|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 13 August 2003
doi: 10.1242/dev.00681
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



Molecular Cell and Developmental Biology, and The Institute for Cellular and Molecular Biology, The University of Texas at Austin, Austin, TX 78712, USA
Author for correspondence (e-mail:
lloyd{at}uts.cc.utexas.edu)
Accepted 20 June 2003
| SUMMARY |
|---|
|
|
|---|
Key words: bHLH, TTG1, Glabra3, Arabidopsis thaliana
| Introduction |
|---|
|
|
|---|
Mutations in TTG1 are suppressed by the expression of the maize
bHLH transcription factor, R (Lloyd et
al., 1992
; Galway et al.,
1994
). We recently showed that the GLABRA3 (GL3)
locus encodes an R-like bHLH protein and that overexpressing the GL3
genomic copy in the ttg1 mutant weakly suppresses the trichome defect
(Payne et al., 2000
). We also
showed that GL3 interacts with GL1 in plants and GL3 interacts with GL1 and
TTG1 in yeast two-hybrid studies, but that TTG1 and GL1 do not interact in
yeast. Thus, GL3 appears to supply an R-like activity in the trichome
development pathway and is probably a physical link between the two cell-fate
regulators, TTG1 and GL1. Paradoxically, gl3 mutants are not
glabrous. The most severe allele only produces a modest reduction in trichome
initiation. Furthermore, gl3 mutants do not appear to be defective in
any of the other TTG1-dependent pathways. Recently the TRANSPARENT
TESTA8 (TT8) locus was identified as encoding a bHLH protein
(Nesi et al., 2000
). Thus part
of the R-like bHLH activity that is required for seed coat pigmentation is
supplied by TT8. TT8 mutations confer a transparent testa because of
phenylpropanoid pigment defects leading to the absence of condensed tannins in
the seed coat. However, similar to the incomplete affects of gl3
mutations on trichome initiation, tt8 mutant plants produce
substantial amounts of the phenylpropanoid pigment, anthocyanin. It appeared
that either the R-like activities supplied by GL3 and TT8 enhanced, but were
not absolutely required for the activation of trichome and anthocyanin
production, or there were one or more partially functionally redundant loci
responsible for the remainder of the bHLH protein requirement in these
pathways. In addition, no bHLH locus had been identified in the
position-dependent cell-fate pathway at work in root hair hairless cell file
differentiation, or in the seed coat differentiation pathway that leads to
mucilage production, both of which are also controlled by TTG1
(Galway et al., 1994
;
Koornneef, 1981
).
In order to test the redundancy hypothesis, we performed a genetic enhancer
screen in the gl3-1 background. A novel unlinked locus was
identified, that gave totally glabrous plants when combined with the
gl3-1 mutation. Because our previous work showed that overexpression
of the bHLH locus, At1G63650, could suppress ttg1 mutations
(Payne et al., 2000
), we
focused on this locus as potentially redundant with GL3. We have
identified this ENHANCER OF GLABRA3 (EGL3) locus as the
bHLH-encoding gene, At1G63650. EGL3 is required along with
GL3 for trichome initiation. In addition, the double mutant was found
to be ttg1-like, having altered root hair positioning, reduced
mucilage production and reduced anthocyanin production. Furthermore, the
triple bHLH mutant, gl3-1 egl3-1 tt8-1, is essentially phenotypically
indistinguishable from the most severe ttg1 mutations. These results
explain why ectopic expression of the maize anthocyanin-specific bHLH
regulator, R, suppresses all of the defects of the ttg1 mutant and
define roles for a set of three, partially functionally redundant, endogenous
bHLH proteins in all of the TTG1-dependent pathways of
Arabidopsis.
| Materials and methods |
|---|
|
|
|---|
Arabidopsis strains
All strains were in the Landsberg erecta (Ler) ecotype
unless noted otherwise. The gl3-1, gl3-2 and ttg1-1 strains
have been described previously (Payne et
al., 2000
; Walker et al.,
1999
). The gl3-1 egl3-1 and gl3-1 egl3-2 strains
were created by EMS mutagenesis of the gl3-1 mutant background. 6,000
gl3-1 seeds were treated with 0.3% EMS according to the method of
Lightner and Caspar (Lightner and Caspar,
1998
). The selfed progeny from groups of 1,000 mutagenized parents
were pooled and 8,000 M2 plants from each of the six pools were
screened. In this group of 48,000 seedlings, we identified eleven enhancer
mutants that appeared to have completely glabrous early leaves. Genetic
complementation tests revealed that one enhancer was mutated in GL2,
three were mutated in TTG1, and the other eight fell into two new
complementation groups. Seven of the eight fell into a new complementation
group identified as having lesions in the At1G63650 basic helix-loop-helix
(bHLH). It is interesting to note that no mutations in GL1 were
isolated although we know that gl3 gl1 double mutants are hairless
and viable. The gl3 enhancer complementation group with the single
member has not been characterized.
The single egl3-1 mutant was isolated by identifying wild-type-appearing F2, from a gl3-1 egl3-1 to wild-type cross that segregated three wild type to one completely glabrous in the F3. These F2 lines had to be homozygous for egl3-1 and heterozygous for gl3-1. F3 individuals were identified that segregated only wild-type-appearing progeny in the F4 and PCR products were sequenced to verify the egl3-1 homozygous genotype.
gl3-2 egl3-1 was identified by crossing an egl3-1 homozygote to gl3-2, selfing the F1 and identifying completely glabrous F2 progeny. The genotype was verified by genetic noncomplementarity with gl3-1 egl3-1.
Genotypes that included tt8 (Enkheim accession) were identified by crossing, selfing the F1, and identifying F2 with the appropriate trichome phenotype and a transparent testa. The tt8 egl3 double mutant was verified by sequencing egl3, and the others by test crosses.
The GL1 (Larkin et al.,
1994
) and PAP1 (Borevitz et
al., 2000
) overexpression lines (both in Col0) were described
previously.
Liquid phase whole-mount RT-PCR in situ hybridization
This in situ protocol is a combination of the RT-PCR protocol of Koltai and
Bird (Koltai and Bird, 2000
)
and the whole-mount protocol of Engler et al.
(Engler et al., 1998
).
Tissue fixation
Soil-grown seedlings were fixed in 1:1 heptane:fixation buffer (0.08 M
EGTA, 5% formaldehyde and 10% DMSO) for 30 minutes, dehydrated twice for 5
minutes in absolute methanol and three times for 5 minutes in absolute
ethanol. Samples were stored 1-3 days in ethanol at 20°C.
Tissue permeabilization and postfixation
Samples were rinsed once in absolute ethanol and incubated for 30 minutes
in 1:1 absolute ethanol:xylene, washed twice for 5 minutes in absolute
ethanol, twice for 5 minutes in absolute methanol, and once for 5 minutes in
1:1 methanol:PBT (phosphate buffered saline + 0.1% Tween 20). Samples were
postfixed for 30 minutes in PBT containing 5% formaldehyde followed by one
rinse with PBS and two rinses with double distilled water
(ddH2O).
Liquid phase RT-PCR on whole tissues
RNase inhibitor, M-MuLV RT, and either the GL3 or EGL3
gene-specific reverse primer were used to reverse transcribe the GL3
or EGL3 message. PCR reactions were performed with primers listed
below with digoxigenin-labeled dUTP to yield a labeled PCR product of about
850 bp for GL3 and 650 bp for EGL3.
GL3 primer sequence: forward 5'TGGTTGTGCAACGCTCATACGGCG3'; reverse 5'TCCCAGTTTCATCTCTGGCTTCTG3'
EGL3 primer sequence: forward 5'AACGCTGAAACCGCCGATAGC3'; reverse- 5'TCTCTCCCAATGTTTTCACA3'
Staining and detection
Immediately after PCR, samples were washed twice for 5 minutes in PBT and
blocked for 30 minutes in PBT containing 3% BSA. Preabsorbed alkaline
phosphatase conjugated anti-digoxigenin monoclonal antibody (Boehringer
Mannheim/Hoffmann-La Roche) was diluted 1:1500 in blocking solution. Samples
were incubated overnight at 4°C in 1 ml of diluted antibody. Antibody
solution was replaced by fresh blocking solution and incubated for 10 minutes.
Samples were washed five times in PBT for 15-30 minutes and placed in
35x10 mm Petri plates with 1 ml of washing buffer (10 mM Tris, 15 mM
NaCl, pH 9.5) containing 150 µg/ml 4-nitro blue tetrazolium chloride and
370 µg/ml 5-bromo-4-chloro-3-indolyl-phosphate (Boehringer
Mannheim/Hoffmann-La Roche). Color development was monitored by microscopy and
stopped by rinsing with ddH2O.
LUX RT-PCR
Total RNA was prepared from 100 mg aliquots of 5-day-old seedlings grown on
germination medium (MS salts, Gamborg's B5 vitamins, 3% sucrose, 0.8% agar, pH
5.8) using a Qiagen RNeasy plant mini kit. 0.75 µg of total RNA was
reversed transcribed in 20 µl reactions using a SuperScript II RT kit
(Invitrogen).
Unlabeled and fluorophore-labeled primers were designed with the help of LUX web-based primer design software (www.invitrogen.com/lux). Primers amplifying target (CHS and DFR) and endogenous control (APRT) sequences were FAM- and JOE-labeled, respectively. The labeled T is in bold type.
CHS primers: forward, 5'CACCTGCCAGCGATCCTAGACCAGGTG 3'; reverse, 5'ACGTGTCGCCCTCATCTTCT 3'
DFR primers: forward, 5'CTACATTTCTGCCGGAACCGTTAATGTAG 3'; reverse, 5'CACGCTGCTTTCTCCGCTAA 3'
APRT primers: forward, 5'CAACGTGGCCCTCCTATTGCGTTG 3'; reverse, 5'CCGAAATAACCTTCCCAGGTAGC 3'
2 µl of cDNA template was amplified in 50 µl PCR reactions containing
100 nM target primers, 125 nM APRT primers, and 60 nM ROX reference
dye using platinum Taq (Invitrogen) according to the manufacturer's
instructions. Reactions were conducted and fluorescence was monitored in a
spectrofluorometric thermal cycler (ABI PRISM 7700). The comparative cycle
threshold (CT) method was used to analyze the results of
quantitative PCR (User Bulletin 2, ABI PRISM 7700 Sequence Detection System).
Relative transcript levels of target genes are reported normalized to an
endogenous reference, APRT
(Moffatt et al., 1994
;
Cowling et al., 1998
), and
relative to a reference calibrator.
Constructs
Many of the GL3, GL1 and TTG1 constructs have been
described previously (Payne et al.,
2000
). All others are briefly described here and cloning details
are available upon request. All PCR amplification products used in
construction were completely sequenced. pGL3STR contains the
CaMV35S::GL3 cDNA from the start to stop codons in the plant
overexpression vector, pLBJ21 (Payne et
al., 2000
). pEGL3E contains the CaMV35S::EGL3 genomic
fragment from the start to stop codons in the plant overexpression vector,
pKYLX71 (Schardl et al.,
1987
). pGL3PGUS contains 2.5 kb of DNA upstream of the
GL3 coding region inserted in front of the GUS gene in
pBI101.3 (Clontech). pEGLPGUS contains 3 kb of DNA upstream of the
EGL3 coding region inserted in front of the GUS gene in
pBG1.1 (Gray-Mitsumune et al.,
1999
).
Two-hybrid constructs
The original EGL3 EST, 146d23T7, encodes a spurious stop codon at
predicted codon 248 (GenBank Accession Number, AF027732). A new EGL3
cDNA was prepared from WS wild-type inflorescence by RT-PCR. The product
encodes a 596 amino acid peptide.
pEGL3NA encodes for the 367 amino acid EGL3 amino end in activation domain vector, pGAD424 (Clontech).
pEGL3CTA encodes for the 229 amino acid EGL3 carboxy end from residue 368 through 596 in pGAD424.
pCPCDB encodes for the full length CPC protein in DNA binding domain vector, pGBT9 (Clontech).
pTRYDB encodes for the full-length TRY protein in pGBT9.
pP1MDB encodes for the PAP1 myb domains, amino acids 1-113, in DNA binding domain vector, pAS2-1 (Clontech).
pP2MDB encodes for the PAP2 myb domains, amino acids 1-113, in pAS2-1.
The GL3, GL1 and TTG1 two-hybrid constructs used here
have been fully described (Payne et al.,
2000
) and are briefly described here.
pGL3A encodes for the full-length GL3 protein in pGAD424.
pGL3NTA encodes for the 400 amino acid GL3 amino end in pGAD424.
pGL396A encodes for amino acids 97-635 of GL3 in pGAD424.
pGL3211A encodes for amino acids 212-635 of GL3 in pGAD424.
pGL3CTA encodes for amino acids 401-635 of GL3 in pGAD424.
pGL1NTA encodes for amino acids 1-121 of GL1 in pGAD424.
pTTG1B encodes for the full-length TTG1 protein in pAS2-1.
| Results |
|---|
|
|
|---|
The large new complementation group was designated Enhancer of Glabra3 (EGL3, Fig. 1 compare A, B, and D). When the gl3-1 egl3-1 double mutant was crossed to the gl3-1 progenitor, the F1 looked like the gl3 parent. When crossed to wild type, the F1 looked wild type, indicating that the egl3 mutation is qualitatively recessive.
|
EGL3 encodes a putative protein of 596 amino acids, 39 amino acids
shorter than GL3. The length difference is distributed throughout the coding
region. Like GL3, EGL3 appears to have six introns and the two
proteins are approximately 75% similar at the amino acid level. An alignment
of GL3 and EGL3 has been presented elsewhere
(Payne et al., 2000
).
gl3 egl3 double mutant is pleiotropic
Mutations in GL3 have a moderate effect on trichome initiation and
a strong effect on reducing trichome branching, endoreduplication and cell
size (Hulskamp et al., 1994
;
Payne et al., 2000
) but no
apparent effect on non-trichome pathways. However, ectopic expression of GL3,
EGL3 or R will suppress most or all of the defects caused by mutations in
TTG1 (Lloyd et al.,
1992
; Galway et al.,
1994
; Payne et al.,
2000
) (this work). One possible explanation is that there are
multiple TTG1-dependent bHLH proteins responsible for the different pathways
and that ectopic expression of any one of them will bypass the need for TTG1
in many of the pathways. We characterized the three TTG1-dependent
non-trichome pathways in the gl3 egl3 double mutant to determine
whether the absence of both endogenous bHLH proteins conferred pleiotropic
defects.
Pigment analysis
The seeds coats, or testa, of gl3 egl3 are brown, not transparent
like the many transparent testa mutants including ttg1
(Fig. 2M). However, a clear-cut
qualitative anthocyanin deficit is seen in the hypocotyls and cotyledons of
5-day-old gl3 egl3 seedlings (Fig.
2P). Anthocyanins are commonly highly expressed in the hypocotyls
(Kubasek et al., 1992
) and
Fig. 2P compares the wild-type
strain, ttg1-1, gl3-1, egl3-1 single and the gl3 egl3 double
mutants. It is clearly evident that the double mutant and ttg1-1 have
no observable purple anthocyanin compared to the parental line. The
gl3 mutant looks more or less wild type and the egl3 mutant
has reduced anthocyanin content.
|
Position dependent root hair differentiation
Wild-type Arabidopsis produce root hairs (trichoblasts) in files
of epidermal cells that lie over the radial wall between two cortical cells.
There are normally eight cortical cells with eight separating radial walls and
therefore eight files of trichoblast cells separated by a variable number of
non-hair cell files (Dolan et al.,
1994
; Galway et al.,
1994
). Mutations in TTG1, GLABRA2 and WEREWOLF
(Lee and Schiefelbein, 1999
)
cause essentially all root epidermal cells to assume a hair cell fate,
ablating position-dependent differentiation. The gl3 egl3 double
mutant exhibits this same ttg1-like phenotype. We have not done
extensive quantification of root hair production, but it is clear that the
gl3 egl3 double mutant (Fig.
3B) differentiates root hairs in all cell files, as does
ttg1 (Fig. 3C),
showing that the double mutant has lost the ability to limit root hair
differentiation to specific cell files
(Fig. 3A). Qualitative
observations of gl3 and egl3 single mutants show at most, a
mild loss of root hair position dependency (not shown).
|
Single egl3-1 mutant lines (Fig. 1C) were grown beside wild-type seedlings (Fig. 1A) and scored for trichome number and branching in leaves numbered on to four. Table 1 shows that the egl3-1 line exhibits a significant reduction in trichome number (approximately a 20% drop) and a shift to fewer branches. The proportion of total four-branched trichomes dropped from 38% to 18% while three-branched trichomes increased from 60% to 78%.
|
Ectopic expression of EGL3 or GL3 suppresses ttg1
Prior to identifying enhancers of gl3, we overexpressed a
PCR-generated genomic copy (including introns) of the At1G63650 locus in
ttg1-1 and wild type under the control of the CaMV 35S promoter.
Overexpression of the At1G63650 /EGL3 genomic clone initiated
trichome differentiation in the ttg1 background
(Fig. 1E,G) and increased
trichome initiation in wild type (Fig.
1J). However, like the GL3 genomic clone
(Payne et al., 2000
), the
overexpressed EGL3 genomic clone was a weak suppressor of the
ttg1 trichome defect. EGL3 also suppressed the anthocyanin
defect of the ttg1 mutation (Fig.
2Q), as did GL3 (Fig.
2Q). EGL3 genomic clone overexpression also suppressed
the mucilage defect of the ttg1 mutation, while neither GL3
cDNA nor genomic clone was able to. This can be seen by comparing the
collapsed columellae of ttg1 that are not rescued by GL3
overexpression but are by EGL3
(Fig. 2G,H,I).
Similar to the suppression of the mucilage defect, overexpressed EGL3 was able to suppress the transparent testa defect of ttg1 while GL3 was not (Fig. 2N). In addition, the ttg1 lines overexpressing GL3 cDNA consistently had a different trichome phenotype (Fig. 1F) than those overexpressing either the EGL3 genomic (Fig. 1G) or the GL3 genomic fragment. The only difference between the GL3 cDNA and genomic DNA fragments is the inclusion of the introns. The EGL3 genomic overexpression trichome phenotype looked very much like the overexpressed GL3 genomic clone phenotype. These had fewer and less branched trichomes than wild type but the trichomes did not appear distorted, while the GL3 cDNA produced many short fat distorted trichomes. Overexpressed GL3 cDNA in wild type (Fig. 1I) was also a much stronger trichome initiator than the genomic clone. Root hairs have not been characterized in these overexpression lines.
Coectopically expressed GL3 and EGL3 interact
synergistically in ttg1
The EGL3 and GL3 overexpression lines were crossed to
create a ttg1-1 mutant background overexpressing both genes. Together
the two genes are extremely strong suppressors of the ttg1 trichome
defect (Fig. 1H), causing the
plants to produce far more trichomes than wild type. This is similar to
ttg1 plants overexpressing R. Many of these trichomes are
highly branched, like the R-induced trichomes. In addition, trichomes
produced by coectopic expression are not distorted.
We also looked at seed coat pigment phenotypes when GL3 or EGL3 were overexpressed in ttg1. EGL3 was able to restore some seed coat pigment while GL3 was not (Fig. 2N). The GL3/EGL3 co-overexpressing lines produced as much or more seed coat pigment as wild type (Fig. 2N, upper) indicating that GL3 can participate in seed coat pigment regulation.
Suppression of gl3 egl3 and tt8 by ectopic
GL3 or EGL3 expression
As further demonstration that these bHLH proteins have overlapping
regulatory capabilities, we overexpressed GL3 and EGL3 in
the gl3 egl3 double mutant and in tt8. Each construct was
able to suppress the double mutant (not shown). Ectopic expression of the
EGL3 genomic clone strongly suppressed, while the GL3 cDNA
or genomic clone weakly suppressed the tt8 seed coat pigment defect
(Fig. 2O) similar to the
differential affect seen in ttg1. We also found that either gene was
able to increase the visible pigment content of the tt8 mutant
hypocotyls (Fig. 2R) but not by
much.
The gl3 egl3 tt8 triple mutant phenocopies
ttg1
The tt8 mutant has a transparent testa, like ttg1.
However, unlike ttg1 mutants, it produces substantial anthocyanins in
the plant body. Mutants blocked early in the anthocyanin pathway lack
anthocyanins in the plant as well as having a transparent testa. These include
the regulatory mutant, ttg1 and mutations in structural genes such as
chalcone synthase (tt4)
(Koornneef, 1990
;
Feinbaum and Ausubel, 1988
) and
dihydroflavanol reductase (tt3)
(Koornneef, 1990
;
Shirley et al., 1992
).
Anthocyanins in the tt8 plant body and seed coat in gl3 egl3
indicates that there is flux through this pathway in both genotypes.
We produced gl3-1 egl3-1 tt8-1 triple mutants and observed them for anthocyanin production by looking at young hypocotyls, a stage when anthocyanin production is relatively high. While the double mutant produced some visible pigment, no anthocyanin production was observed in any developmental stage of the triple mutant indicating that these three bHLH loci are partially redundant in regulating the anthocyanin pathway. Analysis of the regulation of TT4 and TT3 is presented below.
Columellae development and mucilage production were observed in the triple
mutants. Recall that egl3 single and gl3 egl3 double mutants
are partially defective in columellae development and mucilage production, but
tt8 does not appear to have any defect in this pathway
(Fig. 2D)
(Nesi et al., 2000
).
Fig. 2E, F and L shows that
both the gl3 egl3 tt8 triple and the egl3 tt8 double mutants
produce collapsed columellae with no releasable mucilage indicating these bHLH
loci are partially redundant in mucilage pathway regulation. Our evidence
indicates that GL3 normally plays no role in mucilage production.
EGL3 interacts with GL1 and PAP1 in plants
GL3 and R interact with GL1 when co-overexpressed in Arabidopsis
to produce more trichomes (Larkin et al.,
1994
; Payne et al.,
2000
) and R and C1 interact to produce more anthocyanin pigment
(Lloyd et al., 1992
). Here we
tested whether co-ectopic expression of EGL3 with either of two myb elements,
GL1 and PAP1, would give synergistic phenotypes thus indicating interaction.
GL1 overexpression alone suppresses trichome initiation on true leaves
(Fig. 2S)
(Oppenheimer et al., 1991
).
EGL3/GL1 co-overexpression produces supernumerary trichomes on the hypocotyls
and cotyledons and excessive trichomes on the true leaves
(Fig. 2T) indicating a
synergistic interaction similar to the GL3/GL1 and R/GL1 interactions. EGL3
and PAP1 co-overexpression resulted in more anthocyanin production than in
either parent alone indicating a synergistic interaction similar to the R/C1
interaction. This is most easily seen in the anthocyanins present in the
normally white petals. PAP1 overexpression alone causes increased anthocyanin
production, however, the petals are still essentially white
(Fig. 2U, left)
(Borevitz et al., 2000
). When
PAP1 and EGL3 were co-overexpressed, the petals were pink with dark pink veins
(Fig. 2U, right). GL3/PAP1
co-overexpression gave the same result (not shown).
For molecular verification that members of this set of bHLH genes regulate
anthocyanin production, expression of the anthocyanin biosynthetic genes,
chalcone synthase (CHS) and dihydroflavonol
reductase (DFR) was analyzed in various genetic backgrounds.
Quantitative real time RT-PCR was performed on Ler wild type,
ttg1, egl3 gl3 double mutant, and egl3 gl3 tt8 triple
mutant. The comparative CT method was used to analyze the data. In
Fig. 4F, the expression levels
of CHS and DFR in ttg1 were set to equal 1 and all
other levels are relative to that. Kubasek et al.
(Kubasek et al., 1992
) showed
that TTG1 does not regulate transcription of CHS, the first
step in the anthocyanin branch of the phenylpropanoid pathway, but it does
regulate DFR, a later step. Our results agree with that finding. We
also found that the bHLH regulators studied here play no appreciable role in
regulating CHS. However, like TTG1, the bHLH regulators
positively regulate DFR transcription. DFR expression in
wild type is more than 900-fold greater than in ttg1, while
DFR expression in gl3 egl3 is 100-fold more (9-fold down
from wild type) and gl3 egl3 tt8 is 15-fold more than in
ttg1 (63-fold down from wild type).
|
|
GLABRA2 expression in wt and gl3 egl3 leaves
GL2 expression was observed by using a GL2
promoter-GUS transgenic line that has been extensively used
(Masucci et al., 1996
;
Szymanski et al., 1998
). The
GL2GUS fusion was isolated in the double mutant by crossing and
isolating completely glabrous, kanamycin resistant F2 plants.
Fig. 4D shows the typical
GL2 expression pattern in wild-type plants. GL2 is expressed
in young and developing trichomes but is not strongly expressed in young
leaves as opposed to EGL3 and GL3. In the gl3 egl3
mutant, GL2 expression is not detected in the leaves
(Fig. 4E). It is interesting
that we see relatively strong GL2 expression in the stipules of
wild-type plants, which remains strong in the mutant (arrows in
Fig. 4D,E). GL1 is
reported to be expressed in stipules
(Oppenheimer et al., 1991
;
Larkin et al., 1993
) but
neither GL3 or EGL3 expression is obvious in stipules.
| Discussion |
|---|
|
|
|---|
We hypothesized that GL3 was redundant with the At1G63650 locus in the trichome pathway at least. So an enhancer screen in the gl3-1 mutant background was performed, looking for mutations in new loci that result in totally bald plants. Our strategy was to sequence the At1G63650 locus in any new complementation group that required the gl3 mutation to show the hairless phenotype, i.e. mutated loci that were hypostatic to gl3 mutations. A new complementation group was identified with lesions shown to be stop codons in exons of the At1G63650 (EGL3) locus.
Isolation of mutations in the EGL3 locus allowed us to characterize the central role for bHLH proteins in all TTG1-dependent processes and show that this central role has been masked by partial functional redundancy, an increasingly common theme in Arabidopsis.
Although we initially only screened for a trichome defect, the gl3 egl3 double mutant was noted to have defects in the other developmental pathways regulated by TTG1. These include anthocyanin production and the related seed coat tannin production, position-dependent root hair spacing, and seed coat mucilage production. It was found that the new double mutant was partially defective in anthocyanin production, defective in root hair spacing, partially defective in seed coat mucilage production, but apparently normal for the production of the tannin seed coat pigment.
The transparent testa or tt series of phenylpropanoid mutants are
missing seed coat tannin. TT8 was cloned and shown to encode a bHLH
protein responsible for the seed coat tannin but no other phenotypes were
reported (Nesi et al., 2000
).
We combined the tt8 mutation with gl3, egl3 and the gl3
egl3 mutations and found that tt8 and egl3 are
partially redundant for the seed coat mucilage production. egl3-1
single mutant has a mucilage phenotype similar to the gl3-1 egl3-1
double mutant and when tt8 is combined with egl3-1 as either
double or triple mutant, the seed coats are devoid of releasable mucilage and
the columellae are collapsed. The tt8, gl3 single and tt8
gl3 double mutants all produce apparently normal amounts of mucilage and
have pronounced columellae, indicating that GL3 plays little or no
role in this process. As expected, all mutant combinations containing the
tt8 mutation have a transparent testa.
The tt8 single mutant produces significant amounts of visible
anthocyanin pigment in the seedling. However, the egl3 gl3 and
egl3 gl3 tt8 mutant combinations do not. Molecular data indicate that
including the tt8 mutation drives down DFR expression more
than 6-fold from the double to the triple mutant. This indicates that
tt8 probably plays some role in activating anthocyanin pathway genes
in the plant, but this experiment is complicated by the fact that the
tt8-1 mutation used here is in a different ecotype and other genetic
factors may be at work. Shirley et al.
(Shirley et al., 1995
) also
found that the tt8-1 mutant had downregulated DFR but not
CHS in seedlings, but with the same ecotype caveat as the present
work. Also consistent with our work, they showed that DFR but not
CHS was even further downregulated in the ttg1 mutant, but
that DFR expression was still detectable.
bHLH proteins and genetic interactions
We previously reported interactions between GL3 and other proteins in the
yeast two-hybrid system. These include interactions with GL1, TTG1 and self
interactions. These interactions occurred through separate domains included in
roughly the first 100 amino acids, amino acids 200-400 and the carboxy end
including the bHLH region, respectively. A two-hybrid analysis with EGL3
demonstrates the same GL1 and TTG1 interactions as GL3, and that GL3 and EGL3
can form heterodimers, and that the EGL3 carboxy end forms homodimers. The
myb-protein anthocyanin regulators PAP1 and PAP2 were both found to interact
with EGL3 and GL3 through the same GL1 interacting protein fragments. Myb
proteins have been identified that regulate all of the TTG1-dependent pathways
and we predict that each of these will interact with one or more of the three
bHLH proteins that are the subject of this paper. The mybs not tested here
include the root hair position regulator WEREWOLF
(Lee and Schiefelbein, 1999
),
the seed coat pigment regulator TT2 (Nesi
et al., 2001
), and the seed coat mucilage regulator MYB61
(Penfield et al., 2001
). GL1,
PAP1/2, WER, TT2 and MYB61 are so-called R2R3 mybs, containing two myb repeats
and an acidic transcriptional activation domain. We have further shown that
both GL3 and EGL3 interact with the single myb repeat repressors, TRY and CPC,
and that all of these myb interactions occur through the same amino domains of
GL3 and EGL3.
We indirectly tested for some of these interactions in plants by looking for hypermorphic phenotypic synergism between co-overexpressed bHLH and myb regulators. We found that we could detect interactions PAP1 and between EGL3 and GL3. When co-overexpressed, each of these combinations gave phenotypes that were far more severe than can be explained by additive regulation leading us to conclude the regulators are interacting, probably at the protein-protein level.
Extensive work has been done to show required interactions between the myb
proteins C1 or Pl and the bHLH containing proteins, R or B, to activate the
anthocyanin pathway in maize and to show that these proteins interact in yeast
two-hybrid assays (Goff et al.,
1992
). The general protein-protein interactions presented here are
consistent with this earlier work. However, in maize and Antirrhinum
(Goodrich et al., 1992
), the
bHLH anthocyanin regulators are not reported to be involved in the regulation
of any other pathways. In Petunia, the myb/bHLH protein interactions
also hold (Quattrocchio et al.,
1998
), however, as in Arabidopsis, at least one bHLH
protein appears to regulate more than just one pathway. AN1 regulates
anthocyanin production, vacuole pH and seed coat cell shape
(Spelt et al., 2002
).
Differential function for GL3, EGL3, and TT8
Our mutant analysis indicates that the three bHLH proteins have overlapping
but different functions in Arabidopsis. TT8 alone regulates seed coat
pigment, probably participates in regulating anthocyanin biosynthesis in the
plant, and shares seed coat mucilage regulation with EGL3. We have not
uncovered any evidence that TT8 functions in the trichome or root hair
pathways. EGL3 functions with GL3 in the root hair pathway and trichome
pathway but has a much smaller effect on trichome development than GL3 as a
single mutant. GL3 does not appear to affect seed coat mucilage at all. GL3
and EGL3 together regulate anthocyanin accumulation in the hypocotyl with EGL3
apparently having a larger role.
The GL3 cDNA gives very different trichome phenotypes when overexpressed in the ttg1 mutant than either the GL3 or EGL3 genomic fragments. We have not yet tested the EGL3 cDNA and it may behave like the GL3 cDNA. It is also interesting that overexpressed EGL3 genomic fragment is a much better suppressor of seed coat pigment defects of the tt8 and ttg1 mutations and the mucilage defect of the ttg1 mutation than either GL3 genomic or cDNA fragments. It may be that GL3 does not normally function in the seed coat and that it is unable to productively interact with the seed coat mybs that regulate pigment and mucilage production.
Model for epidermal cell-fate and differentiation
The data presented in this and other papers indicate that the TTG1 protein
directly interacts with a set of three bHLH proteins and these bHLH proteins
directly interact with a larger set of myb elements
(Fig. 5). The genetic evidence
is that the pleiotropic spectrum narrows as one moves down this regulatory
hierarchy. Mutations in TTG1 affect the maximum number of pathways
while mutations in the bHLH proteins affect overlapping subsets of the
pathways that TTG1 regulates. Apparently none of the bHLH proteins affect all
of the pathways and none are specific to one. As far as we can tell, none of
the three regulate pathways that are not regulated by TTG1.
|
A possible mechanism by which single MYB repeat proteins cause inhibition
of a particular pathway is by competition with R2R3 MYBs for binding to bHLHs.
In a cell destined to be a trichome or a root non-hair cell, an activator
complex consisting of TTG1s-bHLHs-MYBs activates transcription of genes
required for cell fate differentiation and possibly the repressor genes. The
repressors then move to neighboring cells where they bind to bHLHs and form a
non-activating or repressive complex consisting of TTG1s-bHLHs-single MYB
repressor. Evidence for this model comes from the fact that the repressors of
cell fate are transcribed in cells that have adopted the trichome or non-root
hair cell fate (Schellmann et al.,
2002
), and in the case of root cells, CPC repressor protein
accumulates in root hair (repressed) cells
(Wada et al., 2002
). Evidence
for bHLH proteins as the binding targets of single MYB repressors is suggested
by yeast-two-hybrid results demonstrating that MYBs can interact with bHLHs
but not with TTG1 or each other.
The discovery of EGL3 and additional functions for GL3 and TT8 completes
the search for the missing bHLH proteins required in the regulation of all
TTG1-dependent pathways. These proteins have been hypothesized to exist
(Lloyd et al., 1992
;
Lee and Schiefelbein, 1999
;
Payne et al., 2000
;
Schellmann et al., 2002
) but
have been largely disguised by functional redundancy within the genome. This
analysis raises many new questions for this reticulated regulatory hierarchy.
Identification of the bHLH components of TTG1-dependent regulation will allow
the study of how these key developmental complexes function in the plant.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Departments of Medicine, Microbiology and Immunology,
University of California at San Francisco, San Francisco, CA 94143, USA ![]()
Present address: CSIRO Horticulture Unit, Hartley Grove, Urrbrae, SA 5064,
Australia ![]()
| REFERENCES |
|---|
|
|
|---|
Borevitz, J., Xia, Y., Blount, J., Dixon, R. and Lamb, C.
(2000). Activation tagging identifies a conserved MYB regulator
of phenylpropanoid biosynthesis. Plant Cell
12,2383
-2394.
Cowling, R., Kamiya, Y., Seto, H. and Harberd, N.
(1998). Gibberellin dose-response regulation of GA4 gene
transcript levels in Arabidopsis. Plant Physiol.
117,1195
-1203.
Dolan, L., Duckett, C., Grierson, C., Linstead, P., Schneider,
K., Lawson, E., Dean, C., Poethig, S. and Roberts, K.
(1994). Clonal relationships and cell patterning in the root
epidermis of Arabidopsis. Development
120,2465
-2474.
Engler, J. D. A., Van Montagu, M. and Engler, G. (1998). Whole-mount in situ hybridization in plants. In Methods in Molecular Biology: Arabidopsis Protocols (eds. J. M. Martinez-Zapater and J. Salinas), pp.373 -384. Totowa, New Jersey: Humana Press.
Feinbaum, R. and Ausubel, F. (1988).
Transcriptional regulation of the Arabidopsis thaliana chalcone
synthase gene. Mol. Cell. Biol.
8,1985
-1992.
Galway, M., Masucci, J., Lloyd, A., Walbot, V., Davis, R. and Schiefelbein, J. (1994). The TTG gene is required to specify epidermal cell fate and cell patterning in the Arabidopsis root. Dev. Biol. 166,740 -754.[CrossRef][Medline]
Goff, S., Cone, K. and Chandler, V. (1992).
Functional analysis of the transcriptional activator encoded by the maize
B gene: evidence for a direct functional interaction between two
classes of regulatory proteins. Genes Dev.
6, 864-875.
Goodrich, J., Carpenter, R. and Coen, E. (1992). A common gene regulates pigmentation pattern in diverse plant species. Cell 68,955 -964.[CrossRef][Medline]
Gray-Mitsumune, M., Molitor, E., Cukovic, D., Carlson, J. and Douglas, C. (1999). Developmentally regulated patterns of expression directed by poplar PAL promoters in transgenic tobacco and poplar. Plant Mol. Biol. 39,657 -669.[CrossRef][Medline]
Hulskamp, M., Misera, S. and Jurgens, G. (1994). Genetic dissection of trichome cell development in Arabidopsis. Cell 76,555 -566.[CrossRef][Medline]
Jofuku, K., den Boer, B., Van Montagu, M. and Okamuro, J. (1994). Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell 6,1211 -1225.[Abstract]
Koltai, H. and Bird, D. (2000). High throughput
cellular localization of specific plant mRNAs by liquid-phase in situ reverse
transcription-polymerase chain reaction of tissue sections. Plant
Physiol. 123,1203
-1212.
Koornneef, M. (1981). The complex syndrome of ttg mutants. Arabid. Inf. Serv. 18, 45-51.
Koornneef, M. (1990). Mutations affecting the testa color in Arabidopsis. Arabid. Inf. Serv. 27,94 -97.
Koornneef, M., Dellaert, L. and van der Veen, J. (1982). EMS- and radiation-induced mutation frequencies at individual loci in Arabidopsis thaliana (L.) Heynh. Mutat. Res. 93,109 -123.[Medline]
Kubasek, W., Shirley, B., McKillop, A., Goodman, H., Briggs, W.
and Ausubel, F. (1992). Regulation of flavonoid
bBiosynthetic genes in germinating Arabidopsis seedlings.
Plant Cell 4,1229
-1236.
Larkin, J., Oppenheimer, D., Pollock, S. and Marks, M. (1993). Arabidopsis GLABROUS1 gene requires downstream sequences for function. Plant Cell 5,1739 -1748.[Abstract]
Larkin, J., Oppenheimer, D., Lloyd, A., Paparozzi, E. and Marks, M. (1994). Roles of the GLABROUS1 and TRANSPARENT TESTA GLABRA genes in Arabidopsis trichome development. Plant Cell 6,1065 -1076.[Abstract]
Lee, M. and Schiefelbein, J. (1999). WEREWOLF, a MYB-related protein in Arabidopsis, is a position-dependent regulator of epidermal cell patterning. Cell 99,473 -483.[CrossRef][Medline]
Lee, M. and Schiefelbein, J. (2001). Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis. Development 128,1539 -1546.[Abstract]
Lightner, J. and Caspar, T. (1998). Seed mutagenesis of Arabidopsis. In Methods in Molecular Biology: Arabidopsis Protocols (eds. J. M. Martinez-Zapater and J. Salinas), pp. 91-103. Totowa, New Jersey: Humana Press.
Lloyd, A., Walbot, V. and Davis, R. (1992).
Arabidopsis and Nicotiana anthocyanin production activated
by maize regulators R and C1. Science
258,1773
-1775.
Masucci, J., Rerie, W., Foreman, D., Zhang, M., Galway, M., Marks, M. and Schiefelbein, J. (1996). The homeobox gene GLABRA2 is required for position-dependent cell differentiation in the root epidermis of Arabidopsis thaliana.Development 122,1253 -1260.[Abstract]
Moffatt, B., McWhinnie, E., Agarwal, S. and Schaff, D. (1994). The adenine phosphoribosyltransferase-encoding gene of Arabidopsis thaliana. Gene 143,211 -216.[CrossRef][Medline]
Nesi, N., Debeaujon, I., Jond, C., Pelletier, G., Caboche, M.
and Lepiniec, L. (2000). The TT8 gene encodes
a basic helix-loop-helix domain protein required for expression of
DFR and BAN genes in Arabidopsis siliques.
Plant Cell 12,1863
-1878.
Nesi, N., Jond, C., Debeaujon, I., Caboche, M. and Lepiniec,
L. (2001). The Arabidopsis TT2 gene encodes an R2R3
MYB domain protein that acts as a key determinant for proanthocyanidin
accumulation in developing seed. Plant Cell
13,2099
-2114.
Oppenheimer, D., Herman, P., Sivakumaran, S., Esch, J. and Marks, M. (1991). A myb gene required for leaf trichome differentiation in Arabidopsis is expressed in stipules. Cell 67,483 -493.[CrossRef][Medline]
Payne, C., Zhang, F. and Lloyd, A. (2000).
GL3 encodes a bHLH protein that regulates trichome development in
Arabidopsis through interaction with GL1 and TTG1.
Genetics 156,1349
-1362.
Penfield, S., Meissner, R., Shoue, D., Carpita, N. and Bevan,
M. (2001). MYB61 is required for mucilage deposition and
extrusion in the Arabidopsis seed coat. Plant
Cell 13,2777
-2791.
Quattrocchio, F., Wing, J., van der Woude, K., Mol, J. and Koes, R. (1998). Analysis of bHLH and MYB domain proteins: species-specific regulatory differences are caused by divergent evolution of target anthocyanin genes. Plant J. 13,475 -488.[CrossRef][Medline]
Schardl, C., Byrd, A., Benzion, G., Altschuler, M., Hildebrand, D. and Hunt, A. (1987). Design and construction of a versatile system for the expression of foreign genes in plants. Gene 61,1 -11.[CrossRef][Medline]
Schellmann, S., Schnittger, A., Kirik, V., Wada, T., Okada, K., Beermann, A., Thumfahrt, J., Jurgens, G. and Hulskamp, M. (2002). TRIPTYCHON and CAPRICE mediate lateral inhibition during trichome and root hair patterning in Arabidopsis. EMBO J. 21,5036 -5046.[CrossRef][Medline]
Shirley, B., Hanley, S. and Ausubel, F. (1992)
Effects of ionizing radiation on a plant genome: Analysis of two
Arabidopsis transparent testa mutations. Plant
Cell 4,333
-347.
Shirley, B., Kubasek, W., Storz, G., Bruggemann, E., Koornneef, M., Ausubel, F. and Goodman, H. (1995). Analysis of Arabidopsis mutants deficient in flavonoid biosynthesis. Plant J. 8,659 -671.[CrossRef][Medline]
Spelt, C., Quattrocchio, F., Mol, J. and Koes, R.
(2002). ANTHOCYANIN1 of Petunia controls pigment
synthesis, vacuolar pH, and seed coat development by genetically distinct
mechanisms. Plant Cell
14,2121
-2135.
Sterling, C. (1970). Crystal structure of ruthenium red and stereo-chemistry of its pectin stain. Am. J. Bot. 57,172 175.[CrossRef]
Szymanski, D., Jilk, R., Pollock, S. and Marks, M. (1998). Control of GL2 expression in Arabidopsis leaves and trichomes. Development 125,1161 -1171.[Abstract]
Wada, T., Kurata, T., Tominaga, R., Koshino-Kimura, Y.,
Tachibana, T., Goto, K., Marks, M., Shimura, Y. and Okada, K.
(2002). Role of a positive regulator of root hair development,
CAPRICE, in Arabidopsis root epidermal cell differentiation.
Development 129,5409
-5419.
Walker, A., Davison, P., Bolognesi-Winfield, A., James, C.,
Srinivasan, N., Blundell, T., Esch, J., Marks, M. and Gray, J.
(1999). The TRANSPARENT TESTA GLABRA1 locus, which
regulates trichome differentiation and anthocyanin biosynthesis in
Arabidopsis, encodes a WD40 repeat protein. Plant
Cell 11,1337
-1350.
Western, T., Skinner, D. and Haughn, G. (2000).
Differentiation of mucilage secretory cells of the Arabidopsis seed
coat. Plant Physiol.
122,345
-356.
Windsor, J., Symonds, V., Mendenhall, J. and Lloyd, A. (2000). Arabidopsis seed coat development: morphological differentiation of the outer integument. Plant J. 22,483 -493.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. A. Arsovski, M. M. Villota, O. Rowland, R. Subramaniam, and T. L. Western MUM ENHANCERS are important for seed coat mucilage production and mucilage secretory cell differentiation in Arabidopsis thaliana J. Exp. Bot., July 1, 2009; 60(9): 2601 - 2612. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Arsovski, T. M. Popma, G. W. Haughn, N. C. Carpita, M. C. McCann, and T. L. Western AtBXL1 Encodes a Bifunctional {beta}-D-Xylosidase/{alpha}-L-Arabinofuranosidase Required for Pectic Arabinan Modification in Arabidopsis Mucilage Secretory Cells Plant Physiology, July 1, 2009; 150(3): 1219 - 1234. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Marks, J. P. Wenger, E. Gilding, R. Jilk, and R. A. Dixon Transcriptome Analysis of Arabidopsis Wild-Type and gl3-sst sim Trichomes Identifies Four Additional Genes Required for Trichome Development Mol Plant, June 19, 2009; (2009) ssp037v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-F. Zhu, K. Fitzsimmons, A. Khandelwal, and R. G. Kranz CPC, a Single-Repeat R3 MYB, Is a Negative Regulator of Anthocyanin Biosynthesis in Arabidopsis Mol Plant, June 2, 2009; (2009) ssp030v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wester, S. Digiuni, F. Geier, J. Timmer, C. Fleck, and M. Hulskamp Functional diversity of R3 single-repeat genes in trichome development Development, May 1, 2009; 136(9): 1487 - 1496. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. H. Kang, V. Kirik, M. Hulskamp, K. H. Nam, K. Hagely, M. M. Lee, and J. Schiefelbein The MYB23 Gene Provides a Positive Feedback Loop for Cell Fate Specification in the Arabidopsis Root Epidermis PLANT CELL, April 1, 2009; 21(4): 1080 - 1094. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yoshida, R. Sano, T. Wada, J. Takabayashi, and K. Okada Jasmonic acid control of GLABRA3 links inducible defense and trichome patterning in Arabidopsis Development, March 15, 2009; 136(6): 1039 - 1048. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Terrier, L. Torregrosa, A. Ageorges, S. Vialet, C. Verries, V. Cheynier, and C. Romieu Ectopic Expression of VvMybPA2 Promotes Proanthocyanidin Biosynthesis in Grapevine and Suggests Additional Targets in the Pathway Plant Physiology, February 1, 2009; 149(2): 1028 - 1041. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Li, O. N. Milliken, H. Pham, R. Seyit, R. Napoli, J. Preston, A. M. Koltunow, and R. W. Parish The Arabidopsis MYB5 Transcription Factor Regulates Mucilage Synthesis, Seed Coat Development, and Trichome Morphogenesis PLANT CELL, January 1, 2009; 21(1): 72 - 89. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-H. Chen, G. I. Jenkins, and H. G. Nimmo Identification of an F-Box Protein that Negatively Regulates Pi Starvation Responses Plant Cell Physiol., December 1, 2008; 49(12): 1902 - 1906. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wang and J.-G. Chen Arabidopsis Transient Expression Analysis Reveals that Activation of GLABRA2 May Require Concurrent Binding of GLABRA1 and GLABRA3 to the Promoter of GLABRA2 Plant Cell Physiol., December 1, 2008; 49(12): 1792 - 1804. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakatsuka, K. S. Haruta, C. Pitaksutheepong, Y. Abe, Y. Kakizaki, K. Yamamoto, N. Shimada, S. Yamamura, and M. Nishihara Identification and Characterization of R2R3-MYB and bHLH Transcription Factors Regulating Anthocyanin Biosynthesis in Gentian Flowers Plant Cell Physiol., December 1, 2008; 49(12): 1818 - 1829. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Maes, D. Inze, and A. Goossens Functional Specialization of the TRANSPARENT TESTA GLABRA1 Network Allows Differential Hormonal Control of Laminal and Marginal Trichome Initiation in Arabidopsis Rosette Leaves Plant Physiology, November 1, 2008; 148(3): 1453 - 1464. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Jakoby, D. Falkenhan, M. T. Mader, G. Brininstool, E. Wischnitzki, N. Platz, A. Hudson, M. Hulskamp, J. Larkin, and A. Schnittger Transcriptional Profiling of Mature Arabidopsis Trichomes Reveals That NOECK Encodes the MIXTA-Like Transcriptional Regulator MYB106 Plant Physiology, November 1, 2008; 148(3): 1583 - 1602. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-X. Shangguan, B. Xu, Z.-X. Yu, L.-J. Wang, and X.-Y. Chen Promoter of a cotton fibre MYB gene functional in trichomes of Arabidopsis and glandular trichomes of tobacco J. Exp. Bot., October 1, 2008; 59(13): 3533 - 3542. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. E. Laitinen, M. Ainasoja, S. K. Broholm, T. H. Teeri, and P. Elomaa Identification of target genes for a MYB-type anthocyanin regulator in Gerbera hybrida J. Exp. Bot., October 1, 2008; 59(13): 3691 - 3703. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Pang, G. J. Peel, S. B. Sharma, Y. Tang, and R. A. Dixon A transcript profiling approach reveals an epicatechin-specific glucosyltransferase expressed in the seed coat of Medicago truncatula PNAS, September 16, 2008; 105(37): 14210 - 14215. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zhao, K. Morohashi, G. Hatlestad, E. Grotewold, and A. Lloyd The TTG1-bHLH-MYB complex controls trichome cell fate and patterning through direct targeting of regulatory loci Development, June 1, 2008; 135(11): 1991 - 1999. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Macquet, M.-C. Ralet, O. Loudet, J. Kronenberger, G. Mouille, A. Marion-Poll, and H. M. North A Naturally Occurring Mutation in an Arabidopsis Accession Affects a {beta}-D-Galactosidase That Increases the Hydrophilic Potential of Rhamnogalacturonan I in Seed Mucilage PLANT CELL, December 1, 2007; 19(12): 3990 - 4006. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Morohashi, M. Zhao, M. Yang, B. Read, A. Lloyd, R. Lamb, and E. Grotewold Participation of the Arabidopsis bHLH Factor GL3 in Trichome Initiation Regulatory Events Plant Physiology, November 1, 2007; 145(3): 736 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gan, H. Yu, J. Peng, and P. Broun Genetic and Molecular Regulation by DELLA Proteins of Trichome Development in Arabidopsis Plant Physiology, November 1, 2007; 145(3): 1031 - 1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zentella, Z.-L. Zhang, M. Park, S. G. Thomas, A. Endo, K. Murase, C. M. Fleet, Y. Jikumaru, E. Nambara, Y. Kamiya, et al. Global Analysis of DELLA Direct Targets in Early Gibberellin Signaling in Arabidopsis PLANT CELL, October 1, 2007; 19(10): 3037 - 3057. [Abstract] [Full Text] [PDF] |
||||
![]() |
I.-C. Jang, S. W. Yang, J.-Y. Yang, and N.-H. Chua Independent and interdependent functions of LAF1 and HFR1 in phytochrome A signaling Genes & Dev., August 15, 2007; 21(16): 2100 - 2111. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ishida, S. Hattori, R. Sano, K. Inoue, Y. Shirano, H. Hayashi, D. Shibata, S. Sato, T. Kato, S. Tabata, et al. Arabidopsis TRANSPARENT TESTA GLABRA2 Is Directly Regulated by R2R3 MYB Transcription Factors and Is Involved in Regulation of GLABRA2 Transcription in Epidermal Differentiation PLANT CELL, August 1, 2007; 19(8): 2531 - 2543. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Macquet, M.-C. Ralet, J. Kronenberger, A. Marion-Poll, and H. M. North In situ, Chemical and Macromolecular Study of the Composition of Arabidopsis thaliana Seed Coat Mucilage Plant Cell Physiol., July 1, 2007; 48(7): 984 - 999. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Dombrecht, G. P. Xue, S. J. Sprague, J. A. Kirkegaard, J. J. Ross, J. B. Reid, G. P. Fitt, N. Sewelam, P. M. Schenk, J. M. Manners, et al. MYC2 Differentially Modulates Diverse Jasmonate-Dependent Functions in Arabidopsis PLANT CELL, July 1, 2007; 19(7): 2225 - 2245. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tominaga, M. Iwata, K. Okada, and T. Wada Functional Analysis of the Epidermal-Specific MYB Genes CAPRICE and WEREWOLF in Arabidopsis PLANT CELL, July 1, 2007; 19(7): 2264 - 2277. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Baumann, M. Perez-Rodriguez, D. Bradley, J. Venail, P. Bailey, H. Jin, R. Koes, K. Roberts, and C. Martin Control of cell and petal morphogenesis by R2R3 MYB transcription factors Development, May 1, 2007; 134(9): 1691 - 1701. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Mano, F. Ogasawara, K. Sato, H. Higo, and Y. Minobe Isolation of a Regulatory Gene of Anthocyanin Biosynthesis in Tuberous Roots of Purple-Fleshed Sweet Potato Plant Physiology, March 1, 2007; 143(3): 1252 - 1268. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Paolocci, M. P. Robbins, L. Madeo, S. Arcioni, S. Martens, and F. Damiani Ectopic Expression of a Basic Helix-Loop-Helix Gene Transactivates Parallel Pathways of Proanthocyanidin Biosynthesis. Structure, Expression Analysis, and Genetic Control of Leucoanthocyanidin 4-Reductase and Anthocyanidin Reductase Genes in Lotus corniculatus Plant Physiology, January 1, 2007; 143(1): 504 - 516. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Churchman, M. L. Brown, N. Kato, V. Kirik, M. Hulskamp, D. Inze, L. De Veylder, J. D. Walker, Z. Zheng, D. G. Oppenheimer, et al. SIAMESE, a Plant-Specific Cell Cycle Regulator, Controls Endoreplication Onset in Arabidopsis thaliana PLANT CELL, November 1, 2006; 18(11): 3145 - 3157. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Takos, F. W. Jaffe, S. R. Jacob, J. Bogs, S. P. Robinson, and A. R. Walker Light-Induced Expression of a MYB Gene Regulates Anthocyanin Biosynthesis in Red Apples Plant Physiology, November 1, 2006; 142(3): 1216 - 1232. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Feller, J. M. Hernandez, and E. Grotewold An ACT-like Domain Participates in the Dimerization of Several Plant Basic-helix-loop-helix Transcription Factors J. Biol. Chem., September 29, 2006; 281(39): 28964 - 28974. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu, K.-F. Xia, J.-C. Zhu, Y.-G. Deng, X.-L. Huang, B.-L. Hu, X. Xu, and Z.-F. Xu The Nightshade Proteinase Inhibitor IIb Gene is Constitutively Expressed in Glandular Trichomes Plant Cell Physiol., September 1, 2006; 47(9): 1274 - 1284. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gan, R. Kumimoto, C. Liu, O. Ratcliffe, H. Yu, and P. Broun GLABROUS INFLORESCENCE STEMS Modulates the Regulation by Gibberellins of Epidermal Differentiation and Shoot Maturation in Arabidopsis PLANT CELL, June 1, 2006; 18(6): 1383 - 1395. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Quattrocchio, W. Verweij, A. Kroon, C. Spelt, J. Mol, and R. Koes PH4 of Petunia Is an R2R3 MYB Protein That Activates Vacuolar Acidification through Interactions with Basic-Helix-Loop-Helix Transcription Factors of the Anthocyanin Pathway PLANT CELL, May 1, 2006; 18(5): 1274 - 1291. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Morita, M. Saitoh, A. Hoshino, E. Nitasaka, and S. Iida Isolation of cDNAs for R2R3-MYB, bHLH and WDR Transcriptional Regulators and Identification of c and ca Mutations Conferring White Flowers in the Japanese Morning Glory Plant Cell Physiol., April 1, 2006; 47(4): 457 - 470. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schwinn, J. Venail, Y. Shang, S. Mackay, V. Alm, E. Butelli, R. Oyama, P. Bailey, K. Davies, and C. Martin A Small Family of MYB-Regulatory Genes Controls Floral Pigmentation Intensity and Patterning in the Genus Antirrhinum PLANT CELL, April 1, 2006; 18(4): 831 - 851. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Sweeney, M. J. Thomson, B. E. Pfeil, and S. McCouch Caught Red-Handed: Rc Encodes a Basic Helix-Loop-Helix Protein Conditioning Red Pericarp in Rice PLANT CELL, February 1, 2006; 18(2): 283 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kurata, T. Ishida, C. Kawabata-Awai, M. Noguchi, S. Hattori, R. Sano, R. Nagasaka, R. Tominaga, Y. Koshino-Kimura, T. Kato, et al. Cell-to-cell movement of the CAPRICE protein in Arabidopsis root epidermal cell differentiation Development, December 15, 2005; 132(24): 5387 - 5398. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Teng, J. Keurentjes, L. Bentsink, M. Koornneef, and S. Smeekens Sucrose-Specific Induction of Anthocyanin Biosynthesis in Arabidopsis Requires the MYB75/PAP1 Gene Plant Physiology, December 1, 2005; 139(4): 1840 - 1852. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-R. Xu, C. Liu, Y.-L. Wang, L.-C. Li, W.-Q. Chen, Z.-H. Xu, and S.-N. Bai Histone acetylation affects expression of cellular patterning genes in the Arabidopsis root epidermis PNAS, October 4, 2005; 102(40): 14469 - 14474. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Jung, M.-J. Han, Y.-S. Lee, Y.-W. Kim, I. Hwang, M.-J. Kim, Y.-K. Kim, B. H. Nahm, and G. An Rice Undeveloped Tapetum1 Is a Major Regulator of Early Tapetum Development PLANT CELL, October 1, 2005; 17(10): 2705 - 2722. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vanderauwera, P. Zimmermann, S. Rombauts, S. Vandenabeele, C. Langebartels, W. Gruissem, D. Inze, and F. Van Breusegem Genome-Wide Analysis of Hydrogen Peroxide-Regulated Gene Expression in Arabidopsis Reveals a High Light-Induced Transcriptional Cluster Involved in Anthocyanin Biosynthesis Plant Physiology, October 1, 2005; 139(2): 806 - 821. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Serna Epidermal cell patterning and differentiation throughout the apical-basal axis of the seedling J. Exp. Bot., August 1, 2005; 56(418): 1983 - 1989. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Koshino-Kimura, T. Wada, T. Tachibana, R. Tsugeki, S. Ishiguro, and K. Okada Regulation of CAPRICE Transcription by MYB Proteins for Root Epidermis Differentiation in Arabidopsis Plant Cell Physiol., June 1, 2005; 46(6): 817 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. V. Symonds, A. V. Godoy, T. Alconada, J. F. Botto, T. E. Juenger, J. J. Casal, and A. M. Lloyd Mapping Quantitative Trait Loci in Multiple Populations of Arabidopsis thaliana Identifies Natural Allelic Variation for Trichome Density Genetics, March 1, 2005; 169(3): 1649 - 1658. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bernhardt, M. Zhao, A. Gonzalez, A. Lloyd, and J. Schiefelbein The bHLH genes GL3 and EGL3 participate in an intercellular regulatory circuit that controls cell patterning in the Arabidopsis root epidermis Development, January 15, 2005; 132(2): 291 - 298. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Hernandez, G. F. Heine, N. G. Irani, A. Feller, M.-G. Kim, T. Matulnik, V. L. Chandler, and E. Grotewold Different Mechanisms Participate in the R-dependent Activity of the R2R3 MYB Transcription Factor C1 J. Biol. Chem., November 12, 2004; 279(46): 48205 - 48213. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Serna A Network of Interacting Factors Triggering Different Cell Fates PLANT CELL, September 1, 2004; 16(9): 2258 - 2263. [Full Text] [PDF] |
||||
![]() |
L. Hennig, W. Gruissem, U. Grossniklaus, and C. Kohler Transcriptional Programs of Early Reproductive Stages in Arabidopsis Plant Physiology, July 1, 2004; 135(3): 1765 - 1775. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Western, D. S. Young, G. H. Dean, W. L. Tan, A. L. Samuels, and G. W. Haughn MUCILAGE-MODIFIED4 Encodes a Putative Pectin Biosynthetic Enzyme Developmentally Regulated by APETALA2, TRANSPARENT TESTA GLABRA1, and GLABRA2 in the Arabidopsis Seed Coat Plant Physiology, January 1, 2004; 134(1): 296 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bernhardt, M. M. Lee, A. Gonzalez, F. Zhang, A. Lloyd, and J. Schiefelbein The bHLH genes GLABRA3 (GL3) andENHANCER OF GLABRA3 (EGL3) specify epidermal cell fate in the Arabidopsis root Development, December 29, 2003; 130(26): 6431 - 6439. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Esch, M. Chen, M. Sanders, M. Hillestad, S. Ndkium, B. Idelkope, J. Neizer, and M. D. Marks A contradictory GLABRA3 allele helps define gene interactions controlling trichome development in Arabidopsis Development, December 15, 2003; 130(24): 5885 - 5894. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-Y. Yang, Y.-M. Kim, S. Lee, P.-S. Song, and M.-S. Soh Overexpression of a Mutant Basic Helix-Loop-Helix Protein HFR1, HFR1-{Delta}N105, Activates a Branch Pathway of Light Signaling in Arabidopsis Plant Physiology, December 1, 2003; 133(4): 1630 - 1642. [Abstract] [Full Text] |
||||
![]() |
P. C. Bailey, C. Martin, G. Toledo-Ortiz, P. H. Quail, E. Huq, M. A. Heim, M. Jakoby, M. Werber, and B. Weisshaar Update on the Basic Helix-Loop-Helix Transcription Factor Gene Family in Arabidopsis thaliana PLANT CELL, November 1, 2003; 15(11): 2497 - 2502. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||