bp fragment that includes the exon 5 genomic DNA (Fig. 4A) was amplified from five tna1/Df(3L)vin2 individuals using a 5' oligonucleotide with sequence from the end of exon 4 and a 3' oligonucleotide from the beginning of exon 6 as amplification primers. The sequences of these 5' and 3' primers are 5'GCTATGGTGGAGTCGGAGGAG3' and 5'ATTCGTCGGAGACGGTGACGGTATG3', respectively. All five independently amplified 578 bp fragments contained the substitution of a cytosine for a thymidine that changes the glutamine codon at position 566 to a stop codon (Fig. 4C).
|
Germline clones
Germline mosaics were generated using the dominant female-sterile technique
(Chou et al., 1993
).
tna1, tna2 and tna3
heterozygous females were mated to w; P[w+,
ovoD1]2X48/TM3, Sb males and the progeny irradiated
during the first larval instar (24-48 hours after egg laying) with 1000 rads
of X-rays. Female offspring of the genotypes +/w; tna1 red
e/P[w+, ovoD1]2X48, +/w; tna2
/P[w+, ovoD1]2X48 or +/w;
tna3 /P[w+, ovoD1]2X48 were
crossed to males heterozygous for a tna- deficiency (y
w; Df(3L)lxd6/TM6B, Hu e Tb Dr). Individuals produced by a female bearing
a germ-line clone were dissected, mounted and examined under the light
microscope.
| RESULTS |
|---|
|
|
|---|
tna is a trithorax group gene
The Antp gene has two alternative promoters, P1 and P2. The
AntpNs allele derepresses the Antp P2 promoter in
the eye-antennal disc and expresses wild-type Antp transcripts from
the Antp promoter (Jorgensen and
Garber, 1987
; Talbert and
Garber, 1994
).
Derepression of the Scr gene causes the appearance of extra sex
combs on the second and third legs of males. This derepression can be caused
by gain-of-function alleles of Scr, such as
ScrMsc (reviewed by
Southworth and Kennison,
2002
), or by loss-of-function mutations in Polycomb group genes,
such as Pc3 or Pc4.
Several trithorax group genes (including brm, mor, osa, kis, skd
and kto) were first identified as suppressors of the extra sex combs
phenotype caused by derepression of Scr or as suppressors of the
antenna to leg transformation caused by derepression of Antp in the
Nasobemia (Ns) allele of Antp and
(Kennison and Tamkun, 1988
).
Since we identified the tna gene on the basis of genetic interactions
with brm, we first tested whether tna mutations could also
suppress these two homeotic derepression phenotypes. We found that all
tna mutations strongly suppress the extra sex combs phenotype caused
by Pc3, Pc4 or ScrMsc
(Table 1), but only weakly
suppress the antenna to leg transformation caused by the
AntpNs mutation (Table
2).
|
|
We also analyzed other Antp alleles affecting the expression from
the P2 promoter. We have shown through this approach, that the P2 promoter
expression is sensitive to brm and osa dosages
(Vázquez et al., 1999
).
For example, brm and osa alleles enhance the held-out wings
phenotypes caused by mutations affecting the Antp cis region located
between the breakpoints of In(3R)AntpB and
In(3R)AntpR aberrations. We tested for genetic
interactions with all of the chromosome aberrations with breakpoints between
the Antp P1 and P2 promoters that were previously used to test for
interactions with brm and osa mutations
(Vázquez et al., 1999
).
We found that tna1 (but not the P element tna
alleles) enhances the held-out wings phenotype when in combination with
In(3R)AntpB and In(3R)AntpR lines
(Table 2). We did not observe
interactions with any of the other aberrations (data not shown). Thus, we
conclude that as with brm and osa, there is a
tna-sensitive region mapping between the 5' breakpoints of
In(3R)AntpB and In(3R)AntpR.
tna, tara, brm and osa interact genetically
Since we isolated tna and tara mutations because they
enhance the held-out wings phenotype of brm, we also looked for
genetic interactions with osa, which is also required for
Antp P2 function (Vázquez
et al., 1999
). We tested the EMS-induced alleles,
tna1, tara2 and tara20, and
the P-element insertion alleles, tna3 and
tara03881, for genetic interactions with brm,
osa, and with each other (Table
3). We found that all three EMS-induced alleles interact strongly
with brm2, but that the two P-element insertion alleles do
not show strong genetic interactions. The P-element insertion alleles do show
genetic interactions with brm2 in flies heterozygous for
mutations in all three genes (brm, tna and tara). These
results suggest that the P-insertion alleles are weaker than the EMS-induced
alleles. We observed similar results previously with brm and
osa (Vázquez et al.,
1999
). It is possible that the P-insertion mutations are not null
alleles, but it is also possible that the EMS-induced alleles make mutant
proteins that behave as dominant-negative mutations, still binding to
interacting protein complexes and competing for binding of the wild-type
alleles. All of the tna and tara mutations (except the
P-insertion allele tna3) show strong genetic interactions
with osa1 (Table
3). All three tara alleles interact strongly with
tna1, with tara2 showing the strongest
interactions.
|
tna interacts genetically with mutations in subunits of the
Brm complex, the Mediator coactivator complex and with the Kismet SWI2/SNF2
family ATPase
Several members of the trithorax group proteins are subunits of chromatin
remodeling or coactivator complexes. The Brm protein is the SWI2/SNF2-family
ATPase subunit of the Brm chromatin remodeling complex
(Tamkun et al., 1992
). The
trithorax group genes mor, osa and snr1 encode other
subunits of the Brm complex (Brizuela and
Kennison, 1997
; Collins et
al., 1999
; Collins and
Treisman, 2000
; Crosby et al.,
1999
; Dingwall et al.,
1995
; Kal et al.,
2000
; Papoulas et al.,
1998
; Rozenblatt-Rosen et al.,
1998
; Treisman et al.,
1997
; Vázquez et al.,
1999
). The kismet (kis) gene encodes another
trithorax group SWI2/SNF2-family member and is probably the ATPase subunit of
a different chromatin remodeling complex
(Daubresse et al., 1999
;
Therrien et al., 2000
). It is
thought that chromatin remodeling complexes may interact physically with the
basal transcription machinery, with transcriptional coactivators or
corepressors, or with proteins involved in histone modification, such as
acetyl-transferases and deacetylases. One of the transcriptional coactivator
complexes with which chromatin remodeling complexes might interact is the
Mediator complex (Rachez and Freedman,
2001
). The kohtalo (kto), skuld
(skd), and Trap80 trithorax group genes encode subunits of
the Mediator coactivator complex (Kennison
and Tamkun, 1988
; Boube et al.,
2000
; Treisman,
2001
) (J. W. Southworth and J. A. K., unpublished results).
We tested whether tna mutations could genetically interact with
mutations in the trithorax group genes encoding subunits of the Brm or Kis
chromatin remodeling complexes or the Mediator coactivator complex to give the
same held-out wings phenotype that we observed in the brm/+;
osal/+ transheterozygous combinations
(Vázquez et al., 1999
).
We also looked for genetic interactions between tna and several other
trithorax group mutations that probably do not encode subunits of the Brm, Kis
or Mediator complexes. The results are shown in
Table 3. We found that
tna1 shows strong genetic interactions with some
mutations in the Brm complex (brm2,
osa1, mor1 and
mor2), with kis mutations
(kis1 and kis13416),
and with some mutations in the Mediator complex
(skd2, skdlL7062 and
skdrk760). There were no strong interactions with
the snr10319 mutation in the Brm complex or the
kto1 and Trap80s2956
mutations in the Mediator complex. We also observed no strong genetic
interactions with ash21,
trx1, trx00347,
urd2 or sls1
trithorax group mutations (data not shown).
The zygotic and maternal functions of tna
Transheterozygous combinations among tna1,
tna2, tna3 and
tna4 alleles result in death at the third instar
larval, pupal or pharate adult stages. Heteroallelic pharate individuals
(dissected from the pupal cases) present transformations typical of
loss-of-function of the Antennapedia and Bithorax complex homeotic genes
(Table 4). In some cases, we
observed partial haltere to wing transformation that results from loss of
function for the Ultrabithorax (Ubx) homeotic gene
(Fig. 1B). In 100% of the male
flies we observed a strong reduction in the number of bristles in the male sex
comb (the sex comb teeth) (Fig.
1C). This is the phenotype observed in partial loss of function in
the Scr homeotic gene. Thus, we found that the tna zygotic
function is required for proper expression of at least three homeotic genes,
Antp, Ubx, and Scr.
|
At least 50% of the tna mutant transheterozygotes (and 85% for
some heteroallelic combinations) reach the pupa stage. This late stage of
lethality suggests that maternal tna function might be sufficient for
early development. To determine if this is so we generated homozygous germ
cells for the tna1,
tna2 and tna3
alleles. We used mitotic recombination and a transgene carrying the dominant
female-sterile mutation ovoD1
(Chou et al., 1993
) to produce
embryos that lacked wild-type maternal tna functions. The same
results were obtained with all three tna alleles and individuals
representative of this experiment are shown in
Fig. 2. When both maternal and
zygotic tna functions are lacking, most individuals die as third
instar larvae. For tna1, a few mutant individuals
reach late developmental stages (Fig.
2A-C) if they lack both maternal and zygotic tna
functions. These pharate individuals have fewer sex comb teeth in the male
first legs (Fig. 2C) and show a
haltere to wing transformation. In contrast, if only the zygotic function is
lacking (and the maternal function is normal), the tna mutants die,
predominantly as pupae. Individuals with no maternal tna can be
completely rescued by a wild-type allele inherited from the father, giving
rise to normal (and fertile) adults (Fig.
2D). Thus, we can conclude from these experiments that there is
maternal tna contribution but the zygotic function is sufficient to
reach late developmental stages, at least with the three alleles that we have
tested.
|
Molecular analyses of tna
The closest tna+ insertion line, EP(3)0374
(Fig. 3A, open circle), has an
EP element 6kb upstream of the tna- P-element insertion
sites (Fig. 3A, full circles).
Thus, at least part of the gene could be between the tna-
P and tna+ EP element insertion sites.
To isolate genomic DNA from the tna region we selected P1 clone DS04626, which includes the genomic DNA flanking the sites of the tna2, tna3 and tna4 P-element insertions. We did a chromosomal walk from DS04626 and tested several genomic probes to identify putative tna transcripts (data not shown). The tna- insertion sites are within the first large intron of an annotated gene, CG7958. We will present the evidence below that CG7958 is tna, but we will first describe our efforts to characterize the structure and limits of the transcription unit (Fig. 3A). There is another gene (CG6418, which may encode an RNA-binding protein) about 1.8 kb downstream of the last exon of tna. The 3' end of the tna transcription unit should be within this 1.8 kb region. Although there is an annotated gene (CG12523) about 60 kb upstream of the predicted 5' exon of tna, the first predicted gene (CG6449) for which there is EST evidence is about 160 kb upstream of tna. Although the tna promoter should be somewhere within this large genomic region, we have not yet identified the transcriptional start site. There is one P-element insertion available within this large region, EP(3)0374, which is about 1.6 kb upstream of the predicted tna 5' exon. This P-element insertion complements the tna mutations, i.e., it is tna+.
Our northern analyses identified two transcripts (6.1 and 4.2 kb in size) within the tna region, which derive by alternative splicing (see below). To characterize the structure of these transcripts, we isolated cDNA clones from an embryonic library. ZAP1, which is the longest, is shown in Fig. 3A. We also characterized cDNA clones from the BDGP. The BDGP clone LD16921, which was isolated from a 0- to 24-hour mixed stage embryonic library, was particularly useful and is also shown in Fig. 3A. We were able to amplify several RT-PCR fragments using, as a 5' primer, an oligonucleotide with the 5'LD16921 sequence and as 3' primers olignoucleotides with the sequence of diverse translated tna exons (see Materials and Methods). One of these fragments, PCR1, is a cDNA made from poly(A)+ RNA purified from 3- 24-hour embryos. To corroborate its identity it was cloned and sequenced (Fig. 3A). There are at least two alternative untranslated 5' exons. The 5' exon of the embryonic LD16921 cDNA clone (and the adult cDNA clones RE42750 and RE27454) differs from the 5' exon found in several testis ESTs (AT07790, Fig. 3A). There is also alternative splicing within the translated exons (described in detail below).
The tonalli transcripts are differentially expressed during
development
We performed northern blot analyses with RNA samples purified from
different developmental stages using the ZAP1 cDNA clone
(Fig. 3A) as a probe. This
clone was isolated from a
ZAP embryonic library and overlaps all of
the tna translated exons. We found two signals (6.1 and 4.2 kb)
(Fig. 3B) that correspond to
major tna transcripts. The 6.1 kb transcript was present at all
stages, but its expression increased at the second larval instar and reached
its maximum in the pupal stage. The 4.2 kb transcript was first detected in
third instar larvae, but it was most abundant in the pupal and adult
stages.
One of the Tna protein isoforms belongs to an SP-RING Zn-finger
domain family
The northern and sequence analyses of tna predict at least two
alternative transcripts (CT41698 and CT23982 from BDGP, release 2)
(Fig. 3A, mRNAs) encoding
products of 1109 and 610 residues (Fig.
4A). The long form of the protein (TnaA) is translated from 10
coding exons and may have three different amino termini (CG7958-RA, -RB and
-RC, BDGP, release 3). The mRNA for the short form (TnaB) lacks exons 5-8 and
part of exon 9. Both proteins have similar amino termini, which have two
Gln-rich regions, but they do not share the same carboxyl termini; the
alternative splicing of the short form generates a frameshift that changes the
open reading frame after the alternative splice
(Fig. 4A). This frameshift
generates a stop codon in the middle of exon 9.
Exon 7 is present only in TnaA and encodes a possible bipartite nuclear
location signal and an SP-RING (Siz/PIAS-RING)
(Hochstrasser, 2001
) putative
zinc finger (Fig. 4, see
below).
Blast analyses of the TnA protein sequence allowed us to identify four regions (Fig. 4A). Region I and IV (residues 1-494, and residues 799-1109, respectively) do not show homology to any other reported protein in any organism. Region I contains two blocks of glutamine residues.
Region III (647-798) includes the SP-RING finger (residues 718-760), which
is present in several proteins from organisms ranging from yeast to human
(Fig. 4B). One family of
SP-RING finger proteins are the PIAS [protein inhibitor
of activated STAT (signal
transducer and activator of transcription)]
family. One of the PIAS proteins, Miz1 (ARIP3/PIASX
)
(Wu et al., 1997
) has also
been identified as a cofactor of homeotic gene function in mice. In the
Drosophila genome, the only other SP-RING finger proteins are ZimpA
and ZimpB (zinc finger-containing, Miz1,
PIAS3-like) (Mohr and Boswell,
1999
). The Zimp proteins belong to the PIAS family and are encoded
by the Su(var)2-10 locus (Hari et
al., 2001
). Region III also includes the putative bipartite
nuclear location signal (residues 668-686,
Fig. 4C).
Although there are many proteins with similarities to Regions II (residues
495-646) or III (residues 647-798), there are only a few proteins that have
similarity to both. These include proteins from the mouse (EST B6863016),
Xenopus laevis (EST BJ075201), Gallus gallus (EST AJ396794),
Caenorhabditis elegans (predicted protein NM_069604), Arabidopsis
thaliana (AB011483), and human (KIAA1224 and KIAA1886). The two human
proteins (retinoic acid-induced KIAA1224, EMBL AB033050, and KIAA1886, GenBank
source AL136572) are 60% identical to TnaA in a region spanning almost 300
residues (from TnaA residues 495 to 798)
(Fig. 4A,C). We searched the
OMIM database (McKusick, 2000
)
but did not find any associated diseases attributed to mutations in the
KIAA1224 (10q23.2) and KIAA1886 (7p15.1) genes to date. This family of
proteins differs from the PIAS family in having Region II. We believe that the
300 amino acid domain spanning both Regions II and III identifies a new
signature that we have named the XSPRING (eXtended
SP-RING finger) domain
(Fig. 4A,C).
The TnaB form shares regions I and II with TnaA, but has a unique carboxyl terminus. It does not show any additional homology to other known or predicted proteins.
The tna1 allele carries a mutation that
affects only the TnaA protein product
The tna locus produces at least two different proteins, TnaA and
TnaB. We are interested in characterizing the functions of each one of these
forms and in dissecting more accurately whether the tna mutant
phenotypes are caused by the failure of one or both Tna proteins. Individuals
with the EMS-induced tna1 allele have different
phenotypes from those resulting from the P-element insertion alleles
(tna2, tna3 and
tna4). tna1 is the
allele that interacts strongest with several trithorax group mutations to
reduce Antp P2 function and cause a held-out wings phenotype
(Fig. 1A, Tables
2 and
3). The
tna1 allele is also the allele that shows the
strongest loss-of-function Ubx phenotype
(Fig. 1B,
Table 4) when heterozygous with
the P-element insertion alleles or the deletions. Thus, we characterized
molecularly the nature of the mutation in tna1
(see Materials and Methods). We purified DNA from
tna1/Df(3L)vin2 individuals that survive
until third instar larvae, PCR amplified, and sequenced the
tna1 genomic region. We found only one change
within the entire open reading frame of the tna1
mutant chromosome, a transition (C to T) that changes glutamine 566
(Fig. 4C) to a stop codon. This
change would generate a truncated product at the end of exon 5
(Fig. 4A) that will resemble
the amino-terminal region of the TnaB protein without its carboxyl terminus.
These data suggest that tna1 should affect only
TnaA, with TnaB still functional. The truncation of the TnaA protein may be
responsible for the phenotypes we observe with the
tna1 allele. The fact that this truncated form
resembles the amino terminus of the wild-type TnaB, together with the
tna1 genetic data, leads us to suggest that TnaB
cannot substitute for TnaA. As TnaB mRNA appears for the first time late in
development, the role of TnaB could be to negatively modulate the TnaA
function.
| DISCUSSION |
|---|
|
|
|---|
tara encodes twin proteins, Tara-
and Tara-ß, which
have a cyclinA-binding motif (also present in the cell cycle regulatory
transcription factors E2F1-3), a SERTA domain [which is the largest conserved
region among TRIP-Br (transcriptional regulator
interacting with the PHD-bromodomain)
proteins] and a PHD-bromo interaction domain
(Calgaro et al., 2002
).
Trip-Br1/p34SEI-1 is a Tara-related protein in mice that is a
cyclin-dependent kinase regulator
(Sugimoto et al., 1999
) and a
transcriptional regulator. Trip-Br1/p34SEI-1 can interact with PHD
and/or bromodomains (Hsu et al.,
2001
). It has been proposed that this family of proteins could
link the cell cycle with chromatin remodeling
(Sugimoto et al., 1999
).
Individuals with low dosages of tara
(Calgaro et al., 2002
) or
tna (this work) have a held-out wings phenotype. As we have isolated
tara mutations because they interact genetically with brm
mutations, the simplest hypothesis is that Tara proteins physically interact
with Brm proteins through the Brm bromodomain.
One Tna protein isoform is related to the PIAS family
Analysis of tna ESTs shows that there are at least two different
5' ends (represented by RE42750 and AT07790), suggesting that the
tna gene may have alternative promoters. The tara gene also
appears to have two promoters (Calgaro et
al., 2002
). In addition to the possibility of two promoters,
alternative splicing within the tna open reading frame gives rise to
at least two different protein isoforms, TnaA and TnaB.
The TnaA isoform has an SP-RING (Siz/PIAS RING)
finger (Saurin et al., 1996
),
which is present in the PIAS [protein inhibitor of
activated STAT (signal transducer
and activator of transcription)] family of proteins.
PIAS proteins are co-regulators of many gene-specific transcription factors.
For example, PIAS proteins co-repress STAT factors (which act as signal
transducers of cytokine receptors) to transcriptionally activate specific
target genes (Chung et al.,
1997
; Liu et al.,
1998
). PIAS proteins also coactivate steroid receptor-dependent
transcription (Kotaja et al.,
2000
; Tan et al.,
2000
). The PIAS protein Miz1/ARIP3/PIASX
possesses
intrinsic transcriptional-activating function
(Kotaja et al., 2000
),
interacts with the homeobox protein Msx2 to enhance its affinity for DNA
(Wu et al., 1997
) and is an
androgen receptor (AR)-interacting protein (ARIP). The Drosophila
zimp (zinc finger-containing, Miz1,
PIAS3-like) gene encodes proteins with similarity to the Miz1/PIAS3
protein (Mohr and Boswell,
1999
). The zimp gene is also known as
Su(var)2-10 (Hari et al.,
2001
). In addition to the SP-RING zinc finger domain, the
Su(var)2-10 proteins have a putative DNA-binding domain (the SAP domain) that
is found in diverse nuclear proteins. The Su(var)2-10 proteins regulate
chromosome structure and chromosome condensation, and function in interphase
nuclei (Hari et al., 2001
).
Recently a SUMO-protein ligase (E3) activity has been found in several SP-RING
finger proteins (Johnson and Gupta,
2001
; Sachdev et al.,
2001
) (reviewed by
Hochstrasser, 2001
).
tna and a role for sumoylation in regulating homeotic gene
expression
SUMO (small ubiquitin-related modifier) is a ubiquitin-like protein (UBL)
that is covalently attached to other proteins in a manner analogous to that of
ubiquitin (reviewed by Muller et al.,
2001
). Conjugation of SUMO-1 to all protein targets requires the
E1-activating heterodimer Aos1/Uba2 and the single E2-conjugating Ubc9 enzyme.
The target specificity is conferred by the SUMO E3 ligases. There are at least
two types of SUMO E3 ligases that are structurally unrelated. The first type
is represented by the PIAS family of SP-RING finger proteins. The second type
is represented by RanBP2, a nuclear pore complex protein. TnaA has an SP-RING
finger within the larger XSPRING domain
(Fig. 4B). The XSPRING domain
is present in a new group of human, mouse and Arabidopsis proteins
and may be the signature for a new subgroup of SUMO E3 ligases within the PIAS
family.
Although the role of sumoylation is not clear, it has been suggested that
sumoylation could be an address tag for protein targeting. Most of the
identified substrates of sumoylation are nuclear proteins, and the sumoylated
forms are often found in specific subnuclear protein complexes. Preferential
accumulation sites for sumoylated proteins are the PML nuclear bodies. PML, a
protein found in PML nuclear bodies, is a RING-finger protein. Another core
component of PML nuclear bodies is Sp100, a protein that interacts with HP1
and HMG1/2 families and a major cellular substrate for sumoylation. In vitro,
sumoylated Sp100 has a higher affinity for the HP1 protein
(Seeler et al., 2001
).
Relocalization of proteins to nuclear bodies after sumoylation can modulate
transcriptional activity (Fogal et al.,
2000
; Ishov et al.,
1999
; Lehembre et al.,
2001
; Li et al.,
2000
; Schmidt and Muller,
2002
). It has been suggested that nuclear bodies might stimulate
SUMO conjugation, and that proteins transiently associated with nuclear bodies
include SUMO targets (Muller et al.,
2001
). Thus, sumoylation can modulate the interaction of
transcription factors with transcriptional corregulators. In
Drosophila, the transcriptional repressor Tramtrack 69 protein
(Ttk69), which inhibits neuronal differentiation, has been identified as a
SUMO substrate (Lehembre et al.,
2000
). The Dorsal protein also undergoes sumoylation, which
facilitates its nuclear import (Bhaskar et
al., 2000
).
The SUMO ligation target consensus sequence is
KxE (where
is an
aliphatic residue) surrounding the substrate lysine(s) that is sumoylated.
Although this consensus sequence is short, all of the proteins encoded by the
trithorax groups genes that interact genetically with tna (including
TnaA itself) (Table 3) have one
or more blocks of this consensus sequence (L. G. and M. V., unpublished
results). However, some trithorax group genes that do not interact with
tna, such as trithorax (trx), also encode proteins
with the `sumoylation consensus'. Sumoylation of the HDAC4 deacetylase is
catalysed by the RanBP2 SUMO E3 ligase. While HDAC4 has several `sumoylation
consensus' sequences, only one functions in vitro and in vivo
(Kirsh et al., 2002
). The
possibility that subunits of the Brm and/or Kismet complexes might be targets
for sumoylation opens the window for a new level of regulation of the activity
of chromatin remodeling complexes. This level of regulation could involve the
modification of their subnuclear localization within the nucleus, although
mutation of the SUMO acceptor site in HDAC4 did not change its subcellular
distribution (Kirsh et al.,
2002
). Alternatively, is that sumoylation could target the
homeotic function itself or its cofactors.
Another possible role for sumoylation is as an antagonist of
ubiquitylation. Ubiquitylation is a key regulator of transcription (reviewed
by Conaway et al., 2002
) and
it has been suggested that sumoylation could be an inhibitor of
ubiquitylation. The RING (reviewed by
Jackson et al., 2000
) and PHD
(Lu et al., 2002
) fingers have
been described in proteins that have E3 ubiquitin ligase activities. In that
sense it is intriguing that Trip-Br1 (the tara homolog in mice)
(Hsu et al., 2001
) was
identified because it binds the PHD-bromodomain of Krip1/TIF1ß which also
has an RBCC (RING finger-B boxes-coiled
coil) RING finger (Saurin et
al., 1996
). Krip1/TIF1ß has a dual role because it has been
described as a corepressor of a subset of Krüppel-type zinc finger
proteins (Witzgall et al.,
1994
) and as a hormone-dependent coactivator that interacts with
several nuclear hormone receptors (Chang et
al., 1998
; Le Douarin et al.,
1996
). Mutations in a ubiquitin-conjugating enzyme (UbcD1) have
been shown to affect homeotic gene silencing
(Fauvarque et al., 2001
).
Since tna mutations affect homeotic gene activation, antagonism
between the ubiquitylation and sumoylation post-translational modifications
may play a key role in homeotic gene regulation. Antagonism of ubiquitylation
and targeting nuclear sublocalization are not mutually exclusive roles for
sumoylation, and it is possible that both will be found to have roles in
regulating the functions of chromatin remodeling and/or transcriptional
co-activator complexes.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A.,
Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A.,
Galle, R. F. et al. (2000). The genome sequence of
Drosophila melanogaster. Science
287,2185
-2195.
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J.,
Zhang, Z., Miller, W. and Lipman, D. J. (1997). Gapped BLAST
and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res. 25,3389
-3402.
Balciunas, D., Galman, C., Ronne, H. and Bhorklund, S.
(1999). The Med1 subunit of the yeast mediator complex is
involved in both transcriptional activation and repression. Proc.
Natl. Acad. Sci. USA 96,376
-381.
Bhaskar, V., Valentine, S. A. and Courey, A.
(2000). A functional interaction between dorsal and components of
the Smt3 conjugation machinery. J. Biol. Chem.
275,4033
-4040.
Boube, M., Faucher, C., Joulia, L., Cribbs, D. L. and Bourbon,
H. M. (2000). Drosophila homologs of transcriptional
mediator complex subunits are required for adult cell and segment identity
specification. Genes Dev.
14,2906
-2917.
Brizuela, B. J., Elfring, L., Ballard, J., Tamkun, J. W. and
Kennison, J. A. (1994). Genetic analysis of the
brahma gene of Drosophila melanogaster and polytene
chromosome subdivisions 72AB. Genetics
137,803
-813.[Abstract]
Brizuela, B. J. and Kennison, J. A. (1997). The
Drosophila homeotic gene moira regulates expression of
engrailed and HOM genes in imaginal tissues. Mech.
Dev. 65,209
-220.[CrossRef][Medline]
Calgaro, S., Boube, M., Cribbs, D. L. and Bourbon, H.
(2002). The Drosophila gene taranis encodes a
novel trithorax group member potentially linked to the cell cycle regulatory
apparatus. Genetics 160,547
-560.
Chang, C.-J., Chen, T.-L. and Lee, S.-C.
(1998). Coactivator TIF1ß interacts with transcription
factor C/EBPb and glucocorticoid receptor to induce
1-acid glycoprotein
gene expression. Mol. Cell. Biol.
18,5880
-5887.
Chou, T. B., Noll, E. and Perrimon, N. (1993).
Autosomal P[ovoD1] dominant female-sterile insertions in
Drosophila and their use in generating germ-line chimeras.
Development 119,1359
-1369.[Abstract]
Chung, C. D., Liao, J., Liu, B., Rao, X., Jay, P., Bertha, P.
and Shuai, K. (1997). Specific inhibition of Stat3 signal
transduction by PIAS3. Science
278,1803
-1805.
Collins, R. T., Furukawa, T., Tanese, N. and Treisman, J. E.
(1999). Osa associates with the Brahma chromatin remodeling
complex and promotes the activation of some target genes. EMBO
J. 18,7029
-7040.[CrossRef][Medline]
Collins, R. T. and Treisman, J. E. (2000).
Osa-containing Brahma chromatin remodeling complexes are required for the
repression of Wingless target genes. Genes Dev.
14,3140
-3152.
Conaway, R. C., Brower, C. S. and Conaway, J. W.
(2002). Emerging roles of ubiquitin in transcription regulation.
Science 296,1254
-1258.
Cosma, M. P., Tanaka, T. and Nasmyth, K.
(1999). Ordered recruitment of transcription and chromatin
remodeling factors to a cell cycle- and developmentally regulated promoter.
Cell 97,299
-311.[CrossRef][Medline]
Crosby, M. A., Miller, C., Alon, T., Watson, K. L., Verrijzer,
C. P., Goldman-Levi, R. and Zak, N. B. (1999). The trithorax
group gene moira encodes a Brahma-associated putative
chromatin-remodeling factor in Drosophila melanogaster. Mol. Cell.
Biol. 19,1159
-1170.
Daubresse, G., Deuring, R., Moore, L., Papoulas, O., Zakrajsek,
I., Waldrip, W. R., Scott, M. P., Kennison, J. A. and Tamkun, J. W.
(1999). The Drosophila kismet gene is related to
chromatin-remodeling factors and is required for both segmentation and segment
identity. Development
126,1175
-1187.[Abstract]
Dingwall, A. K., Beek, S. J., McCallum, C. M., Tamkun, J. W.,
Kalpana, G. V., Goff, S. P. and Scott, M. P. (1995). The
Drosophila snr1 and Brm proteins are related to yeast SWI/SNF
proteins and are components of a large protein complex. Mol. Biol.
Cell 6,777
-791.[Abstract]
Eisen, J. A., Sweder, K. S. and Hanawalt, P. C.
(1995). Evolution of the SNF2 family of proteins: subfamilies
with distinct sequences and functions. Nucleic Acids
Res. 23,2715
-2723.
Fauvarque, M. O., Laurenti, P., Boivin, A., Bloyer, S.,
Griffin-Shea, R., Bourbon, H. M. and Dura, J. M. (2001).
Dominant modifiers of the polyhomeotic extra-sex-combs phenotype induced by
marked P element insertional mutagenesis in Drosophila. Genet.
Res. 78,137
-148.[Medline]
Felsenfeld, A. L. and Kennison, J. A. (1995).
Positional signaling by hedgehog in Drosophila imaginal disc
development. Development
121, 1-10.[Abstract]
Fernandez-Funez, P., Niño-Rosales, M. L., de Gouyon, B.,
She, W. C., Luchak, J. M., Martinez, P., Turiegano, E., Benito, J., Capovilla,
M., Skinner, P. J. et al. (2000). Identification of genes
that modifiy ataxin-1-induced neurodegeneration.
Nature 408,101
-106.[CrossRef][Medline]
Flaus, A. and Owen-Hughes, T. (2001).
Mechanisms for ATP-dependent chromatin remodelling. Curr. Opin.
Genet. Dev. 11,148
-154.[CrossRef][Medline]
Fogal, V., Gostissa, M., Sandy, P., Zacchi, P., Sternsdorf, T.,
Jensen, K., Pandolfi, P. P., Will, H., Schneider, C. and del Sal, G.
(2000). Regulation of p53 activity in nuclear bodies by a
specific PML isoform. EMBO J.
19,6185
-6195.[CrossRef][Medline]
Francis, N. J. and Kingston, R. E. (2001).
Mechanisms of transcriptional memory. Nat. Rev. Mol. Cell.
Biol. 2,409
-421.[CrossRef][Medline]
Gellon, G. and McGinnis, W. (1998). Shaping
animal body plans in development and evolution by modulation of Hox
expression patterns. BioEssays
20,116
-125.[CrossRef][Medline]
Hari, K. L., Cook, K. R. and Karpen, G. H.
(2001). The Drosophila Su(var)2-10 locus regulates
chromosome structure and function and encodes a member of the PIAS protein
family. Genes Dev. 15,1334
-1348.
Hassan, A. H., Neely, K. E. and Workman, J. L.
(2001). Histone acetyltransferase complexes stabilize SWI/SNF
binding to promoter nucleosomes. Cell
104,817
-827.[CrossRef][Medline]
Hochstrasser, M. (2001). SP-RING for SUMO: new
functions bloom for a ubiquitin-like protein. Cell
107, 5-8.[CrossRef][Medline]
Hsu, S. I. H., Yang, C. M., Sim, K. G., Hentschel, D. M.,
O'Leary, E. and Bonventre, J. V. (2001). TRIP-Br: a novel
family of PHD zinc-finger- and bromodomain-interacting proteins that regulate
the transcriptional activity of E2F-1/DP-1. EMBO J.
20,2273
-2285.[CrossRef][Medline]
Ishov, A. M., Sotnikov, A. G., Negorev, D., Vladimirova, O. V.,
Neff, N., Kamitani, T., Yeh, E. T., Strauss, J. F. r. and Maul, G. G.
(1999). PML is critical for ND10 formation and recruits the
PML-interacting protein Daxx to this nuclear structure when modified by
SUMO-1. J. Cell Biol.
147,221
-234.
Jackson, P. K., Eldridge, A. G., Freed, E., Furstenthal, L.,
Hsu, J. Y., Kaiser, B. K. and Reimann, J. D. (2000). The lore
of the RINGs: substrate recognition and catalysis by ubiquitin ligases.
Tr. Cell Biol. 10,429
-439.[CrossRef][Medline]
Johnson, E. S. and Gupta, A. A. (2001). An
E3-like factor that promotes SUMO conjugation to the yeast septins.
Cell 106,735
-744.[CrossRef][Medline]
Jorgensen, E. M. and Garber, R. L. (1987).
Function and misfunction of the two promoters of the Drosophila
Antennapedia gene. Genes Dev.
1, 544-555.
Kal, A. J., Mahmoudi, T., Zak, N. B. and Verrijzer, C. P.
(2000). The Drosophila Brahma complex is an essential
coactivator for the trithorax group protein zeste. Genes
Dev. 14,1058
-1071.
Kennison, J. A. (1995). The Polycomb and
trithorax group proteins of Drosophila: trans-regulators of homeotic
gene function. Annu. Rev. Genet.
29,289
-303.[CrossRef][Medline]
Kennison, J. A. and Russell, M. A. (1987).
Dosage-dependent modifiers of homeotic mutations in Drosophila
melanogaster. Genetics 116,75
-86.
Kennison, J. A. and Tamkun, J. W. (1988).
Dosage-dependent modifiers of Polycomb and Antennapedia
mutations in Drosophila. Proc. Natl. Acad. Sci. USA
85,8136
-8140.
Kirsh, O., Seeler, J. S., Pichler, A., Gast, A., Muller, S.,
Miska, E., Mathieu, M., Harel-Bellan, A., Kouzarides, T., Melchior, F. et
al. (2002). The SUMO E3 ligase RanBP2 promotes modification
of the HDAC4 deacetylase. EMBO J.
21,2682
-2691.[CrossRef][Medline]
Klochendler-Yeivin, A., Muchardt, C. and Yaniv, M.
(2002). SWI/SNF chromatin remodeling and cancer. Curr.
Opin. Genet. Dev. 12,73
-79.[CrossRef][Medline]
Kotaja, N., Aittomaki, S., Silvennoinen, O., Palvimo, J. J. and
Janne, O. A. (2000). ARIP3 (androgen receptor-interacting
protein 3) and other PIAS (protein inhibitor of activated STAT) proteins
differ in their ability to modulate steroid receptor-dependent transcriptional
activation. Mol. Endocrinol.
14,1986
-2000.
Le Douarin, B., Nielsen, A. L., Garnier, J.-M., Ichinose, H.,
Jeanmougin, F., Losson, R. and Chambon, P. (1996). A possible
involvement of TIF1
and TIF1ß in the epigenetic control of
transcription by nuclear receptors. EMBO J.
15,6701
-6715.[Medline]
Lehembre, F., Badenhorst, P., Muller, S., Travers, A.,
Schweisguth, F. and Dejean, A. (2000). Covalent modification
of the transcriptional repressor tramtrack by the ubiquitin-related protein
Smt3 in Drosophila flies. Mol. Cell. Biol.
20,1072
-1082.
Lehembre, F., Muller, S., Pandolfi, P. P. and Dejean, A.
(2001). Regulation of Pax3 transcriptional activity by
SUMO-1-modified PML. Oncogene
20, 1-9.[CrossRef][Medline]
Li, H., Leo, C., Zhu, J., Wu, X., O'Neil, J., Park, E. J. and
Chen, J. D. (2000). Secuestration and inhibition of
Daxx-mediated transcriptional repression by PML. Mol. Cell.
Biol. 20,1784
-1796.
Lindsley, D. L. and Zimm, G. G. (1992).The genome of Drosophila melanogaster
. San Diego,
Calif.: Academic Press.
Liu, B., Liao, J., Rao, X., Kushner, S. A., Chung, C. D., Chang,
D. D. and Shuai, K. (1998). Inhibition of Stat1-mediated gene
activation by PIAS1. Proc. Natl. Acad. Sci. USA
95,10626
-10631.
Lu, Z., Xu, S., Joazeiro, C., Cobb, M. H. and Hunter, T.
(2002). The PHD domain of MEKK1 acts as an E3 ubiquitin-ligase
and mediates ubiquitination and degradation of ERK1/2. Mol.
Cell 9,945
-956.[CrossRef][Medline]
McKusick, V. A. (2000). Online Mendelian
Inheritance in Man, OMIMTM. (ed. McKusick-Nathans) Institute for
Genetic Medicine, Johns Hopkins University (Baltimore, MD) and National Center
for Biotechnology Information, National Library of Medicine (Bethesda,
MD).
Mohr, S. E. and Boswell, R. E. (1999).
Zimp encodes a homologue of mouse Miz1 and PIAS3 and is an essential
gene in Drosophila melanogaster. Gene
229,109
-118.[CrossRef][Medline]
Muller, S., Hoege, C., Pyrowolakis, G. and Jentsch, S.
(2001). SUMO, ubiquitin mysterious cousin. Nat. Rev.
Mol. Cell Biol. 2,202
-210.[CrossRef][Medline]
Papoulas, O., Beek, S. J., Moseley, S. L., McCallum, C. M.,
Sarte, M., Shearn, A. and Tamkun, J. W. (1998). The
Drosophila trithorax group proteins BRM, ASH1 and ASH2 are subunits
of distinct protein complexes. Development
125,3955
-3966.[Abstract]
Park, J. M., Gim, B. S., Kim, J. M., Yoon, J. H., Kim, H. S.,
Kang, J. G. and Kim, Y. J. (2001). Drosophila
Mediator complex is broadly utilized by diverse gene-specific transcription
factors at different types of core promoters. Mol. Cell.
Biol. 21,2312
-2323.
Rachez, C. and Freedman, L. P. (2001). Mediator
complexes and transcription. Curr. Opin. Cell Biol.
13,274
-280.[CrossRef][Medline]
Rorth, P., Szabo, K., Bailey, A., Laverty, T., Rehm, J., Rubin,
G. M., Wigmann, K., Milan, M., Benes, V., Ansorge, W. et al.
(1998). Systematic gain-of-function genetics in Drosophila.Development 125,1049
-1057.[Abstract]
Rozenblatt-Rosen, O., Rozobskaia, T., Burakov, D., Sedkov, Y.,
Tillib, S., Blechman, J., Nakamura, T., Croce, C. M., Mazo, A. and Canaani,
E. (1998). The C-terminal SET domains of ALL-1 and Trithorax
interact with Ini1 and Snr1 proteins, components of the SWI/SNF complex.
Proc. Natl. Acad. Sci. USA,4152
-4157.
Sachdev, S., Bruhn, L., Sieber, H., Pichler, A., Melchior, F.
and Grosschedl, R. (2001). PIASy, a nuclear matrix-associated
SUMO E3 ligase, represses LEF1 activity by sequestration into nuclear bodies.
Genes Dev. 15,3088
-3103.
Saurin, A. J., Borden, K. L. B., Boddy, M. N. and Freemont, P.
S. (1996). Does this have a familiar RING? Tr.
Biochem. Sci. 21,208
-214.
Schmidt, D. and Muller, S. (2002). Members of
the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53
activity. Proc. Natl. Acad. Sci., USA
99,2872
-2877.
Seeler, J. S., Marchio, A., Losson, R., Desterro, J. M., Hay, R.
T., Chambon, P. and Dejean, A. (2001). Common properties of
nuclear body protein SP100 and TIF1 alpha chromatin factor: role of SUMO
modification. Mol. Cell. Biol.
21,3314
-3324.
Simon, J. A. and Tamkun, J. W. (2002).
Programming off and on states in chromatin: mechanisms of Polycomb and
trithorax group complexes. Curr. Opin. Genet. Dev.
12,210
-218.[CrossRef][Medline]
Song, W. and Carlson, M. (1998). Srb/mediator
proteins interact functionally and physically with transcriptional repressor
Sfl1. EMBO J. 17,5757
-5765.[CrossRef][Medline]
Southworth, J. W. and Kennison, J. A. (2002).
Transvection and silencing of the Sex combs reduced homeotic gene of
Drosophila melanogaster. Genetics
161,733
-746.
Staehling-Hampton, K., Ciampa, P. J., Brook, A. and Dyson,
N. (1999). A genetic screen for modifiers of E2F in
Drosophila melanogaster. Genetics
153,275
-287.
Sugimoto, M., Nakamura, T., Ohtani, N., Hampson, L., Hampson, I.
N., Shimamoto, A., Furuichi, Y., Okumura, K., Niwa, S., Taya, Y. et al.
(1999). Regulation of CDK4 activity by a novel CDK4-binding
protein, p34(SEI-1). Genes Dev.
13,3027
-3033.
Sullivan, W., Ashburner, M. and Hawley, R. S.
(2000). Drosophila Protocols. Cold Spring
Harbor, New York: Cold Spring Harbor Laboratory Press.
Sun, X., Zhang, Y., Cho, H., Rickert, P., Lees, E., Lane, W. and
Reinberg, D. (1998). NAT, a human complex containing Srb
polypeptides that functions as a negative regulator of activated
transcription. Mol. Cell
2, 213-222.[CrossRef][Medline]
Talbert, P. B. and Garber, R. L. (1994). The
Drosophila homeotic mutation Nasobemia (AntpNs)
and its revertants: and analysis of mutational reversion.
Genetics 138,709
-720.[Abstract]
Tamkun, J. W., Deuring, R., Scott, M. P., Kissinger, M.,
Pattatuci, A. M., Kaufman, T. C. and Kennison, J. A. (1992).
brahma: a regulator of Drosophila homeotic genes
structurally related to the yeast transcriptional activator SNF2/SWI2.
Cell 68,561
-572.[CrossRef][Medline]
Tan, J., Hall, S. H., Hamil, K. G., Grossman, G., Petrusz, P.,
Liao, J., Shuai, K. and French, F. S. (2000). Protein
Inhibitor of Activated STAT-1 (Signal Transducer and Activator of
Transcription-1) is a nuclear receptor coregulator expressed in human testis.
Mol. Endocrinol. 14,14
-26.
Therrien, M., Morrison, D. K., Wong, A. M. and Rubin, G. M.
(2000). A genetic screen for modifiers of a kinase suppressor of
Ras-dependent rough eye phenotype in Drosophila.Genetics 156,1231
-1242.
Treisman, J. (2001). Drosophila
homologues of the transcriptional coactivation complex subunits TRAP240 and
TRAP230 are required for identical processes in eye-antennal disc development.
Development 128,603
-615.[Abstract]
Treisman, J. E., Luk, A., Rubin, G. M. and Heberlein, U.
(1997). eyelid antagonizes wingless signaling
during Drosophila development and has homology to the Bright family
of DNA-binding proteins. Genes Dev.
11,1949
-1962.
Vázquez, M., Moore, L. and Kennison, J. A.
(1999). The trithorax-group gene osa encodes an
ARID-domain protein that interacts with the Brahma chromatin-remodeling factor
to regulate transcription. Development
126,733
-742.[Abstract]
Vignali, M., Hassan, A. H., Neely, K. E. and Workman, J. L.
(2000). ATP-dependent chromatin remodeling complexes.
Mol. Cell. Biol. 20,1899
-1910.
Witzgall, R., O'Leary, E., Leaf, E., Önalde, D. and
Bonventre, J. V. (1994). The Krüppel-associated box-A
(KRAB-A) domain of zinc finger proteins mediates transcriptional repression.
Proc. Natl. Acad. Sci. USA
91,4514
-4518.
Wu, L., Wu, H., Sangiorgi, F., Wu, N., Bell, J. R., Lyons, G. E.
and Maxson, R. (1997). Miz1, a novel zinc finger
transcription factor that interacts with Msx2 and enhances its affinity for
DNA. Mech. Dev. 65,3
-17.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. Vazquez, M. T. Cooper, M. Zurita, and J. A. Kennison {gamma}Tub23C Interacts Genetically With Brahma Chromatin-Remodeling Complexes in Drosophila melanogaster Genetics, October 1, 2008; 180(2): 835 - 843. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Yazdani, Z. Huang, and J. R. Terman The Glucose Transporter (GLUT4) Enhancer Factor Is Required for Normal Wing Positioning in Drosophila Genetics, February 1, 2008; 178(2): 919 - 929. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Beliakoff, J. Lee, H. Ueno, A. Aiyer, I. L. Weissman, G. S. Barsh, R. D. Cardiff, and Z. Sun The PIAS-Like Protein Zimp10 Is Essential for Embryonic Viability and Proper Vascular Development Mol. Cell. Biol., January 1, 2008; 28(1): 282 - 292. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lee, J. Beliakoff, and Z. Sun The novel PIAS-like protein hZimp10 is a transcriptional co-activator of the p53 tumor suppressor Nucleic Acids Res., July 26, 2007; 35(13): 4523 - 4534. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, G. Thyssen, J. Beliakoff, and Z. Sun The Novel PIAS-like Protein hZimp10 Enhances Smad Transcriptional Activity J. Biol. Chem., August 18, 2006; 281(33): 23748 - 23756. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Huang, J. Beliakoff, X. Li, J. Lee, X. Li, M. Sharma, B. Lim, and Z. Sun hZimp7, a Novel PIAS-Like Protein, Enhances Androgen Receptor-Mediated Transcription and Interacts with SWI/SNF-Like BAF Complexes Mol. Endocrinol., December 1, 2005; 19(12): 2915 - 2929. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Janody, J. D. Lee, N. Jahren, D. J. Hazelett, A. Benlali, G. I. Miura, I. Draskovic, and J. E. Treisman A Mosaic Genetic Screen Reveals Distinct Roles for trithorax and Polycomb Group Genes in Drosophila Eye Development Genetics, January 1, 2004; 166(1): 187 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Janody, Z. Martirosyan, A. Benlali, and J. E. Treisman Two subunits of the Drosophila mediator complex act together to control cell affinity Development, August 15, 2003; 130(16): 3691 - 3701. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||