|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 September 2003
doi: 10.1242/dev.00678
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 HHMI and Division of Biology, California Institute of Technology, Pasadena, CA
91125, USA
2 Division of Cell Biology, Biozentrum, University of Basel, Klingelbergstr.
50/70, CH-4056 Basel, Switzerland
3 Department of Biosciences at Novum, Karolinska Institutet, Alfred Nobels alle
7, Södertörns Högskola, SE-141 89 Huddinge, Sweden
* Author for correspondence (e-mail: pws{at}caltech.edu)
Accepted 19 June 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Transcriptional regulation, Cell specification, Zinc finger proteins, TEF, RFX factors, Polycystins
| Introduction |
|---|
|
|
|---|
During mating, the C. elegans male scans for the vulva by touching
the hermaphrodite with the ventral side of his tail and backing along her
body. If the vulva is not found, he turns at the hermaphrodite head or tail
and scans the other side (Liu and
Sternberg, 1995
). The male hook sensillum is a copulatory
structure that is located just anterior to the cloaca and mediates vulval
location behavior (Liu and Sternberg,
1995
). Intact wild-type males usually stop at their first or
second vulval encounter. When the hook sensillum is ablated, operated males
circle the hermaphrodite multiple times and fail to stop at the vulva
(Liu and Sternberg, 1995
).
This defect is referred to as the Lov (location of the vulva defective)
phenotype (Barr and Sternberg,
1999
). The hook sensillum consists of five cells, including a
structural cell and two ciliated sensory neurons HOA and HOB
(Sulston et al., 1980
). The
two hook neurons have large nuclei and send dendrites into the hook structure;
however, their anatomy can be distinguished by cell morphology and synaptic
contacts (Sulston et al.,
1980
). Ablation of either HOA or HOB results in a Lov phenotype,
indicating that HOA and HOB have non-redundant functions
(Liu and Sternberg, 1995
).
The C. elegans homologues of human autosomal dominant polycystic
kidney disease genes PKD1 (lov-1) and PKD2
(pkd-2) are expressed in the HOB hook neuron
(Barr and Sternberg, 1999
;
Barr et al., 2001
;
Kaletta et al., 2003
). Human
PKD genes, which encode divergent members of the TRP family of cation
channels, possibly act in signal transduction important for renal epithelial
differentiation, as mutations in PKD1 and PKD2 are associated with pathogenic
renal cyst formation (reviewed by Wu,
2001
). In C. elegans, lov-1 and pkd-2 mutations
disrupt vulva location behavior, consistent with a defect in HOB sensory
function (Barr and Sternberg,
1999
; Barr et al.,
2001
). Although LOV-1 and PKD-2 are localized in sensory cilia and
cell bodies, the ultrastructure of cilia and dendrites appears normal in
lov-1 and pkd-2 mutants
(Barr et al., 2001
).
Another class of genes required for vulva location affects the formation of
ciliated endings in sensory neurons. This class includes che-3, daf-10,
osm-5 and osm-6 (Barr and
Sternberg, 1999
). che-3, osm-5 and osm-6 are
required for most or all sensory cilia
(Lewis and Hodgkin, 1977
;
Perkins et al., 1986
), while
daf-10 only functions in a subset of ciliated sensory neurons
(Albert et al., 1981
). The
hermaphrodite expression of osm-5, a homolog of the mouse autosomal
recessive polycystic kidney disease (ARPKD) gene
(Haycraft et al., 2001
;
Qin et al., 2001
), and
osm-6 has been shown to be regulated by a RFX transcription factor
DAF-19, which plays a critical role in general sensory cilium differentiation
(Swoboda et al., 2000
;
Haycraft et al., 2001
).
We report the isolation of an allele of egl-46, a putative
zinc-finger transcription factor, in a screen for loci required for fate
specification of C. elegans hook neuron HOB. egl-46 was
previously characterized as a gene when mutated affecting the development of
two mechanosensory neurons (FLP cells) (Wu
et al., 2001
), as well as having defects in the hermaphrodite HSN
egg-laying motoneurons (Desai et al.,
1988
; Desai and Horvitz,
1989
). We demonstrate that EGL-46 and the transcription enhancer
factor (TEF) homolog EGL-44 are expressed in the HOB hook neuron and are
required for expression of genes encoding polycystins LOV-1 and PKD-2,
homeodomain protein CEH-26, and neuropeptide-like protein NLP-8.
egl-44 and egl-46 mutants are defective in vulva location
behavior during mating, suggesting compromised normal HOB function. This
HOB-specific pathway is distinct from the DAF-19-regulated general cilia
formation pathway in sensory neurons. We found that daf-19 acts
independently of egl-44 and egl-46 to affect expression of
downstream genes in the HOB-specific program, indicating that general and
cell-specific regulatory factors work in concert to establish cell-specific
features crucial for HOB neuronal function in sensory behavior.
| Materials and methods |
|---|
|
|
|---|
ceh-26 gfp construct
A 6.4 kb fragment of ceh-26 containing 5277 bp 5' flanking
sequence plus coding sequence to the fourth exon was amplified by long-range
PCR using primers P26-22 (GTCCTTTGGCCAATCCCGGGGATCCAGAGCTACTGTTACTTTCAGGGC)
and P26-23 (GCCTGCAGAACATTGGCATGTGGCGTCACGGG). BamHI-digested
pPD95.77 was joined to the ceh-26 fragment by primer extension and
linear amplification (Cassata et al.,
1998
). The product was cut with PstI and circularized to
give plasmid pRFP7. pRFP7 (100 ng/µl) was co-injected with dpy-20
(20 ng/µl) into dpy-20(e2017) hermaphrodites as described
(Mello et al., 1991
).
Integration of a transgenic line yielded strain TB1200 with
ceh-26::gfp integrated transgene chIs1200 linked to
chromosome III. chIs1200 was crossed into him-5(e1490) to
yield strain TB1225.
Mapping, cloning, and complementation test
The sy628 allele was generated by mutagenizing the strain TB1225
carrying the HOB marker ceh-26::gfp with EMS using standard protocols
(Rosenbluth et al., 1983
). In
particular, we picked males descended from each single hermaphrodite daughter
of mutagenized parents and examined them under a conventional epi-fluorescence
microscope for GFP expression. Three-factor mapping of sy628 on
linkage group V used alleles of unc-46, dpy-11, unc-68 and
unc-42: unc-46 (16/16 recombinants) dpy-11 (0/16
recombinants) sy628; dpy-11 (0/44) sy628 (44/44)
unc-42; dpy-11 (4/10) sy628 (6/10) unc-68.
During the mapping experiments, the presence of sy628 mutation was
determined by loss of ceh-26::gfp expression in HOB.
The
0.6 map unit interval between dpy-11 and unc-68
was covered by 17 cosmids, including 97 identified genes or predicted coding
sequences
(www.wormbase.org,
version WS74). The sy628 hermaphrodites had a mild egg-laying
defective (Egl) phenotype. A previously identified gene associated with an Egl
phenotype, egl-46, is located in the middle of that interval. Cosmid
K11G9, which contains the entire egl-46 locus, was injected into the
strain PS3568 ceh-26::gfp; egl-46(sy628) him-5(e1490) at 40
ng/µl using pmyo-2::gfp plasmid pPD118.33 (5.5 ng/µl) as
co-transformation marker (Mello et al.,
1991
). Three stable lines were obtained from individual F1 progeny
that expressed myo-2::gfp in pharynx. Injection of cosmid K11G9
restored the ceh-26::gfp expression in HOB in 76/81 males from three
independent transgenic lines. Injection of another cosmid in the same
interval, F44C4, which contains a different predicted zinc-finger
transcription factor, showed no rescue of HOB expression of
ceh-26::gfp in fourteen stable transgenic lines (n=172).
Those transgenic lines had a nonsex-specific ectopic expression of
ceh-26::gfp in a neuron anterior to HOB, most likely PVT. It is not
clear that this ectopic expression is due to injected F44C4 cosmid or
interaction between pmyo-2::gfp plasmid and F44C4 cosmid. Cosmids
were obtained from the Sanger Institute (Cambridge, UK).
To test for complementation, PS3568 ceh-26::gfp; egl-46(sy628) him-5(e1490) males were crossed to MT2316 egl-46(n1127) hermaphrodites. F1 hermaphrodites with CEH-26::GFP expression were cross progeny, and were examined for an Egl phenotype. F1 males were analyzed by HOB expression of ceh-26::gfp. All 79 sy628/n1127 heterozygous males examined lacked ceh-26::gfp expression in HOB, and heterozygous hermaphrodites were Egl. Thus, sy628 and n1127 fail to complement.
PCR and sequencing
A 2318 bp genomic DNA fragment containing the entire egl-46 coding
region was PCR amplified from sy628 mutant DNA using the pair of
primers 5'-CTCCCCTTCTTGTAAGGTGTCTT-3' and
5'-AATTCACTCAGCAATTTGGAAAA-3'. The PCR products from six
independent PCR reactions were separately purified using QIAquick PCR
purification kit and were pooled together for direct sequencing. Two nested
primers, 5'-TTTCGTTCACATCTACCGTAACC-3' at the 5' end of the
gene and 5'-CGGGGGAAATTGTAAAGAGTTAG-3' at the 3' end, and
two internal primers, the reverse primer
5'-CCTCTTATGTGCCTTCGTTTTG-3' at 109-131 bp of the intron 2 and the
forward primer 5'-GCTAATGACACCGAGAAAACGAAC-3' at 274-297 bp of the
same intron, were used for sequencing. This sequencing therefore did not cover
the 189 bp gap in the intron 2 between reverse and forward primers. The PCR
primers and two outside sequencing primers were picked by an oligo design
program in the C. elegans genome project at the Sanger Institute
(www.sanger.ac.uk/Projects/C_elegans/).
The two internal sequencing primers were obtained using Macvector software
(Oxford Molecular Group). The G-to-A lesion site at nucleotide 165 of the
first exon was observed in both strands.
Transgenics
The N-terminal cfp::egl-46 translational fusion plasmid TU#627 and
yfp::egl-44 fusion plasmid TU#628 were kindly provided by Ji Wu and
Martin Chalfie. Plasmid DNAs of TU#627 and TU#628 were injected separately
into the strain unc-119(ed4); him-5(e1490) at 49 ng/µl. We used 50
ng/µl of pDP#MM016B, a plasmid containing a wild-type copy of the
unc-119 gene, as the co-injection marker. Transgenic animals were
recognized by rescue of the Unc phenotype of unc-119
(Maduro and Pilgrim, 1995
).
Three independent lines were obtained for each construct and the male
expression pattern in those lines was characterized. Transgenic animals
generated with the same CFP and YFP plasmids but with myo-2::gfp as a
transformation marker had similar expression patterns in the male tail.
Mating assay (Vulva location behavior)
The mating behavior of mutant or control males was observed with sluggish
unc-31 adult hermaphrodites. All males were isolated from
hermaphrodites at the L4 stage and were kept on fresh plates in groups of
30 animals before observation. For the mating assay, a virgin adult male
(12-36 hr post L4 lethargus) was placed on a 0.5 cm bacterial lawn with five
24-hour-old unc-31 hermaphrodite adults
(Barr and Sternberg, 1999
;
Garcia et al., 2001
). Each
individual male was watched under a Zeiss Stemi SV11 or Wild M420 `Macroscope'
for ten vulva encounters or until he stopped at the vulva (pausing for more
than 1 second or inserting his spicules), whichever came first. The vulva
location efficiency of individuals for a population was calculated as
described by Barr and Sternberg (Barr and
Sternberg, 1999
). To facilitate calculation, the vulva location
efficiency of males with more than 10 vulva encounters (pass all ten vulva
encounters) was considered to be 0 (actual value
1/11). The Wilcoxon
(Mann-Whitney) test was used to determine statistical significance.
Microscopy
GFP expression was analyzed by conventional fluorescence microscopy (Zeiss
Axioskop) using a Chroma Technology High Q GFP long-pass filter set (450 nm
excitation, 505 nm emission). CFP and YFP were visualized using a Chroma
Technology CFP filter set `31044v2' (exciter D436/20, emitter D480/40,
beamsplitter 455dclp) and an YFP set `41029' (exciter HQ 500/20, emitter
HQ520lp, beamsplitter Q515lp).
| Results |
|---|
|
|
|---|
|
|
|
We confirmed the male phenotypes of the egl-46 mutant using a
different allele, n1127, which alters the splicing donor of intron 2,
located before the region encoding the three zinc fingers of EGL-46 protein
(Wu et al., 2001
).
n1127 and sy628 failed to complement (see Materials and
methods). Desai and Horvitz (Desai and
Horvitz, 1989
) found that n1127 has a decreased male
mating efficiency (
50%). We observed that n1127 males had a Lov
phenotype similar to sy628 mutants
(Fig. 2B). The vulva location
efficiency of n1127 males was 39% (n=17), compared with 94%
(n=16) for the control males. There was a marked decrease of
ceh-26::gfp expression in n1127 HOB neurons
(Table 1). Only two out of 118
n1127 homozygous males examined retained a faint GFP expression in
HOB. No altered expression of ceh-26::gfp was detected in cells other
than HOB in n1127 mutants.
egl-46 regulates cell-specific expression of lov-1
and pkd-2 to specify the behavioral function of the HOB neuron
The hermaphrodite expression pattern of egl-46 has been described
by Wu et al. (Wu et al.,
2001
). Using an egl-46::cfp construct, we analyzed its
expression in males and found a similar pattern for non-sex-specific
expression (such as the FLP cells, ventral cord neurons and PVD). Both HOA and
HOB are born from a single precursor cell (P10.p) at the late L3 stage, and
they differentiate into their neuronal fates during the L4 stage.
egl-46::cfp was expressed in the HOB neuron beginning at the L4 stage
and continuing throughout adulthood (Fig.
3A-D), consistent with the timing of HOB differentiation, and a
potential role in the maintenance of HOB function. No detectable expression
was seen in the HOA hook neuron. The egl-46 mating defect is
reminiscent of ablation of a hook neuron
(Liu and Sternberg, 1995
).
Based on expression of egl-46 gene in a single hook neuron, we infer
that the Lov phenotype of egl-46 mutant males is probably due to
impaired HOB function.
|
We also observed male-specific egl-46::cfp expression in ciliated
ray neurons. The C. elegans male has nine pairs of rays (ray 1-9 for
both the left and right sides), each associated with an A-type neuron and a
B-type neuron (RnA and RnB, n=1-9)
(Sulston et al., 1980
).
egl-46::cfp was observed in one of the two ray neurons for each ray
(Fig. 3D,E); this neuron is
probably a B-type neuron because of its co-localization with
pkd-2::gfp (data not shown), which is known to be expressed in these
neurons (Barr and Sternberg,
1999
). However, egl-46 regulation was not necessary for
lov-1 and pkd-2 expression in ray neurons
(Fig. 1B3). lov-1 and
pkd-2 mutants show deficiencies in both response and vulva location
during mating, correlating with their expression in the B-type ray neurons
(except ray 6) and the HOB hook neuron
(Barr and Sternberg, 1999
;
Barr et al., 2001
). By
contrast, despite egl-46 expression in ray neurons, no obvious defect
in either ray neuron expression of PKD genes or response behavior of the
mating was detected in egl-46 mutant males. egl-46 might
play a major role in HOB sensory specification, but some other factors
function in ray neurons.
egl-44 exhibits a similar Lov defect for male mutants and
may regulate gene expression in HOB
Wu et al. (Wu et al., 2001
)
reported that egl-46 acts with egl-44 to specify subtypes of
mechanosensory neurons, and for HSN development in hermaphrodites
(Desai and Horvitz, 1989
).
egl-44 encodes a transcription enhancer factor of the TEA domain
class (Bürglin, 1991
) and
is orthologous to the mammalian TEF factors
(Wu et al., 2001
). We
therefore examined the behavior of egl-44(n1080) males, and found
that this egl-44 mutation reduced vulva location behavior
(Fig. 2C). Similar to
egl-46 mutants, egl-44 mutant males passed the vulva
frequently and it took an egl-44(n1080) male about five encounters on
average to locate the vulva. Specifically, egl-44 mutant males had an
overall 43% vulva location efficiency, while control males (wild-type for the
egl-44 locus) had an 88% vulva location efficiency.
We determined the male tail expression pattern of the egl-44 gene
with the yfp construct described by Wu et al.
(Wu et al., 2001
). Expression
of egl-44 overlapped with but was not identical to that of
egl-46. At the L4 stage, the four neurons PVX, PVY, HOA and HOB are
positioned in a signature anterior-to-posterior row at the middle left side
(Sulston et al., 1980
).
egl-44::yfp fluorescence was obvious in HOB, PVX and PVY, with HOB
usually the brightest, but was barely visible in HOA
(Fig. 4A,B). As stated above,
egl-46::cfp was only present in HOB. A few neurons anterior to PVX
(e.g. PVV) had faint egl-44::yfp expression, as did several cells
from the B and Y lineage, including PCB, PCC and PCh
(Fig. 4C,D). These cells did
not express egl-46::cfp. In addition, almost all the descendants of
the ray precursor cells (Rn) expressed egl-44::yfp, including the ray
neurons (RnA and RnB) and the ray structure cells (Rnst), all of which are
derived from the anterior daughter Rn.a, as well as posterior daughter Rn.p
hypodermal cells (Fig. 4E,F;
data not shown). EGL-46 showed a more limited expression in the ray lineage.
In adults, egl-44::yfp was still expressed in HOB, RnA, RnB and Rnst
cells. Hypodermal Rn.p cells no longer displayed bright YFP expression in
adults, possibly because of their fusion with the tail hypodermal syncytium.
Owing to dramatic changes in cell shapes and positions during the extensive
male tail remodeling at the L4-adult transition, the faint
egl-44::yfp expression in PCB, PCC and PCh was hard to trace in
adults. Overall, egl-44::yfp was expressed more extensively in the
male tail than was egl-46. However, a mutation in egl-44 did
not result in broader defects in male mating behavior than did an
egl-46 mutation.
|
Even though the egl-46 mutations caused a more severe defect in
HOB gene expression than did an egl-44 mutation, the Lov phenotypes
are similar in male mutants. One possibility is that incomplete decrease of
gene expression in the HOB neuron by the egl-44 mutation could reduce
the HOB function enough to display a comparable Lov phenotype; however, we
cannot rule out the possibility that EGL-44 and EGL-46 might have some
distinct targets in HOB. In addition, the faint EGL-44 expression in the HOA
hook neuron, as well as in the PCB and PCC neurons of the postcloacal
sensilla, might also contribute to the vulva location activity
(Liu and Sternberg, 1995
). The
Lov phenotype is not synergistic in the egl-44; egl-46 double mutant,
and there was no observable difference in the efficiency of vulva location
compared with single mutants (data not shown). By contrast, C.
elegans males with HOB ablated have a 0% vulva location efficiency
(Liu and Sternberg, 1995
).
Both egl-44 and egl-46 mutants had an incomplete loss of
nlp-8::gfp expression, but no further elimination of
nlp-8::gfp expression was seen in an egl-44; egl-46 double
mutant background (Table 1).
This lack of enhancement for the Lov phenotype and a defect in nlp-8
expression indicates that egl-44 and egl-46 act at least
partially in a common pathway for HOB specification. The egl-44;
egl-46 double mutant males seemed less active than each of the single
mutants and took longer to initiate mating behavior, which might be due to
insufficient function of the ray neurons in the double mutant.
egl-44 and egl-46 do not regulate each other's
expression in the HOB neuron
In the non-sex-specific FLP cells, wild-type egl-44 is required
for normal egl-46 expression (Wu
et al., 2001
). To determine whether egl-44 and
egl-46 regulate each other's expression in the HOB neuron, we
introduced an extrachromosomal egl-46::cfp array into an
egl-44 mutant, and an egl-44::yfp array into an
egl-46 mutant. The timing and relative brightness of
egl-46::cfp expression in HOB was not affected in an
egl-44(n1080) mutant background compared with a wild-type background,
but CFP expression in FLP neurons was reduced. Similarly, no change in the HOB
expression of egl-44::yfp was observed in egl-46(sy628)
males. We infer that there is no interdependence of egl-44 and
egl-46 expression in HOB.
The daf-19 general cilium formation pathway is required for
cell-specific features of HOB
Genes that are expressed in HOB and mutate to a Lov phenotype can be
grouped into two separate pathways (Barr
and Sternberg, 1999
) (this work). osm-5 and
osm-6 belong to a general ciliogenic pathway common to all ciliated
neurons, including HOA and HOB (Collet et
al., 1998
; Qin et al.,
2001
). The other genes discussed above, including egl-44,
egl-46, lov-1 and pkd-2, define a program specific for HOB
differentiation. We thus asked if there are any interactions between these two
pathways; i.e., whether regulators in the cell-specific pathway,
egl-44 and egl-46, affect the HOB expression of the general
cilium structure genes (osm-5 and osm-6), and whether
ciliogenesis might be a prerequisite for execution of an HOB-specific
program.
In wild-type males, OSM-5::GFP and OSM-6::GFP are expressed in the cell
bodies and dendrites of HOA and HOB at the late L4 stage; their then
expression decreases, which is coincident with the formation of ciliated
sensory endings in these two neurons
(Collet et al., 1998
;
Qin et al., 2001
). Using an
integrated osm-6::gfp line (mnIs17) and an extrachromosomal
array carrying osm-5::gfp, we found that the HOB expression of these
two GFPs at the L4 stage in egl-44(n1080) and egl-46(sy628)
mutants was comparable with wild-type
(Table 1;
Fig. 1C1-C4).
osm-5::gfp expression in HOA and HOB was also not affected by
egl-46(n1127) (Table
1). In these egl-44 and egl-46 mutant males, the
HOB dendritic process, visualized by osm-5::gfp or
osm-6::gfp, was extended correctly into the male hook. Neither
egl-44(n1080) nor egl-46(sy628) mutants had dye-filling
defects (data not shown). We conclude that mutation of either egl-44
or egl-46 impedes neither gross cell morphology nor the ultimate
neuronal outgrowth and wiring of HOB.
Qin et al. (Qin et al.,
2001
) showed that an osm-5 mutation affects subcellular
localization of LOV-1 and PKD-2, but not their expression. We found that
ceh-26::gfp expression was not affected in osm-5(p813)
animals. Therefore, it is unlikely that establishment of the HOB-specific
program depends on the activities of downstream structure genes (such as
OSM-5) in the ciliogenic pathway. The RFX transcription factor DAF-19 is a key
upstream regulator of general ciliogenesis
(Swoboda et al., 2000
;
Haycraft et al., 2001
). In the
male tail, we observed exclusively nuclear-localized GFP expression of
daf-19 in male-specific ciliated sensory neurons, including the two
hook neurons (Fig. 5A,B) and
the 36 ray neurons. The fluorescence in HOA was usually fainter than in HOB.
We observed no difference in the HOB expression of daf-19::gfp in
egl-44 or egl-46 mutants compared with wild type
(Fig. 5C,D). We then analyzed
egl-44::yfp and egl-46::cfp in daf-19(m86) mutant
males, and found that the timing and relative brightness of expression in HOB
was similar to daf-19(+) animals. We infer that, during HOB
differentiation, egl-44 and egl-46 are expressed
independently of a general cilium formation pathway governed by
daf-19.
|
DAF-19 has been proposed to act on the X-box motifs in the
cis-regulatory regions of downstream target genes to regulate their
transcription (Swoboda et al.,
2000
). So far, 5' regions of demonstrated DAF-19 target
genes all harbor the X boxes in close proximity to the coding region (the
typical spacing is within less than 200 nucleotides upstream). As expected
from this hypothesis, expression of X-box-containing osm-6::gfp in
the hook and ray neurons was not detected in daf-19 mutants
(n=68) (Fig. 1C5). A
single X-box sequence is located at about 1.3 kb upstream of the ATG start
codon of egl-46. This relatively upstream X box in egl-46
promoter was apparently not a functional target site, as egl-46::cfp
expression was not altered in daf-19 mutants. We found no matches to
C. elegans X-box consensus sequences in the 5' regions, introns
and immediate 3' regions of ceh-26, lov-1, pkd-2 and
nlp-8. Regulation of ceh-26, pkd-2 and nlp-8 by
daf-19 is thus likely to be indirect and mediated by some unknown
factor(s), which is probably cell-type specific.
| Discussion |
|---|
|
|
|---|
|
Previous studies suggested that daf-19 is only required for genes
functioning in common aspects of cilium formation
(Swoboda et al., 2000
). We
provide the first evidence that daf-19 is required for the expression
of some cell-type-specific factors. We propose that daf-19 acts
through some unknown factor(s) [which could be an X-box containing gene(s)] to
modify HOB-specific gene expression. We observed stronger daf-19::gfp
expression in HOB than in HOA, but whether it is associated with additional
daf-19 regulation of HOB-specific gene expression is not known. This
daf-19 regulation is not limited to the HOB neuron as daf-19
also affects pkd-2 expression in the ray neurons and CEM neurons,
indicating some general features are common in this subtype of ciliated
sensory neurons. Coupled regulation of general neuronal features and
cell-specific identities by multiple transcriptional factors has been found in
several different organisms, such as specification of the C. elegans
AIY interneuron (Altun-Gultekin et al.,
2001
), C. elegans olfactory neurons
(Troemel et al., 1997
) and
vertebrate motoneurons (Novitch et al.,
2001
; Zhou and Anderson,
2002
), and thus might be a general aspect of the logic of neuronal
cell type specification.
Both male hook neurons, HOA and HOB, play a role in vulva location
behavior. They both detect the presence of a hermaphrodite vulva, and then
produce a distinctive output. This output causes the male to stop at the vulva
and to proceed to the next step of mating
(Liu and Sternberg, 1995
) (M.
M. Barr and P.W.S., unpublished). One possible explanation for the functional
non-redundancy of HOA and HOB is that they possess different sensory
specificity, and hence respond to different cues from the vulva. Another
possibility is HOA and HOB might receive the same cues at different times.
egl-44 is broadly expressed in many cells of the male tail, but its
expression is almost undetectable in HOA. None of the other genes, including
egl-46 and its downstream targets in the HOB-specific program
described here, is expressed in HOA. The unequal expression of those genes in
the two hook neurons provides molecular evidence supporting distinct roles for
HOA and HOB in mating.
EGL-46 and EGL-44 regulation in HOB sensory function
egl-46 mutations result in an extra cell division in the terminal
differentiation of the C. elegans Q neuroblast lineage
(Desai and Horvitz, 1989
).
Loss of either egl-44 or egl-46 function does not cause a
cell division defect or a failure in establishment of primary ciliated neural
fate during HOB specification. This was determined by anatomical examination
and by expression of the cilium structure genes, osm-5 and
osm-6. In the non-sex-specific FLP cells, it has been shown that
egl-44 and egl-46 act as transcriptional repressors
(Wu et al., 2001
). They
promote the correct subtype of mechanosensory neurons by suppressing
expression of genes dedicated to another subtype. Possible positive roles in
gene transcription are implicated for egl-44 and egl-46 in
the HSN neurons, but no target has been identified
(Desai and Horvitz, 1989
;
Wu et al., 2001
). Our data
suggest a positive effect of egl-44 and egl-46 on the
expression of downstream HOB-specific genes. However, we have not ruled out
that EGL-44 and EGL-46 activate gene expression in HOB by repression of a
repressor of HOB-specific genes.
We propose that the sensory abilities of the HOB neuron are established by
individual cell-specific components regulated by egl-44 and
egl-46. One of these components, ceh-26, is the C.
elegans ortholog of Drosophila prospero (pros) gene
(Bürglin, 1994
).
pros is involved in the initiation of differentiation in specific
neurons following asymmetric cell division
(Hirata et al., 1995
;
Broadus et al., 1998
;
Manning and Doe, 1999
).
However, expression of ceh-26 in HOB is not coupled with cell
division. Instead, it is expressed at a much later stage, after basic features
of cell fate have been established. Similar to HOB, ray B neurons express both
egl-44 and egl-46, but unlike HOB, these neurons do not
express ceh-26::gfp. Therefore, we think that co-expression of
egl-44 and egl-46 is not sufficient to activate
ceh-26::gfp in HOB and additional co-factors are also required. The
other downstream components, lov-1, pkd-2 and nlp-8, encode
proteins that are probably involved in HOB sensory input and output. LOV-1 and
PKD-2 accumulate in the sensory cilia and have been proposed to act in a
complex; a working model is that LOV-1 is a sensory receptor and PKD-2 is a
channel protein (Barr et al.,
2001
; Koulen et al.,
2002
). Neuropeptide-like protein NLP-8 might act as a
neurotransmitter or neuromodulator released by HOB to mediate the response to
the stimuli from the hermaphrodite vulva.
Potential mechanosensory and chemosensory interactions between the male and
the hermaphrodite during mating is implied by the vulva location behavior
itself, as well as by the requirement of functional ciliated sensory endings
in the two hook neurons. Whether HOB is a mechanical sensor or a chemical
sensor or both, as is the case for the polymodal ASH neuron
(Kaplan and Horvitz, 1993
), is
not known. Because egl-44 and egl-46 distinguish between
mechanosensory neuron subtypes during FLP fate specification, it is possible
that these two genes regulate downstream targets that confer mechanosensory
ability to the HOB neuron. If so, as members of TRP protein gene family,
lov-1 and pkd-2 might be such targets. Known examples of TRP
proteins that play a role in mechanotransduction include a C. elegans
TRP protein OSM-9 and the Drosophila TRP-like NOMPC protein
(Colbert et al., 1997
;
Walker et al., 2000
). Both of
these TRP proteins are expressed in mechanosensory neurons and are involved in
mechanosensory response.
Transcriptional regulation of polycystins and polycystic kidney
disease
Human PKD1 and PKD2 were identified as two loci responsible for the
autosomal dominant polycystic kidney disease (ADPKD), a genetic disorder that
causes renal failure at various ages of adulthood (reviewed by
Gabow, 1993
;
Wu, 2001
). Relatively little
is known about the regulation of these PKD genes and possible alterations
during the disease process. In this work, we showed that expression of C.
elegans PKD gene homologs, lov-1 and pkd-2, is affected
by transcription factors egl-44 and egl-46. The mammalian
TEF proteins, homologous to egl-44, have been implicated in multiple
developmental processes (Chen et al.,
1994
; Jacquemin et al.,
1996
). Specific expression in kidney was reported for multiple
members of TEF proteins (Jacquemin et al.,
1996
; Kaneko et al.,
1997
; Jacquemin et al.,
1998
). C. elegans EGL-46 belongs to a novel zinc-finger
protein subfamily. Identified close mammalian homologs of egl-46
includes insulinoma associated (IA) proteins, implicated in islet
differentiation of the pancreas, and murine MLT 1 protein, silenced in the
liver tumors (Goto et al.,
1992
; Tateno et al.,
2001
), but their possible roles in the kidney have not been
investigated. Progressive cyst formation in ADPKD is not restricted to kidney:
involvement of the liver and the pancreas occurs, indicating that those organs
suffer similar pathogenesis during progression of the disease
(Gabow, 1993
;
Chauveau et al., 2000
). The
demonstrated gene regulation network in HOB might reveal important insights
into the regulation of human polycystin gene expression.
The dependence of ciliogenesis for the function of PKD-2 may be even more
relevant to renal development in mammals. In C. elegans, the ARPKD
homolog osm-5 is a direct target of the RFX factor DAF-19
(Haycraft et al., 2001
),
making the requirement of DAF-19 activity for pkd-2 expression
particularly interesting with regard to the link between ADPKD and ARPKD.
Mammalian polycystins and the cilia of the kidney cells might participate in a
common signaling pathway crucial for renal differentiation and function. This
hypothesis implies that RFX factor(s) might play a role in the renal
development.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Albert, P. S., Brown, S. J. and Riddle, D. L.
(1981). Sensory control of dauer larva formation in C.
elegans. J. Comp. Neurol. 198,
435-451.
Altun-Gultekin, Z., Andachi, Y., Tsalik, E. L., Pilgrim, D.,
Kohara, Y. and Hobert, O. (2001). A regulatory cascade of
three homeobox genes, ceh-10, ttx-3 and ceh-23, controls
cell fate specification of a defined interneuron class in C. elegans.
Development 128,1951
-1969.
Barr, M. M. and Sternberg, P. W. (1999). A
polycystic kidney-disease gene homologue required for male mating behavior in
C. elegans. Nature
401,386
-389.[CrossRef][Medline]
Barr, M. M., DeModena, J., Braun, D., Nguyen, C. Q., Hall, D. H.
and Sternberg, P. W. (2001). The Caenorhabditis
elegans autosomal dominant polycystic kidney disease gene homologs
lov-1 and pkd-2 act in the same pathway. Curr.
Biol. 11,1341
-1346.[CrossRef][Medline]
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Broadus, J., Fuerstenberg, S. and Doe, C. Q.
(1998). Staufen-dependent localization of prospero mRNA
contributes to neuroblast daughter-cell fate. Nature
391,792
-795.[CrossRef][Medline]
Bürglin, T. R. (1991). The TEA domain: a
novel, highly conserved DNA-binding motif. Cell
66, 11-12.[CrossRef][Medline]
Bürglin, T. R. (1994). A
Caenorhabditis elegans prospero homologue defines a novel domain.
Trends Biochem. Sci. 19,70
-71.[CrossRef][Medline]
Cassata, G., Kagoshima, H., Prétôt, R. F.,
Aspöck, G., Niklaus, G., and Bürglin, T. R. (1998).
Rapid expression screening of C. elegans homeobox genes using a
2-step PCR promoter-GFP reporter construction technique.
Gene 212,127
-135.[CrossRef][Medline]
Chalfie, M. (1995). The differentiation and
function of the touch receptor neurons of Caenorhabditis elegans.
Prog. Brain Res. 105,179
-182.[Medline]
Chauveau, D., Fakhouri, F. and Grunfeld, J. P.
(2000). Liver involvement in autosomal-dominant polycystic kidney
disease: therapeutic dilemma. J. Am. Soc. Nephrol.
11,1767
-1775.
Chen, Z., Friedrich, G. A. and Soriano, P.
(1994). Transcriptional enhancer factor 1 disruption by a
retroviral gene trap leads to heart defects and embryonic lethality in mice.
Genes Dev. 8,2293
-2301.
Colbert, H. A., Smith, T. L. and Bargmann, C. I.
(1997). OSM-9, a novel protein with structural similarity to
channels, is required for olfaction, mechanosensation, and olfactory
adaptation in Caenorhabditis elegans. J.
Neurosci. 17,8259
-8269.
Collet, J., Spike, C. A., Lundquist, E. A., Shaw, J. E. and
Herman, R. K. (1998). Analysis of osm-6, a gene that
affects sensory cilium structure and sensory neuron function in
Caenorhabditis elegans. Genetics
148,187
-200.
Desai, C. and Horvitz, H. R. (1989).
Caenorhabditis elegans mutants defective in the functioning of the
motor neurons responsible for egg laying. Genetics
121,703
-721.
Desai, C., Garriga, G., McIntire, S. L. and Horvitz, H. R.
(1988). A genetic pathway for the development of the
Caenorhabditis elegans HSN motor neurons.
Nature 336,638
-646.[CrossRef][Medline]
Dusenbery, D. B. (1980). Chemotactic behavior
of mutants of the nematode C. elegans that are defective in osmotic
avoidance. J. Comp. Physiol.
137, 93-96.[CrossRef]
Ferguson, E. L. and Horvitz, H. R. (1985).
Identification and characterization of 22 genes that affect the vulval cell
lineages of the nematode C. elegans. Genetics
110, 17-72.
Gabow, P. A. (1993). Autosomal dominant
polycystic kidney disease. New Engl. J. Med.
329,332
-342.
Garcia, L. R., and Sternberg, P. W. (2003).
C. elegans UNC-103 ERG-like potassium channel regulates contractile
behaviors of sex muscles in males prior to and during mating. J.
Neurosci. 23,2696
-2705.
Garcia, L. R., Mehta, P. and Sternberg, P. W.
(2001). Regulation of distinct muscle behaviors controls the
C. elegans male's copulatory spicules during mating.
Cell 107,777
-788.[CrossRef][Medline]
Goto, Y., de Silva, M. G., Toscani, A., Prabhakar, B. S.,
Notkins, A. L. and Lan, M. S. (1992). A novel human
insulinoma-associated cDNA, IA-1, encodes a protein with
"zinc-finger" DNA-binding motifs. J. Biol.
Chem. 267,15252
-15257.
Haycraft, C. J., Swoboda, P., Taulman, P. D., Thomas, J. H. and
Yoder, B. K. (2001). The C. elegans homolog of the
murine cystic kidney disease gene Tg737 functions in a ciliogenic
pathway and is disrupted in osm-5 mutant worms.
Development 128,1493
-1505.[Abstract]
Hirata, J., Nakagoshi, H., Nabeshima, Y. and Matsuzaki, F.
(1995). Asymmetric segregation of the homeodomain protein
Prospero during Drosophila development.
Nature 377,627
-630.[CrossRef][Medline]
Hodgkin, J., Horvitz, H. R. and Brenner, S.
(1979). Nondisjunction mutants of the nematode C.
elegans. Genetics
91, 67-94.
Jacquemin, P., Hwang, J. J., Martial, J. A., Dolle, P. and
Davidson, I. (1996). A novel family of developmentally
regulated mammalian transcription factors containing the TEA/ATTS DNA binding
domain. J. Biol. Chem.
271,21775
-21785.
Jacquemin, P., Sapin, V., Alsat, E., Evain-Brion, D., Dolle, P.
and Davidson, I. (1998). Differential expression of the TEF
family of transcription factors in the murine placenta and during
differentiation of primary human trophoblasts in vitro.
Dev. Dyn. 12,423
-436.
Kaletta, T., van Der Craen, M., van Geel, A., Dewulf, N.,
Bogaert, T., Branden, M., King, K. V., Buechner, M., Barstead, R., Hyink, D.,
Li, H. P., Geng, L., Burrow, C. and Wilson, P. (2003).
Towards understanding the polycystins. Nephron.
93, E9-E17
Kaneko, K. J., Cullinan, E. B., Latham, K. E. and DePamphilis,
M. L. (1997). Transcription factor mTEAD-2 is selectively
expressed at the beginning of zygotic gene expression in the mouse.
Development 124,1963
-1973.[Abstract]
Kaplan, J. M. and Horvitz, H. R. (1993). A dual
mechanosensory and chemosensory neuron in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. USA
90,2227
-2231.
Koulen, P., Cai, Y., Geng, L., Maeda, Y., Nishimura, S.,
Witzgall, R., Ehrlich, B. E. and Somlo, S. (2002).
Polycystin-2 is an intracellular calcium release channel. Nat. Cell
Biol. 4,191
-197.[CrossRef][Medline]
Lewis, J. A. and Hodgkin, J. A. (1977).
Specific neuroanatomical changes in chemosensory mutants of the nematode
C. elegans. J. Comp. Neurol.
172,489
-510.[CrossRef][Medline]
Lewis, J. A., Wu, C. H., Berg, H. and Levine, J. H.
(1980). The genetics of levamisole resistance in the nematode
C. elegans. Genetics
95,905
-928.
Liu, K. S. and Sternberg, P. W. (1995). Sensory
regulation of male mating behavior in Caenorhabditis elegans.
Neuron 14,79
-89.[CrossRef][Medline]
Loer, C. M. and Kenyon, C. J. (1993).
Serotonin-deficient mutants and male mating-behavior in the nematode
Caenorhabditis elegans. J. Neurosci.
13,5407
-5417.[Abstract]
Maduro, M. F. and Pilgrim, D. B. (1995).
Identification and cloning of unc-119, a gene expressed in the
Caenorhabditis elegans nervous system.
Genetics 141,977
-988.[Abstract]
Manning, L. and Doe, C. Q. (1999). Prospero
distinguishes sibling cell fate without asymmetric localization in the
Drosophila adult external sense organ lineage.
Development 126,2063
-2071.[Abstract]
Mello, C. C., Kramer, J. M., Stinchcomb, D. and Ambros, V.
(1991). Efficient gene transfer in C. elegans:
Extrachromosomal maintenance and integration of transforming sequences.
EMBO J. 10,3959
-3970.[Medline]
Nathoo, A. N., Moeller, R. A., Westlund, B. A. and Hart, A.
C. (2001). Identification of neuropeptide-like
protein gene families in Caenorhabditis elegans and other species.
Proc. Natl. Acad. Sci. USA
98,14000
-14005.
Novitch, B. G., Chen, A. I. and Jessell, T. M.
(2001). Coordinate regulation of motor neuron subtype identity
and pan-neuronal properties by the bHLH repressor Olig2.
Neuron 31,773
-789.[CrossRef][Medline]
Perkins, L. A., Hedgecock, E. M., Thomson, J. N. and Culotti, J.
G. (1986). Mutant sensory cilia in the nematode C.
elegans. Dev. Biol.
117,456
-487.[CrossRef][Medline]
Qin, H., Rosenbaum, J. L. and Barr, M. M.
(2001). An autosomal recessive polycystic kidney disease gene
homolog is involved in intraflagellar transport in C. elegans
ciliated sensory neurons. Curr. Biol.
11,457
-461.[CrossRef][Medline]
Riddle, D. L. and Brenner, S. (1978). Indirect
suppression in C. elegans. Genetics
89,299
-314.
Rosenbluth, R. E., Cuddeford, C. and Baillie, D. L.
(1983). Mutagenesis in Caenorhabditis elegans. I. A
rapid eukaryotic mutagen test system using the reciprocal translocation
eT1(III;V). Mutat. Res.
110, 39-48.
Schnabel, H. and Schnabel, R. (1990). An
organ-specific differentiation gene, pha-1, from Caenorhabditis
elegans. Science
250,686
-688.
Sulston, J. E. (1983). Neuronal cell lineages
in the nematode C. elegans. Cold Spring Harb. Symp. Quant.
Biol. 48,443
-452.
Sulston, J. E., Albertson, D. G. and Thomson, J. N.
(1980). The C. elegans male: postembryonic development
of nongonadal structures. Dev. Biol.
78,542
-576.[CrossRef][Medline]
Sulston, J. E. and Horvitz, H. R. (1977).
Post-embryonic cell lineages of the nematode, Caenorhabditis elegans.
Dev. Biol. 56,110
-156.[CrossRef][Medline]
Sulston, J. E. and White, J. G. (1980).
Regulation and cell autonomy during postembryonic development of C.
elegans. Dev. Biol.
78,577
-597.[CrossRef][Medline]
Swoboda, P., Adler, H. T. and Thomas, J. H.
(2000). The RFX-type transcription factor DAF-19 regulates
sensory neuron cilium formation in C. elegans. Mol.
Cell 5,411
-421.[CrossRef][Medline]
Tateno, M., Fukunishi, Y., Komatsu, S., Okazaki, Y., Kawai, J.,
Shibata, K., M., I., Muramatsu, M., Held, W. A. and Hayashizaki, Y.
(2001). Identification of a novel member of the
snail/Gfi-1 repressor family, mlt 1, which is methylated and
silenced in liver tumors of SV40 T antigen transgenic mice. Cancer
Res. 61,1144
-1153.
Troemel, E. R., Kimmel, B. E. and Bargmann, C. I.
(1997). Reprogramming chemotaxis responses: sensory neurons
define olfactory preferences in C. elegans.
Cell 91,161
-169.[CrossRef][Medline]
Walker, R. G., Willingham, A. T. and Zuker, C. S.
(2000). A Drosophila mechanosensory transduction
channel. Science 287,2229
-2234.
White, J. G. (1986). The structure of the
nervous system of Caenorhabditis elegans. Philos. Trans.
R. Soc. Lond. B. Biol. Sci. 314,1
-340.[CrossRef]
Wu, G. (2001). Current advances in molecular
genetics of autosomal-dominant polycystic kidney disease. Curr.
Opin. Nephrol. Hypertens. 10,23
-31.[CrossRef][Medline]
Wu, J., Duggan, A. and Chalfie, M. (2001).
Inhibition of touch cell fate by egl-44 and egl-46 in C.
elegans. Genes Dev.
15,789
-802.
Zhou, Q. and Anderson, D. J. (2002). The bHLH
transcription factors OLIG2 and OLIG1 couple neuronal and glial subtype
specification. Cell 109,61
-73.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
R. Jovelin Rapid Sequence Evolution of Transcription Factors Controlling Neuron Differentiation in Caenorhabditis Mol. Biol. Evol., October 1, 2009; 26(10): 2373 - 2386. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Lan and M. B. Breslin Structure, expression, and biological function of INSM1 transcription factor in neuroendocrine differentiation FASEB J, July 1, 2009; 23(7): 2024 - 2033. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Karakuzu, D. P. Wang, and S. Cameron MIG-32 and SPAT-3A are PRC1 homologs that control neuronal migration in Caenorhabditis elegans Development, March 15, 2009; 136(6): 943 - 953. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sawada, H. Kiyonari, K. Ukita, N. Nishioka, Y. Imuta, and H. Sasaki Redundant Roles of Tead1 and Tead2 in Notochord Development and the Regulation of Cell Proliferation and Survival Mol. Cell. Biol., May 15, 2008; 28(10): 3177 - 3189. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Efimenko, K. Bubb, H. Y. Mak, T. Holzman, M. R. Leroux, G. Ruvkun, J. H. Thomas, and P. Swoboda Analysis of xbx genes in C. elegans Development, April 15, 2005; 132(8): 1923 - 1934. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T.F. Wolf, J. Lee, F. Panther, E. A. Otto, K.-L. Guan, and F. Hildebrandt Expression and Phenotype Analysis of the Nephrocystin-1 and Nephrocystin-4 Homologs in Caenorhabditis elegans J. Am. Soc. Nephrol., March 1, 2005; 16(3): 676 - 687. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||