|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 October 2003
doi: 10.1242/dev.00810
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Anatomy and Cell Biology, Hebrew University Hadassah
Medical School, POB 12272, 91120 Jerusalem, Israel
2 Department of Cellular Biochemistry and Human Genetics, Hebrew University
Hadassah Medical School, POB 12272, 91120 Jerusalem, Israel
* Author for correspondence (e-mail: yisraeli{at}cc.huji.ac.il)
Accepted 6 August 2003
| SUMMARY |
|---|
|
|
|---|
Key words: VICKZ protein family, RNA-binding proteins, Neural crest, Roof plate, Cell movement, Xenopus
| Introduction |
|---|
|
|
|---|
Over the past few years, it has become clear that Vg1 RBP is a member of a
family of RNA-binding proteins, which we have termed VICKZ proteins, based on
the first letters of the founding members of this family (Vg1 RBP/Vera; IMP-1,
IMP-2 and Imp-3; CRD-BP; KOC; and ZBP-1)
(Yaniv and Yisraeli, 2002
).
These proteins are highly conserved among all vertebrates that have been
examined, in both their primary sequence and their expression patterns during
embryogenesis (Mueller-Pillasch et al.,
1999
; Zhang et al.,
1999
). All family members contain two RNA recognition motifs
(RRMs) at their N terminus, an RGG RNA-binding domain and four hnRNP
K-homology (KH) domains at the C terminus (also shown to mediate RNA binding
in other proteins). In chick embryo fibroblasts, a homolog, termed ZBP-1,
binds ß-actin mRNA and co-localizes with this RNA to the leading
edge of migrating cells (Farina et al.,
2003
; Oleynikov and Singer,
2003
; Ross et al.,
1997
). Other members of the VICKZ family are involved in RNA
stability (CRD-BP) (Leeds et al.,
1997
) and translational control (IMP-1, IMP-2 and IMP-3)
(Nielsen et al., 1999
) in
different embryonic cell types. Quite strikingly, a number of different types
of human cancers and neoplastic cells overexpress one or more of the three
human homologs of the VICKZ family, yet their role in cancer cells is not
understood (reviewed by Yaniv and
Yisraeli, 2002
). The expression in almost all normal adult tissues
is essentially non-detectable, however; based on this expression profile, the
VICKZ proteins have been termed `oncofetal proteins'.
The biological function of VICKZ proteins is beginning to be deciphered. In
embryonic hippocampal neurons, ZBP-1 protein and ß-actin mRNA
colocalize in growth cones (Zhang et al.,
2001a
). In these cells, an antisense oligonucleotide directed
against ß-actin RNA localization (`zipcode') sequences found in
its 3'UTR disrupts both ß-actin RNA and ZBP-1 protein
localization and leads to growth cone collapse. The same antisense
oligonucleotide, in migrating embryo fibroblasts in culture, causes a loss of
lamellar ZBP-1 localization, cellular polarity and persistent movement
(Kislauskis et al., 1994
;
Kislauskis et al., 1997
;
Oleynikov and Singer, 2003
;
Shestakova et al., 2001
).
These experiments, although indirect, suggest that VICKZ proteins play a role
in cell migration via their ability to localize RNA. Cell movement requires
the coordinated regulation of a number of different processes within the cell.
At the leading edge, increased actin polymerization leads to an extension of
the cell membrane and the formation of new focal contacts with the substratum
(reviewed by Welch et al.,
1997
). At the trailing edge, focal contacts are broken, the cell
membrane is retracted, and the cell mass moves forward. During cell migration,
a number of proteins, many of which are involved in signal transduction or
actin nucleation or polymerization, are localized and/or activated at either
the leading or trailing edge. By sorting requisite RNAs to particular
intracellular targets, cells could facilitate the local production of proteins
needed for prolonged, persistent migration.
In Xenopus embryos, cell motility is activated at the mid-blastula
transition (Gerhart, 1979
).
The embryo undergoes a series of cell shape changes and migrations that
transform it from a sphere into a tadpole with a clearly defined
anteroposterior bilateral axis of symmetry. Cells arising in the lateral edges
of the neural plate demonstrate a great deal of motility, with cells from the
superficial layer migrating medially to form the dorsal domain of the neural
tube, and those from the deep layer migrating along defined pathways
throughout the embryo as neural crest cells
(Davidson and Keller, 1999
).
As shown for many cell movements, neural crest cell migration is dependent on
an intact actin cytoskeleton and signalling apparatus
(Liu and Jessell, 1998
;
Santiago and Erickson,
2002
).
We decided to directly explore the role of Vg1 RBP in Xenopus embryos and explants. Neural crest migration is severely diminished in embryos in which the level of Vg1 RBP expression has been reduced by injecting antisense morpholino oligonucleotides (AMOs). Other specific defects are also observed, including a dorsally open neural tube that appears to derive from the inability of correctly specified neuroepithelial cells to reach the dorsal midline. In explants, Vg1 RBP is localized to the distal edge of emigrating neural crest, and this process is inhibited in neural tubes explanted from antisense-injected embryos. Our results, reducing for the first time the expression of a VICKZ family member in developing embryos show that these proteins play a role in cell migration in different cell types.
| Materials and methods |
|---|
|
|
|---|
Immunofluorescence
Cultured neural crest cells were fixed in MEMFA (0.1 M MOPS, pH 7.4, 2 mM
EGTA, 1 mM MgSO4 and 3.7% Formaldehyde) for 30 minutes and
immunostained overnight at 4°C with rabbit anti-Vg1RBP antibody
(Zhang et al., 1999
) at a
1:100 dilution. For staining with monoclonal antibody HNK-1, the cells were
fixed in 4% paraformaldehyde. The plates were incubated for 1 hour at room
temperature with the secondary antibody (1:100), consisting of either
affinity-purified goat anti-mouse or anti-rabbit IgG conjugated to cy5 or
rhodamine, respectively (Jackson Immunoresearch). Slides incubated with the
secondary antibody alone showed no background fluorescence. Coverslips were
mounted in Glycerol:PBS (1:1).
In situ hybridization and probes
Embryos were fixed in MEMFA and processed for whole-mount in situ
hybridization as described elsewhere
(Epstein et al., 1997
), or for
hybridization to sections as described previously
(Butler et al., 2001
). Embryos
destined for paraffin sectioning were stained with NBT/BCIP (20 µl/ml from
stock solution; catalog number 1681451, Roche) instead of magenta phosphate.
Staining reactions were never allowed to proceed beyond the point that embryos
incubated in parallel with control probes were completely negative. Probes
were prepared with the RiboMax Transcription Kit (Promega) using
Digoxygenin-UTP (Roche) and subsequently cleaned using the RNA Easy Kit
(Qiagen). The probes used were: Xsnail, the SP72Xsna plasmid
(Sargent and Bennett, 1990
);
Vg1 RBP, a 609 bp probe spanning amino acids 282-485 of
Xenopus Vg1 RBP; pax3, PCR fragment spanning amino acids
41-267 of mouse Pax3 (Goulding et al.,
1991
) and Xtwist, a 560 bp probe
(Hopwood et al., 1989
).
Manipulation and injection of embryos
Eggs were stripped, fertilized and injected as previously described
(Epstein et al., 1997
).
Embryos were maintained in 0.1x Modified Barth's Solution-HEPES (MBSH)
and, at the two-cell stage, they were transferred to 1x MBSH for
injection. Morpholino oligonucleotides, either directed against a sequence in
the 5'UTR of Vg1 RBP
(5'AAAGAAGACGAGCCCGAAAAACCCG3') or encoding a control sequence
(5'CCTCTTACCTCAGTTACAATTTATA3'), were purchased from Gene Tools
LLC, resuspended in sterile, filtered water and 10ng/blastomere was injected
into either one or both blastomeres. For the rescue experiments, 1.4 ng of
capped Vg1 RBP-GFP RNA, synthesized using the Cap Scribe RNA kit
(Roche) from a pET21-Vg1 RBP plasmid (obtained from A. Git), was co-injected
with AMO into each blastomere of a two-cell stage embryo. The Vg1
RBP-GFP mRNA lacks all 5' and 3' UTR sequences, and is
therefore not a target for AMO-directed inhibition of translation. For the
overexpression experiments, 2 ng/blastomere of Vg1 RBP-GFP RNA was
injected. Both injected and uninjected embryos were staged according to
Nieuwkoop and Faber (Nieuwkoop and Faber,
1967
), and not on the basis of elapsed time from
fertilization.
Microinjection of DiI
Stage 16 embryos were dejellied manually prior to injections, which were
carried out in 0.1x MBSH. Cell Tracker CM-DiI [C-7001, Molecular Probes;
4 nl from a 1mg/ml stock solution (in 100% ethanol)] was injected into the
dorsal neural folds, containing presumptive neural crest and roof plate cells
(Collazo et al., 1993
).
Following the injection, the embryos were maintained at 17°C until stage
34, when they were fixed and photographed using a fluorescent stereoscope. A
rhodamine filter set was used to detect the dye. For the single blastomere
injections (Fig. 5D-F), 0.4 ng
of capped GFP mRNA was co-injected with 10 ng of AMO into one
blastomere at the two-cell stage and, at stage 16, labeled with DiI, as above.
Embryos were fixed and photographed at stage 28.
|
For histological sections, fixed or stained embryos (after in situ hybridization) were embedded in paraffin wax and sectioned at 10 µm thickness.
Western blot analysis
Two embryo equivalents per lane of an S10 protein extract were resolved on
a 10% SDS-PAGE gel, transferred to an Immobilon membrane and probed with
1:20,000 of a Vg1 RBP polyclonal serum, followed by a horseradish
peroxidase-coupled goat anti-rabbit antibody and ECL detection. Blots were
then stripped by standard protocols and probed with a 1:10,000 dilution of
ERK-2 monoclonal antibody (Cell Signaling Technology). Exposures were 10-30
seconds on Kodak LS film. Quantification was performed by densitometry of
exposed films using the NIH Image software.
| Results |
|---|
|
|
|---|
|
|
|
To ascertain more precisely the effects of downregulating Vg1 RBP
expression in the embryo, we looked at the histology of injected embryos. By
injecting a fluorescent nucleo-lipophilic dye into the embryos before first
cleavage, which acts essentially as a counterstain, it is possible to image
transected, fixed embryos using a confocal microscope
(Davidson and Keller, 1999
).
The cells that form the roof plate of the neural tube migrate, after neural
fold fusion, from the lateral part of the superficial neuroectoderm towards
the midline, where they narrow and elongate to form the dorsal aspect of the
tube; this movement is also thought to lead to a narrowing and elongation of
the neural tube (Davidson and Keller,
1999
; Linker et al.,
2000
). In the AMO-injected embryos, the neural tube is open on its
dorsal side (Fig. 3B,B',
arrowhead). This lack of a roof plate in the neural tube, even when the
overlying ectoderm is fused normally, continues throughout later stages, as
observed in both confocal and paraffin wax embedded histological sections
(Fig. 3D,F). The neural tube in
the AMO-injected embryos also appears to be wider than in control embryos,
consistent with a disruption in normal cell movements. Normal roof-plate
formation is restored, however, in AMO-injected embryos rescued with sense
Vg1 RBP mRNA (Fig.
3G). These data indicate that the migration of roof plate cells to
the dorsal midline of the forming neural tube is dependent on Vg1 RBP
expression.
|
Cells in the lateral edge of the neural tube are specified correctly,
but do not migrate, in AMO-injected embryos
The lateral edges of the neuroectoderm give rise to both roof plate cells,
from the superficial layer, and neural crest cells, from the deep layer
(Davidson and Keller, 1999
;
Linker et al., 2000
;
Schroeder, 1970
). The
inhibition of cell movements observed upon reduction of Vg1 RBP expression may
be the result of interfering with intrinsic cell migration or disrupting
normal cell differentiation. To distinguish between these two possibilities,
we examined the effects of inhibiting Vg1 RBP translation on the expression of
lateral fold markers. Xpax3, a paired-domain transcription factor, is
expressed in cells that form the roof of the neural tube. Immediately prior to
neural fold fusion, it is expressed throughout the neural plate, but after
fusion, Xpax3 expression is detected in a single layer of cells at
the dorsal midline of the tube (Bang et
al., 1997
; Davidson and
Keller, 1999
). No significant differences in either the level or
pattern of Xpax3 expression are detected in CMO- when compared with
AMO-injected embryos, at early neurula stages
(Fig. 4A,C). After neural fold
fusion, the level of Xpax3 expression remains unchanged in both CMO-
and AMO-injected embryos; however, a clear difference in the pattern of its
expression is observed. In CMO-injected embryos, Xpax3 is expressed
in a single stripe along the dorsal midline
(Fig. 4B), whereas in
AMO-injected embryos, a conspicuous medial groove devoid of Xpax3
expression is present (Fig.
4D). These results indicate that although the prospective
roof-plate cells are properly specified, their medial migration is prevented
by the injection of AMO.
|
Xsnail is also expressed in the prospective roof plate cells in
the superficial layer of the lateral edge of the neural plate, from
mid-neurula stages (Essex et al.,
1993
; Linker et al.,
2000
). After neural fold fusion, these cells continue to express
Xsnail at the midline in the CMO-injected embryos
(Fig. 4F, arrows). In
AMO-injected embryos after neural fold fusion, however, the medial population
of Xsnail-expressing cells is completely absent
(Fig. 4I, arrows); instead, as
seen with the Xpax3 expression, there are two stripes of expressing
cells that can be observed adjacent to the dorsal midline. These results
reinforce the conclusion from the histological analysis that the neural tube
in these embryos is open on its dorsal side
(Fig. 3B,D, arrowhead).
Cranial neural crest do not migrate in AMO-injected embryos
Cranial neural crest cells originate at the lateral edges of the neural
plate, in the midbrain-hindbrain region, prior to neural fold fusion, and
migrate along three distinct pathways: mandibular, hyoid and branchial
(Mayor et al., 1999
). We
followed directly the migration along the branchial pathway of the cranial
neural crest cells by labeling the lateral edge of the neural plate, in the
posterior part of the rhombencephalon, with the hydrophobic dye DiI
(Collazo et al., 1993
)
(Fig. 5A). Embryos injected
with AMO in both blastomeres of a two-cell embryo were labeled at stage 16 and
allowed to grow until stage 34, when they were fixed and examined under a
fluorescence stereoscope. As seen in Fig.
5B, in control embryos, the DiI-labeled cells leave the neural
tube and stream towards the branchial arches. In AMO-injected embryos,
however, no movement of the DiI-labeled cells is detected
(Fig. 5C). Thus, as suggested
by the absence of Xtwist-positive cells in the branchial arches of
AMO-injected embryos (Fig. 4L),
downregulation of Vg1 RBP inhibits cranial neural crest migration in
embryos.
The inhibition of cranial neural crest migration could be the result of either global inhibitory mechanisms, such as defective neural tube formation and/or a general toxicity, or more localized effects, resulting from an interference with mechanisms intrinsic to the affected cells and their immediate environment. To distinguish between these two possibilities, we injected a single blastomere at the two-cell stage with both AMO and an mRNA encoding GFP, and then, at stage 16, bilaterally labeled the lateral edges of the neural plate at the level of the posterior hindbrain (Fig. 5D). Embryos were fixed at stage 28 and examined, as above, by fluorescence stereo-microscopy. On the control side of the embryo, DiI-labeled cells are clearly detected migrating towards the branchial arches (Fig. 5E). On the AMO/GFP-injected side of the same embryos, however, the cells remain along the dorsal midline and no fluorescence is observed outside of the neural tube (Fig. 5F). These results show that AMO prevent neural crest migration even when contralateral neural crest, at the same AP axial level, migrate normally, strongly suggesting that the inhibition of migration is mediated locally, rather than globally.
AMO-mediated inhibition of neural crest migration is not dependent on
an open neural tube
Medial migration of the cells forming the roof plate of the neural tube
occurs in stage 16-17 embryos, in conjunction with, although faster than,
neural crest migration towards the midline
(Linker et al., 2000
). Given
the absence of a closed neural tube in the AMO-injected embryos, it is
formally possible that the inhibition of neural crest migration in these
embryos may be a consequence of faulty roof-plate formation, and not a result
of interference with an intrinsic cell motility mechanism. To distinguish
between these options, we have generated embryos with a milder phenotype by
injecting a lower concentration of AMO. These embryos develop normal eyes, and
the overall morphology of the embryo appears normal as well. In fact, as
revealed in cross-sections of these embryos taken from two different stages,
the neural tube is closed and even appears to attain a normal width by stage
30 (Fig. 6B,D). Nevertheless,
few if any neural crest cells are present above the neural tube or in the
dorsal fin region, as are seen in control embryos examined at the same AP
levels (Fig. 6A,C). Thus,
neural crest and roof plate cell migration appear to be independent events,
the inhibition of which is differentially dependent on AMO concentration.
|
|
| Discussion |
|---|
|
|
|---|
Specificity of AMO-induced phenotypes
Several lines of evidence indicate that the AMO-injection phenotypes are a
direct result of inhibiting Vg1 RBP expression, and not the result of a
non-specific toxic effect. First, Vg1 RBP protein level is reduced fivefold,
relative to an internal control, in the AMO-injected embryos. Second, Vg1
RBP mRNA, engineered not to be a target for the AMO, rescues these
embryos when injected in parallel with the AMO. Third, the AMO appears to
function in a dose-dependent fashion. At lower concentrations, neural crest
migration is predominantly affected, while lens and neural tube formation
appear normal. Higher concentrations of AMO lead to abnormal tube formation
and the absence of a lens and dorsal fin. Fourth, when only one of two
blastomeres at the two-cell stage is injected with AMO, migration on the
uninjected side is normal. Fifth, all of the sites affected by AMO injection
are tissues where Vg1 RBP is normally expressed. Taken together, these results
argue strongly that the reduction of Vg1 RBP protein levels leads to specific,
pleiotypic phenotypes.
Two Vg1 RBP cDNAs have been described in Xenopus laevis,
originally termed Vg1 RBP D and B
(Havin et al., 1998
), encoding
proteins that are 97% identical. Vg1 RBP D is identical to
Vera, a Vg1 RNA-binding protein described previously
(Deshler et al., 1998
), and
Vg1 RBP A is identical to a protein in GenBank called B3, which was
isolated on the basis of its ability to bind a DNA element upstream to the
gene TFIIIA (Griffin et al.,
2003
). Given the pseudotetraploid nature of Xenopus
laevis, it seems likely that these cDNAs represent two alleles of the
same gene rather than independent genetic loci. In higher vertebrates, the
three distinct VICKZ genes reside on three separate chromosomes
(Yaniv and Yisraeli, 2002
). In
Xenopus laevis, we (Havin et al.,
1998
) and others
(Mueller-Pillasch et al.,
1999
) have not found evidence of any additional VICKZ proteins.
The antisense morpholino oligonucleotide used in these studies was directed
against the 5' UTR of Vg1 RBP D in a region that is not
homologous to Vg1 RBP A. Thus, the phenotypes reported here can be
attributed directly to the reduced expression of a single gene, Vg1 RBP
D.
Role of Vg1 RBP in roof plate and neural crest movements
The initial stages of determination of both presumptive roof plate and
neural crest cells are unaffected by the AMO injection. The presence of
melanophores dorsal to the neural tube
(Fig. 3), even in the
antisense-injected embryos, suggests that Vg1 RBP is not required for the
initial specification of neural crest cells, but rather is necessary for their
migration. In addition, cells expressing Xpax3 and Xsnail
continue to express these markers in the AMO-injected embryos for some period
of time after migration has commenced in parallel CMO-injected sibs (see
Fig. 4, and data not shown),
indicating that these cells are still viable, even if sessile. Indeed, the
slightly broader domain of Xsnail expression, as well as the wider
neural tube, observed in the AMO-injected embryos
(Fig. 3) may also reflect the
inhibited migration of cells located at the lateral edge of the
neuroectoderm.
After 24 hours, all Xsnail and Xtwist expression has
disappeared from the AMO-injected embryos, while the CMO-injected embryos
display the normal neural crest staining pattern. Loss of Xsnail and
Xtwist-positive cells in AMO-injected embryos could be the result of
either death of the non-migrating cells or downregulation, perhaps coupled
with transdetermination, of the sessile cells. The fact that roughly equal
amounts of DiI-labeled neural crest cells are maintained in both antisense and
control-injected embryos, despite the lack of movement of these cells in the
former case, suggests that certainly massive cell death is not occurring. In
the case of neural crest cells whose migration was inhibited by the
overexpression of either full length Xcadherin 11 (Xcad-11) or Xcad-11 lacking
its cytoplasmic domain, neural crest markers such as Xsnail and
Xtwist were downregulated after 4 hours, and completely lost after 18
hours; neural markers, however, such as N-tubulin and nrp-1,
were activated during this same period in the non-migrating cells
(Borchers et al., 2001
). Our
results are consistent with such a reprogramming of neural crest, although we
cannot exclude the possibility that blocking migration may eventually lead to
a small increase in cell death. By stage 34, cross-sections of AMO-injected
embryos show some cells present in the lumen of the neural tube (not seen in
control embryos) that are likely to become apoptotic
(Fig. 3D,F,G). Such cells are
not seen at earlier stages in the AMO-injected embryos
(Fig. 3B), even in stages at
which control embryos contain migratory neural crest. Thus, if AMO-injection
does eventually lead to some apoptosis, it occurs considerably after the block
in migration.
Despite the fact that AMO-injection inhibits both roof plate formation and
neural crest migration, it appears that one event is not dependent upon the
other. Neural crest migration can proceed normally even in the presence of an
open neural tube (Regnier et al.,
2002
) (C.K., unpublished). In embryos injected with a low
concentration of AMO, the neural tube is closed, but, nevertheless, neural
crest migration is inhibited (Fig.
6). Taken together, these data suggest that the formation of the
neural tube roof plate and the migration of neural crest out of the tube are
independent events that both require Vg1 RBP expression.
It is interesting to speculate as to how and why the roof plate and neural crest cells respond differently to low concentrations of AMO. We note that the high concentration of AMO used in this study reduced the overall level of Vg1 RBP expression to 20% of wild-type levels, but did not eliminate it completely. [This may be the result of large, excess amounts of Vg1 RBP present in cells; we estimate that there is at least a 100-fold molar excess in oocytes of Vg1 RBP over Vg1 mRNA (JKY, personal observations). This excess may also explain why no effect is observed when Vg1 RBP is overexpressed in embryos (Fig. 2H).] It is unclear whether the 20% expression of Vg1 RBP reflects a lower level in all cells or a mosaic expression. The fact that the few cells managing to migrate out of neural tube explants taken from AMO-injected embryos are Vg1 RBP-positive may be indicative of such a mosaic pattern. Perhaps, in embryos injected with a low concentration of AMO, those cells that need to migrate only a small distance (such as roof plate cells) may express the minimal amount of Vg1 RBP necessary for migration. Those cells requiring longer distances of migration (such as neural crest cells) may not have the levels necessary for persistent, extended movement. Alternatively, only a few roof plate cells may be required to reach the midline in order to close the neural tube. Studies aimed at modulating the levels of Vg1 RBP in cells should help in understanding how Vg1 RBP functions.
Vg1RBP mediates specific types of cell movement
Different types of cell movements are required for normal embryonic
development (Locascio and Nieto,
2001
). Convergent-extension facilitates gastrulation, and these
integrative, tissue movements appear to exhibit planar-cell polarity
(Wallingford et al., 2000
).
Inhibition of the non-canonical Wnt signaling pathway prevents both
gastrulation and neurulation movements, including neural fold fusion of the
ectoderm (Goto and Keller,
2002
; Wallingford and Harland,
2001
; Wallingford and Harland,
2002
). In the AMO-injected embryos, however, both gastrulation and
neural fold fusion occur normally. It is the migration of individual neural
crest and roof plate cells, both of which appear to exhibit a monopolar,
protrusive movement, that is inhibited and, in the latter case, that results
in a neural tube that is open on its dorsal side. These data suggest that
different mechanisms orchestrate individual cell movements, as opposed to
integrative, tissue behavior, in various tissues.
Davidson and Keller (Davidson and
Keller, 1999
) have shown, using time-lapse fluorescence
microscopy, that the cells forming the dorsal neural tube exhibit a protrusive
migration towards the midline from the lateral margins of the neural plate.
These cells have apparently already undergone an epithelial-to-mesenchymal
transition (EMT) in order to migrate as individual cells. It is these
Xpax3-positive cells that fail to achieve their dorsal midline
localization in the AMO-injected embryos
(Fig. 4D). The monopolar
morphology of these cells is very similar to both that observed by these
researchers in neural crest cells migrating from the lateral edges underneath
the overlying epidermis towards the midline
(Davidson and Keller, 1999
),
and that which we observe in neural crest migrating out of the neural tube
explant in culture (Fig. 7).
Although it is difficult to determine the direction of migration of a given
cell in a static picture, the protein accumulates, in a large majority of the
cells, in what appear to be processes pointing away from the explanted tube.
It is tempting to speculate that Vg1RBP is required in the polar processes for
proper migration in all of these cells, after they have undergone EMT. This
localization is reminiscent of the subcellular distribution reported for some
of the VICKZ proteins in different cell types
(Farina et al., 2003
;
Nielsen et al., 2002
;
Oleynikov and Singer, 2003
;
Zhang et al., 2001a
). Future
experiments that mislocalize the protein within the cell will be helpful in
determining whether intracellular localization of Vg1 RBP is required for its
function.
Mechanism of Vg1 RBP action
Neural crest migration and differentiation involves concerted changes in
cell and matrix adhesion, cytoskeletal organization and gene expression. Over
the past few years, several molecules have been identified in Xenopus
embryos, which are involved in these different processes
(Alfandari et al., 2001
;
Bellmeyer et al., 2003
;
Borchers et al., 2001
;
Carl et al., 1999
;
Helbling et al., 1998
;
Krull et al., 1997
;
Smith et al., 1997
;
Wang and Anderson, 1997
). Vg1
RBP represents a novel type of molecule, an RNA-binding protein, involved in
the process of neural crest migration. Vg1 RBP also plays a role in additional
migration events, such as the movement of roof plate cells towards the
midline. Given its asymmetric localization in migrating neural crest, and its
multiple RNA binding sites, Vg1 RBP could mediate the sorting of certain RNAs
required at the leading edge of migrating cells. Any RNA encoding a protein
required in large amounts in order to facilitate the rapid formation of new
cell membranes or sub-membrane structures would be a potential candidate. Such
RNAs might encode extracellular receptors, membrane components, adhesion
molecules, ß-actin and other cytoskeletal components. Other members of
the VICKZ family have been identified as repressing translation or stabilizing
mRNAs. These functions may also be important aspects of Vg1 RBPs actions,
potentially coupling localization (and perhaps stabilization) of RNA with
restricted, intracellular expression. It is formally possible that Vg1 RBPs
role in motility is independent of its RNA-binding ability. Experiments in
chick embryonic neurons, however, using antisense oligonucleotides directed
against the cis-acting localization elements in ß-actin mRNA,
indicate that RNA binding is required for localization of ZBP-1 into neurites
and growth cones (Zhang et al.,
2001a
) and lamellapodia
(Oleynikov and Singer, 2003
).
In addition, Farina and Singer (Farina and Singer, 2003) have recently shown
that transfection of certain constructs of ZBP-1 into chick embryo fibroblasts
can disrupt both ß-actin mRNA localization and fibroblast
motility. Taken together, these results suggest that Vg1 RBP is likely to be
required in neural crest and roof plate cell migration because it facilitates
the localization of certain mRNAs to the leading edge of the cell.
This mechanism suggests that Vg1 RBP should function in a cell-autonomous manner. Its expression pattern is consistent with this hypothesis, inasmuch as AMO phenotypes are observed only in tissues in which Vg1 RBP is expressed. In addition, the results from labeling small populations of prospective neural crest in embryos in which Vg1 RBP has been depleted from half of the embryo (Fig. 5) indicate that Vg1 RBP appears to be functioning locally, and not globally. Despite the fact that in neural tubes explanted from AMO-injected embryos, the only neural crest cells that manage to migrate are those that still express Vg1 RBP, further experiments are still required to definitively establish whether Vg1 RBP functions exclusively in a cell-autonomous fashion.
Expression of VICKZ proteins in neoplastic cells
Numerous studies over the last three years have revealed that VICKZ
proteins are overexpressed in a wide variety of tumors (reviewed by
Yaniv and Yisraeli, 2002
).
Many individuals with colorectal adenocarcinomas and hepatocellular carcinomas
generate antisera against one or more of the VICKZ proteins
(Zhang et al., 2001b
); in
human breast cancers, the gene for the VICKZ protein CRD-BP/IMP-1 is amplified
up to 40 times (Doyle et al.,
2000
). RT-PCR and immunoblotting have shown that
CRD-BP/IMP-1 are expressed in 81% of colorectal carcinomas, 73% of
malignant mesenchymal tumors and 14/14 Ewing sarcomas that were examined;
strikingly, normal tissues are almost always negative for these genes
(Ioannidis et al., 2001
;
Ross et al., 2001
).
p62 (the splice variant of IMP2) is detected in all of the
malignant cells in 33% of cancer nodules from hepatocellular carcinomas that
were examined in one study, but is completely undetectable in adjacent,
non-malignant cells and in normal livers
(Lu et al., 2001
). The results
presented here, analyzing for the first time the effects of reducing VICKZ
protein expression, raise an intriguing, possible role for these RNA binding
proteins in carcinogenesis. In addition to the activation of proteins
important for invasiveness and migration, the expression of VICKZ proteins may
be one of many changes required to make neoplastic cells motile, and
therefore, a putatively important marker for metastatic potential. It is
interesting to note that another gene found to be required for neural crest
migration, snail, appears to play an important role in the
epithelial-to-mesenchymal transition associated with metastasis
(Batlle et al., 2000
;
Blanco et al., 2002
;
Cano et al., 2000
). These
results emphasize the close relationship between mechanisms mediating and
controlling cell movements in embryos and in neoplasias, and therefore it is
perhaps not surprising that similar molecules appear to participate in both of
these processes.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alfandari, D., Cousin, H., Gaultier, A., Smith, K., White, J. M., Darribere, T. and DeSimone, D. W. (2001). Xenopus ADAM 13 is a metalloprotease required for cranial neural crest-cell migration. Curr. Biol. 11,918 -930.[CrossRef][Medline]
Baker, C. V. and Bronner-Fraser, M. (2001). Vertebrate cranial placodes I. Embryonic induction. Dev. Biol. 232,1 -61.[CrossRef][Medline]
Bang, A. G., Papalopulu, N., Kintner, C. and Goulding, M. D. (1997). Expression of Pax-3 is initiated in the early neural plate by posteriorizing signals produced by the organizer and by posterior non-axial mesoderm. Development 124,2075 -2085.[Abstract]
Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J. and Garcia de Herreros, A. (2000). The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat. Cell Biol. 2, 84-89.[CrossRef][Medline]
Bellmeyer, A., Krase, J., Lindgren, J. and LaBonne, C. (2003). The protooncogene c-Myc is an essential regulator of neural crest formation in Xenopus. Dev. Cell 4, 827-839.[CrossRef][Medline]
Blanco, M. J., Moreno-Bueno, G., Sarrio, D., Locascio, A., Cano, A., Palacios, J. and Nieto, M. A. (2002). Correlation of Snail expression with histological grade and lymph node status in breast carcinomas. Oncogene 21,3241 -3246.[CrossRef][Medline]
Borchers, A., David, R. and Wedlich, D. (2001). Xenopus cadherin-11 restrains cranial neural crest migration and influences neural crest specification. Development 128,3049 -3060.
Bubunenko, M., Kress, T. L., Vempati, U. D., Mowry, K. L. and King, M. L. (2002). A consensus RNA signal that directs germ layer determinants to the vegetal cortex of Xenopus oocytes. Dev. Biol. 248,82 -92.[CrossRef][Medline]
Butler, K., Zorn, A. M. and Gurdon, J. B. (2001). Nonradioactive in situ hybridization to xenopus tissue sections. Methods 23,303 -312.[CrossRef][Medline]
Cano, A., Perez-Moreno, M. A., Rodrigo, I., Locascio, A., Blanco, M. J., del Barrio, M. G., Portillo, F. and Nieto, M. A. (2000). The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat. Cell Biol. 2,76 -83.[CrossRef][Medline]
Carl, T. F., Dufton, C., Hanken, J. and Klymkowsky, M. W. (1999). Inhibition of neural crest migration in Xenopus using antisense slug RNA. Dev. Biol. 213,101 -115.[CrossRef][Medline]
Collazo, A., Bronner-Fraser, M. and Fraser, S. E. (1993). Vital dye labelling of Xenopus laevis trunk neural crest reveals multipotency and novel pathways of migration. Development 118,363 -376.[Abstract]
Davidson, L. A. and Keller, R. E. (1999). Neural tube closure in Xenopus laevis involves medial migration, directed protrusive activity, cell intercalation and convergent extension. Development 126,4547 -4556.[Abstract]
Deshler, J. O., Highett, M. I. and Schnapp, B. J.
(1997). Localization of Xenopus Vg1 mRNA by Vera protein and the
endoplasmic reticulum. Science
276,1128
-1131.
Deshler, J. O., Highett, M. I., Abramson, T. and Schnapp, B. J. (1998). A highly conserved RNA-binding protein for cytoplasmic mRNA localization in vertebrates. Curr. Biol. 8,489 -496.[CrossRef][Medline]
Dibner, C., Elias, S. and Frank, D. (2001). XMeis3 protein activity is required for proper hindbrain patterning in Xenopus laevis embryos. Development 128,3415 -3426.
Doyle, G. A., Bourdeau-Heller, J. M., Coulthard, S., Meisner, L.
F. and Ross, J. (2000). Amplification in human breast
cancer of a gene encoding a c-myc mRNA-binding protein. Cancer
Res. 60,2756
-2759.
Elisha, Z., Havin, L., Ringel, I. and Yisraeli, J. K. (1995). Vg1 RNA binding protein mediates the association of Vg1 RNA with microtubules in Xenopus oocytes. EMBO J. 14,5109 -5114.[Medline]
Elsdale, T. and Jones, K. (1963). The independence and interdependence of cells in the amphibian embryo. Symp. Soc. Exp. Biol. 17,257 -273.[Medline]
Epstein, M., Pillemer, G., Yelin, R., Yisraeli, J. K. and Fainsod, A. (1997). Patterning of the embryo along the anterior-posterior axis: the role of the caudal genes. Development 124,3805 -3814.[Abstract]
Essex, L. J., Mayor, R. and Sargent, M. G. (1993). Expression of Xenopus snail in mesoderm and prospective neural fold ectoderm. Dev. Dyn. 198,108 -122.[Medline]
Farina, K. L., Huttelmaier, S., Musunuru, K., Darnell, R. and
Singer, R. H. (2003). Two ZBP1 KH domains facilitate
beta-actin mRNA localization, granule formation, and cytoskeletal attachment.
J. Cell Biol. 160,77
-87.
Fukuzawa, T. and Ide, H. (1988). A ventrally localized inhibitor of melanization in Xenopus laevis skin. Dev. Biol. 129,25 -36.[CrossRef][Medline]
Gerhart, J. C. (1979). Mechanisms regulating pattern formation in the amphibian egg and early embryo. In Biological Regulation and Development (ed. R. F. Goldberger), pp. 133-316. New York: Plenum Press.
Goto, T. and Keller, R. (2002). The planar cell polarity gene strabismus regulates convergence and extension and neural fold closure in Xenopus. Dev. Biol. 247,165 -181.[CrossRef][Medline]
Goulding, M. D., Chalepakis, G., Deutsch, U., Erselius, J. R. and Gruss, P. (1991). Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J. 10,1135 -1147.[Medline]
Griffin, D., Penberthy, W. T., Lum, H., Stein, R. W. and Tayler, W. L. (2003). Isolation of the B3 transcription factor of the Xenopus TFIIIA gene. Gene 313,179 -188.