spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 24 September 2003
doi: 10.1242/dev.00759


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow All Versions of this Article:
dev.00759v1
130/22/5413    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gaengel, K.
Right arrow Articles by Mlodzik, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gaengel, K.
Right arrow Articles by Mlodzik, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 130, 5413-5423 (2003)
Copyright © 2003 The Company of Biologists Limited

Egfr signaling regulates ommatidial rotation and cell motility in the Drosophila eye via MAPK/Pnt signaling and the Ras effector Canoe/AF6

Konstantin Gaengel and Marek Mlodzik*

Mount Sinai School of Medicine, Brookdale Department of Molecular, Cell and Developmental Biology, 1 Gustave L. Levy Place, New York, NY 10029, USA

* Author for correspondence (e-mail: marek.mlodzik{at}mssm.edu)

Accepted 29 July 2003


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Epidermal Growth Factor-receptor (Egfr) signaling is evolutionarily conserved and controls a variety of different cellular processes. In Drosophila these include proliferation, patterning, cell-fate determination, migration and survival. Here we provide evidence for a new role of Egfr signaling in controlling ommatidial rotation during planar cell polarity (PCP) establishment in the Drosophila eye. Although the signaling pathways involved in PCP establishment and photoreceptor cell-type specification are beginning to be unraveled, very little is known about the associated 90° rotation process. One of the few rotation-specific mutations known is roulette (rlt) in which ommatidia rotate to a random degree, often more than 90°. Here we show that rlt is a rotation-specific allele of the inhibitory Egfr ligand Argos and that modulation of Egfr activity shows defects in ommatidial rotation. Our data indicate that, beside the Raf/MAPK cascade, the Ras effector Canoe/AF6 acts downstream of Egfr/Ras and provides a link from Egfr to cytoskeletal elements in this developmentally regulated cell motility process. We provide further evidence for an involvement of cadherins and non-muscle myosin II as downstream components controlling rotation. In particular, the involvement of the cadherin Flamingo, a PCP gene, downstream of Egfr signaling provides the first link between PCP establishment and the Egfr pathway.

Key words: Canoe/AF6, Egfr, Ommatidial rotation, Planar cell polarity (PCP), roulette (rlt), Argos, Flamingo


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Epithelial planar cell polarity (PCP) in the Drosophila eye is generated when immature ommatidial preclusters acquire opposite chirality in the dorsal and ventral halves of the eye imaginal disc and subsequently rotate 90° towards the dorsoventral midline, the equator (Adler, 2002Go; Mlodzik, 1999Go; Mlodzik, 2002Go; Reifegerste and Moses, 1999Go). The signaling pathways that regulate the establishment of ommatidial chirality are beginning to be understood and require the specification of distinct cell fates within the R3/R4 photoreceptor pair. This is generated through an interplay of Frizzled (Fz)/PCP and Notch signaling. Fz/PCP signaling induces R3 and leads to the expression of the Notch ligand Delta in R3. Delta subsequently activates Notch in the neighboring cell, specifying it as R4 (Cooper and Bray, 1999Go; Fanto and Mlodzik, 1999Go; Tomlinson and Struhl, 1999Go). The direction of the subsequent rotation follows the cell-type specification of the R3/R4 photoreceptors (Adler, 2002Go; Mlodzik, 2002Go). However, in fz and other PCP mutants as well as in Notch the mechanistic aspects of rotation are not abolished (Adler, 2002Go; Mlodzik, 1999Go; Mlodzik, 2002Go; Reifegerste and Moses, 1999Go), suggesting that other signaling pathways and mechanisms regulate the cell motility aspects of rotation.

During this process each ommatidium rotates 90° towards the equator and thus in opposite directions in the dorsal and ventral halves. This morphogenetic event is remarkable, as it requires groups of cells to undergo a coordinated precise movement: cells of each ommatidial precluster stick together and move as a unit with respect to the surrounding epithelial cells (Mlodzik, 1999Go; Reifegerste and Moses, 1999Go). The rotation of ommatidial preclusters is initiated in the third instar eye imaginal disc, shortly after the Fz/PCP-Notch signaling interplay specifies cell fate, and is visibly appreciated around column 6 posterior to the morphogenetic furrow (see Fig. 1A-C). It is completed by column 15-18 approximately 20-24 hours later. During this process, the rotation angles of individual ommatidia can be visualized with markers that highlight either the R3/R4 precursor pair or the R1/R6 pair. Interestingly, ommatidial rotation appears to be a two-step process as clusters stop for 3-4 columns after undergoing the first 45° rotation and before initiating the second 45° to complete the 90° rotation. In the adult eye the rotation is represented in the precise mirror image arrangement of the two chiral ommatidial forms that face each other on opposite sites of the equator (see Fig. 1D,E).



View larger version (91K):
[in this window]
[in a new window]
 
Fig. 1. The roulette mutant is an allele of the Egfr-ligand argos. Panels show eye imaginal discs (A-C) or adult eye sections (D-I). Anterior is left and dorsal up. (A) Eye-imaginal disc stained with anti-Elav (red, all photoreceptor precursors) and m{delta}0.5-lacZ (blue, R4 precursors) shown as an overlay with a Nomarski optics bright-field view of same disc. The dorsoventral midline, equator (Eq), is marked by white broken line, the position of the morphogenetic furrow (MF) is indicated. (B) Higher magnification of boxed area from A also showing anti-Boss (green, marking the central R8 cell in each cluster). Note regular arrangement and orientation of ommatidial clusters. Overlay of the red and blue channels is for clarity shown in blue. (C) Semi-schematic presentation of ommatidial rotation (generated from real clusters shown in A,B with the `solarize' filter of Adobe Photoshop). Representative clusters for the dorsal and ventral halves are shown. Colors are as in B. R3/R4 photoreceptor precursors are indicated by white numbers. Ommatidial preclusters represent examples from columns 4, 5, 7, 9, 12 and 15, respectively. Yellow arrows indicate rotation of clusters. The rotation angle of individual clusters is indicated above the panel. The `base' of arrows indicates the R3/R4 axis and the arrowheads point towards the middle of cluster. Note successive changes in the rotation angles to the complete 90°. (D) Examples of mature adult ommatidia with numbered photoreceptor rhabdomeres (R1-R7; R8 is below the plane of section) and schematic arrows as shown in E-I. Black arrow: dorsal ommatidium; red arrow: ventral ommatidium. (E-I) Tangential sections of equatorial region of adult eyes with schematic presentations below sections. (E) wild-type (wt), (F) argos-roulette (aosrlt/aosrlt), (G) aosrlt/aos{Delta}7, (H) aosrlt/Df(3L)st7P, (I) sev-aos/+; aosrlt/aosrlt. Note that aosrlt fails to complement aos alleles and that sev-aos fully rescues the aosrlt phenotype. Ommatidia with a wt photoreceptor number are represented by arrows with flags; clusters with extra photoreceptors are indicated by simple arrows.

 
Very little is known about the regulation and mechanistic aspects of ommatidial rotation as only a few mutants that specifically affect this process have been isolated. In such `rotation specific' mutations both the direction of rotation and associated chirality-R3/R4 specification are unaffected, whereas the degree of rotation of individual ommatidial clusters is abnormal. Mutations falling into this category include nemo (nmo) (Choi and Benzer, 1994Go), roulette (rlt) (Choi and Benzer, 1994Go), rok (the Drosophila Rho-kinase) (Winter et al., 2001Go) and scabrous (sca) (Chou and Chien, 2002Go).

The requirement of rok in ommatidial rotation provides the only link to the Fz/PCP pathway as Rho-kinase acts downstream of RhoA in several cellular contexts. Particularly in the Drosophila wing, rok has been shown to act downstream of Fz/Dishevelled and RhoA in PCP establishment, affecting wing hair number (2-3 cell) but not their orientation (Winter et al., 2001Go). rok has been reported to affect rotation (and photoreceptor number), but not the R3/R4 cell fate decision (which is equivalent to wing hair orientation). This might suggest that some aspects of wing hair growth and rotation are shared through similar regulatory input into cytoskeletal regulation.

The nmo gene encodes a distant member of the Map kinase family, and in nmo mutants most ommatidia arrest at a rotation angle of approximately 45°, failing to execute the second 45° turn (Choi and Benzer, 1994Go). In sca, mutant clusters generally rotate more than 90° (Chou and Chien, 2002Go). In contrast, rlt mutant ommatidia rotate both less and more than the normal 90° (approximately 50% each) (see Fig. 1F), suggesting a general regulatory role in this process. The observation that nmo is epistatic to rlt and that nmo, rlt double mutants show the nmo phenotype (with ommatidia arresting at around 45°), lead to the hypothesis that rlt is required to stop rotation (Choi and Benzer, 1994Go).

Here we show that rlt is a rotation-specific allele of the Egfr-inhibitory ligand Argos. Both reduction and increase in Egfr signaling lead to defects in ommatidial rotation, suggesting that Egfr signaling is generally required to regulate this process. Using a combination of mutant analysis, genetic interactions and specific Ras-effector loop mutations we have identified both the Raf/MAPK cascade and the novel Ras effector Canoe/AF6 as a mediator of Egfr/Ras signaling in this process (Kuriyama et al., 1996Go). Our data indicate that Canoe/AF6 provides a link from Egfr to cytoskeletal elements in this developmentally regulated cell motility process. Furthermore, we provide evidence that Egfr signaling acts on cell adhesion via effects through the cadherin Flamingo, thus providing a link between Egfr and the PCP genes.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Fly stocks
If not otherwise mentioned, fly stocks are as described in Flybase (http://flybase.bio.indiana.edu/), provided by The Bloomington Stock Center (http://flystocks.bio.indiana.edu/). The wild-type (WT) stock used was OregonR. rlt1 and nemoP1 mutants were kindly provided by K.W. Choi (Choi and Benzer, 1994Go). The argosW11, argos{Delta}7 flies (Freeman et al., 1992Go) were kindly provided by C. Klaembt and sevargos by M. Freeman (Freeman, 1994Go). Deficiencies used that failed to complement the rlt rough eye phenotype were: Df(3L)st7P, Df(3L)st-j7, Df(3L)st-f13, Df(3L)81k19, Df(3L)st7, whereas the adjacent deficiencies Df(3L)D-5rv12, Df(3L)th102, Df(3L)std11, Df(3L)w10, Df(3L)cat and deficiencies more proximal or distal to the 70C-75F interval did complement rlt.

The Egfr alleles top1 and EgfrEC20 (Clifford and Schupbach, 1989Go), as well as the S48-5 allele and UAS-{lambda}-top (Queenan et al., 1997Go) were kindly provided by T. Schupbach. UAS-PI3K and Dp110A flies were from Sally Leevers (Leevers et al., 1996Go). The GMR-RalG23V flies are as published (Sawamoto et al., 1999Go). The cnoMis1 allele (Miyamoto et al., 1995Go) was provided by D. Yamamoto. UAS-cno, cno2, cno3 (Matsuo et al., 1997Go) and the UAS-RasV12 isoforms (Karim and Rubin, 1998Go) were kindly provided by U. Gaul. The signaling specificity of the RasV12 effector loop isoforms was confirmed in Drosophila (Karim and Rubin, 1998Go; Prober and Edgar, 2002Go).

Embedding and sectioning of eyes was performed as described (Tomlinson, 1987). Crosses were performed at 25°C (except for aosw11 at 18°C). Multiple eyes were sectioned and analyzed for each genotype.

Molecular characterization of the rlt mutation
The hypomorphic behavior of the rlt allele and the absence of any other obvious phenotype led us to the conclusion that rlt is probably a regulatory mutant of aos. As regulatory mutations often affect untranslated regions of a gene, whereas the protein is not altered, we analyzed the genomic aos region in homozygous rlt flies using overlapping PCR primers. Two of the overlapping primer sets gave PCR products that were approximately 1 kb larger than the WT control. Sequencing of these PCR products revealed a truncated P-element inserted in the 5' UTR of aos within the proposed transcriptional start site at bp 55 according to the published aos sequence M91381. Primers used to amplify the truncated P-element from genomic DNA were: 5' CACAGACACGCACATACCG 3' and 5' CCCTCGCTCTATCGTTGTTC 3'.

Generation of the m{Delta}0.5-Gal4 construct
The m{Delta}0.5-Gal4 construct was generated by cloning a XhoI-EcoRI m{Delta}0.5-fragment (PCR amplified from a plasmid, kindly provided by S. Bray using primers: 5'-CCGCTCGAGTGCCATCAGATGTCAGCAAATG-3' and 5'-CGGAATTCCTTTTGGCGCACAGTCACAC-3') upstream of an EcoRI-BamHI fragment containing the P-element minimal-promoter (PCR amplified from pCasper 4 using the primers: 5'-CGGAATTCAAAGCCGAAGCTTACCGAAGT-3' and 5'-CGGGATCCTTTTTTTTTATTCCACGTAAGG-3').

The Gal4 gene was added as a BamHI-NotI fragment (from pGaTB). The final construct was cloned as an Asp718-NotI fragment from pBSSK into pCasper4. Several fly lines were established according to standard procedures. m{Delta}0.5-Gal4 drives expression mainly in R4 (and also weaker early in R3 and later in R7), as confirmed by ablation experiments and expression of an UAS-GFP transgene.

Immunofluorescence
Imaginal discs were dissected, fixed and stained as described (Freeman et al., 1992Go). Antibodies used were: rat anti-Elav (1:50), mouse anti-Boss (1:1000) (from Developmental Studies Hybridoma Bank), rabbit anti-Bar (1:100) (a generous gift from K. Saigo) (Higashijima et al., 1992Go), mouse anti-Fmi (1:10) (gift from Tadashi Uemura), rat anti-DE-cadherin (DCAD2, 1:20) (gift from H. Oda) (Oda et al., 1994Go) and mouse (Promega) or rabbit anti-ßGal (Molecular Probes) (1:2000). Images were acquired on a Leica TCSSP (UV) confocal microscope and processed in Adobe Photoshop.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
rlt is a rotation-specific allele of argos
We mapped rlt, originally described as a spontaneous mutation on chromosome III (Choi and Benzer, 1994Go), by complementation analysis with overlapping deficiencies to the 72D10-73B1 interval on chromosome 3L (not shown). Complementation analysis with candidate genes within this region revealed that alleles of the secreted Egfr inhibitory ligand argos (Freeman et al., 1992Go) failed to complement rlt (Fig. 1G). Transheterozygous rlt/aos and rlt/Df(3L)st7P(aos) flies displayed a very similar phenotype with rotation defects resembling homozygous rlt flies (Fig. 1G,H). In addition, the extra photoreceptor cell phenotype reported in a small number of rlt ommatidia (Choi and Benzer, 1994Go) is enhanced in rlt/aos and rlt/Df(3L)st7P(aos) combinations (Fig. 1G,H). This is intriguing, as the most prominent phenotype of aos null clones and strong hypomorphic alleles are 1-2 extra photoreceptors per ommatidium caused by a lack of Egfr inhibition (Freeman et al., 1992Go). Thus, in complementation analysis rlt behaves as a hypomorphic allele of aos.

To confirm these results we attempted to rescue rlt with an argos transgene. The sev-argos transgene rescues the argos loss-of-function (LOF) eye phenotype and has no dominant effect on eye development (Freeman, 1994Go). Strikingly, sevargos completely rescued the rlt eye phenotype to WT (Fig. 1I). These data indicated that rlt is a hypomorphic, rotation-specific allele of aos. In addition, molecular analysis of aosrlt revealed an insertion of a truncated P-element in the 5' untranslated region within the proposed transcription start site of aos (see Materials and methods for details), indicating that rlt is most probably a regulatory mutation of aos. We will subsequently refer to the rlt allele as aosrlt.

rlt and argos discs exhibit rotation defects
To refine the phenotypic features of aosrlt we have analyzed aosrlt eye imaginal discs using markers that highlight cell-type identity and orientation of each cluster at the time when chirality is being established and ommatidial rotation takes place (Fig. 2 and not shown). Whereas in WT discs a fairly regular pattern is observed with all markers (Fig. 2A,C and not shown; see Figure legend for markers), in aosrlt discs many clusters reveal rotation abnormalities (Fig. 2B,D). We observe clusters that are both overrotated and underrotated with respect to their neighbors and developmental stage (Fig. 2B,D). Discs of the strong aosw11 allele showed, in addition to the extra R-cell phenotype, even more severe rotation defects (Fig. 2E), again indicating that aos is generally required during ommatidial rotation. Based on the relatively regular appearance of the first svp-lacZ and Bar-positive rows (Fig. 2B,D), it appears that the initial 45° rotation step is less affected.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 2. Eye imaginal discs mutant for argos or canoe exhibit defects in ommatidial rotation. Panels show a dorsal field of third instar eye imaginal discs, anterior is left and dorsal up. Discs in A,B are double-stained with anti-Elav (red; all photoreceptors) and svp-lacZ (green; marking R3/R4 and R1/R6). (C-F) Double-labeled with anti-Bar (red; labeling R1/R6) and anti-Boss (green; marking R8). With these markers rotation angles can be unambiguously determined and are schematically shown with arrows below each panel (arrows are drawn according to Fig. 1C). (A,C) wild-type, (B,D) aosrlt/aosrlt, (E) aosw11/aosw11. Note misrotations in both aos alleles. (F) cnomis1/cnomis1. Discs were costained with anti-Elav to ensure that rotation abnormalities are not because of photoreceptor loss (blue channel, not shown).

 
We found no evidence for an aos effect on the R3/R4 cell-fate decision and ommatidial chirality, as the expression of the m{Delta}0.5lacZ marker, highlighting the R4 photoreceptor, appears normal within the R3/R4 pair (not shown; see below). Thus we conclude that argos is generally required for the process of ommatidial rotation, but has no effect on chirality and associated R3/R4 cell-fate decisions.

Ommatidial rotation is controlled by Egfr signaling
The requirement of Argos as an inhibitory ligand of Egfr (Jin et al., 2000Go) and the identification of argosrlt suggested that Egfr signaling plays a critical role in ommatidial rotation. As Egfr is very pleiotropic with multiple requirements throughout development and eye patterning in particular (Bogdan and Klambt, 2001Go; Casci and Freeman, 1999Go; Freeman, 1997Go; Schweitzer and Shilo, 1997Go; Van Buskirk and Schupbach, 1999Go), it is not possible to analyze the role of Egfr in ommatidial rotation using mitotic clones of null alleles. However, hypomorphic alleles of Egfr allow the analysis of rotation defects. Eyes of the Egfrtop1 allele (Clifford and Schupbach, 1989Go), for example, are mildly rough and reveal, beside the expected photoreceptor loss (Freeman, 1997Go), many ommatidia with rotation defects (Fig. 3A). Similarly, rotation is affected in hetero-allelic Egfrtop1/EgfrEC20 combinations (Fig. 3B).



View larger version (100K):
[in this window]
[in a new window]
 
Fig. 3. Reduction in Egfr signaling affects ommatidial rotation. Panels show tangential adult eye sections around the equator and corresponding schemes reflecting ommatidial rotation. Orientation and arrows are as in Fig. 1, `circles' represent ommatidia with loss of photoreceptors that cannot be unambiguously scored (`asterisk' indicates the rare event of a symmetrical ommatidium). (A) Egfrtop1/Egfrtop1, (B) Egfrtop1/EgfrtopEC20. The hypomorphic Egfrtop1 allele and Egfrtop1/EgfrEC20 allelic combination show typical rotation defects. Reduction of Egfr activity in Star/+ causes rotation defects and is dominantly enhanced by components of Egfr signaling. Star is haplo-insufficient for eye development (note rare photoreceptor loss and rotation defects). The rotation defects are dominantly enhanced by removal of components of the Egfr/Ras pathway (compare C with D,E). Note that canoe, flamingo and zipper heterozygosity also enhances the S/+ phenotype (see Table 1 for other genotypes and quantification). (C) S48-5/+, (D) S48-5/+, Egfrtop1/+, (E) S48-5/+; ras1e2F/+, (F) S48-5/+; cno2/+, (G) S48-5/+; fmiE59/+, (H) S48-5/+; zipper02957/+.

 
Further evidence for an involvement of Egfr signaling in ommatidial rotation came from the analysis of Star (S) mutants. Star is a chaperone required for processing of the secreted Egfr ligand Spitz (Lee et al., 2001Go), and Egfr signaling is thus reduced in S mutants. S is haplo-insufficient for eye development and loss of one gene copy leads to a rough eye phenotype because of the reduction in Egfr activation (Kolodkin et al., 1994Go). S–/+ eyes show a very mild loss of photoreceptors and, in addition, rotation abnormalities (Fig. 3C). Interestingly, the S–/+ rotation phenotype is enhanced when one copy of Egfr or Ras is removed (Fig. 3D,E, Table 1), and is suppressed by aosrlt heterozygosity (not shown). In addition, we see a specific dominant enhancement of the S–/+ rotation phenotype by the removal of one copy of spitz, whereas the other known Egfr ligands vein and gurken had no effect (Table 1), suggesting that Spitz is the activating Egfr ligand in this context. The recently described Egfr ligand Keren could not be tested, because no mutants are available (Reich and Shilo, 2002Go). Taken together, these observations indicate that Egfr/Ras signaling is directly involved in regulating ommatidial rotation, a requirement that is masked by other effects seen in null clones or severe hypomorphic mutations.


View this table:
[in this window]
[in a new window]
 
Table 1. Genetic interactions with the Star haploinsufficient rough eye phenotype

 
Egfr affects rotation through the Ras/MAPK/Pointed cascade
Because loss of the inhibitory ligand Aos results in gain of Egfr signaling, we asked if reduction of Egfr signaling components could suppress the rotation defects in aosrlt. Given that the argos rough eye phenotype is dosage-sensitive to Egfr-signaling components (Sawamoto et al., 1996Go), we analyzed aosrlt flies in a heterozygous background of Egfr or its downstream effectors to obtain an insight into the effector pathways employed in ommatidial rotation. We found that the rotation defects in aosrlt eyes were suppressed in an Egfrtop1/+ or Rase2F/+ and pnt{Delta}88/+ background (Fig. 4), arguing for a requirement of the conserved Ras/MAPK/Pnt cascade in rotation downstream of Egfr. This is further supported by the fact that aos is a direct transcriptional target of the ETS domain transcription factor Pointed (pnt), which is itself activated by the MAPK Rolled (Golembo et al., 1996Go). Surprisingly, removing one copy of raf and rl/Mapk did not suppress the rotation defects of aosrlt (not shown), suggesting that these kinases are not rate limiting in this process. Nevertheless, the facts that pnt acts as the strongest suppressor of aosrlt and that Pnt is activated by Rl/MAPK argue for a requirement of the conserved Ras/MAPK/Pnt pathway in rotation. In addition, removal of one copy of the nmo gene also suppresses the aosrlt phenotype (Fig. 4E), suggesting a link between Egfr signaling and nmo. This is in line with previous observations proposing that nmo is epistatic to rlt: the nmo, rlt double mutant exhibits a nmo phenotype (Choi and Benzer, 1994Go).



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 4. aosrlt is dominantly suppressed by components of the Egfr pathway and nemo. Panels show tangential adult eye sections through equatorial regions and corresponding schematic drawings indicating ommatidial rotation. Orientation and arrows are as in Fig. 1, `stars' indicate rare event of symmetrical ommatidia. (A) aosrlt/aosrlt. (B) Egfrtop1/+; aosrlt/aosrlt, (C) ras1e2F/+, aosrlt/aosrlt. (D) pnt{Delta}88/+; aosrlt/aosrlt. (E) nmoP1/+, aosrlt/aosrlt.

 
Ras-effector loop mutants identify additional Egfr effectors in rotation
As ommatidial rotation is a cell motility process requiring cytoskeletal rearrangements, we wondered if other effectors of Egfr beside the Raf/MAPK cascade play a role in this process. The Ras GTPase, the main transducer of Egfr signaling, can utilize distinct effectors in different contexts. In addition to nuclear signaling, mediated by the Raf/MAPK/Pnt cascade, Ras can affect cell growth and cytoskeletal rearrangements via its effectors Rgl/Ral, Phospho-inositol-3-Kinase (PI3K) and Canoe, whose human homologue (AF6) is known as the critical partner of ALL1 in a chimeric protein associated with myeloid leukemia (Joneson et al., 1996Go; Karim and Rubin, 1998Go; Kuriyama et al., 1996Go; Prasad et al., 1993Go; Prober and Edgar, 2002Go; Rodriguez-Viciana et al., 1997Go).

Several point mutations have been identified within the Raseffector loop (amino acids 34-41) that abrogate the binding to and activation by Ras of specific effectors (Joneson et al., 1996Go; Karim and Rubin, 1998Go; Rodriguez-Viciana et al., 1997Go) (see also Fig. 5). The specificity of the existing Ras-effector loop mutations has been thoroughly tested in Drosophila imaginal discs (Prober and Edgar, 2002Go). Prober and Edgar show that RasV12[S35], able to interact with Raf in cell culture, can activate ERK/Rolled (via Raf) and induce Ras/Raf/ERK-specific transcriptional responses in wing and eye imaginal discs (figures 3,7 in Prober and Edgar) (Prober and Edgar, 2002Go). In contrast, RasV12[G37], unable to bind Raf in cell culture, cannot activate these responses, but is still capable of activating PI3K-specific read-outs (figures 3,7 in Prober and Edgar) (Prober and Edgar, 2002Go). Therefore we tested the Raseffector loop mutations in constitutively activated RasV12 for their effects on ommatidial rotation.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 5. Expression of Ras-effector loop mutations affects ommatidial rotation. (A-F) Tangential sections of adult eyes through equatorial regions and corresponding schematic drawings indicating ommatidial rotation. Orientation, arrows and circles are as in Figs 1, 3. (A) m{delta}0.5Gal4>UAS-RasV12 (A similar, but weaker effect was generated by activated Egfr {{lambda}-top} under m{delta}0.5Gal4 control; not shown), (B) m{delta}0.5Gal4>UAS-RasV12[S35]. (C) m{delta}0.5Gal4>UAS-RasV12[G37], (D) m{delta}0.5Gal4>UAS-RasV12[C40], (E) sevGal4>UASRasV12[G37], (F) sevGal4>UAS-RasV12[C40].

 
Expression of RasV12 in developing photoreceptor precursor cells using common eye-specific drivers causes induction of many extra photoreceptors (Fortini et al., 1992Go), and thus does not allow the analysis of rotation (the orientation of individual ommatidial clusters cannot be determined unambiguously in the presence of extra photoreceptor cells). To circumvent this problem RasV12 and its effector loop isoforms were expressed in a limited photoreceptor subset after these have been determined as photoreceptors using the m{Delta}0.5-Gal4 driver (see Materials and methods for detail). RasV12 effects on photoreceptor number and fate were thus strongly reduced. To determine the full effect of activated Ras expression under the control m{Delta}0.5-Gal4, we expressed constitutively active RasV12 that activates all known Ras-effectors. This gave rise to eyes with some gain and loss of photoreceptors and severe misrotations (Fig. 5A). The equivalent expression of RasV12[S35], thought to activate mainly Raf, also resulted in rotation abnormalities and occasional gain or loss of photoreceptors, again supporting a requirement of the Raf/MAPK cascade (Fig. 5B).

Strikingly, expression of RasV12[G37] and RasV12[C40] also caused misrotations, suggesting an involvement of additional Ras-effectors in this process. In particular, RasV12[G37], in which Raf activation is abolished (or at least strongly reduced), resulted in severe rotation defects (Fig. 5C,E), suggesting that PI3K, Rgl/Ral or Canoe might play a role in this cell motility process. Similarly, RasV12[C40], eliminating Raf activation, but maintaining weaker activation of other effectors, also showed rotation abnormalities, albeit weaker than RasV12[G37] (Fig. 5D). Moreover, expression of RasV12[C40] under the control of the sevenless (sev) promoter (in R3/R4, R1/R6 and R7) resulted in strong rotation defects that were comparable to those seen with RasV12[G37] under sev control (Fig. 5E,F). Taken together, these data suggested an involvement of PI3K, Rgl/Ral or Canoe in ommatidial rotation.

Canoe is involved in ommatidial rotation
To confirm the RasV12[G37] effect and determine which of the three known effectors activated by RasV12[G37] is required in ommatidial rotation, we analyzed PI3K, Ral and Canoe directly. UAS-PI3K expressed under m{Delta}0.5-Gal4 had no effect on rotation (not shown), suggesting that PI3K is not required in this process. This is further supported by the lack of rotation defects in dPI3K mutant clones (Leevers et al., 1996Go). In contrast, expression of activated Ral (Sawamoto et al., 1999Go) as well as m{Delta}0.5-Gal4>UAS-Cno exhibits rotation defects (Fig. 6A and not shown).



View larger version (78K):
[in this window]
[in a new window]
 
Fig. 6. Effects of Ral and Canoe on ommatidial rotation. (A,B) Tangential sections of adult eyes. An equatorial region is shown with the corresponding schematic presentation. Arrows and circles are drawn as in Figs 1, 3. (A) GMR-RalG23V (an activated isoform of Ral); (B) cnomis1/cno2, a subviable hypomorphic allelic combination. Note the severe rotation defects in the cno mutant background.

 
We next tested for a direct canoe (cno) requirement in ommatidial rotation using LOF alleles. First, we asked whether cno heterozygosity could interact with the S48-5/+ rotation phenotype. Strikingly, similar to the enhancement observed with Egfr or Ras, the cno2/+ and cno3/+ genotypes enhanced the S48-5/+ rotation phenotype (Fig. 3F, Table 1 and not shown). cno is required for cone cell and photoreceptor differentiation and thus clones of null and strong alleles cause a general disorganization of the eye (Miyamoto et al., 1995Go) and are difficult to analyze for rotation defects. However, the hypomorphic cnomis1 allele is subviable in trans to the strong alleles cno2 and cno3 with mildly rough eyes, allowing an analysis of ommatidial rotation. Eye sections of such transheterozygous cno flies (e.g. cnomis1/cno2) reveal severe rotation defects (Fig. 6B). To test whether such defects are already observed at the time when rotation takes place, we analyzed cno mutant third instar eye discs. Strikingly, rotation defects, comparable in strength to the stronger aos alleles, are apparent in cno eye imaginal discs (Fig. 2F). The discs were counterstained with anti-Elav (not shown) to ensure that the photoreceptor complement is normal in such cno mutant discs and the observed rotation abnormalities are primary defects, which was indeed confirmed. A similar analysis of Ral/Rgl is precluded by the lack of suitable alleles. In summary, these data indicate that cno plays a critical role in ommatidial rotation and acts as an effector of Egfr/Ras signaling in this context (see also Discussion).

Effects of Egfr signaling on cell adhesion components during ommatidial rotation
As ommatidial rotation is a cell biological event, it is probable that among the main read-outs affected are cell-adhesion properties of the precluster cells and effects on cytoskeletal elements. This is further supported by our observations that (1) Raf/MAPK-independent and thus transcription-independent Egfr/Ras signaling pathways are important, and (2) that canoe is required in this context. To address this further, we performed two sets of experiments. First, we tested for genetic interactions between the dosage-sensitive Star/+ rotation phenotype and selected factors required in cell adhesion and cytoskeletal regulation; and second, we directly analyzed whether cell-adhesion components such as cadherins and integrins are normally localized in aosrlt and cnoMis1 mutant backgrounds.

To specifically test the involvement of cytoskeletal elements and adhesion as well as junctional components, we tested candidate genes for dominant interaction of the mild Star rotation phenotype (Table 1). This genetic data argue for an involvement of DE-Cadherin/shotgun, the atypical cadherin Flamingo (Fmi) (Usui et al., 1999Go), the adherens junction protein canoe, non-muscle myosin II (zipper), the septin peanut, and capulet, a protein with actin and adenylate cyclasebinding ability.

Next we examined the expression of Fmi and DE-cadherin in ommatidial preclusters during rotation. Strong LOF alleles of Egfr and its signaling components also affect cell proliferation, fate specification and survival, making the analysis of cell adhesion and junctional components in the context of rotation rather difficult. Thus we analyzed localization of the cadherins and Arm/ß-catenin in imaginal discs of the rotation-specific aosrlt allele.

Although the overall expression and localization of DECadherin and Arm/ß-catenin are largely unaffected (Fig. 7A,A'',B,B'',C,C'',D,D'' and not shown), the localization of Fmi is changed in aosrlt discs (Fig. 7A,A',B,B',G,H). In WT, Fmi is initially present apically in all cells of the morphogenetic furrow and subsequently becomes asymmetrically enriched in the R3/R4 precursor pair (column 4-5, Fig. 7A,C,G) (Das et al., 2002Go). In and posterior to column 6 Fmi is expressed at the membrane of R4, and largely depleted from R3 membranes that do not touch R4, forming a horseshoe-like R4-specific pattern (Fig. 7A,A',G). In contrast, in aosrlt discs Fmi restriction to the R4 precursor is generally delayed, and often not established even in columns 8-12, where high levels of Fmi are still seen around the apical membrane cortex of R3 and R4 (Fig. 7B,H). As Fmi is thought to act as a homophyllic cell-adhesion molecule (Usui et al., 1999Go), its increased presence on R3 membranes should have a direct effect on Fmi localization in neighboring cells and thus possibly the adhesive properties of the precluster. It is worth noting that although Fmi is required during PCP establishment and R3/R4 cell-fate specification, the delay in Fmi restriction to R4 has no significant effect on the R3/R4 cell-fate decision. Although Fmi interacts with Fz and Notch in this context, the R4-specific m{Delta}-lacZ marker does not differ significantly from WT (Fig. 7E,F) and adult aosrlt eyes also display no defects in R3/R4 specification. Thus, it appears that the delay in Fmi localization specifically affects ommatidial rotation, probably through adhesion, and possibly explains the broad range of rotation angles in aosrlt and other Egfr pathway mutants.



View larger version (114K):
[in this window]
[in a new window]
 
Fig. 7. Expression of the atypical cadherin Flamingo is altered within the R3/R4 precursor pair in argosrlt discs. Confocal images of third instar eye discs are shown, anterior is left. The morphogenetic furrow is at the left edge of each panel. (A,C,G) wild-type (WT) and (B,D,H) aosrlt discs stained with anti-Fmi (green in A-D, black and white in A' and B'), anti-DE-cadherin (magenta in A,B and b/w in A'' and B'') and F-actin (red, labeled by Phalloidin, in C,D and b/w in C',D'). A higher magnification of the Fmi and DE-cadherin stainings in similar discs is shown in G and H (ommatidial rows 1-11). Note that Fmi, in WT downregulated in the R3 precursor by row 7 and subsequently detected only around R4, is still present in R3 cells in aosrlt until rows 11-12 and beyond. Typical WT and mutant examples are highlighted with yellow arrowheads in A',B',G,H. Abnormal localization of Fmi does not correlate with R3/R4 cell-fate defects, as the R4-specific marker m{Delta}-lacZ is restricted to R4 in WT (E) and aosrlt mutant (F) preclusters.

 
Taken together with the genetic interactions, these data suggest that Egfr signaling impinges on the cell adhesive properties of ommatidial clusters during the rotation process (see below).


    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Our data demonstrate that Egfr signaling regulates ommatidial rotation. Loss and gain-of-function data indicate that at least two Ras-effector pathways, the Ras/Raf/MAPK cascade and Ras/Cno signaling, are required downstream of Egfr in this context of cellular motility (Fig. 8). We provide further evidence for an involvement of cadherins and non-muscle myosin II as downstream components controlling rotation. In particular, the involvement of the cadherin Fmi, a PCP gene, downstream of Egfr signaling, is of interest as it provides the first link between PCP establishment and Egfr signaling.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 8. Model for the role of Egfr/Ras signaling in the context of ommatidial rotation. Raf/MAPK nuclear signaling to Pnt upregulates the transcription of activating (spi) and inhibiting (aos) Egfr ligands and might regulate transcription of additional genes important for ommatidial rotation. Egfr/Ras signal via Canoe to affect cytoskeletal and/or cell junctional elements (junctions are schematized as black oval regions on membrane). In addition, Egfr signaling affects Flamingo localization (the effector regulating this aspect is not known).

 
The role of Egfr in rotation
What is the role of Egfr signaling in the regulation of ommatidial rotation? It is of interest to note that both loss and gain-of-function phenotypes of Egfr and its signaling pathway components result in very similar phenotypes, with ommatidia being both under- and overrotated. This is in contrast to nmo and sca mutants, in which ommatidia generally underrotate (nmo) or overrotate (sca). Although rlt has been implicated to stop rotation at 90° (Choi and Benzer, 1994Go), our data suggest a general role for Egfr in this process affecting more than just its termination. The observed underrotation in Egfr LOF genotypes, such as Egfrtop1 alleles or Star heterozygosity, is consistent with a positive requirement of Egfr in the process. The presence of overrotated ommatidia in these genotypes questions this simple interpretation. However, the overrotations could be explained by the feedback loops that regulate the levels of Egfr signaling. An initial reduction of Egfr signaling, such as in the Egfrtop1 or Star backgrounds, also results in a reduced induction of the negative feedback loop (mediated through aos), subsequently leading to a mild increase in Egfr signaling. Thus, as null mutations of Egfr cannot be easily analyzed in this context, it is possible that in all genotypes analyzed the absolute levels of Egfr signaling fluctuate, causing the observed phenotypic variations. In this context, it is noteworthy that the gain-of-function Egfr mutation ElpB1 exhibits only very minor rotation abnormalities, but significant photoreceptor loss because of overproduction of Aos (Lesokhin et al., 1999Go).

An alternative interpretation of the observed Egfr rotation defects could be a general regulatory input from Egfr signaling into the process of rotation. Egfr/Ras signaling could serve as a `gas' or `brake' pedal throughout the process, thus regulating the strength of another signaling input. This is supported by the observations that ommatidia can be significantly overrotated before the end of the process, suggesting a continuous Egfr input.

Nevertheless, the phenotypes observed in third instar eye imaginal discs suggest that the first 45° rotation is much less affected than the second step. This indicates that Egfr signaling plays an important role in the second 45° turn, and serves a lesser role in the first rotation step (see also Brown and Freeman, 2003Go). In summary, we suggest that if Egfr signaling is deregulated, either through a reduction in aos or Egfr function, rotation is disturbed during the second 45° step. We propose that the restriction of Egfr signaling, required for correct rotation, is mediated by an autoregulatory feedback loop via aos. In parallel, the mechanistic cell motility aspects of rotation are probably regulated at least in part via the Ras effector Cno.

Ommatidial rotation and cell adhesion factors
The enhancement of the rotation defects in S heterozygous eyes through several cell adhesion molecules and cytoskeletal regulators implicates Egfr signaling in controlling the mechanistic `cellmotility process'. Our results, showing that expression of the cadherin Fmi is altered in aosrlt eye discs, suggest that Egfr signaling impinges on cell-adhesion properties of the ommatidial precluster. It is interesting to note that in WT the expression of DE-cadherin and Fmi are almost exclusive within the early precluster: membranes between the R8, R2 and R5 cells show high levels of DE-cadherin, whereas the membranes of the R3/R4 precursors show high Fmi levels (Fig. 7A,A'',B,B'',G,H). Thus the regulation of such differences among distinct cadherin proteins might be important for normal ommatidial rotation to occur. The input of Egfr signaling on cell adhesion is further supported by the genetic interactions of Star with fmi and DE-cadherin/shotgun.

These analyses of the regulation of cell adhesion molecules in the context of ommatidial rotation will help to start unravel the mechanistic aspects of rotation.

The role of Canoe in ommatidial rotation
The Egfr/Ras/Cno link is intriguing for several reasons. The cno gene was originally identified as a mutation affecting the dorsal closure process during embryogenesis (Jürgens, 1984; Takahashi et al., 1998Go). Cno shows a genetic and molecular link to Ras: it contains two Ras-interacting domains and binds both WT Ras and activated Ras-V12 (Kuriyama et al., 1996Go; Matsuo et al., 1997Go). In addition, Cno has been postulated to link cytoskeletal elements to cellular junctions via its ability to bind actin (Mandai et al., 1997Go), its interaction with ZO-1/Pyd and its homology with kinesin and myosin-like domains (Takahashi et al., 1998Go). Thus Cno could directly mediate an Egfr/Ras signal to cytoskeletal and cell architecture elements through its association with adherens junctions and its kinesin and myosin-like domains (Miyamoto et al., 1995Go). Interestingly, Zipper does not only show a similar interaction with Star, like Cno (Table 1), but it is also required during embryonic dorsal closure (Young et al., 1993Go), and thus a more general Cno-Zipper link might exist in cell motility contexts.

A second interesting feature of cno is that it has been genetically linked to sca and Notch signaling (Miyamoto et al., 1995Go). First, the phenotype of the sca1 allele is strongly enhanced by cno/+. Second, cno alleles also display Notch-like phenotypes in the wing and a GOF Notch allele, NotchAbruptex, is suppressed by cno (Miyamoto et al., 1995Go). Although the biochemical role of Sca remains obscure, it has been linked to Notch, possibly as a Notch ligand, in several contexts (Powell et al., 2001Go). Thus as sca has recently been implicated in ommatidial rotation (Chou and Chien, 2002Go), the link between Cno and Sca/Notch is intriguing. Taken together, Cno could serve as a factor integrating signaling input from different pathways, e.g. Egfr and Notch in this process, and relaying this to cytoskeletal elements. The Canoe link is also interesting from a disease point of view as its human homologue AF6 is the critical partner of ALL1 in a chimeric protein associated with myeloid leukemia (Prasad et al., 1993Go). Thus taken together, Cno could serve as a factor integrating signaling input from different pathways, e.g. Egfr and Notch in ommatidial rotation, and relaying this to the regulation of cell adhesion and cytoskeletal elements in the context of a developmental patterning process or disease.

Concluding remarks
We demonstrate that Egfr/Ras signaling plays a general role in the regulation of ommatidial rotation. We further identify Canoe as an effector of Ras in this context. Although much was known about how ommatidial chirality and the associated R3/R4 cell-fate decision are regulated (Fz/PCP-Notch signaling), no clear link between the mechanistic aspects of ommatidial rotation and Fz/PCP signaling previously existed. We show a first link between Egfr signaling and PCP genes, namely Fmi. A further connection between Egfr signaling and PCP establishment is provided by Zipper, which acts downstream of Fz/Dsh and Rok in wing PCP (Winter et al., 2001Go) and modifies the Star rotation phenotype. The identification of the Egfr pathway and its regulation of Fmi/cadherin-mediated cell adhesion will serve as an important entry point to further such studies.


    ACKNOWLEDGMENTS
 
We are grateful to K. Choi, M. Freeman and U. Gaul for sharing unpublished results and helpful discussion, N. Baker, K. Choi, M. Freeman, U. Gaul, Ch. Klaembt, S. Leevers, K. Moses, H. Okano, K. Saigo, T. Schuepbach, D. Yamamoto, T. Uemura, H. Oda, A. Jenny, the Bloomington Stock Center and the DSHB for flies or antibodies. We thank members of the Mlodzik lab, C. Desplan, N. Baker and L. Kockel for discussion and/or comments on the manuscript. Microscopy was performed at the MSSM-Microscopy Shared Resource Facility, supported by a NIH-NCI shared resources grant (1 R24 CA095823-01). This work was supported by NIH-NEI grant EY14597 to M.M.


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 


Adler, P. N. (2002). Planar signaling and morphogenesis in Drosophila. Dev. Cell 2, 525-535.[CrossRef][Medline]
Bogdan, S. and Klambt, C. (2001). Epidermal growth factor receptor signaling. Curr. Biol. 11,R292 -295.[CrossRef][Medline]
Brown, K. E. and Freeman, M. (2003). Egfr signalling defines a protective function for ommatidial orientation in the Drosophila eye. Development 130,5401 -5412.[Abstract/Free Full Text]
Casci, T. and Freeman, M. (1999). Control of EGF receptor signalling: lessons from fruitflies. Cancer Metastasis Rev. 18,181 -201.[CrossRef][Medline]
Choi, K.-W. and Benzer, S. (1994). Rotation of photoreceptor clusters in the developing Drosophila eye requires the nemo gene. Cell 78,125 -136.[CrossRef][Medline]
Chou, Y. H. and Chien, C. T. (2002). Scabrous controls ommatidial rotation in the Drosophila compound eye. Dev. Cell 3,839 -850.[CrossRef][Medline]
Clifford, R. J. and Schupbach, T. (1989). Coordinately and differentially mutable activities of torpedo, the Drosophila melanogaster homolog of the vertebrate EGF receptor gene. Genetics 123,771 -787.[Abstract/Free Full Text]
Cooper, M. T. D. and Bray, S. J. (1999). Frizzled regulation of Notch signalling polarizes cell fate in the Drosophila eye. Nature 397,526 -529.[CrossRef][Medline]
Das, G., Reynolds-Kenneally, J. and Mlodzik, M. (2002). The atypical cadherin Flamingo links Frizzled and Notch signaling in planar polarity establishment in the Drosophila eye. Dev. Cell 2,655 -666.[CrossRef][Medline]
Fanto, M. and Mlodzik, M. (1999). Asymmetric Notch activation specifies photoreceptors R3 and R4 and planar polarity in the Drosophila eye. Nature 397,523 -526.[CrossRef][Medline]
Fortini, M. E., Simon, M. A. and Rubin, G. M. (1992). Signalling by the sevenless protein tyrosine kinase is mimicked by Ras1 activation. Nature 355,559 -561.[CrossRef][Medline]
Freeman, M. (1994). Misexpression of the Drosophila argos gene, a secreted regulator of cell determination. Development 120,2297 -2304.[Abstract]
Freeman, M. (1997). Cell determination strategies in the Drosophila eye. Development 124,261 -270.[Abstract]
Freeman, M., Klämbt, C., Goodman, C. S. and Rubin, G. M. (1992). The argos gene encodes a diffusible factor that regulates cell fate decisions in the Drosophila eye. Cell 69,963 -975.[CrossRef][Medline]
Golembo, M., Schweitzer, R., Freeman, M. and Shilo, B. Z. (1996). Argos transcription is induced by the Drosophila EGF receptor pathway to form an inhibitory feedback loop. Development 122,223 -230.[Abstract]
Higashijima, S., Kojima, T., Michiue, T., Ishimaru, S., Emori, Y. and Saigo, K. (1992). Dual Bar homeo box genes of Drosophila required in two photoreceptor cells, R1 and R6, and primary pigment cells for normal eye development. Genes Dev. 6,50 -60.[Abstract/Free Full Text]
Jin, M. H., Sawamoto, K., Ito, M. and Okano, H. (2000). The interaction between the Drosophila secreted protein argos and the epidermal growth factor receptor inhibits dimerization of the receptor and binding of secreted spitz to the receptor. Mol. Cell Biol. 20,2098 -2107.[Abstract/Free Full Text]
Joneson, T., White, M. A., Wigler, M. H. and Bar-Sagi, D. (1996). Stimulation of membrane ruffling and MAP kinase activation by distinct effectors of RAS. Science 271,810 -812.[Abstract]
Jürgens, G., Wieschaus, E., Nüsslein-Volhard, C. and Kluding, H. (1984). Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. Wilhelm Roux's Arch. Dev. Biol. 193,283 -295.[CrossRef]
Karim, F. and Rubin, G. M. (1998). Ectopic expression of activated Ras1 induces hyperplastic growth and increased cell death in Drosophila imaginal tissues. Development 125,1 -9.[Abstract]
Kolodkin, A. L., Pickup, A. T., Lin, D. M., Goodman, C. S. and Banerjee, U. (1994). Characterization of Star and its interactions with sevenless and EGF receptor during photoreceptor cell development in Drosophila. Development 120,1731 -1745.[Abstract]
Kuriyama, M., Harada, N., Kuroda, S., Yamamoto, T., Nakafuku, M., Iwamatsu, A., Yamamoto, D., Prasad, R., Croce, C. and Canaani, E. et al. (1996). Identification of AF-6 and canoe as putative targets for Ras. J. Biol. Chem. 271,607 -610.[Abstract/Free Full Text]
Lee, J. R., Urban, S., Garvey, C. F. and Freeman, M. (2001). Regulated intracellular ligand transport and proteolysis control EGF signal activation in Drosophila. Cell 107,161 -171.[CrossRef][Medline]
Leevers, S. J., Weinkove, D., MacDougall, L. K., Hafen, E. and Waterfield, M. D. (1996). The Drosophila phosphoinositide 3-kinase Dp110 promotes cell growth. EMBO J. 15,6584 -6594.[Medline]
Lesokhin, A. M., Yu, S. Y., Katz, J. and Baker, N. E. (1999). Several levels of EGF receptor signaling during photoreceptor specification in wild-type, Ellipse, and null mutant Drosophila. Dev. Biol. 205,129 -144.[CrossRef][Medline]
Mandai, K., Nakanishi, H., Satoh, A., Obaishi, H., Wada, M., Nishioka, H., Itoh, M., Mizoguchi, A., Aoki, T. and Fujimoto, T. et al. (1997). Afadin: a novel actin filament-binding protein with one PDZ domain localized at cadherin-based cell-to-cell adherens junction. J. Cell Biol. 139,517 -528.[Abstract/Free Full Text]
Matsuo, T., Takahashi, K., Kondo, S., Kaibuchi, K. and Yamamoto, D. (1997). Regulation of cone cell formation by Canoe and Ras in the developing Drosophila eye. Development 124,2671 -2680.[Abstract]
Miyamoto, H., Nihonmatsu, I., Kondo, S., Ueda, R., Togashi, S., Hirata, K., Ikegami, Y. and Yamamoto, D. (1995). canoe encodes a novel protein containing a GLGF/DHR motif and functions with Notch and scabrous in common developmental pathways in Drosophila. Genes Dev. 9,612 -625.[Abstract/Free Full Text]
Mlodzik, M. (1999). Planar polarity in the Drosophila eye: a multifaceted view of signaling specificity and cross-talk. EMBO J. 18,6873 -6879.[CrossRef][Medline]
Mlodzik, M. (2002). Planar cell polarization: do the same mechanisms regulate Drosophila tissue polarity and vertebrate gastrulation? Trends Genet. 18,564 -571.[CrossRef][Medline]
Oda, H., Uemura, T., Harada, Y., Iwai, Y. and Takeichi, M. (1994). A Drosophila homolog of cadherin associated with armadillo and essential for embryonic cell-cell adhesion. Dev. Biol. 165,716 -726.[CrossRef][Medline]
Powell, P. A., Wesley, C., Spencer, S. and Cagan, R. L. (2001). Scabrous complexes with Notch to mediate boundary formation. Nature 409,626 -630.[CrossRef][Medline]
Prasad, R., Gu, Y., Alder, H., Nakamura, T., Canaani, O., Saito, H., Huebner, K., Gale, R. P., Nowell, P. C. and Kuriyama, K. (1993). Cloning of the ALL-1 fusion partner, the AF-6 gene, involved in acute myeloid leukemias with the t(6;11) chromosome translocation. Cancer Res. 53,5624 -5628.[Abstract/Free Full Text]
Prober, D. A. and Edgar, B. A. (2002). Interactions between Ras1, dMyc, and dPI3K signaling in the developing Drosophila wing. Genes Dev. 16,2286 -2299.[Abstract/Free Full Text]
Queenan, A. M., Ghabrial, A. and Schupbach, T. (1997). Ectopic activation of torpedo/Egfr, a Drosophila receptor tyrosine kinase, dorsalizes both the eggshell and the embryo. Development 124,3871 -3880.[Abstract]
Reich, A. and Shilo, B. Z. (2002). Keren, a new ligand of the Drosophila epidermal growth factor receptor, undergoes two modes of cleavage. EMBO J. 21,4287 -4296.[CrossRef][Medline]
Reifegerste, R. and Moses, K. (1999). The genetics of epithelial polarity and pattern in the Drosophila retina. BioEssays 21,275 -285.[CrossRef][Medline]
Rodriguez-Viciana, P., Warne, P. H., Khwaja, A., Marte, B. M., Pappin, D., Das, P., Waterfield, M. D., Ridley, A. and Downward, J. (1997). Role of phosphoinositide 3-OH kinase in cell transformation and control of the actin cytoskeleton by Ras. Cell 89,457 -467.[CrossRef][Medline]
Sawamoto, K., Okabe, M., Tanimura, T., Mikoshiba, K., Nishida, Y. and Okano, H. (1996). The Drosophila secreted protein Argos regulates signal transduction in the Ras/MAPK pathway. Dev. Biol. 178,13 -22.[CrossRef][Medline]
Sawamoto, K., Yamada, C., Kishida, S., Hirota, Y., Taguchi, A., Kikuchi, A. and Okano, H. (1999). Ectopic expression of constitutively activated Ral GTPase inhibits cell shape changes during Drosophila eye development. Oncogene 18,1967 -1974.[CrossRef][Medline]
Schweitzer, R. and Shilo, B. Z. (1997). A thousand and one roles for the Drosophila EGF receptor. Trends Genet. 13,191 -196.[CrossRef][Medline]
Takahashi, K., Matsuo, T., Katsube, T., Ueda, R. and Yamamoto, D. (1998). Direct binding between two PDZ domain proteins Canoe and ZO-1 and their roles in regulation of the jun N-terminal kinase pathway in Drosophila morphogenesis. Mech. Dev. 78,97 -111.[CrossRef][Medline]
Tomlinson, A. and Ready, D. F. (1987). Cell fate in the Drosophila ommatidium. Dev. Biol. 123,264 -275.[CrossRef][Medline]
Tomlinson, A. and Struhl, G. (1999). Decoding vectorial information from a gradient: sequential roles of the receptors Frizzled and Notch in establishing planar polarity in the Drosophila eye. Development 126,5725 -5738.[Abstract]
Usui, T., Shima, Y., Shimada, Y., Hirano, S., Burgess, R. W., Schwarz, T. L., Takeichi, M. and Uemura T. (1999). Flamingo, a seven-pass transmembrane cadherin, regulates planar cell polarity under the control of Frizzled. Cell 98,585 -595.[CrossRef][Medline]
Van Buskirk, C. and Schupbach, T. (1999). Versatility in signalling: multiple responses to EGF receptor activation during Drosophila oogenesis. Trends Cell Biol. 9,1 -4.[CrossRef][Medline]
Winter, C. G., Wang, B., Ballew, A., Royou, A., Karess, R., Axelrod, J. D. and Luo, L. (2001). Drosophila Rho-associated kinase (Drok) links Frizzled-mediated planar cell polarity signaling to the actin cytoskeleton. Cell 105, 81-91.[CrossRef][Medline]
Young, P. E., Richman, A. M., Ketchum, A. S. and Kiehart, D. P. (1993). Morphogenesis in Drosophila requires nonmuscle myosin heavy chain function. Genes Dev. 7, 29-41.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
DevelopmentHome page
J. L. Fetting, S. A. Spencer, and T. Wolff
The cell adhesion molecules Echinoid and Friend of Echinoid coordinate cell adhesion and cell signaling to regulate the fidelity of ommatidial rotation in the Drosophila eye
Development, October 1, 2009; 136(19): 3323 - 3333.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. Oishi, H. Zhang, W. J. Gault, C. J. Wang, C. C. Tan, I.-K. Kim, H. Ying, T. Rahman, N. Pica, M. Tartaglia, et al.
Phosphatase-defective LEOPARD syndrome mutations in PTPN11 gene have gain-of-function effects during Drosophila development
Hum. Mol. Genet., January 1, 2009; 18(1): 193 - 201.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Sese, M. Corominas, H. Stocker, T. I. Heino, E. Hafen, and F. Serras
The Cdi/TESK1 kinase is required for Sevenless signaling and epithelial organization in the Drosophila eye
J. Cell Sci., December 15, 2006; 119(24): 5047 - 5056.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
I. Mirkovic and M. Mlodzik
Cooperative activities of Drosophila DE-Cadherin and DN-Cadherin regulate the cell motility process of ommatidial rotation
Development, September 1, 2006; 133(17): 3283 - 3293.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. D. Vrailas, D. R. Marenda, S. E. Cook, M. A. Powers, J. A. Lorenzen, L. A. Perkins, and K. Moses
smoothened and thickveins regulate Moleskin/Importin 7-mediated MAP kinase signaling in the developing Drosophila eye
Development, April 15, 2006; 133(8): 1485 - 1494.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Fanto and H. McNeill
Planar polarity from flies to vertebrates
J. Cell Sci., February 15, 2004; 117(4): 527 - 533.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow All Versions of this Article:
dev.00759v1
130/22/5413    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gaengel, K.
Right arrow Articles by Mlodzik, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gaengel, K.
Right arrow Articles by Mlodzik, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?