spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

doi: 10.1242/10.1242/dev.00222


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gutiérrez, L.
Right arrow Articles by Vázquez, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gutiérrez, L.
Right arrow Articles by Vázquez, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 130, 343-354 (2003)
Copyright © 2003 The Company of Biologists Limited

The Drosophila trithorax group gene tonalli(tna) interacts genetically with the Brahma remodeling complex and encodes an SP-RING finger protein

Luis Gutiérrez1, Mario Zurita1, James A. Kennison2 and Martha Vázquez1,*

1 Departamento de Fisiología Molecular y Genética del Desarrollo, Instituto de Biotecnología, UNAM, Cuernavaca, Morelos 62250, México
2 Laboratory of Molecular Genetics, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892, USA

* Author for correspondence (e-mail: mvazquez{at}ibt.unam.mx)

Accepted 21 October 2002


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The trithorax group genes are required for positive regulation of homeotic gene function. The trithorax group gene brahma encodes a SWI2/SNF2 family ATPase that is a catalytic subunit of the Brm chromatin-remodeling complex. We identified the tonalli (tna) gene in Drosophila by genetic interactions with brahma. tna mutations suppress Polycomb phenotypes and tna is required for the proper expressions of the Antennapedia, Ultrabithorax and Sex combs reduced homeotic genes. The tna gene encodes at least two proteins, a large isoform (TnaA) and a short isoform (TnaB). The TnaA protein has an SP-RING Zn finger, conserved in proteins from organisms ranging from yeast to human and thought to be involved in the sumoylation of protein substrates. Besides the SP-RING finger, the TnaA protein also has extended homology with other eukaryotic proteins, including human proteins. We show that tna mutations also interact with mutations in additional subunits of the Brm complex, with mutations in subunits of the Mediator complex, and with mutations of the SWI2/SNF2 family ATPase gene kismet. We propose that Tna is involved in postranslational modification of transcription complexes.

Key words: Homeotic gene regulation, brahma, Trithorax group, Sumoylation, Chromatin remodeling, SWI/SNF, taranis, tonalli, Drosophila melanogaster


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The trithorax and Polycomb group genes encode positive and negative factors required for the maintenance of homeotic gene expression (Francis and Kingston, 2001Go; Gellon and McGinnis, 1998Go; Kennison, 1995Go; Simon and Tamkun, 2002Go). Kennison and Tamkun (Kennison and Tamkun, 1988Go) first identified brahma (brm) as a trithorax group gene required for the maintenance of homeotic gene expression, but brm also regulates the expression or function of engrailed (Brizuela et al., 1994Go), hedgehog (Felsenfeld and Kennison, 1995Go), wingless (Collins and Treisman, 2000Go), and E2F (Staehling-Hampton et al., 1999Go). The Brm protein (Tamkun et al., 1992Go) is a SWI2/SNF2 family ATPase (Eisen et al., 1995Go). Brm is a subunit of a large protein complex that is a member of the SWI/SNF family of chromatin remodeling complexes (Papoulas et al., 1998Go). Several different mouse and human SWI/SNF complexes related to the Brm complex have been isolated and mutations of some subunits have revealed their roles in a variety of processes, including cell proliferation, differentiation, viral infection, and cancer (reviewed by Klochendler-Yeivin et al., 2002Go). In vitro studies show that SWI/SNF complexes can alter both nucleosome position and nucleosome conformation (reviewed by Flaus and Owen-Hughes, 2001Go; Vignali et al., 2000Go). The yeast SWI/SNF complex is recruited to nucleosomes proximal to the promoter by transcriptional activators. This recruitment leads to localized nucleosome disruption. Retention of SWI/SNF complexes on the promoter requires either the continued binding of the transcriptional activator or the presence of acetylated histones (Cosma et al., 1999Go; Hassan et al., 2001Go). These changes facilitate the transcriptional activation or repression by gene-specific DNA-binding proteins. It is likely that the effects of SWI/SNF complexes will have important effects on inter-nucleosomal interactions that could have consequences for higher-order chromatin structure (Francis and Kingston, 2001Go).

Several trithorax groups genes in Drosophila encode proteins involved in chromatin remodeling, including moira (Brizuela and Kennison, 1997Go; Crosby et al., 1999Go), snr1 (Dingwall et al., 1995Go; Rozenblatt-Rosen et al., 1998Go), osa (Collins et al., 1999Go; Collins and Treisman, 2000Go; Treisman et al., 1997Go; Vázquez et al., 1999Go), and kismet (Daubresse et al., 1999Go; Therrien et al., 2000Go). The Brm, Mor, and Snr1 proteins are probably part of a core complex that is required for chromatin remodeling activity, whereas other subunits probably regulate and/or target this activity (Collins et al., 1999Go; Kal et al., 2000Go; Papoulas et al., 1998Go).

In addition to chromatin remodeling complexes, the initiation of transcription in eukaryotes also requires the function of several other large protein complexes that may act to either relieve repression or allow transcriptional activators to interact with RNA polymerase and other basal transcription factors. Among these other protein complexes, the Mediator and TATA-binding protein (TBP)-associated factors (TAF)s function as coactivators by relaying transcriptional activation signals from DNA-bound activators to the basal transcription machinery. The Mediator complex is found from yeast to human and functions as an interface between activators and RNA polymerase II to transduce regulatory information from enhancers to promoters. There is also some in vitro evidence to suggest that some specific Mediator subcomplexes act as transcriptional corepressors (Balciunas et al., 1999Go; Song and Carlson, 1998Go; Sun et al., 1998Go). In flies, the Mediator complex has been purified and its interactions with different promoters, sequence-specific transcription factors and basal transcription machinery has been characterized to some extent (Park et al., 2001Go). In addition, many subunits have been identified in the Drosophila genomic DNA sequence by their similarity to yeast or human Mediator subunits (Boube et al., 2000Go; Rachez and Freedman, 2001Go). The TRAP230 and TRAP240 subunits of the Mediator complex are encoded by the trithorax group genes: kohtalo (kto) (Treisman, 2001Go) and skuld (skd) [described as blind spot (bli) (Treisman, 2001Go) and poils aux pattes (pap) (Boube et al., 2000Go) (J. W. Southworth and J. A. Kennison, unpublished results)]. kto and skd were first identified in the same genetic screen for regulators of homeotic genes as brm (Kennison and Tamkun, 1988Go).

In order to identify additional proteins that are required for the proper regulation of homeotic gene expression, we have screened for mutations that show genetic interactions with brm mutations in regulation of the Antennapedia (Antp) P2 promoter. We have previously described the isolation of mutations in the trithorax group gene osa in these screens (Vázquez et al., 1999Go). Here we report the isolation of mutations in two other genes, taranis (tara) and tonalli (tna). tara has been recently characterized as a new trithorax group gene required for homeotic gene expression (Calgaro et al., 2002Go; Fauvarque et al., 2001Go). In this work we show that tna is a novel trithorax group gene that is required to regulate the expression of the Sex combs reduced (Scr) and Antp homeotic genes. We also show that tna function is required at several developmental stages. The molecular characterization of two Tna protein isoforms reveals that tna could function in postranslational modification of chromatin-modifiers and/or transcriptional activator proteins.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Fly strains
Flies were raised at 25°C on a yeast-sucrose-agar medium with either Nipagin or propionic acid or on a cornmeal-molasses-yeast-agar medium with Tegosept. Unless otherwise noted, all mutations and chromosome aberrations are described by Lindsley and Zimm (Lindsley and Zimm, 1992Go). tna1, tara2, and tara20 are EMS-induced mutations recovered on the basis of the wings-out phenotype when transheterozygous to brm2 (Vázquez et al., 1999Go). tara03881 is a P-element insertion allele. tra2 [P{PZ}l(3)rI075rI075], tra3 [P{lacW}l(3)s0583/02] and tra4 [P{lacW}l(3)rI075L6731] are P-element insertion alleles, that are lethal in combination with tna1. The EP(3)0374 is a tna+ line kindly provided by P. Rorth (Rorth et al., 1998Go). We will refer to In(3R)ScrMsc simply as ScrMsc.

Mutant phenotypes
The `held-out wings' phenotype was scored if flies had both wings extended (Fig. 1A). For Pc3, Pc4, and ScrMsc, the penetrance of the homeotic transformation was measured by the presence of ectopic sex comb teeth on the second and third legs of adult males. The expressivity of the homeotic transformation was determined by counting the number of ectopic sex comb teeth on the second and third legs and comparing it to control first legs, which have an average of 10.8 sex comb teeth per leg (Kennison and Russell, 1987Go). Wing extension, transformation of haltere to wing (Fig. 1B), and reductions in the numbers of sex comb teeth on the male first legs (Fig. 1C) were used to evaluate Antp, Ultrabithorax (Ubx) and Scr expressions, respectively.



View larger version (128K):
[in this window]
[in a new window]
 
Fig. 1. tna mutant phenotypes mimic homeotic loss-of-function phenotypes. In all panels wild type is on the left and the mutant is on the right (A) The held-out wings phenotype of a tna1/brm2 double heterozygote indicative of loss of Antp P2 function. (B) The partial transformation of haltere to wing in a tna1/tna4 mutant fly indicative of loss of Ubx function. (C) The reduction in the number of sex comb teeth on the first leg of a tna2/tna4 mutant male indicative of loss of Scr function.

 

Lethality of individuals carrying homozygous or heteroallelic combinations of tna alleles was determined by counting the Tb+ progeny from crosses between tna alleles balanced with TM6B, Hu e Tb.

Isolation of DNA from the tna genomic region
We identified three P-element insertion strains (tna2, tna3 and tna4) that failed to complement tna1 for viability. The insertion sites of these three P elements were mapped in contig Dm3049 (Adams et al., 2000Go) located in the 67F1-68A1 region. To isolate genomic DNA from the tna locus we carried out a standard plasmid rescue of genomic DNA adjacent to the P element from the tna2 and tna3 strains (Sullivan et al., 2000Go). Both isolates were [32P]dCTP-labeled and used as probes for Southern analyses of P1 clones from the 67F1-68A1 region. After standard restriction mapping and Southern hybridization of the positive P1 clones, we carried out further restriction mapping and Southern analysis of approximately 32 kb of the chromosomal region surrounding the tna2 and tna3 insertion sites in the DS04626 P1 clone. Several fragments of this P1 clone were used as probes to analyze the transcripts from the tna genomic region and to screen cDNA libraries.

Nucleic acids analyses
To identify cDNAs representing the tna transcripts, we screened a cDNA library in the Uni-ZAP XR vector from 2- to 14-hour Canton-S embryos (Stratagene). Three positive clones were recovered and in vivo excised to isolate the phagemids containing the cloned insert. The largest cDNA clone (ZAP1 in Results, Fig. 3A) was sequenced to confirm its identity.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 3. Molecular organization and developmental expression of the tna locus. (A) The tna genomic region is represented at the bottom of the panel. The tna- P-element insertion sites are indicated by gray circles. The arrows by the insertions represent the orientation of the respective P-element with respect to the tna transcription direction. The tna+ EP0374 insertion site is shown as a white circle. The restriction sites are: B, BamHI; X, XbaI; E, EcoRI; H, HindIII. CG6418 is an RNA helicase transcribed towards the 3' end of the tna locus. The transcripts (mRNAs) are depicted in the middle of the panel. The BDGP, release 2-predicted transcripts containing the translated exons (black rectangles for shared, grey rectangles for the non-shared exons between tnaA and tnaB) are shown. We have added the 5' untranslated exon and the 3' poly(A)+ regions (white rectangles) deduced from our analysis of the locus. The 5' UTR exon is open on the left to indicate that the tna transcription initiation start site has not been determined. The indicated sizes of both transcripts are in agreement with the northern analysis shown in B. The upper part A (cDNAs) shows representative cDNAs isolated from the tna locus. AT07790 is one of several ESTs identified in adult testis. RE42750 is an EST from adult heads. The ZAP1 embryo cDNA clone was isolated from the UNI-ZAP library from 0-12-hour embryos (see Material and Methods) and was the probe for the northern blot shown in B. The PCR1 embryo cDNA clone was RT-PCR amplified with 5' and 3' primers sequences from the reported LD16921 embryonic clone (see Material and Methods). (B) RNA poly(A)+ was prepared from 0-3-hour and 3-21-hour embryos (0-3 and 3-21), first, second and third instar larvae (L1, L2, L3), pupae (P) and adults (A). Samples were blotted and run under standard conditions. The blot was probed with the ZAP1 cDNA (A). The blot was washed and rehybridized using a probe for rp49 as a loading control. The sizes of the detected bands are indicated.

 

Several expressed sequenced tags (ESTs) were identified by identity searches carried out using the BLASTN and BLASTX programs (Altschul et al., 1997Go) as provided by the NCBI and BDGP databases. The cDNA clone LD16921 (from 0-22 h embryos) was reported with the nucleotide sequence from the 5' and 3' ends. With primers from these 5' and 3' sequences we amplified an RT-PCR fragment named PCR1 (see Fig. 3A). This fragment joins the most 5' untranslated exon to the Tna coding exons. PCR1 was amplified with the Expand High Fidelity polymerase (Roche) according to manufacturer's instructions with poly(A)+ RNA from 0-3-hour embryos, using as 5' and 3' 24mers primers with the sequences 5'CTGTCGCTTCTTCTTCTTCTTCAC3' and 5'TGCCTCCGTAACCATTTCCTGCTC3', respectively.

Southern and northern analyses were done as previously described (Vázquez et al., 1999Go). Five micrograms of poly(A)+ RNA from the indicated developmental stages were fractionated on a 1% agarose Mops/formaldehyde gel and transferred to a HybondTM N+ nylon membrane (Amersham). RNA blots were probed with purified DNA fragments labeled with [32P]dCTP by the random primer method (Prime-It II kit from Stratagene) and washed under conditions of high stringency (0.1 x SSC, 0.1% sodium dodecyl sulfate, at 65°C).

We searched for tna-related proteins in the human genome using the http://www.ensembl.org/Homo_sapiens/ and Online Mendelian Inheritance in ManTM (McKusick, 2000Go) databases.

To identify the molecular lesion in the tna1 mutant allele, we purified genomic DNA from individuals with the genotypes tna1 red e/Df(3L)vin2 or tna+ red e/Df(3L)vin2. Df(3L)vin2 is a chromosomal deletion that lacks the entire tna gene. The tna coding region was PCR amplified with Expand High Fidelity polymerase (Roche) using as 5' and 3' primers oligonucleotides with the sequences 5'ATGAACCAGCAGGCGGGCTCCTCAAGGGCG3' and 5'CTAGTCGAATAACGTGGCCAGCAAGTCGT3', respectively. These primers amplify a 4.4 kb fragment with the entire tna open reading frame. One fragment from tna1 and tna+ (the wild-type chromosome in which the tna1 mutation was induced) was sequenced in both strands and the sequences were compared. To verify the identity of the tna1 mutation, a 578 bp fragment that includes the exon 5 genomic DNA (Fig. 4A) was amplified from five tna1/Df(3L)vin2 individuals using a 5' oligonucleotide with sequence from the end of exon 4 and a 3' oligonucleotide from the beginning of exon 6 as amplification primers. The sequences of these 5' and 3' primers are 5'GCTATGGTGGAGTCGGAGGAG3' and 5'ATTCGTCGGAGACGGTGACGGTATG3', respectively. All five independently amplified 578 bp fragments contained the substitution of a cytosine for a thymidine that changes the glutamine codon at position 566 to a stop codon (Fig. 4C).



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 4. The Tonalli proteins. (A) The two alternatively spliced forms predicted by the BDGP, release 2, are shown. In the upper part is a scale that indicates the aminoacid residues. In the TnaA protein the exons are indicated as E. E1 to E4 are exons shared between the TnaA and the TnaB forms. The glutamine rich domains are indicated by lightly shaded boxes. The bipartite nuclear location signal is indicated by the hatched box. The SP-RING finger is indicated by a black box. The TnaB carboxyl termini is indicated by the grey box and is different from the one in TnaA. The XSPRING domain, which is present in the human KIAA proteins and in proteins in other organisms, is indicated by the box above the proteins. (B) Multiple alignment of the SP-RING finger region in different proteins. KIAA1224 and KIAA1886 human proteins (accession numbers in Results); Su(var), D. melanogaster Su(var)2-10/ZimpA/B (gb/AAD29287.1); Miz1, (Msx-interacting-zinc finger) from mouse (gb/AAB96678.1); PIAS1 from mouse (gb/AAC36702.1); KCh, K+ channel-associated protein from rat (gb/AAC40114.1); PIAS3 from mouse (dbj/BAA78533.1); PIASy from human (gb/AAC36703.1); CEW10D5 predicted protein from C. elegans (pir/T26331); VICIA, Vicia faba transcription factor (pir/T12184); SER-INT, a Schizosaccharomyces pombe homologue (pir/T37748) of Saccharomyces cerevisiae Siz proteins; NFI1/SIZ2, CDC12 and septin-interacting protein in S. cerevisiae (gb/AAA86121.1); SIZ1, septin-interacting protein from S. cerevisiae (pir/S69691). The bottom line is the identical (in uppercase letters) and most common (lowercase) residues in all sequences. (C) Multiple alignment of Drosophila TnaA, human KIAA1224, and human KIAA1886 XSPRING domains (495-798). The glutamine 566 that changes for a stop codon in tna1 is indicated by the residue number. The bipartite nuclear location signal residues are underlined. The SP-RING finger residues are indicated with asterisks. Consensus sequence of the same amino acid present in the three proteins is indicated.

 

Germline clones
Germline mosaics were generated using the dominant female-sterile technique (Chou et al., 1993Go). tna1, tna2 and tna3 heterozygous females were mated to w; P[w+, ovoD1]2X48/TM3, Sb males and the progeny irradiated during the first larval instar (24-48 hours after egg laying) with 1000 rads of X-rays. Female offspring of the genotypes +/w; tna1 red e/P[w+, ovoD1]2X48, +/w; tna2 /P[w+, ovoD1]2X48 or +/w; tna3 /P[w+, ovoD1]2X48 were crossed to males heterozygous for a tna- deficiency (y w; Df(3L)lxd6/TM6B, Hu e Tb Dr). Individuals produced by a female bearing a germ-line clone were dissected, mounted and examined under the light microscope.


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
tonalli and taranis enhance brahma mutant phenotypes
Flies heterozygous for some combinations of mutations in trithorax group genes have a held-out wings phenotype (Fig. 1A) that results from reduced expression of the Antp P2 promoter (Vázquez et al., 1999Go). On the basis of this phenotype we isolated several dominant enhancers of brm. Two of the new mutations are alleles of the trithorax group gene taranis (tara) (Fauvarque et al., 2001Go). These mutations, tara2 and tara20, show genetic interactions with multiple alleles of brm. In addition, we isolated one mutation in a novel gene that we named tonalli (tna). tonalli is `fate' in náhuatl, an indigenous mexican language. We mapped tna1 to polytene chromosome bands 67F3-4. Analyzing the available collection of P-element insertion lines from the BDGP we identified three P-element insertion strains [P{PZ}l(3)rI075rI075, P{lacW}l(3)s0583/02, and P{lacW}l(3)rI075L6731] that failed to complement tna1. We will refer to these P-insertion mutations as tna2, tna3 and tna4, respectively.

tna is a trithorax group gene
The Antp gene has two alternative promoters, P1 and P2. The AntpNs allele derepresses the Antp P2 promoter in the eye-antennal disc and expresses wild-type Antp transcripts from the Antp promoter (Jorgensen and Garber, 1987Go; Talbert and Garber, 1994Go).

Derepression of the Scr gene causes the appearance of extra sex combs on the second and third legs of males. This derepression can be caused by gain-of-function alleles of Scr, such as ScrMsc (reviewed by Southworth and Kennison, 2002Go), or by loss-of-function mutations in Polycomb group genes, such as Pc3 or Pc4.

Several trithorax group genes (including brm, mor, osa, kis, skd and kto) were first identified as suppressors of the extra sex combs phenotype caused by derepression of Scr or as suppressors of the antenna to leg transformation caused by derepression of Antp in the Nasobemia (Ns) allele of Antp and (Kennison and Tamkun, 1988Go). Since we identified the tna gene on the basis of genetic interactions with brm, we first tested whether tna mutations could also suppress these two homeotic derepression phenotypes. We found that all tna mutations strongly suppress the extra sex combs phenotype caused by Pc3, Pc4 or ScrMsc (Table 1), but only weakly suppress the antenna to leg transformation caused by the AntpNs mutation (Table 2).


View this table:
[in this window]
[in a new window]
 
Table 1. Effects of tna mutations on Scr homeotic derepression phenotypes induced by Polycomb and Scr mutations

 

View this table:
[in this window]
[in a new window]
 
Table 2. Genetic interactions of tna1 with Antp chromosomal aberrations that alter Antp P2 promoter function

 

We also analyzed other Antp alleles affecting the expression from the P2 promoter. We have shown through this approach, that the P2 promoter expression is sensitive to brm and osa dosages (Vázquez et al., 1999Go). For example, brm and osa alleles enhance the held-out wings phenotypes caused by mutations affecting the Antp cis region located between the breakpoints of In(3R)AntpB and In(3R)AntpR aberrations. We tested for genetic interactions with all of the chromosome aberrations with breakpoints between the Antp P1 and P2 promoters that were previously used to test for interactions with brm and osa mutations (Vázquez et al., 1999Go). We found that tna1 (but not the P element tna alleles) enhances the held-out wings phenotype when in combination with In(3R)AntpB and In(3R)AntpR lines (Table 2). We did not observe interactions with any of the other aberrations (data not shown). Thus, we conclude that as with brm and osa, there is a tna-sensitive region mapping between the 5' breakpoints of In(3R)AntpB and In(3R)AntpR.

tna, tara, brm and osa interact genetically
Since we isolated tna and tara mutations because they enhance the held-out wings phenotype of brm, we also looked for genetic interactions with osa, which is also required for Antp P2 function (Vázquez et al., 1999Go). We tested the EMS-induced alleles, tna1, tara2 and tara20, and the P-element insertion alleles, tna3 and tara03881, for genetic interactions with brm, osa, and with each other (Table 3). We found that all three EMS-induced alleles interact strongly with brm2, but that the two P-element insertion alleles do not show strong genetic interactions. The P-element insertion alleles do show genetic interactions with brm2 in flies heterozygous for mutations in all three genes (brm, tna and tara). These results suggest that the P-insertion alleles are weaker than the EMS-induced alleles. We observed similar results previously with brm and osa (Vázquez et al., 1999Go). It is possible that the P-insertion mutations are not null alleles, but it is also possible that the EMS-induced alleles make mutant proteins that behave as dominant-negative mutations, still binding to interacting protein complexes and competing for binding of the wild-type alleles. All of the tna and tara mutations (except the P-insertion allele tna3) show strong genetic interactions with osa1 (Table 3). All three tara alleles interact strongly with tna1, with tara2 showing the strongest interactions.


View this table:
[in this window]
[in a new window]
 
Table 3. Genetic interactions of tna and tara with some trithorax group genes

 

tna interacts genetically with mutations in subunits of the Brm complex, the Mediator coactivator complex and with the Kismet SWI2/SNF2 family ATPase
Several members of the trithorax group proteins are subunits of chromatin remodeling or coactivator complexes. The Brm protein is the SWI2/SNF2-family ATPase subunit of the Brm chromatin remodeling complex (Tamkun et al., 1992Go). The trithorax group genes mor, osa and snr1 encode other subunits of the Brm complex (Brizuela and Kennison, 1997Go; Collins et al., 1999Go; Collins and Treisman, 2000Go; Crosby et al., 1999Go; Dingwall et al., 1995Go; Kal et al., 2000Go; Papoulas et al., 1998Go; Rozenblatt-Rosen et al., 1998Go; Treisman et al., 1997Go; Vázquez et al., 1999Go). The kismet (kis) gene encodes another trithorax group SWI2/SNF2-family member and is probably the ATPase subunit of a different chromatin remodeling complex (Daubresse et al., 1999Go; Therrien et al., 2000Go). It is thought that chromatin remodeling complexes may interact physically with the basal transcription machinery, with transcriptional coactivators or corepressors, or with proteins involved in histone modification, such as acetyl-transferases and deacetylases. One of the transcriptional coactivator complexes with which chromatin remodeling complexes might interact is the Mediator complex (Rachez and Freedman, 2001Go). The kohtalo (kto), skuld (skd), and Trap80 trithorax group genes encode subunits of the Mediator coactivator complex (Kennison and Tamkun, 1988Go; Boube et al., 2000Go; Treisman, 2001Go) (J. W. Southworth and J. A. K., unpublished results).

We tested whether tna mutations could genetically interact with mutations in the trithorax group genes encoding subunits of the Brm or Kis chromatin remodeling complexes or the Mediator coactivator complex to give the same held-out wings phenotype that we observed in the brm/+; osal/+ transheterozygous combinations (Vázquez et al., 1999Go). We also looked for genetic interactions between tna and several other trithorax group mutations that probably do not encode subunits of the Brm, Kis or Mediator complexes. The results are shown in Table 3. We found that tna1 shows strong genetic interactions with some mutations in the Brm complex (brm2, osa1, mor1 and mor2), with kis mutations (kis1 and kis13416), and with some mutations in the Mediator complex (skd2, skdlL7062 and skdrk760). There were no strong interactions with the snr10319 mutation in the Brm complex or the kto1 and Trap80s2956 mutations in the Mediator complex. We also observed no strong genetic interactions with ash21, trx1, trx00347, urd2 or sls1 trithorax group mutations (data not shown).

The zygotic and maternal functions of tna
Transheterozygous combinations among tna1, tna2, tna3 and tna4 alleles result in death at the third instar larval, pupal or pharate adult stages. Heteroallelic pharate individuals (dissected from the pupal cases) present transformations typical of loss-of-function of the Antennapedia and Bithorax complex homeotic genes (Table 4). In some cases, we observed partial haltere to wing transformation that results from loss of function for the Ultrabithorax (Ubx) homeotic gene (Fig. 1B). In 100% of the male flies we observed a strong reduction in the number of bristles in the male sex comb (the sex comb teeth) (Fig. 1C). This is the phenotype observed in partial loss of function in the Scr homeotic gene. Thus, we found that the tna zygotic function is required for proper expression of at least three homeotic genes, Antp, Ubx, and Scr.


View this table:
[in this window]
[in a new window]
 
Table 4. Homeotic transformations in pharate adult tna mutants

 

At least 50% of the tna mutant transheterozygotes (and 85% for some heteroallelic combinations) reach the pupa stage. This late stage of lethality suggests that maternal tna function might be sufficient for early development. To determine if this is so we generated homozygous germ cells for the tna1, tna2 and tna3 alleles. We used mitotic recombination and a transgene carrying the dominant female-sterile mutation ovoD1 (Chou et al., 1993Go) to produce embryos that lacked wild-type maternal tna functions. The same results were obtained with all three tna alleles and individuals representative of this experiment are shown in Fig. 2. When both maternal and zygotic tna functions are lacking, most individuals die as third instar larvae. For tna1, a few mutant individuals reach late developmental stages (Fig. 2A-C) if they lack both maternal and zygotic tna functions. These pharate individuals have fewer sex comb teeth in the male first legs (Fig. 2C) and show a haltere to wing transformation. In contrast, if only the zygotic function is lacking (and the maternal function is normal), the tna mutants die, predominantly as pupae. Individuals with no maternal tna can be completely rescued by a wild-type allele inherited from the father, giving rise to normal (and fertile) adults (Fig. 2D). Thus, we can conclude from these experiments that there is maternal tna contribution but the zygotic function is sufficient to reach late developmental stages, at least with the three alleles that we have tested.



View larger version (100K):
[in this window]
[in a new window]
 
Fig. 2. Phenotypes from maternal loss of tna function. Prepupa (A) and young pupa (B) that lack both maternal and zygotic tna functions. These individuals are tna1/Df(3L)lxd6 [tna-] and very few individuals reach the pharate adult stage without paternal rescue. One of the males that reached the pharate adult stage is shown in C. The first leg has a smaller sex comb with fewer sex comb teeth (inset in C) suggesting a reduction in Scr function. (D) A tna1/+ male that lacked maternal Tna function but was rescued by the paternally-inherited wild-type allele. The paternally rescued males have sex combs with normal numbers of sex comb teeth (inset in D).

 

Molecular analyses of tna
The closest tna+ insertion line, EP(3)0374 (Fig. 3A, open circle), has an EP element 6kb upstream of the tna- P-element insertion sites (Fig. 3A, full circles). Thus, at least part of the gene could be between the tna- P and tna+ EP element insertion sites.

To isolate genomic DNA from the tna region we selected P1 clone DS04626, which includes the genomic DNA flanking the sites of the tna2, tna3 and tna4 P-element insertions. We did a chromosomal walk from DS04626 and tested several genomic probes to identify putative tna transcripts (data not shown). The tna- insertion sites are within the first large intron of an annotated gene, CG7958. We will present the evidence below that CG7958 is tna, but we will first describe our efforts to characterize the structure and limits of the transcription unit (Fig. 3A). There is another gene (CG6418, which may encode an RNA-binding protein) about 1.8 kb downstream of the last exon of tna. The 3' end of the tna transcription unit should be within this 1.8 kb region. Although there is an annotated gene (CG12523) about 60 kb upstream of the predicted 5' exon of tna, the first predicted gene (CG6449) for which there is EST evidence is about 160 kb upstream of tna. Although the tna promoter should be somewhere within this large genomic region, we have not yet identified the transcriptional start site. There is one P-element insertion available within this large region, EP(3)0374, which is about 1.6 kb upstream of the predicted tna 5' exon. This P-element insertion complements the tna mutations, i.e., it is tna+.

Our northern analyses identified two transcripts (6.1 and 4.2 kb in size) within the tna region, which derive by alternative splicing (see below). To characterize the structure of these transcripts, we isolated cDNA clones from an embryonic library. ZAP1, which is the longest, is shown in Fig. 3A. We also characterized cDNA clones from the BDGP. The BDGP clone LD16921, which was isolated from a 0- to 24-hour mixed stage embryonic library, was particularly useful and is also shown in Fig. 3A. We were able to amplify several RT-PCR fragments using, as a 5' primer, an oligonucleotide with the 5'LD16921 sequence and as 3' primers olignoucleotides with the sequence of diverse translated tna exons (see Materials and Methods). One of these fragments, PCR1, is a cDNA made from poly(A)+ RNA purified from 3- 24-hour embryos. To corroborate its identity it was cloned and sequenced (Fig. 3A). There are at least two alternative untranslated 5' exons. The 5' exon of the embryonic LD16921 cDNA clone (and the adult cDNA clones RE42750 and RE27454) differs from the 5' exon found in several testis ESTs (AT07790, Fig. 3A). There is also alternative splicing within the translated exons (described in detail below).

The tonalli transcripts are differentially expressed during development
We performed northern blot analyses with RNA samples purified from different developmental stages using the ZAP1 cDNA clone (Fig. 3A) as a probe. This clone was isolated from a {lambda}ZAP embryonic library and overlaps all of the tna translated exons. We found two signals (6.1 and 4.2 kb) (Fig. 3B) that correspond to major tna transcripts. The 6.1 kb transcript was present at all stages, but its expression increased at the second larval instar and reached its maximum in the pupal stage. The 4.2 kb transcript was first detected in third instar larvae, but it was most abundant in the pupal and adult stages.

One of the Tna protein isoforms belongs to an SP-RING Zn-finger domain family
The northern and sequence analyses of tna predict at least two alternative transcripts (CT41698 and CT23982 from BDGP, release 2) (Fig. 3A, mRNAs) encoding products of 1109 and 610 residues (Fig. 4A). The long form of the protein (TnaA) is translated from 10 coding exons and may have three different amino termini (CG7958-RA, -RB and -RC, BDGP, release 3). The mRNA for the short form (TnaB) lacks exons 5-8 and part of exon 9. Both proteins have similar amino termini, which have two Gln-rich regions, but they do not share the same carboxyl termini; the alternative splicing of the short form generates a frameshift that changes the open reading frame after the alternative splice (Fig. 4A). This frameshift generates a stop codon in the middle of exon 9.

Exon 7 is present only in TnaA and encodes a possible bipartite nuclear location signal and an SP-RING (Siz/PIAS-RING) (Hochstrasser, 2001Go) putative zinc finger (Fig. 4, see below).

Blast analyses of the TnA protein sequence allowed us to identify four regions (Fig. 4A). Region I and IV (residues 1-494, and residues 799-1109, respectively) do not show homology to any other reported protein in any organism. Region I contains two blocks of glutamine residues.

Region III (647-798) includes the SP-RING finger (residues 718-760), which is present in several proteins from organisms ranging from yeast to human (Fig. 4B). One family of SP-RING finger proteins are the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family. One of the PIAS proteins, Miz1 (ARIP3/PIASX{alpha}) (Wu et al., 1997Go) has also been identified as a cofactor of homeotic gene function in mice. In the Drosophila genome, the only other SP-RING finger proteins are ZimpA and ZimpB (zinc finger-containing, Miz1, PIAS3-like) (Mohr and Boswell, 1999Go). The Zimp proteins belong to the PIAS family and are encoded by the Su(var)2-10 locus (Hari et al., 2001Go). Region III also includes the putative bipartite nuclear location signal (residues 668-686, Fig. 4C).

Although there are many proteins with similarities to Regions II (residues 495-646) or III (residues 647-798), there are only a few proteins that have similarity to both. These include proteins from the mouse (EST B6863016), Xenopus laevis (EST BJ075201), Gallus gallus (EST AJ396794), Caenorhabditis elegans (predicted protein NM_069604), Arabidopsis thaliana (AB011483), and human (KIAA1224 and KIAA1886). The two human proteins (retinoic acid-induced KIAA1224, EMBL AB033050, and KIAA1886, GenBank source AL136572) are 60% identical to TnaA in a region spanning almost 300 residues (from TnaA residues 495 to 798) (Fig. 4A,C). We searched the OMIM database (McKusick, 2000Go) but did not find any associated diseases attributed to mutations in the KIAA1224 (10q23.2) and KIAA1886 (7p15.1) genes to date. This family of proteins differs from the PIAS family in having Region II. We believe that the 300 amino acid domain spanning both Regions II and III identifies a new signature that we have named the XSPRING (eXtended SP-RING finger) domain (Fig. 4A,C).

The TnaB form shares regions I and II with TnaA, but has a unique carboxyl terminus. It does not show any additional homology to other known or predicted proteins.

The tna1 allele carries a mutation that affects only the TnaA protein product
The tna locus produces at least two different proteins, TnaA and TnaB. We are interested in characterizing the functions of each one of these forms and in dissecting more accurately whether the tna mutant phenotypes are caused by the failure of one or both Tna proteins. Individuals with the EMS-induced tna1 allele have different phenotypes from those resulting from the P-element insertion alleles (tna2, tna3 and tna4). tna1 is the allele that interacts strongest with several trithorax group mutations to reduce Antp P2 function and cause a held-out wings phenotype (Fig. 1A, Tables 2 and 3). The tna1 allele is also the allele that shows the strongest loss-of-function Ubx phenotype (Fig. 1B, Table 4) when heterozygous with the P-element insertion alleles or the deletions. Thus, we characterized molecularly the nature of the mutation in tna1 (see Materials and Methods). We purified DNA from tna1/Df(3L)vin2 individuals that survive until third instar larvae, PCR amplified, and sequenced the tna1 genomic region. We found only one change within the entire open reading frame of the tna1 mutant chromosome, a transition (C to T) that changes glutamine 566 (Fig. 4C) to a stop codon. This change would generate a truncated product at the end of exon 5 (Fig. 4A) that will resemble the amino-terminal region of the TnaB protein without its carboxyl terminus. These data suggest that tna1 should affect only TnaA, with TnaB still functional. The truncation of the TnaA protein may be responsible for the phenotypes we observe with the tna1 allele. The fact that this truncated form resembles the amino terminus of the wild-type TnaB, together with the tna1 genetic data, leads us to suggest that TnaB cannot substitute for TnaA. As TnaB mRNA appears for the first time late in development, the role of TnaB could be to negatively modulate the TnaA function.


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To study the mechanism of action of the Brm complex on different homeotic genes, we have characterized genes that interact with Brm in regulating the expression of the Antp P2 promoter in the imaginal wing disc. Reduced expression of the Antp P2 promoter in the imaginal wing disc causes flies to extend their wings out from the body (a held-out wings phenotype). While flies heterozygous for a null brm allele usually hold their wings properly, they often extend their wings when also heterozygous for brm-interacting mutations. We have previously used this genetic screen to isolate mutations in the osa gene (Vázquez et al., 1999Go), which encodes a subunit of the Brm chromatin remodeling complex. Here we report the isolation of mutations in two additional brm-interacting genes, tara and tna. tara is pleiotropic and has been identified in several other genetic screens (e.g. Fernandez-Funez et al., 2000Go). Of particular importance to our own results was the recent identification of tara as a dominant suppressor of the extra-sex-combs phenotype displayed by loss-of-function mutations in the Polycomb group gene polyhomeotic (Fauvarque et al., 2001Go) and its modification of phenotypes associated with ectopic expression of the homeotic gene proboscipedia (pb) (Calgaro et al., 2002Go). The published results, as well as the results presented here, suggest that tara and tna are both members of the trithorax group of homeotic gene regulators.

tara encodes twin proteins, Tara-{alpha} and Tara-ß, which have a cyclinA-binding motif (also present in the cell cycle regulatory transcription factors E2F1-3), a SERTA domain [which is the largest conserved region among TRIP-Br (transcriptional regulator interacting with the PHD-bromodomain) proteins] and a PHD-bromo interaction domain (Calgaro et al., 2002Go). Trip-Br1/p34SEI-1 is a Tara-related protein in mice that is a cyclin-dependent kinase regulator (Sugimoto et al., 1999Go) and a transcriptional regulator. Trip-Br1/p34SEI-1 can interact with PHD and/or bromodomains (Hsu et al., 2001Go). It has been proposed that this family of proteins could link the cell cycle with chromatin remodeling (Sugimoto et al., 1999Go).

Individuals with low dosages of tara (Calgaro et al., 2002Go) or tna (this work) have a held-out wings phenotype. As we have isolated tara mutations because they interact genetically with brm mutations, the simplest hypothesis is that Tara proteins physically interact with Brm proteins through the Brm bromodomain.

One Tna protein isoform is related to the PIAS family
Analysis of tna ESTs shows that there are at least two different 5' ends (represented by RE42750 and AT07790), suggesting that the tna gene may have alternative promoters. The tara gene also appears to have two promoters (Calgaro et al., 2002Go). In addition to the possibility of two promoters, alternative splicing within the tna open reading frame gives rise to at least two different protein isoforms, TnaA and TnaB.

The TnaA isoform has an SP-RING (Siz/PIAS RING) finger (Saurin et al., 1996Go), which is present in the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of proteins. PIAS proteins are co-regulators of many gene-specific transcription factors. For example, PIAS proteins co-repress STAT factors (which act as signal transducers of cytokine receptors) to transcriptionally activate specific target genes (Chung et al., 1997Go; Liu et al., 1998Go). PIAS proteins also coactivate steroid receptor-dependent transcription (Kotaja et al., 2000Go; Tan et al., 2000Go). The PIAS protein Miz1/ARIP3/PIASX{alpha} possesses intrinsic transcriptional-activating function (Kotaja et al., 2000Go), interacts with the homeobox protein Msx2 to enhance its affinity for DNA (Wu et al., 1997Go) and is an androgen receptor (AR)-interacting protein (ARIP). The Drosophila zimp (zinc finger-containing, Miz1, PIAS3-like) gene encodes proteins with similarity to the Miz1/PIAS3 protein (Mohr and Boswell, 1999Go). The zimp gene is also known as Su(var)2-10 (Hari et al., 2001Go). In addition to the SP-RING zinc finger domain, the Su(var)2-10 proteins have a putative DNA-binding domain (the SAP domain) that is found in diverse nuclear proteins. The Su(var)2-10 proteins regulate chromosome structure and chromosome condensation, and function in interphase nuclei (Hari et al., 2001Go). Recently a SUMO-protein ligase (E3) activity has been found in several SP-RING finger proteins (Johnson and Gupta, 2001Go; Sachdev et al., 2001Go) (reviewed by Hochstrasser, 2001Go).

tna and a role for sumoylation in regulating homeotic gene expression
SUMO (small ubiquitin-related modifier) is a ubiquitin-like protein (UBL) that is covalently attached to other proteins in a manner analogous to that of ubiquitin (reviewed by Muller et al., 2001Go). Conjugation of SUMO-1 to all protein targets requires the E1-activating heterodimer Aos1/Uba2 and the single E2-conjugating Ubc9 enzyme. The target specificity is conferred by the SUMO E3 ligases. There are at least two types of SUMO E3 ligases that are structurally unrelated. The first type is represented by the PIAS family of SP-RING finger proteins. The second type is represented by RanBP2, a nuclear pore complex protein. TnaA has an SP-RING finger within the larger XSPRING domain (Fig. 4B). The XSPRING domain is present in a new group of human, mouse and Arabidopsis proteins and may be the signature for a new subgroup of SUMO E3 ligases within the PIAS family.

Although the role of sumoylation is not clear, it has been suggested that sumoylation could be an address tag for protein targeting. Most of the identified substrates of sumoylation are nuclear proteins, and the sumoylated forms are often found in specific subnuclear protein complexes. Preferential accumulation sites for sumoylated proteins are the PML nuclear bodies. PML, a protein found in PML nuclear bodies, is a RING-finger protein. Another core component of PML nuclear bodies is Sp100, a protein that interacts with HP1 and HMG1/2 families and a major cellular substrate for sumoylation. In vitro, sumoylated Sp100 has a higher affinity for the HP1 protein (Seeler et al., 2001Go). Relocalization of proteins to nuclear bodies after sumoylation can modulate transcriptional activity (Fogal et al., 2000Go; Ishov et al., 1999Go; Lehembre et al., 2001Go; Li et al., 2000Go; Schmidt and Muller, 2002Go). It has been suggested that nuclear bodies might stimulate SUMO conjugation, and that proteins transiently associated with nuclear bodies include SUMO targets (Muller et al., 2001Go). Thus, sumoylation can modulate the interaction of transcription factors with transcriptional corregulators. In Drosophila, the transcriptional repressor Tramtrack 69 protein (Ttk69), which inhibits neuronal differentiation, has been identified as a SUMO substrate (Lehembre et al., 2000Go). The Dorsal protein also undergoes sumoylation, which facilitates its nuclear import (Bhaskar et al., 2000Go).

The SUMO ligation target consensus sequence is {psi}KxE (where {psi} is an aliphatic residue) surrounding the substrate lysine(s) that is sumoylated. Although this consensus sequence is short, all of the proteins encoded by the trithorax groups genes that interact genetically with tna (including TnaA itself) (Table 3) have one or more blocks of this consensus sequence (L. G. and M. V., unpublished results). However, some trithorax group genes that do not interact with tna, such as trithorax (trx), also encode proteins with the `sumoylation consensus'. Sumoylation of the HDAC4 deacetylase is catalysed by the RanBP2 SUMO E3 ligase. While HDAC4 has several `sumoylation consensus' sequences, only one functions in vitro and in vivo (Kirsh et al., 2002Go). The possibility that subunits of the Brm and/or Kismet complexes might be targets for sumoylation opens the window for a new level of regulation of the activity of chromatin remodeling complexes. This level of regulation could involve the modification of their subnuclear localization within the nucleus, although mutation of the SUMO acceptor site in HDAC4 did not change its subcellular distribution (Kirsh et al., 2002Go). Alternatively, is that sumoylation could target the homeotic function itself or its cofactors.

Another possible role for sumoylation is as an antagonist of ubiquitylation. Ubiquitylation is a key regulator of transcription (reviewed by Conaway et al., 2002Go) and it has been suggested that sumoylation could be an inhibitor of ubiquitylation. The RING (reviewed by Jackson et al., 2000Go) and PHD (Lu et al., 2002Go) fingers have been described in proteins that have E3 ubiquitin ligase activities. In that sense it is intriguing that Trip-Br1 (the tara homolog in mice) (Hsu et al., 2001Go) was identified because it binds the PHD-bromodomain of Krip1/TIF1ß which also has an RBCC (RING finger-B boxes-coiled coil) RING finger (Saurin et al., 1996Go). Krip1/TIF1ß has a dual role because it has been described as a corepressor of a subset of Krüppel-type zinc finger proteins (Witzgall et al., 1994Go) and as a hormone-dependent coactivator that interacts with several nuclear hormone receptors (Chang et al., 1998Go; Le Douarin et al., 1996Go). Mutations in a ubiquitin-conjugating enzyme (UbcD1) have been shown to affect homeotic gene silencing (Fauvarque et al., 2001Go). Since tna mutations affect homeotic gene activation, antagonism between the ubiquitylation and sumoylation post-translational modifications may play a key role in homeotic gene regulation. Antagonism of ubiquitylation and targeting nuclear sublocalization are not mutually exclusive roles for sumoylation, and it is possible that both will be found to have roles in regulating the functions of chromatin remodeling and/or transcriptional co-activator complexes.


    ACKNOWLEDGMENTS
 
We thank Y. Hiromi for his advice on the plasmid rescue, C. Thummel and P. Rorth for providing P1 clones and EP lines, and the Bloomington Drosophila Stock Center for providing stocks. This work was supported by funds from CONACyT grant No. 31781-N and DGAPA grant IN-200799 to M. V. and Howard Hughes Medical Institute grant 55003712 to M. Z.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A., Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A., Galle, R. F. et al. (2000). The genome sequence of Drosophila melanogaster. Science 287,2185 -2195.[Abstract/Free Full Text]
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25,3389 -3402.[Abstract/Free Full Text]
Balciunas, D., Galman, C., Ronne, H. and Bhorklund, S. (1999). The Med1 subunit of the yeast mediator complex is involved in both transcriptional activation and repression. Proc. Natl. Acad. Sci. USA 96,376 -381.[Abstract/Free Full Text]
Bhaskar, V., Valentine, S. A. and Courey, A. (2000). A functional interaction between dorsal and components of the Smt3 conjugation machinery. J. Biol. Chem. 275,4033 -4040.[Abstract/Free Full Text]
Boube, M., Faucher, C., Joulia, L., Cribbs, D. L. and Bourbon, H. M. (2000). Drosophila homologs of transcriptional mediator complex subunits are required for adult cell and segment identity specification. Genes Dev. 14,2906 -2917.[Abstract/Free Full Text]
Brizuela, B. J., Elfring, L., Ballard, J., Tamkun, J. W. and Kennison, J. A. (1994). Genetic analysis of the brahma gene of Drosophila melanogaster and polytene chromosome subdivisions 72AB. Genetics 137,803 -813.[Abstract]
Brizuela, B. J. and Kennison, J. A. (1997). The Drosophila homeotic gene moira regulates expression of engrailed and HOM genes in imaginal tissues. Mech. Dev. 65,209 -220.[CrossRef][Medline]
Calgaro, S., Boube, M., Cribbs, D. L. and Bourbon, H. (2002). The Drosophila gene taranis encodes a novel trithorax group member potentially linked to the cell cycle regulatory apparatus. Genetics 160,547 -560.[Abstract/Free Full Text]
Chang, C.-J., Chen, T.-L. and Lee, S.-C. (1998). Coactivator TIF1ß interacts with transcription factor C/EBPb and glucocorticoid receptor to induce {alpha}1-acid glycoprotein gene expression. Mol. Cell. Biol. 18,5880 -5887.[Abstract/Free Full Text]
Chou, T. B., Noll, E. and Perrimon, N. (1993). Autosomal P[ovoD1] dominant female-sterile insertions in Drosophila and their use in generating germ-line chimeras. Development 119,1359 -1369.[Abstract]
Chung, C. D., Liao, J., Liu, B., Rao, X., Jay, P., Bertha, P. and Shuai, K. (1997). Specific inhibition of Stat3 signal transduction by PIAS3. Science 278,1803 -1805.[Abstract/Free Full Text]
Collins, R. T., Furukawa, T., Tanese, N. and Treisman, J. E. (1999). Osa associates with the Brahma chromatin remodeling complex and promotes the activation of some target genes. EMBO J. 18,7029 -7040.[CrossRef][Medline]
Collins, R. T. and Treisman, J. E. (2000). Osa-containing Brahma chromatin remodeling complexes are required for the repression of Wingless target genes. Genes Dev. 14,3140 -3152.[Abstract/Free Full Text]
Conaway, R. C., Brower, C. S. and Conaway, J. W. (2002). Emerging roles of ubiquitin in transcription regulation. Science 296,1254 -1258.[Abstract/Free Full Text]


Cosma, M. P., Tanaka, T. and Nasmyth, K. (1999). Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter. Cell 97,299 -311.[CrossRef][Medline]
Crosby, M. A., Miller, C., Alon, T., Watson, K. L., Verrijzer, C. P., Goldman-Levi, R. and Zak, N. B. (1999). The trithorax group gene moira encodes a Brahma-associated putative chromatin-remodeling factor in Drosophila melanogaster. Mol. Cell. Biol. 19,1159 -1170.[Abstract/Free Full Text]
Daubresse, G., Deuring, R., Moore, L., Papoulas, O., Zakrajsek, I., Waldrip, W. R., Scott, M. P., Kennison, J. A. and Tamkun, J. W. (1999). The Drosophila kismet gene is related to chromatin-remodeling factors and is required for both segmentation and segment identity. Development 126,1175 -1187.[Abstract]
Dingwall, A. K., Beek, S. J., McCallum, C. M., Tamkun, J. W., Kalpana, G. V., Goff, S. P. and Scott, M. P. (1995). The Drosophila snr1 and Brm proteins are related to yeast SWI/SNF proteins and are components of a large protein complex. Mol. Biol. Cell 6,777 -791.[Abstract]
Eisen, J. A., Sweder, K. S. and Hanawalt, P. C. (1995). Evolution of the SNF2 family of proteins: subfamilies with distinct sequences and functions. Nucleic Acids Res. 23,2715 -2723.[Abstract/Free Full Text]
Fauvarque, M. O., Laurenti, P., Boivin, A., Bloyer, S., Griffin-Shea, R., Bourbon, H. M. and Dura, J. M. (2001). Dominant modifiers of the polyhomeotic extra-sex-combs phenotype induced by marked P element insertional mutagenesis in Drosophila. Genet. Res. 78,137 -148.[Medline]
Felsenfeld, A. L. and Kennison, J. A. (1995). Positional signaling by hedgehog in Drosophila imaginal disc development. Development 121, 1-10.[Abstract]
Fernandez-Funez, P., Niño-Rosales, M. L., de Gouyon, B., She, W. C., Luchak, J. M., Martinez, P., Turiegano, E., Benito, J., Capovilla, M., Skinner, P. J. et al. (2000). Identification of genes that modifiy ataxin-1-induced neurodegeneration. Nature 408,101 -106.[CrossRef][Medline]
Flaus, A. and Owen-Hughes, T. (2001). Mechanisms for ATP-dependent chromatin remodelling. Curr. Opin. Genet. Dev. 11,148 -154.[CrossRef][Medline]
Fogal, V., Gostissa, M., Sandy, P., Zacchi, P., Sternsdorf, T., Jensen, K., Pandolfi, P. P., Will, H., Schneider, C. and del Sal, G. (2000). Regulation of p53 activity in nuclear bodies by a specific PML isoform. EMBO J. 19,6185 -6195.[CrossRef][Medline]
Francis, N. J. and Kingston, R. E. (2001). Mechanisms of transcriptional memory. Nat. Rev. Mol. Cell. Biol. 2,409 -421.[CrossRef][Medline]
Gellon, G. and McGinnis, W. (1998). Shaping animal body plans in development and evolution by modulation of Hox expression patterns. BioEssays 20,116 -125.[CrossRef][Medline]
Hari, K. L., Cook, K. R. and Karpen, G. H. (2001). The Drosophila Su(var)2-10 locus regulates chromosome structure and function and encodes a member of the PIAS protein family. Genes Dev. 15,1334 -1348.[Abstract/Free Full Text]
Hassan, A. H., Neely, K. E. and Workman, J. L. (2001). Histone acetyltransferase complexes stabilize SWI/SNF binding to promoter nucleosomes. Cell 104,817 -827.[CrossRef][Medline]
Hochstrasser, M. (2001). SP-RING for SUMO: new functions bloom for a ubiquitin-like protein. Cell 107, 5-8.[CrossRef][Medline]
Hsu, S. I. H., Yang, C. M., Sim, K. G., Hentschel, D. M., O'Leary, E. and Bonventre, J. V. (2001). TRIP-Br: a novel family of PHD zinc-finger- and bromodomain-interacting proteins that regulate the transcriptional activity of E2F-1/DP-1. EMBO J. 20,2273 -2285.[CrossRef][Medline]
Ishov, A. M., Sotnikov, A. G., Negorev, D., Vladimirova, O. V., Neff, N., Kamitani, T., Yeh, E. T., Strauss, J. F. r. and Maul, G. G. (1999). PML is critical for ND10 formation and recruits the PML-interacting protein Daxx to this nuclear structure when modified by SUMO-1. J. Cell Biol. 147,221 -234.[Abstract/Free Full Text]
Jackson, P. K., Eldridge, A. G., Freed, E., Furstenthal, L., Hsu, J. Y., Kaiser, B. K. and Reimann, J. D. (2000). The lore of the RINGs: substrate recognition and catalysis by ubiquitin ligases. Tr. Cell Biol. 10,429 -439.[CrossRef][Medline]
Johnson, E. S. and Gupta, A. A. (2001). An E3-like factor that promotes SUMO conjugation to the yeast septins. Cell 106,735 -744.[CrossRef][Medline]
Jorgensen, E. M. and Garber, R. L. (1987). Function and misfunction of the two promoters of the Drosophila Antennapedia gene. Genes Dev. 1, 544-555.[Abstract/Free Full Text]
Kal, A. J., Mahmoudi, T., Zak, N. B. and Verrijzer, C. P. (2000). The Drosophila Brahma complex is an essential coactivator for the trithorax group protein zeste. Genes Dev. 14,1058 -1071.[Abstract/Free Full Text]
Kennison, J. A. (1995). The Polycomb and trithorax group proteins of Drosophila: trans-regulators of homeotic gene function. Annu. Rev. Genet. 29,289 -303.[CrossRef][Medline]
Kennison, J. A. and Russell, M. A. (1987). Dosage-dependent modifiers of homeotic mutations in Drosophila melanogaster. Genetics 116,75 -86.[Abstract/Free Full Text]
Kennison, J. A. and Tamkun, J. W. (1988). Dosage-dependent modifiers of Polycomb and Antennapedia mutations in Drosophila. Proc. Natl. Acad. Sci. USA 85,8136 -8140.[Abstract/Free Full Text]
Kirsh, O., Seeler, J. S., Pichler, A., Gast, A., Muller, S., Miska, E., Mathieu, M., Harel-Bellan, A., Kouzarides, T., Melchior, F. et al. (2002). The SUMO E3 ligase RanBP2 promotes modification of the HDAC4 deacetylase. EMBO J. 21,2682 -2691.[CrossRef][Medline]
Klochendler-Yeivin, A., Muchardt, C. and Yaniv, M. (2002). SWI/SNF chromatin remodeling and cancer. Curr. Opin. Genet. Dev. 12,73 -79.[CrossRef][Medline]
Kotaja, N., Aittomaki, S., Silvennoinen, O., Palvimo, J. J. and Janne, O. A. (2000). ARIP3 (androgen receptor-interacting protein 3) and other PIAS (protein inhibitor of activated STAT) proteins differ in their ability to modulate steroid receptor-dependent transcriptional activation. Mol. Endocrinol. 14,1986 -2000.[Abstract/Free Full Text]
Le Douarin, B., Nielsen, A. L., Garnier, J.-M., Ichinose, H., Jeanmougin, F., Losson, R. and Chambon, P. (1996). A possible involvement of TIF1{alpha} and TIF1ß in the epigenetic control of transcription by nuclear receptors. EMBO J. 15,6701 -6715.[Medline]
Lehembre, F., Badenhorst, P., Muller, S., Travers, A., Schweisguth, F. and Dejean, A. (2000). Covalent modification of the transcriptional repressor tramtrack by the ubiquitin-related protein Smt3 in Drosophila flies. Mol. Cell. Biol. 20,1072 -1082.[Abstract/Free Full Text]
Lehembre, F., Muller, S., Pandolfi, P. P. and Dejean, A. (2001). Regulation of Pax3 transcriptional activity by SUMO-1-modified PML. Oncogene 20, 1-9.[CrossRef][Medline]
Li, H., Leo, C., Zhu, J., Wu, X., O'Neil, J., Park, E. J. and Chen, J. D. (2000). Secuestration and inhibition of Daxx-mediated transcriptional repression by PML. Mol. Cell. Biol. 20,1784 -1796.[Abstract/Free Full Text]
Lindsley, D. L. and Zimm, G. G. (1992).The genome of Drosophila melanogaster . San Diego, Calif.: Academic Press.
Liu, B., Liao, J., Rao, X., Kushner, S. A., Chung, C. D., Chang, D. D. and Shuai, K. (1998). Inhibition of Stat1-mediated gene activation by PIAS1. Proc. Natl. Acad. Sci. USA 95,10626 -10631.[Abstract/Free Full Text]
Lu, Z., Xu, S., Joazeiro, C., Cobb, M. H. and Hunter, T. (2002). The PHD domain of MEKK1 acts as an E3 ubiquitin-ligase and mediates ubiquitination and degradation of ERK1/2. Mol. Cell 9,945 -956.[CrossRef][Medline]
McKusick, V. A. (2000). Online Mendelian Inheritance in Man, OMIMTM. (ed. McKusick-Nathans) Institute for Genetic Medicine, Johns Hopkins University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, MD).
Mohr, S. E. and Boswell, R. E. (1999). Zimp encodes a homologue of mouse Miz1 and PIAS3 and is an essential gene in Drosophila melanogaster. Gene 229,109 -118.[CrossRef][Medline]
Muller, S., Hoege, C., Pyrowolakis, G. and Jentsch, S. (2001). SUMO, ubiquitin mysterious cousin. Nat. Rev. Mol. Cell Biol. 2,202 -210.[CrossRef][Medline]
Papoulas, O., Beek, S. J., Moseley, S. L., McCallum, C. M., Sarte, M., Shearn, A. and Tamkun, J. W. (1998). The Drosophila trithorax group proteins BRM, ASH1 and ASH2 are subunits of distinct protein complexes. Development 125,3955 -3966.[Abstract]
Park, J. M., Gim, B. S., Kim, J. M., Yoon, J. H., Kim, H. S., Kang, J. G. and Kim, Y. J. (2001). Drosophila Mediator complex is broadly utilized by diverse gene-specific transcription factors at different types of core promoters. Mol. Cell. Biol. 21,2312 -2323.[Abstract/Free Full Text]
Rachez, C. and Freedman, L. P. (2001). Mediator complexes and transcription. Curr. Opin. Cell Biol. 13,274 -280.[CrossRef][Medline]
Rorth, P., Szabo, K., Bailey, A., Laverty, T., Rehm, J., Rubin, G. M., Wigmann, K., Milan, M., Benes, V., Ansorge, W. et al. (1998). Systematic gain-of-function genetics in Drosophila.Development 125,1049 -1057.[Abstract]
Rozenblatt-Rosen, O., Rozobskaia, T., Burakov, D., Sedkov, Y., Tillib, S., Blechman, J., Nakamura, T., Croce, C. M., Mazo, A. and Canaani, E. (1998). The C-terminal SET domains of ALL-1 and Trithorax interact with Ini1 and Snr1 proteins, components of the SWI/SNF complex. Proc. Natl. Acad. Sci. USA,4152 -4157.
Sachdev, S., Bruhn, L., Sieber, H., Pichler, A., Melchior, F. and Grosschedl, R. (2001). PIASy, a nuclear matrix-associated SUMO E3 ligase, represses LEF1 activity by sequestration into nuclear bodies. Genes Dev. 15,3088 -3103.[Abstract/Free Full Text]
Saurin, A. J., Borden, K. L. B., Boddy, M. N. and Freemont, P. S. (1996). Does this have a familiar RING? Tr. Biochem. Sci. 21,208 -214.
Schmidt, D. and Muller, S. (2002). Members of the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53 activity. Proc. Natl. Acad. Sci., USA 99,2872 -2877.[Abstract/Free Full Text]
Seeler, J. S., Marchio, A., Losson, R., Desterro, J. M., Hay, R. T., Chambon, P. and Dejean, A. (2001). Common properties of nuclear body protein SP100 and TIF1 alpha chromatin factor: role of SUMO modification. Mol. Cell. Biol. 21,3314 -3324.[Abstract/Free Full Text]
Simon, J. A. and Tamkun, J. W. (2002). Programming off and on states in chromatin: mechanisms of Polycomb and trithorax group complexes. Curr. Opin. Genet. Dev. 12,210 -218.[CrossRef][Medline]
Song, W. and Carlson, M. (1998). Srb/mediator proteins interact functionally and physically with transcriptional repressor Sfl1. EMBO J. 17,5757 -5765.[CrossRef][Medline]
Southworth, J. W. and Kennison, J. A. (2002). Transvection and silencing of the Sex combs reduced homeotic gene of Drosophila melanogaster. Genetics 161,733 -746.[Abstract/Free Full Text]
Staehling-Hampton, K., Ciampa, P. J., Brook, A. and Dyson, N. (1999). A genetic screen for modifiers of E2F in Drosophila melanogaster. Genetics 153,275 -287.[Abstract/Free Full Text]
Sugimoto, M., Nakamura, T., Ohtani, N., Hampson, L., Hampson, I. N., Shimamoto, A., Furuichi, Y., Okumura, K., Niwa, S., Taya, Y. et al. (1999). Regulation of CDK4 activity by a novel CDK4-binding protein, p34(SEI-1). Genes Dev. 13,3027 -3033.[Abstract/Free Full Text]
Sullivan, W., Ashburner, M. and Hawley, R. S. (2000). Drosophila Protocols. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Sun, X., Zhang, Y., Cho, H., Rickert, P., Lees, E., Lane, W. and Reinberg, D. (1998). NAT, a human complex containing Srb polypeptides that functions as a negative regulator of activated transcription. Mol. Cell 2, 213-222.[CrossRef][Medline]
Talbert, P. B. and Garber, R. L. (1994). The Drosophila homeotic mutation Nasobemia (AntpNs) and its revertants: and analysis of mutational reversion. Genetics 138,709 -720.[Abstract]
Tamkun, J. W., Deuring, R., Scott, M. P., Kissinger, M., Pattatuci, A. M., Kaufman, T. C. and Kennison, J. A. (1992). brahma: a regulator of Drosophila homeotic genes structurally related to the yeast transcriptional activator SNF2/SWI2. Cell 68,561 -572.[CrossRef][Medline]
Tan, J., Hall, S. H., Hamil, K. G., Grossman, G., Petrusz, P., Liao, J., Shuai, K. and French, F. S. (2000). Protein Inhibitor of Activated STAT-1 (Signal Transducer and Activator of Transcription-1) is a nuclear receptor coregulator expressed in human testis. Mol. Endocrinol. 14,14 -26.[Abstract/Free Full Text]
Therrien, M., Morrison, D. K., Wong, A. M. and Rubin, G. M. (2000). A genetic screen for modifiers of a kinase suppressor of Ras-dependent rough eye phenotype in Drosophila.Genetics 156,1231 -1242.[Abstract/Free Full Text]
Treisman, J. (2001). Drosophila homologues of the transcriptional coactivation complex subunits TRAP240 and TRAP230 are required for identical processes in eye-antennal disc development. Development 128,603 -615.[Abstract]
Treisman, J. E., Luk, A., Rubin, G. M. and Heberlein, U. (1997). eyelid antagonizes wingless signaling during Drosophila development and has homology to the Bright family of DNA-binding proteins. Genes Dev. 11,1949 -1962.[Abstract/Free Full Text]
Vázquez, M., Moore, L. and Kennison, J. A. (1999). The trithorax-group gene osa encodes an ARID-domain protein that interacts with the Brahma chromatin-remodeling factor to regulate transcription. Development 126,733 -742.[Abstract]
Vignali, M., Hassan, A. H., Neely, K. E. and Workman, J. L. (2000). ATP-dependent chromatin remodeling complexes. Mol. Cell. Biol. 20,1899 -1910.[Free Full Text]
Witzgall, R., O'Leary, E., Leaf, E., Önalde, D. and Bonventre, J. V. (1994). The Krüppel-associated box-A (KRAB-A) domain of zinc finger proteins mediates transcriptional repression. Proc. Natl. Acad. Sci. USA 91,4514 -4518.[Abstract/Free Full Text]
Wu, L., Wu, H., Sangiorgi, F., Wu, N., Bell, J. R., Lyons, G. E. and Maxson, R. (1997). Miz1, a novel zinc finger transcription factor that interacts with Msx2 and enhances its affinity for DNA. Mech. Dev. 65,3 -17.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
GeneticsHome page
M. Vazquez, M. T. Cooper, M. Zurita, and J. A. Kennison
{gamma}Tub23C Interacts Genetically With Brahma Chromatin-Remodeling Complexes in Drosophila melanogaster
Genetics, October 1, 2008; 180(2): 835 - 843.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
U. Yazdani, Z. Huang, and J. R. Terman
The Glucose Transporter (GLUT4) Enhancer Factor Is Required for Normal Wing Positioning in Drosophila
Genetics, February 1, 2008; 178(2): 919 - 929.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Beliakoff, J. Lee, H. Ueno, A. Aiyer, I. L. Weissman, G. S. Barsh, R. D. Cardiff, and Z. Sun
The PIAS-Like Protein Zimp10 Is Essential for Embryonic Viability and Proper Vascular Development
Mol. Cell. Biol., January 1, 2008; 28(1): 282 - 292.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Lee, J. Beliakoff, and Z. Sun
The novel PIAS-like protein hZimp10 is a transcriptional co-activator of the p53 tumor suppressor
Nucleic Acids Res., July 26, 2007; 35(13): 4523 - 4534.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Li, G. Thyssen, J. Beliakoff, and Z. Sun
The Novel PIAS-like Protein hZimp10 Enhances Smad Transcriptional Activity
J. Biol. Chem., August 18, 2006; 281(33): 23748 - 23756.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C.-Y. Huang, J. Beliakoff, X. Li, J. Lee, X. Li, M. Sharma, B. Lim, and Z. Sun
hZimp7, a Novel PIAS-Like Protein, Enhances Androgen Receptor-Mediated Transcription and Interacts with SWI/SNF-Like BAF Complexes
Mol. Endocrinol., December 1, 2005; 19(12): 2915 - 2929.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
F. Janody, J. D. Lee, N. Jahren, D. J. Hazelett, A. Benlali, G. I. Miura, I. Draskovic, and J. E. Treisman
A Mosaic Genetic Screen Reveals Distinct Roles for trithorax and Polycomb Group Genes in Drosophila Eye Development
Genetics, January 1, 2004; 166(1): 187 - 200.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
F. Janody, Z. Martirosyan, A. Benlali, and J. E. Treisman
Two subunits of the Drosophila mediator complex act together to control cell affinity
Development, August 15, 2003; 130(16): 3691 - 3701.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gutiérrez, L.
Right arrow Articles by Vázquez, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gutiérrez, L.
Right arrow Articles by Vázquez, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?