|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 27 August 2003
doi: 10.1242/dev.00686
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Max Planck Institute of Experimental Endocrinology, Hannover, Germany
30625
2 Department of Biochemistry, Baylor College of Medicine, Houston, TX 77030,
USA
3 Institute of Molecular Biology, Medical School Hannover, Hannover, Germany
30625
* Author for correspondence (e-mail: gregor.eichele{at}mpihan.mpg.de)
Accepted 25 June 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Carboxypeptidase Z, Somite, Sclerotome, Pax3, Pax1, Scapula, Rib, Wnt, Cysteine-rich-domain, CRD, AER, Paraxial head mesoderm, Chicken
| Introduction |
|---|
|
|
|---|
CPZ harbors a cysteine-rich-domain (CRD) N-terminal to the catalytic domain
(Song and Fricker, 1997
;
Xin et al., 1998
). A CRD is
characterized by a series of 10 cysteine residues and is found in several
proteins including Frizzled, Frizzled related proteins, Smoothened, the
receptor tyrosine kinase MuSK and CPZ. In the case of Frizzled and Frizzled
related proteins the CRD has been shown to act as a ligand-binding domain for
Wnts (Bhanot et al., 1996
;
Rattner et al., 1997
). Wnt
proteins are secreted molecules involved in many developmental processes
(reviewed by Cadigan and Nusse,
1997
) including patterning of somites and limb development. The
presence of a CRD has implicated CPZ in Wnt signaling during development
(Reznik and Fricker, 2001
).
However, experimental evidence has not yet been provided to support this
proposal.
Somites are segmental units of the paraxial mesoderm. They form by
epithelialization of mesenchymal cell clusters in the anterior region of the
unsegmented paraxial mesoderm. Thereafter, epithelial somites are regionalized
into a ventral compartment, the sclerotome, from which the axial skeleton
forms, and a dorsal compartment, the dermomyotome giving rise to dermis and
skeletal muscle (Keynes and Stern,
1988
). Somite patterning is controlled by signals from adjacent
tissues including the notochord, neural tube, surface ectoderm and lateral
plate mesoderm (Brand-Saberi et al.,
1993
; Pourquie et al.,
1993
; Fan and Tessier-Lavigne,
1994
; Kuratani et al.,
1994
; Spence et al.,
1996
). Several members of the Wnt family are expressed in these
tissues and have been shown to induce the expression of dermamyotomal genes
such as the paired-box transcription factor Pax3
(Fan et al., 1997
;
Cossu and Borello, 1999
).
Sonic hedgehog is another major axial signal that is responsible for induction
and differentiation of the sclerotome
(Marcelle et al., 1999
).
Signaling activity of these secreted proteins may be regulated by proteolytic
processing.
The present study uses a combination of strategies to unravel the developmental function of CPZ. In situ hybridization in chick embryos revealed regionalized expression of CPZ in somites, sclerotome, paraxial head mesoderm and the apical ectodermal ridge. Retrovirus-mediated ectopic CPZ expression in the chick was used to investigate the role of CPZ during embryogenesis. Overexpression in the somites resulted in upregulation of Pax3 in the hypaxial dermomyotome, in a downregulation of Pax1 in cells fated to form the scapula and in a partial loss of the scapula and ribs. CPZ increased Wnt4-mediated induction of the homeobox gene Cdx1 in vitro, and immunoprecipitation experiments showed that the CRD of CPZ can bind to Wnt4. Collectively, these experiments suggest that CPZ has a role in Wnt signaling.
| Materials and methods |
|---|
|
|
|---|
The rest of the ORF was obtained by 5' and 3' RACE-PCR using the SMART RACE cDNA Amplification Kit (Clontech, USA). GenBank accession numbers: chicken CPZ AF351205; murine CPZ AF356844.
Whole-mount in situ hybridization
Whole-mount in situ hybridization (WMISH) and subsequent sectioning of
embryos were carried out as described previously
(Albrecht et al., 1997
). The
entire cCPZ coding region was used as template for riboprobe
synthesis. In situ hybridization analysis on sections was performed as
described previously (Swindell et al.,
2001
). For Pax1, Pax3, myf5, myogenin and MyoD
full-length cDNAs were used as templates for riboprobe production.
Site directed CPZ mutagenesis
A single nucleotide change (G1405 to C1405) was inserted into cCPZ using
the QuikChange site directed mutagenesis protocol (Stratagene). Primers:
5'GCTTTGAAGTTACTGTGCAGGTAGGATGTG3',
5'CACATCCTACCTGCACAGTAACTTCAAAGC3'. This
mutagenesis resulted in a single amino acid change (Glu469 to Gln469). The
corresponding mutation was also inserted into the murine CPZ with the
following primers:
5'GCTTTGAGATCACCGTGCAACTGGGCTGTGTGAAGTTC3',
5'GAACTTCACACAGCCCAGTTGCACGGTGATCTCAAAGC3'.
This nucleotide mutation resulted in the single amino acid change Glu477 to Gln477.
Viral overexpression
Full-length chicken CPZ and mutant chicken CPZ
(cCPZE469Q) were cloned into the RCAS-BPA vector. The
virus was produced and concentrated as described by Logan and Tabin
(Logan and Tabin, 1998
). The
virus was injected into the segmental plate of HH stage 10 embryos at the
level of the presumptive wings (Chaube,
1959
). Injection of the virus to other sites had no effects.
Embryos were then collected for WMISH or Alcian Blue staining at the times
noted.
Skeletal preparations
Day-10 chick embryos were collected and fixed in 5% TCA. Embryos were then
stained with 0.1% Alcian Blue, unspecifically bound dye was washed off with 1%
HCl/70% ethanol, followed by dehydration in 100% ethanol and clearing in
methyl salicylate in order to visualize the skeleton.
Generation of CPZ-expressing cell lines
HEK-293 cells were transfected by lipofection (Effectene, Qiagen) using
linearized pcDNA3.1/myc-HisA (Invitrogen) containing the full-length coding
region of the murine CPZ cDNA either in its native form or carrying a
glutamate to glutamine mutation. Cells were split 24 hours after transfection
and grown in 6-well plates under selective conditions (DMEM, 10% FCS, and 1
mg/ml G418). Clones were tested for native and mutant CPZ expression by
western blot analysis using mouse anti-myc antibody (Invitrogen).
CPZ-containing extracellular matrix (ECM) was prepared as described previously
(Novikova et al., 2000
).
Co-culture assay for detection of Wnt activity and quantitative
RT-PCR
Analyses are based on multiple experiments using different CPZ and
CPZE477Q cell lines. CPZ-expressing HEK-293 cells or wild type
HEK-293 cells were seeded into 6 cm tissue culture dishes and grown for 1 day.
These cultures were always done in duplicate. To generate plates coated with
normal ECM or ECM spiked with CPZ, normal HEK-293 cells or CPZ-producing
HEK-293 cells were detached with 1 mM EDTA in PBS. Into these conditioned
plates were placed either untransfected HEK-293 cells or CPZ-expressing
HEK-293 cells and NIH-3T3 fibroblasts stably transfected with different
Wnt cDNAs (Kispert et al.,
1998
). Equal numbers of HEK-293 and NIH-3T3 cells were used to
give a total cell number of 3x106 cells per plate. HEK-293
and NIH-3T3 cells were cultured for
4 hours after which time ES cells
were seeded on top of these cells as previously described
(Lickert et al., 2000
).
Depending on the Wnt-expressing cell line used and the passage number of the
ES cells, the co-cultures were grown for between 6 and 12 hours. Thereafter,
RNA was isolated with RNAzol (WAK Chemie) and cDNA was generated using
Superscript II Reverse Transcriptase (Invitrogen). Cdx1 expression
levels were detected with quantitative RTPCR as described
(Fruman et al., 2002
) with the
housekeeping gene elongation factor 1 alpha (EF1
) to
standardize Cdx1 expression levels. The following primer pairs were
used: EF1
-forward 5'GTCCCCAGGACACAGAGACTTCA3',
EF1
-reverse 5'AATTCACCAACACCAGCAGCAA3',
Cdx1-forward 5'TACAGCCGGTACATCACTAT CCG3',
Cdx1-reverse 5'CTGTTTCTTCTTGTTTACTTTGCGC3'. Co-cultures
of lacZ-NIH-3T3, untransfected HEK-293 cells and ES cells display
basal levels of Cdx1 expression
(Lickert et al., 2000
). Hence
the increase of Cdx1 expression in the presence of inducers (Wnts,
CPZ) was calculated as the ratio of expression in the presence of inducers and
basal level of expression resulting in a `fold-induction'. The co-culture
experiment were repeated multiple times and data shown in
Fig. 6B are typical.
|
| Results |
|---|
|
|
|---|
|
|
Ectopic expression of CPZ induces Pax3 in the hypaxial
dermomyotome and evokes dysmorphogenesis of scapula and ribs
The expression of cCPZ in somites suggests a role for this enzyme
in the development of the axial skeleton. In order to test this we reasoned
that ectopic expression of CPZ in the chick embryo might specifically affect
the development of these structures. RCAS virus containing the cCPZ
open reading frame was injected into the segmental plate of HH stage 10 chick
embryos in the presumptive wing region. Embryos were harvested 48-60 hours
after injection. In most cases they showed a high level of cCPZ
expression across 2-4 somites and in the lateral plate at the level of the
wing bud (Fig. 3A). Expression
of cCPZ was not seen in the somites on the non-injected side of the
embryo (Fig. 3B,C). Transverse
sections through whole mounts showed that virally mediated cCPZ
expression occurred in epaxial, central and hypaxial dermomyotome but not in
the sclerotome (Fig. 3C). Such
targeted expression to dermomyotome by RCAS virus injected into the segmental
plate has also been reported for sonic hedgehog
(Johnson et al., 1994
). The
ectopic expression of cCPZ in the dermomyotome prompted us to search
for changes of expression of dermamyotomal marker genes. Expression of
myoD, myf5 or myogenin was not changed (n=10 for
each gene, data not shown), but the expression of Pax3 was markedly
affected. At the wing level, Pax3 is normally expressed in the
epaxial portion of the dermomyotome (Fig.
3F). Overexpression of cCPZ in the dermomyotome resulted
in ectopic expression of Pax3 in the hypaxial dermomyotome
(Fig. 3D,F; 16 out of 31
injected embryos). Of note, overexpression of cCPZ in dermomyotome
did not alter either the normal expression of Pax1 in the sclerotome
or, at this stage, induce Pax1 in the dermomyotome (n=10,
data not shown).
|
The appearance of Pax3 mRNA in the hypaxial dermomyotome may
reflect the possibility that ectopic CPZ evokes a change in the fate of
hypaxial mesodermal cells. In turn, this may affect the development of the
scapula blade known to derive from this tissue
(Huang et al., 2000
). In the
chicken, the scapula consists of a head (acromium) and a blade that are
connected by the `neck' of the scapula
(Baumel and Witmer, 1993
;
Ede, 1964
). When
cCPZ-injected embryos were examined at day 10, 55% (12 out of 22
injected embryos) showed a truncation of the scapular blade
(Fig. 4A,B). We also noticed
that ectopic expression of cCPZ causes truncation or loss of rostralmost ribs
(10 out of 22 injected embryos; Fig.
4A,D). Injection of a retrovirus encoding alkaline phosphatase as
a control had no effect on morphogenesis of the scapula or ribs
(n=22, not shown). When embryos injected with
CPZE469Q were allowed to develop to day 10, we observed a
much lower frequency and severity of skeletal malformations (3 out of 22
injected embryos). One embryo had a partial loss of the distalmost part of the
blade of the scapula and the other two embryos exhibited a slight outward
bending of the scapula (not shown).
|
CPZ promotes Wnt4 based gene induction
The above experiments demonstrate striking effects of ectopic CPZ
expression on Pax3 expression in hypaxial dermomyotome. Pax3
had previously been shown to be regulated by Wnt signals
(Fan et al., 1997
). This
finding and the presence of a CRD in CPZ, which in other proteins was shown to
bind Wnt ligands (see Introduction), prompted us to hypothesize that CPZ plays
a role in Wnt signaling. To assess whether CPZ can influence Wnt signaling, we
adapted a paracrine in vitro Wnt assay
(Lickert et al., 2000
). In
this assay transfected Wnt secreting NIH-3T3 feeder cells were cocultured with
murine ES cells. Wnts secreted by the feeder cells induce the homeobox gene
Cdx1 in ES cells. In order to test whether CPZ modulates Wnt
signaling we added HEK-293 cells stably expressing murine CPZ to the culture
and measured Cdx1 induction. All CPZ HEK-293 cell lines generated
exhibited similar levels of CPZ protein expression (see
Fig. 5A for five representative
cell lines). Immunolocalization studies of CPZ-producing HEK-293 cells showed
that CPZ localizes to the endoplasmic reticulum (not shown). Cell extraction
further demonstrated that CPZ is present in the extracellular matrix
(Fig. 5A).
|
CPZ binds to Wnt4 via its cysteine-rich domain
The potentiation of Wnt4 signaling by CPZ raised the question of whether
CPZ can directly bind to Wnt4 and if so, which part of the protein may mediate
this interaction. To answer this questions we performed co-immunoprecipitation
experiments from cells co-expressing HA-tagged Wnt4HA
(Lescher et al., 1998
) and
myc-tagged CPZ (Fig. 6A,
CPZmyc). pcDNA3.1 expression vectors containing the appropriate
ORFs were cotransfected into HEK-293 cells and complexes were precipitated
using anti-HA antibody. Precipitated proteins were separated by PAGE, western
blotted and an antibody directed against the myc-epitope was used to detect
CPZ. Analyses of cell lysates demonstrated that CPZmyc of the
correct size was expressed (Fig.
6B, lane 2). Importantly, analysis of the co-precipitate
demonstrated the presence of a CPZmyc/Wnt4HA complex
(Fig. 6C, lane 2). A myc-tagged
sFRP-2 (Fig. 6A) served as a
positive control [specific binding of sFRP-2 to Wnt4 had been described
previously (Lescher et al.,
1998
)]. As shown in Fig.
6B,C sFRP-2 was produced (lane 1) and co-precipitated with Wnt4
(lane1). CPZmyc/E477Q, bearing the above described inactivating
point mutation, co-precipitated with Wnt4HA suggesting that the
catalytic activity of CPZ is not required for Wnt4 binding
(Fig. 6B,C, lanes 3). However,
the CRD of CPZ is required for the interaction with Wnt4. In the absence of
this domain, as in the constructs CPZ
CRD/myc
(Fig. 6A) and
CPZ
CRD/myc/E477Q, CPZ could not be co-precipitated with
Wnt4HA (Fig. 6C,
lanes 4 and 5) although both mutant proteins were present in the lysate
(Fig. 6B, lanes 4 and 5). In
contrast, Wnt4HA co-precipitated with a CPZ lacking the
carboxypeptidase domain (CPZ
CPD/myc) (see
Fig. 6B,C, lanes 6). None of
the co-immunoprecipitated proteins was unspecifically bound to Protein-G
agarose or was unspecifically precipitated by the anti-HA antibody alone (data
not shown).
Taken together these data suggest that Wnt4 and CPZ can interact, that this interaction is mediated by the CRD of CPZ and that catalytic activity is not required for binding per se (although such activity is obviously required for CPZ function, see above). Since co-precipitation experiments were performed from cell lysates we cannot rule out the possibility that CPZ-Wnt4 complexes contain additional factors mediating CPZWnt4 binding.
| Discussion |
|---|
|
|
|---|
It has previously been shown that hypaxial dermomyotome-derived
Pax1-expressing cells give rise to the scapular blade
(Huang et al., 2000
). In
embryos expressing cCPZ in the dermomyotome, ectopic Pax3
expression was induced in presumptive scapula cells of the hypaxial
dermomyotome, concomitant with a loss of Pax1 expression in the
descendants of these cells. These changes in the gene expression program are
likely to underlie the severe dysmorphogenesis of the blade of the scapula and
of the distal portion of the ribs. Pax3 expression in paraxial
mesoderm is known to be regulated by Wnt signals
(Fan et al., 1997
). Such a Wnt
signal may be affected by ectopically expressed cCPZ. Support for this
possibility comes from our observations that CPZ enhances Wnt4 signaling and
that it binds to Wnt4 via its cysteine-rich domain (CRD). Except for binding
to Wnt4, all effects described in this study require CPZ to be catalytically
active.
CPZ and Wnt signaling
It has recently been suggested that CPZ processes Wnt signals (see
Reznik and Fricker, 2001
).
This view is based on the fact that CPZ harbors a CRD domain. Such a domain is
found in several other proteins (including Frizzled and sFRPs) known to
directly interact with Wnts. The present study provides three lines of
experimental evidence for a distinct role of CPZ in Wnt signaling. First, it
is shown that CPZ potentiates the activation of a Wnt reporter gene,
Cdx1, in an in vitro assay. In addition, ectopic expression of CPZ in
dermomyotome induces Pax3, a Wnt response gene
(Fan et al., 1997
;
Lee et al., 2000
). Finally,
evidence is provided that CPZ binds to Wnt4 and that this interaction occurs
through the CRD of CPZ.
In the following section, we discuss mechanisms by which CPZ could
participate in Wnt signaling. Wnt molecules are locally released from cells,
diffuse into the extracellular space, bind to Frizzled transmembrane receptors
and through a ß-catenin or a `non-canonical' pathway regulate gene
expression (for reviews, see Wodarz and
Nusse, 1998
; Borycki and
Emerson, 2000
). In the extracellular space, Wnts also bind to
soluble Frizzled related proteins (sFRPs) that sequester Wnt from binding to
their cognate receptors (for reviews, see
Wodarz and Nusse, 1998
;
Bejsovec, 2000
;
Pandur et al., 2002
;
Lee et al., 2000
). Where in
this complex inter- and intracellular signaling process could CPZ play a role?
Three obvious, not necessarily mutually exclusive mechanisms of action can be
envisaged. (1) CPZ could degrade components of the extracellular matrix,
thereby enhancing the availability of Wnt molecules [for an example, see
Dhoot et al., 2001
)]. (2) CPZ
could proteolytically process sFRPs and thereby affect their affinity for
Wnts. A precedent for such a mechanism is provided by the BMPs that bind to
chordin which is proteolytically cleaved by the protease BMP-1/tolloid,
allowing BMPs to bind to their cognate receptor (for review, see
Nakayama et al., 2000
). (3)
Wnts and CPZ could directly interact. Our experiments provide evidence for the
latter mechanism, as we show that Wnt4 and CPZ can be co-precipitated from
mammalian cell extracts. Of course, we cannot rule out that other components
are required for a Wnt4-CPZ-interaction to occur. A direct in vitro binding
study could address this issue, but in vitro production or purification of Wnt
proteins has remained elusive. Binding of Wnt4 to CPZ may result in quenching
of Wnt signaling. We deem this less likely, because CPZ does not abolish, but
enhances Wnt4 signaling in our in vitro assay. An additional argument against
a quenching mechanism arises from our observation, that enzymatically inactive
CPZ fails in our functional studies. Quenching would not depend on such a
catalytic activity. Hence we favor a mechanism in which binding of Wnt4 to CPZ
represents a first step followed by proteolytic processing of the Wnt4 ligand.
Song and Fricker (Song and Fricker,
1997
) have shown that CPZ effectively hydrolyses peptides carrying
a C-terminal arginine. Intriguingly, among the three Wnt molecules tested in
our in vitro assay (Wnt1, Wnt3a and Wnt4) only Wnt4 has a C-terminal arginine
and only the combination of Wnt4 and CPZ potentiates Cdx1 induction.
Wnt8C from chicken is the only other Wnt carrying a C-terminal arginine
residue Hume and Dood,
1993
).
Ectopic CPZ expression and the formation of the blade of the scapula
and of ribs
Most of the dermomyotome should give rise to muscles with exception of the
hypaxial dermomyotome at somite levels 17 to 24 from which the blade of the
scapula arises (Huang et al.,
2000
). It has been proposed that downregulation of Pax3
expression in the hypaxial dermomyotome prevents this tissue from committing
to a myogenic fate (Huang et al.,
2000
). Instead, signals from ectoderm would trigger a chondrogenic
fate in the hypaxial dermomyotome, as shown by the finding that cells
descending from this region switch on Pax1
(Huang et al., 2000
). In
embryos expressing CPZ throughout the dermomyotome, Pax3 is
induced in the hypaxial portion of the dermomyotome suggesting that these
cells do not acquire a chondrogenic fate. It has been shown that Wnt
molecules, including Wnt4, induce Pax3 in the presomitic mesoderm
(Fan et al., 1997
;
Lee et al., 2000
). Ectopic
expression of CPZ in the dermomyotome may thus lead to greater activation of a
Wnt signal emanating from surrounding tissues, most probably the ectoderm.
This subsequently causes a change in the developmental fate of this tissue and
thus prevents morphogenesis of the blade of the scapula. At the molecular
level this is reflected by ectopic activation of Pax3 in earlier
stages (HH 21-22) followed by the downregulation of Pax1 in cells
originating from the hypaxial dermomyotome and fated to form the scapula
blade. It remains to be seen whether these changes in Pax gene expression are
indeed causing the observed morphological defects. Of note,
Pax1-/- mice lack part of the spine of the scapula, a
structure homologous to the avian scapular blade
(Wilm et al., 1998
).
Ectopic CPZ expression also results in the partial (i.e. distal) or
complete loss of the rostralmost ribs. Ribs are thought to either exclusively
derive from the sclerotome (Huang et al.,
2000b
; Evans,
2003
) or from sclerotome and dermomyotome
(Kato and Aoyama, 1998
).
Sclerotome normally expresses CPZ and it is thus unlikely that
ectopic CPZ per se causes the observed rib defects. Since ectopic CPZ
is expressed in dermomyotome, one possibility is that this leads to an
excessive or `ectopic' activation of Wnt signaling. In turn, this may
influence the differentiation of the lateral part of the sclerotome, resulting
in partial or complete absence of ribs. If one assumes that part of the ribs
derive from the dermomyotome (Kato and
Aoyama, 1998
), the rib defects can be readily explained along the
lines discussed for the blade of the scapula. Ectopic CPZ may
upregulate Pax3 and thereby abolish rib chondrogenesis.
Function of native CPZ
So far the developmental function of CPZ has been discussed in the context
of overexpression in the dermomyotome. However, CPZ transcripts are
normally expressed in the epithelial somites and in the sclerotome. Because
CPZ protein is secreted, it may also act in tissues adjacent to the
sclerotome. In fact, our in vitro studies find CPZ in the extracellular matrix
of CPZ-producing HEK-293 cells. Since Wnt molecules are also secreted factors
acting over a certain distance (Fan et
al., 1997
) CPZ could encounter Wnts that are released from
surrounding tissues, e.g. the surface ectoderm (see below) or it could
interact with Wnt molecules that are directly expressed in the somites, such
as Wnt5a and Wnt11
(Cauthen et al., 2001
). If one
assumes that CPZ functions in tissue adjacent to the sclerotome, such as in
the dermomyotome or mesenchymal cells in this region, CPZ could interact with
a number of Wnt molecules. Wnt4 is expressed in the dorsal neural
tube of the mouse and chicken embryo as well as the surface ectoderm of the
mouse embryo (Parr et al.,
1993
; Cauthen et al.,
2001
). In addition to Wnt4, several other Wnts are
expressed in, and hence released by, the surface ectoderm, the dorsal neural
tube [e.g. Wnt6 and Wnt7a, (see
Parr et al., 1993
;
Cauthen et al., 2001
;
Tajbakhsh et al., 1998
)], and
in the dermomyotome [e.g. Wnt11 (see Tanda, 1995;
Marcelle et al., 1997
)].
A future challenge remains: the identification of endogenous substrates of CPZ. Although our data suggest that Wnt4 may represent such a substrate, definitive biochemical proof is still lacking. In addition, the relevance of proteolytic processing for binding of Wnts to their cognate receptors remains to be explored.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Albrecht, U., Eichele, G., Helms, J. A. and Lu, H. C.
(1997). Visualization of gene expression patterns by in situ
hybridization. In Molecular and Cellular Methods in Developmental
Toxicology (ed. G. P. Daston), pp.23
-48. Boca Raton: CRC Press.
Baumel, J. J. and Witmer, L. M. (1993).
Osteologia. In Handbook of Avian Anatomy: Nomina Anatomica
Avium (ed. J. J. Baumel), pp.45
-132.Cambridge, Massachusetts: Nuttal
Ornithological Club.
Bejsovec, A. (2000). Wnt signaling: an
embarrassment of receptors. Curr. Biol.
10,919
-922.[CrossRef][Medline]
Bhanot, P., Brink, M., Samos, C. H., Hsieh, J. C., Wang, Y.,
Macke, J. P., Andrew, D., Nathans, J. and Nusse, R. (1996). A
new member of the Frizzled family from Drosophila functions as a Wingless
receptor. Nature 382,225
-230.[CrossRef][Medline]
Borycki, A. G. and Emerson, C. P., Jr (2000).
Multiple tissue interactions and signal transduction pathways control somite
myogenesis. Curr. Top. Dev. Biol.
48,165
-224.[Medline]
Brand-Saberi, B., Ebensperger, C., Wilting, J., Balling, R. and
Christ, B. (1993). The ventralizing effect of the notochord
on somite differentiation in chick embryos. Anat.
Embryol. 188,239
-245.[Medline]
Cadigan, K. M. and Nusse, R. (1997). Wnt
signaling: a common theme in animal development. Genes
Dev. 11,3286
-3305.
Cauthen, C. A., Berdougo, E., Sandler, J. and Burrus, L. W.
(2001). Comparative analysis of the expression patterns of Wnts
and Frizzleds during early myogenesis in the chick embryo. Mech.
Dev. 104,133
-138.[CrossRef][Medline]
Chaube, S. (1959). On axiation and symmetry in
the transplanted wing of the chick. J. Exp. Zool.
140, 29-77.[Medline]
Cossu, G. and Borello, U. (1999). Wnt signaling
and the activation of myogenesis in mammals. EMBO J.
18,6867
-6872.[CrossRef][Medline]
Dhoot, G. K., Gustafsson, M. K., Ai, X., Sun, W., Standiford, D.
M. and Emerson, C. P., Jr (2001). Regulation of Wnt signaling
and embryo patterning by an extracellular sulfatase.
Science 293,1633
-1666.
Ede, D. A. (1964). Bird Structure:
An Approach Through Evolution, Development and Function in the
Fowl. London: Hutchinson Educational.
Evans, D. J. (2003). Contribution of somitic
cells to the avian ribs. Dev. Biol.
256,115
-127.[CrossRef]
Fan, C. M. and Tessier-Lavigne, M. (1994).
Patterning of mammalian somites by surface ectoderm and notochord: evidence
for induction by a hedgehog homolog. Cell
79,1175
-1186.[CrossRef][Medline]
Fan, C. M., Lee, C. S. and Tessier-Lavigne, M.
(1997). A role for WNT proteins in induction of dermomyotome.
Dev. Biol. 191,160
-165.[CrossRef][Medline]
Fricker, L. D. (1998). Carboxypeptidase E/H. In
Handbook of Proteolytic Enzymes (ed. A. J. Barett, N.
D. Rawlings and J. F. Woessner, Jr), pp. 1341-1351.
London: Academic Press.
Fruman, D. A., Ferl, G. Z., An, S. S., Donahue, A. C.,
Satterthwaite, A. B. and Witte, O. N. (2002).
Phosphoinositide 3-kinase and Bruton's tyrosine kinase regulate overlapping
sets of genes in B lymphocytes. Proc. Natl. Acad. Sci.
99,359
-364.
Gossler, A. and Hrabe de Angelis, M. (1998).
Somitogenesis. Curr. Top. Dev. Biol.
38,225
-287.[Medline]
Hamburger, V. and Hamilton, H. L. (1951). A
series of normal stages in the development of the chick. J.
Morphol. 88,49
-92.[CrossRef]
Huang, R., Zhi, Q., Patel, K., Wilting, J. and Christ, B.
(2000). Dual origin and segmental organisation of the avian
scapula. Development
127,3789
-3794.[Abstract]
Huang, R., Zhi, Q., Schmidt, C., Wilting, J., Brand-Saberi, B.
and Christ, B. (2000b). Sclerotomal origin of the ribs.
Development 127,527
-532.[Abstract]
Hume, C. R. and Dodd, J. (1993). Cwnt-8C: a
novel Wnt gene with a potential role in primitive streak formation and
hindbrain organization. Development
119,1147
-1160.[Abstract]
Johnson, R. L., Laufer, E., Riddle, R. D. and Tabin, C.
(1994). Ectopic expression of Sonic hedgehog alters
dorsal-ventral patterning of somites. Cell
79,1165
-1173.[CrossRef][Medline]
Kato, N. and Aoyama, H. (1998). Dermomyotomal
origin of the ribs as revealed by extirpation and transplantation experiments
in chick and quail embryos. Development
125,3437
-3443.[Abstract]
Keynes, R. J. and Stern, C. D. (1988).
Mechanisms of vertebrate segmentation. Development
103,413
-429.[Medline]
Kispert, A., Vainio, S. and McMahon, A. P.
(1998). Wnt4 is a mesenchymal signal for epithelial
transformation of metanephric mesenchyme in the developing kidney.
Development 125,4425
-4234.
Kuratani, S., Martin, J. F., Wawersik, S., Lilly, B., Eichele,
G. and Olson, E. N. (1994). The expression pattern of the
chick homeobox gene gMHox suggests a role in patterning of the limbs and face
and in compartmentalization of somites. Dev. Biol.
161,357
-369.[CrossRef][Medline]
Lee, C. S., Buttitta, L. A., May, N. R., Kispert, A. and Fan, C.
M. (2000). SHH-N upregulates Sfrp2 to mediate its competitive
interaction with WNT1 and WNT4 in the somitic mesoderm.
Development 127,108
-118.
Lescher, B. Haenig, B. and Kispert, A. (1998).
sFRP-2 is a target of the Wnt-4 signaling pathway in the developing
metanephric kidney. Dev. Dyn.
213,440
-451.[CrossRef][Medline]
Lickert, H., Domon, C., Huls, G., Wehrle, C., Duluc, C.,
Clevers, H., Meyer, B. I., Freund, J. N. and Kemler, R.
(2000). Wnt/ß-catenin signaling regulates the expression of
the homeobox gene Cdx1 in embryonic intestine.
Development 127,3805
-3813.[Abstract]
Logan, M. and Tabin, C. (1998). Targeted gene
misexpression in chick limb buds using avian replication-competent
retroviruses. Methods
14,407
-420.[CrossRef][Medline]
Marcelle, C., Stark, M. R. and Bronner-Fraser, M.
(1997). Coordinate actions of BMPs, Wnts, Shh and noggin mediate
patterning of the dorsal somite. Development
124,3955
-3963.[Abstract]
Marcelle, C., Ahlgren, S. and Bronner-Fraser, M.
(1999). In vivo regulation of somite differentiation and
proliferation by Sonic Hedgehog. Dev. Biol.
214,277
-287.[CrossRef][Medline]
Müller, T. S., Ebensperger, C., Neubuser, A., Koseki, H.,
Balling, R., Christ, B. and Wilting, J. (1996). Expression of
avian Pax1 and Pax9 is intrinsically regulated in the pharyngeal endoderm, but
depends on environmental influences in the paraxial mesoderm. Dev.
Biol. 178,403
-417.[CrossRef][Medline]
Nakayama, T., Cui, Y. and Christian, J. L.
(2000). Regulation of BMP/Dpp signaling during embryonic
development. Cell. Mol. Life Sci.
57,943
-956.[CrossRef][Medline]
Novikova, E. G. and Fricker, L. D. (1999).
Purification and characterization of human metallocarboxypeptidase Z.
Biochem. Biophys. Res. Commun.
256,564
-568.[CrossRef][Medline]
Novikova, E. G., Reznik, S. E., Varlamov, O. and Fricker, L.
D. (2000). Carboxypeptidase Z is present in the regulated
secretory pathway and extracellular matrix in cultured cells and in human
tissues. J. Biol. Chem.
275,4865
-4870.
Pandur, P., Maurus, D. and Kuhl, M. (2002).
Increasingly complex: new players enter the Wnt signaling network.
BioEssays 24,881
-884.[CrossRef][Medline]
Parr, B. A., Shea, M. J., Vassileva, G. and McMahon, A. P.
(1993). Mouse Wnt genes exhibit discrete domains of expression in
the early embryonic CNS and limb buds. Development
119,247
-261.[Abstract]
Pourquie, O., Coltey, M., Teillet, M. A., Ordahl, C. and le
Douarin, N. M. (1993). Control of dorsoventral patterning of
somitic derivatives by notochord and floor plate. Proc. Natl. Acad.
Sci. USA 90,5242
-5246.
Qian, Y., Varlamov, O. and Fricker, L. D.
(1999). Glu300 of rat carboxypeptidase E is essential for
enzymatic activity but not substrate binding or routing to the regulated
secretory pathway. J. Biol. Chem.
274,11582
-11586.
Rattner, A., Hsieh, J. C., Smallwood, P. M., Gilbert, D. J.,
Copeland, N. G., Jenkins, N. A. and Nathans, J. (1997). A
family of secreted proteins contains homology to the cysteine-rich
ligand-binding domain of Frizzled receptors. Proc. Natl. Acad. Sci.
USA 94,2859
-2863.
Reznik, S. E. and Fricker, L. D. (2001).
Carboxypeptidases from A to Z: implications in embryonic development and Wnt
binding. Cell. Mol. Life Sci.
58,1790
-1804.[CrossRef][Medline]
Skidgel, R. A. (1988). Basic carboxypeptidases:
regulators of peptide hormone activity. Trends Pharmacol
Sci. 9,299
-304.[CrossRef][Medline]
Song, L. and Fricker, L. D. (1997). Cloning and
expression of human carboxypeptidase Z, a novel metallocarboxypeptidase.
J. Biol. Chem. 272,10543
-10550.
Spence, M. S., Yip, J. and Erickson, C. A.
(1996). The dorsal neural tube organizes the dermomyotome and
induces axial myocytes in the avian embryo.
Development 122,231
-241.[Abstract]
Swindell, E. C., Moeller, C., Thaller, C. and Eichele, G.
(2001). Cloning and expression analysis of chicken Lix1, a
founding member of a novel gene family. Mech. Dev.
109,450
-458.
Tanda, N., Ohuchi, H., Yoshioka, H., Noji, S. and Nohno, T.
(1995). A chicken Wnt gene, Wnt-11, is involved in dermal
development. Biochem. Biophys. Res. Commun.
211,123
-129.[CrossRef][Medline]
Tajbakhsh, S., Borello, U., Vivarelli, E., Kelly, R., Papkoff,
J., Duprez, D., Buckingham, M. and Cossu, G. (1998).
Differential activation of Myf5 and MyoD by different Wnts in explants of
mouse paraxial mesoderm and the later activation of myogenesis in the absence
of Myf5. Development
125,4155
-4162.[Abstract]
Wilm, B., Dahl, E., Peters, H., Balling, R. and Imai, K.
(1998). Targeted disruption of Pax1 defines its null phenotype
and proves haploinsufficiency. Proc. Natl. Acad. Sci.
USA 95,8692
-8697.
Wodarz, A. and Nusse, R. (1998). Mechanisms of
Wnt signaling in development. Annu. Rev. Cell. Dev.
Biol. 14,59
-88.[CrossRef][Medline]
Xin, X., Day, R., Dong, W., Lei, Y. and Fricker, L. D.
(1998). Cloning, sequence analysis, and distribution of rat
metallocarboxypeptidase Z. DNA Cell. Biol.
17,311
-319.[Medline]
This article has been cited by other articles:
![]() |
S. Liu, W. Tang, J. Fang, J. Ren, H. Li, Z. Xiao, and L. D. Quarles Novel Regulators of Fgf23 Expression and Mineralization in Hyp Bone Mol. Endocrinol., September 1, 2009; 23(9): 1505 - 1518. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kuijper, A. Beverdam, C. Kroon, A. Brouwer, S. Candille, G. Barsh, and F. Meijlink Genetics of shoulder girdle formation: roles of Tbx15 and aristaless-like genes Development, April 1, 2005; 132(7): 1601 - 1610. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Jansen, J. S. E. Laven, H. B. R. Dommerholt, J. Polman, C. van Rijt, C. van den Hurk, J. Westland, S. Mosselman, and B. C. J. M. Fauser Abnormal Gene Expression Profiles in Human Ovaries from Polycystic Ovary Syndrome Patients Mol. Endocrinol., December 1, 2004; 18(12): 3050 - 3063. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Knappe, F. Wu, M. R. Madlansacay, and Q. Wu Identification of Domain Structures in the Propeptide of Corin Essential for the Processing of Proatrial Natriuretic Peptide J. Biol. Chem., August 13, 2004; 279(33): 34464 - 34471. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||