|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 October 2003
doi: 10.1242/dev.00802
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Division of Developmental Neurobiology, MRC National Institute for Medical
Research, The Ridgeway, Mill Hill, London NW7 1AA, UK
2 INSERM U.382, Developmental Biology Institute of Marseille (CNRS-INSERM-Univ.
Mediterranee) Marseille, France
3 Stowers Institute for Medical Research, 1000 East 50th Street, Kansas City, MO
64110, USA
Author for correspondence (e-mail:
rek{at}stowers-institute.org)
Accepted 13 August 2003
 |
SUMMARY |
|---|
 TOP SUMMARY IntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
Key words: Hox genes, Hindbrain, Neurogenesis, Neuronal patterning, Neuronal migration, Gene regulation, Neural development, Segmentation, Mouse
|
Introduction |
|---|
|
TOPSUMMARYIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
;
Tanabe and Jessell, 1997).
Dorsal cell specification is controlled by secreted signals belonging to the
TGFß (Lee and Jessell,
1999) and Wnt (Megason and
McMahon, 2002; Muroyama et
al., 2002) families, and ventral cell specification depends upon
the secreted molecule Shh (Jessell,
2000). These signals elicit the regionally restricted expression
of a battery of transcription factors, such as members of the Pax family
(Ericson et al., 1997;
Osumi et al., 1997;
Takahashi and Osumi, 2002), to
further elaborate neuronal patterning. Hox genes play a general role in the
processes that control the AP identity of the neural tube. Their expression
patterns as well as gain- and loss-of-function experiments imply that they
also have specific roles in patterning neurogenesis and neuronal
differentiation (Davenne et al.,
1999; Graham et al.,
1991; Jungbluth et al.,
1999; Studer et al.,
1996). In addition to the nested patterns of Hox expression along
the AP axis, their expression patterns also become restricted along the DV
axis concomitant with the birth of major classes of neurons
(Graham et al., 1991). While
grafting and neural tube rotation studies suggest that the positional identity
of cells in the neuroepithelium can be controlled independently along the AP
and DV axes (Ensini et al.,
1998; Simon et al.,
1995), the patterning processes along the two axes ultimately have
to be integrated to generate the different types of neurons in their
appropriate position. How Hox genes function in coordinating AP and DV
patterning in the neural tube is an important issue poorly understood.
The segmental structure of the hindbrain is particularly suited for studies
aimed at elucidating the link between AP and DV specification in the CNS. The
hindbrain is transiently divided into a series of lineage restricted and
morphologically distinct repeats, the rhombomeres (r1 to r8), each of which
generates a similar set of neurons (Fraser
et al., 1990; Lumsden and
Keynes, 1989). However, the number, distribution and
specialisation of these neurons are rhombomere-specific
(Lumsden and Krumlauf, 1996).
The specific identity of each rhombomere is imposed by the differential
expression of Hox genes (Trainor and
Krumlauf, 2000). During neurogenesis and neuronal differentiation,
homeobox containing genes (i.e. Phox2b, Isl1), mammalian homologs of
the Drosophila proneural genes, and members of the Notch signalling
pathway are expressed in rhombomere specific longitudinal stripes
(Davenne et al., 1999;
Kusumi et al., 2001;
Osumi et al., 1997;
Pattyn et al., 1997). By
analogy to the patterns seen in the spinal cord, these longitudinal domains
are believed to prefigure sites of generation and differentiation of defined
neuronal subtypes (Davenne et al.,
1999; Lumsden and Krumlauf,
1996; Tanabe and Jessell,
1997). Together these AP and DV expression patterns in the
hindbrain appear to form a grid of distinct coordinates, onto which is
superimposed the temporally and spatially ordered generation of specific
neuronal subtypes.
Hindbrain motoneuron progenitors are born next to the floorplate and
differentiate in a rhombomere-specific pattern
(Lumsden and Keynes, 1989)
into three functional classes: the somatomotor (sm) neurons, which innervate
muscles of the body; the branchiomotor (bm) neurons, which innervate the
muscles derived from the pharyngeal arches; and the visceromotor (vm) neurons,
which innervate the sympathetic and parasympathetic ganglia. Each rhombomere
will generate specific subtype(s) of motoneurons according to its AP level.
Trigeminal (V) motoneurons are derived from r2/r3 and exclusively
differentiate into the bm class. The abducens (VI) motoneurons, which are
derived from r5, are composed exclusively from sm neurons. By contrast, facial
(VII) motoneurons, derived from r4/r5, belong to both the bm and vm classes.
According to their functional subclass, cranial motoneurons migrate to form
nuclei in specific DV positions. In the mouse, motoneurons from r2 migrate
dorsally to contribute to the Vth motor nucleus on the pial surface of the
hindbrain. The abducens motoneurons assemble into nuclei close to their
birthplace on the ventricular side of r5. The bm neurons derived from r4
undergo a complex migration moving caudally and laterally through r5 and r6 to
form the VIIth motor nucleus on the pial side of in the posterior hindbrain
(Auclair et al., 1996;
Covell and Noden, 1989;
Garel et al., 2000;
McKay et al., 1997;
Studer et al., 1996).
Mutational analyses of Hox genes involved in the early segmental patterning
of the hindbrain such as kreisler and Krox20 show that these genes
have a profound impact on subsequent neuronal development
(Cordes and Barsh, 1994;
Manzanares et al., 1999;
Schneider-Maunoury et al.,
1997). Mutation of Hox genes also leads to later defects in
neuronal patterning. Targeted inactivation of Hoxa1 results in
partial loss of r4 and r5, defects in the development of the facial
motoneurons and in malformations of several cranial nerves
(Carpenter et al., 1993;
Gavalas et al., 1998;
Mark et al., 1993). Loss of
Hoxb1 leads to early changes in the identity of r4 and impairs the
development of facial motoneurons (Gaufo
et al., 2000; Goddard et al.,
1996; Studer et al.,
1996). Hoxa1 and Hoxb1 also synergise in early
patterning of the r4 territory (Gavalas et
al., 1998; Studer et al.,
1998) as well as the generation of the r4-derived neural crest
(Di Rocco et al., 2001b).
Hoxa2 controls the identity to the r4-derived neural crest cells, r2
and r3 patterning and axonal pathfinding of a subset of the trigeminal
motoneurons (Gavalas et al.,
1997; Gendron-Maguire et al.,
1993; Rijli et al.,
1993). Hoxa2 and Hoxb2 have unique and
overlapping roles in controlling neurogenesis and neuronal differentiation in
multiple segments (Davenne et al.,
1999). Furthermore, in chick, ectopic expression of Hoxb1
and Hoxa2 can confer specific motoneuron identities in the rostral
hindbrain (Bell et al., 1999;
Jungbluth et al., 1999).
Although the phenotypes described above demonstrate that Hox genes play a role
in neuronal development, it has not been shown whether they can directly
instruct developing neurons to modify their behaviour, or if their influence
is simply an indirect consequence of their ability to pattern the environment
(Gavalas et al., 1998;
Helmbacher et al., 1998;
Manzanares et al., 1999;
Studer et al., 1996).
Auto-, cross- and para-regulatory interactions among Hox genes contribute
to the establishment and maintenance of their segmental expression patterns
(Gould et al., 1997;
Maconochie et al., 1997;
Manzanares et al., 2001). For
example, regulatory analyses have defined a hierarchy of direct interactions
among the Hoxa1, Hoxb1 and Hoxb2 genes that control their
segmental expression. Initially Hoxa1 and Hoxb1 are
activated in neural tissue by retinoic acid
(Dupé et al., 1997;
Marshall et al., 1994;
Studer et al., 1998). The
subsequent maintenance of Hoxb1 expression in r4 is dependent upon a
highly conserved auto- and cross-regulatory element (r4 ARE)
(Pöpperl et al., 1995).
First Hoxa1 transactivates Hoxb1 expression by binding to the
Hoxb1 r4 ARE in cooperation with co-factors (Pbx, Sox, Oct)
(Di Rocco et al., 2001a;
Di Rocco et al., 1997) and
then Hoxb1 continues to maintain its own expression
(Pöpperl et al., 1995;
Studer et al., 1998;
Studer et al., 1996).
Similarly, the subsequent upregulation of Hoxb2 expression in r4 is
directly mediated by Hoxb1, through binding to an r4–specific enhancer
at the 5' of the Hoxb2 locus
(Ferretti et al., 2000;
Maconochie et al., 1997). This
regulatory hierarchy provides a mechanism for the synergy between
Hoxa1 and Hoxb1 in patterning the r4 territory and formation
of r4-derived crest (Di Rocco et al.,
2001b; Gavalas et al.,
1998; Studer et al.,
1998; Studer et al.,
1996).
To understand if this coordinated series of direct regulatory interactions also plays a role in neuronal patterning, we compared neurogenesis, neuronal differentiation and motoneuron migration in hindbrains lacking Hoxa1, Hoxb1 or Hoxb2. Our comparative analysis revealed many similarities in the defects arising during neurogenesis and differentiation in r4 and differences in the relative degrees of severity correlate with their relative position in the hierarchy. Together these observations support the idea that these genes function in common pathways not only during the early phase of segmental patterning, but also in subsequent neuronal differentiation.
|
Materials and methods |
|---|
|
TOPSUMMARYIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
; Gavalas et al.,
1998). Genotyping of the Bax mutation
(Deckwerth et al., 1998) was
carried out using the same conditions and the primers were:
5'GTTGACCAGAGTGGCGTAGG3' (common to both alleles),
5'GAGCTGATCAGAACCATCATG3' (wild-type allele) and
ACCCGCTTCCATTGCTCAGCGGTGC (mutant allele), which give rise to a 304 bp product
for the wild-type allele and 507 bp product for the mutant allele. The HL5
lacZ transgenic line contains a ß-galactosidase gene inserted in
frame into an EcoRV fragment derived form the Hoxb1 locus
(Marshall et al., 1994).
Whole-mount in situ hybridisation
The following mouse cDNA templates were used: Hoxb1, Hoxb2, Math3, Phox2b,
Gata2, Isl1, Lhx4, Er81, Met and Cad8. Antisense digoxigenin-labelled
riboprobes were synthesised from linearised templates by the incorporation of
digoxigenin-labelled UTP (Boehringer) using T3, T7 or SP6 polymerase.
Processing of the embryos and hybridisation with 500 ng ml–1
of the probe was as previously described
(Gavalas et al., 1998).
TUNEL assay
Embryos fixed in 4% PFA were embedded in 20% (w/v) gelatin and sectioned
using a Leica vibratome at 50 µm. The TUNEL reaction was carried out on the
sections as described (Maden et al.,
1997) and peroxidase staining as described
(Di Rocco et al., 2001b).
|
Results |
|---|
|
TOPSUMMARYIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
Expression patterns of Hoxb1 and Hoxb2 between 10.5
and 14.5 dpc
Analysis of Hoxa1, Hoxb1 and Hoxb2 expression patterns
have previously been performed between 7.5 and 10.5 dpc, spanning the stages
when the hindbrain is being segmentally patterned
(Frohman et al., 1990;
Murphy et al., 1989;
Murphy and Hill, 1991;
Wilkinson et al., 1989). To
understand the potential roles that these genes may play during neurogenesis
and neuronal differentiation, we extended this analysis to include later
developmental stages. We focused our attention on Hoxb1 and
Hoxb2, as Hoxa1 is no longer expressed in the hindbrain by
8.5 dpc (Murphy and Hill,
1991).
The early expression of Hoxb1 was uniform throughout r4, but underwent dynamic changes between 9.5-12.5 dpc. Then expression became upregulated in paired ventral and dorsal longitudinal stripes (Fig. 1A,B). By 11.5 dpc, the ventral r4 domain had further segregated into two separate columns, a narrow one next to the floorplate and a broader column that curved away from the midline (Fig. 1B). By 12.5 dpc, Hoxb1 expression in the hindbrain began to be downregulated and was not detectable at subsequent stages (Fig. 1C and data not shown).
|
), expression between 10.5 and 12.5 dpc was upregulated
in the r4, r5 and r6 territories (Fig.
1E-G). At 10.5 dpc the Hoxb2 pattern had resolved into a
series of longitudinal stripes, with a more complex and dynamic pattern that
persisted longer than that of Hoxb1
(Fig. 1D-H). Within r4, the
expression pattern at 10.5 dpc was very similar to that of Hoxb1
(Fig. 1A,E), consistent with
their regulatory relationship (Maconochie
et al., 1997). At 12.5 dpc Hoxb2 expression was absent in
the territory corresponding to the path of facial branchial motoneuron (fbm)
migration (Fig. 1G). From 12.5
dpc onwards, expression in the other longitudinal stripes became diffuse and
ill-defined (Fig. 1D,G,H).
Together, the temporally dynamic and longitudinal organisation of these Hox
expression patterns during neurogenesis provides a framework for examining
neuronal patterning in mutants of these genes.
Altered patterns of Math3 and Phox2b expression
suggest a defect in the generation of r4 neurons
To analyse Hoxa1, Hoxb1 and Hoxb2 mutants for
neurogenesis defects, we examined the expression of two genes that are
expressed in early neuronal precursors in the hindbrain. The atonal-related
gene Math3 is upregulated in early post-mitotic precursors
(Takebayashi et al., 1997),
and the paired homeobox gene Phox2b is expressed in both
proliferating precursors and post-mitotic neurons
(Dubreuil et al., 2000;
Pattyn et al., 2000;
Pattyn et al., 1997). In the
wild-type hindbrain, Math3 and Phox2b are each expressed in
three longitudinal columns with defined AP positions
(Fig. 2A,E) (see also
Davenne et al., 1999)).
Although it has not been established whether these columns overlap, we have
termed them the ventral (Vc), medial (Mc) and dorsal (Dc) columns to refer to
their respective DV positions (Fig.
2A, white arrows).
|
In addition to this ventral pattern, expression was also prominent in paired medial (Mc) and dorsal (Dc) columns for both Math3 and Phox2b. While the Mc population for each gene included r2 to r6, the dorsal column extended from r4 caudally, and therefore both columns overlapped in r4, r5 and r6 (Fig. 2A,E,I, black bar). Although Math3 expression in the dorsal column was more clearly visualised at 11.5 dpc than at 10.5 dpc, the Phox2b positive column was prominent at both 10.5 and 11.5 dpc (compare Fig. 2A with 2E,I; and data not shown).
In Hoxb1 mutants, Math3 and Phox2b expression
was downregulated at both 10.5 and 11.5 dpc in the ventral, medial and dorsal
columns of r4 compared with wild-type littermates, and, therefore, the r4
expression pattern now closely resembled that of r2 and r3 (compare
Fig. 2A with 2B, 2E with 2F, and 2I with
2J). These altered expression patterns support the notion that the
earlier homeotic transformation of r4 into r2 persists into the period of
neurogenesis and neuronal differentiation
(Studer et al., 1996).
Neurogenesis appeared less severely affected in Hoxb2 compared
with Hoxb1 mutants. Although Math3 and Phox2b
expression was reduced in the ventral r4 domain at 10.5 dpc when compared with
wild-type r4, it nevertheless remained stronger than in the neighbouring r3
and r5 domains (Fig. 2C) (see
Davenne et al., 1999). By 11.5
dpc, the reduction of Math3 expression in r4 had become more evident
(Fig. 2G and data not shown).
While Math3 expression was reduced throughout the ventral r4 domain
in 2/7 mutants (Fig. 2G), in
3/7 mutants upregulation was restricted to the posterior half of r4, and no
Math3 up-regulation at all could be detected in ventral r4 in 2/7
Hoxb2 mutants (data not shown). The dorsal and medial columns had
also receded caudally, as seen in Hoxb1 mutants at that stage. The
observation that neurogenesis defects in Hoxb2 mutants were generally
milder than in Hoxb1 mutants and more prominent at later stages
raised the possibility that only later-born neurons were affected (see
below).
In Hoxa1 mutants, the r4 domain is compressed to a very narrow
stripe of cells (del Toro et al.,
2001) and r5 is reduced and incorporated in r6
(Dollé et al., 1993;
Mark et al., 1993) to form a
territory termed here rx (Fig.
2D,H,L). Accordingly, the r4-specific upregulation of
Math3 and Phox2b expression is lost in Hoxa1
mutants (Fig. 2D,H,L; white
arrowheads), and the medial and dorsal columns were shortened along the AP
axis, so that they now overlapped by only one rhombomere rather than three
rhombomeres width, as normally seen (compare
Fig. 2A with 2D and 2E with
2H). Thus, the initial segmental patterning defects of
Hoxa1 mutants are paralleled by corresponding defects in subsequent
neurogenesis patterns.
In summary, loss of Hoxb1, Hoxb2 or Hoxa1 impaired hindbrain neurogenesis in areas where their regulatory interactions have previously been shown to regulate segmental patterning. The region most severely affected was ventral r4, where motoneurons are formed, consistent with the observation that facial nerve development is disrupted in these mutants.
Patterns of GATA2 expression suggest defects in the
formation of r4 efferent neurons
Specification of r4 efferent neurons depends upon the presence of the
zinc-finger transcription factor Gata3. In turn, Gata3
expression in r4 is controlled by Gata2, a transcription factor of
the same family that is expressed in ventral r4 between 8.5 and 10.5 dpc. The
ventral-most expression domain of Gata2 in r4 corresponds to the
efferent motoneurons in this territory
(Pata et al., 1999;
Varela-Echavarria et al.,
1996). Expression of Gata2 in ventral r4 depends upon
Hoxb1 (Nardelli et al.,
1999; Pata et al.,
1999) and accordingly, was completely lost in Hoxb1
mutants (Fig. 2N)
(Pata et al., 1999) and
reduced in Hoxb2 mutants (Fig.
2O). The ventral-most domain of Gata2 expression was
strongly reduced, but not abolished in Hoxa1 mutants
(Fig. 2P). By contrast, the
dorsal domain of Gata2 expression, which corresponds to V2
interneurons (Ericson et al.,
1997; Zhou et al.,
2000), was not affected in any of the mutants.
(Fig. 2N-P). These phenotypes
are consistent with the idea that in Hoxb1 mutants there is a more
complete transformation of an r4 to r2 identity than in Hoxb2
mutants, and that in Hoxa1 mutants the r4 territory is reduced, but
not lost.
Defects in hindbrain motoneuron migration in Hoxa1, Hoxb1 and Hoxb2
mutants between 10.5 and 12.5 dpc
To begin to understand how the observed changes in neurogenesis patterns
impacted on subsequent development of hindbrain neurons, we decided to follow
the migration patterns of postmitotic cranial motoneurons in our Hox mutants.
All postmitotic motoneurons in the hindbrain and the spinal cord are
characterised by the early expression of the LIM homeodomain protein Isl1
(Ericson et al., 1992;
Karlsson et al., 1990;
Tsuchida et al., 1994). In
wild-type hindbrains motoneuron differentiation was initiated at 10.5 dpc in
all rhombomeres, with elevated levels in r2 and r4
(Fig. 3A). Interestingly, at
this stage the difference in Isl1 expression levels between r4 and r2
appeared smaller than the difference observed in Phox2b and
Math3 expression levels between the two rhombomeres (compare
Fig. 2A,I with
Fig. 3A). This suggests that at
this stage not all committed Math3+ r4 motoneurons have fully
differentiated into postmitotic Isl1+ motoneurons. At 10.75 dpc
(Fig. 3B), prospective
trigeminal motoneurons began to migrate dorsally and half a day later they
started coalescing to form the trigeminal motor nucleus
(Fig. 3C) next to the exit
point of the trigeminal nerve. Migration of the trigeminal motoneurons
appeared to be complete by 11.5 dpc (Fig.
3D). In contrast to the trigeminal motoneurons, facial motoneurons
began their caudal migration at 11.25 dpc
(Fig. 3C). Subsequently, they
followed a curved path around the prospective abducens motor nucleus into a
medial position of the pial side of the r6 territory where they form the
facial motor nucleus (Fig.
3D,E,I,M) (Auclair et al.,
1996; Studer et al.,
1996). We initiated the analysis of motoneuron migration in our
Hox mutants at 11.25 dpc, a time when most trigeminal motoneurons have
completed their dorsal migration, but r4 motoneurons are migrating
caudally.
|
;
Mark et al., 1993). In
Hoxb1 mutants the r4 motoneurons migrated dorsally
(Fig. 3G) assuming a
trigeminal-like migratory behaviour. Interestingly, in the Hoxb2
mutants, a proportion of r4 motoneurons seemed to follow the normal path of
migration, while a second population followed a trigeminal-like pattern of
migration (Fig. 3H), consistent
with a partial r4 to r2 transformation.
The dorsally migrating motoneurons detected in all three mutants appear to
form an ectopic motor nucleus, first identified in the Hoxb1 mutants
at a position anterior to the normal facial motor nucleus
(Goddard et al., 1996;
Studer et al., 1996).
Accordingly, we extended the analysis of Isl1 expression to later
stages of hindbrain development. At 12.5 dpc, r4 motoneurons migrated from the
ventricular aspect of ventral r4 and r5 to a medial position at the pial side
of r6 (Fig. 3I,M) to form the
facial motor nucleus (Altman and Bayer,
1982; Auclair et al.,
1996). During their migration, they assumed a caudal course with a
dorsolateral deviation travelling in a loop around the sixth motor nucleus
(Altman and Bayer, 1982;
Auclair et al., 1996;
Goddard et al., 1996;
Studer et al., 1996).
Accordingly, at this stage the abducens motor nucleus is not distinguishable
in whole mounts as the facial motoneurons migrate over the same area.
At 12.5 dpc only a few caudally migrating r4 motoneurons, which had not
reached the pial side of the hindbrain, were seen in Hoxa1 mutants
(compare Fig. 3J,N). Their
course of migration was shortened due to the overall reduction of the caudal
hindbrain length in these mutants (Mark et
al., 1993). Small ectopic nuclei were also detected
(Fig. 3N), suggesting that the
laterally migrating motoneurons detected earlier had indeed assumed a
trigeminal-like behaviour. They were positioned between the trigeminal nuclei
and the area where facial motor nuclei normally resided (compare
Fig. 3N with 3M). Their AP
position was variable between different embryos and even between the left and
right side of the same embryo (Fig.
3N). Despite the low number of the r4-derived motoneurons the
abducens motor nucleus could not be detected (see also below), and this is in
accordance with the observation that the r5 territory is nearly eliminated in
these mutants (Dollé et al.,
1993; Mark et al.,
1993). No r4-derived motoneurons were observed in the ventricular
area of Hoxb1 mutants at 12.5 dpc, while r5-derived abducens
motoneurons were now clearly visible (Fig.
3K,O). In these mutants, no facial motor nuclei were formed in the
appropriate site (compare Fig. 3O with
3M). Instead, ectopic nuclei were observed in more anterior
positions (Fig. 3O) (see
Studer et al., 1996)). In
Hoxb1 mutants, ectopic nuclei invariably resided in an area about
half way between the normal positions of the trigeminal and facial motor
nuclei. They were larger than the Hoxa1 ectopic nuclei but remained
smaller than the trigeminal nuclei. In all but one of six cases examined,
Hoxb2 mutants formed correctly positioned facial motor nuclei
(Fig. 3L,P and data not shown).
However, the number of caudally migrating pool of facial motoneurons was
variable and reduced in most cases (compare
Fig. 3I,O with 3L,P).
Hoxb2 mutants showed variability with respect to the number and
position of ectopic nuclei, which always resided between the trigeminal and
facial nuclei. Importantly, there was an inverse correlation between the size
of the normally positioned facial nuclei and the number/size of the ectopic
nuclei (compare Fig. 3Q-T).
These results revealed a striking commonality of phenotypes among the three mutants examined. Motoneurons derived from the r4 of Hoxb1 mutants appear to be misspecified and follow an r2 migratory pathway. By contrast, in Hoxa1 and Hoxb2 mutants r4 derived motoneurons display both trigeminal and facial migratory behaviours, suggesting there are mixed identities or a partial transformation. In all mutants, ectopic motoneurons migrated dorsally to the r4/r5-derived vm neurons, suggesting that they retained a bm neuron identity.
Hoxb1 requires Hoxb2 for complete specification of facial motoneuron
identity
Facial motoneurons depend upon Hoxb1 for correct specification.
The presence of two migratory populations in Hoxb2 mutants could be
explained by two alternative possibilities. Either cumulative levels of
Hoxb1 and Hoxb2 activity may be necessary in all cells for
robust specification of fbm fate or, alternatively, Hoxb2 may be
necessary to specify a subset of facial motoneurons. In the first case,
molecular markers of fbms would be similarly affected, whereas in the second
case they would be differentially affected. To address this issue we used
riboprobes for Lhx4 and Er81, which are expressed during the
late phase of facial motor nucleus development. Lhx4, a LIM
homeobox-containing transcription factor, has been implicated in assigning
motoneuron subtype identities in the spinal cord
(Sharma et al., 1998), whereas
Er81, an Ets transcription factor, has been implicated in the
formation of functional circuits between proprioceptive afferent neurons and
motoneurons of the spinal cord (Arber et
al., 2000).
At 14.5 dpc Lhx4 was expressed in the trigeminal as well as the superior salivatory motor nucleus and the forming facial motor nucleus (Fig. 4A). By contrast, Er81 was expressed in the facial motor nucleus (Fig. 4C). We examined the expression of these transcription factors in Hoxb2 mutant embryos in order to determine whether any of the populations they mark was specifically affected. Expression of both markers was reduced in the forming facial motor nucleus, suggesting that the reduction of the nucleus was not due to preferential loss of a specific subpopulation (Fig. 4B,D). Lhx4 (Fig. 4B), but not Er81 (Fig. 4D), was expressed in the ectopic motoneurons. The position of the Lhx4+ ectopic cells is similar to that of the Isl1+ ectopic cells, and this is consistent with the idea that these motoneurons have acquired a trigeminal identity. Therefore, Hoxb2 does not specify a subset of fbms, but rather the total dose of Hoxb1 and Hoxb2 activity is important for full fbm specification.
|
). The
aberrant migratory phenotype could be due to either cell-autonomous changes in
the fbm identity, changes in the resident territory or both. Furthermore, it
was unclear whether molecular changes detected in early hindbrain development
persisted during neuronal patterning as well. We addressed these issues by
molecular analysis at late stages in hindbrain development. All bm and vm neurons in the hindbrain express Phox2b at 10.5 dpc (Pattyn et al., 1997b) (Fig. 3A). At 12.5 dpc Phox2b expression persists only in trigeminal and facial motoneurons (Fig. 5A,D). To determine whether ectopic nuclei retained features of either of these neurons, we examined the expression of Phox2b in Hoxb1 (Fig. 5B,E) and Hoxb2 (Fig. 5C,F) mutants. In both mutants Phox2b expression was retained in the ectopic motoneurons, suggesting that they had either a trigeminal or facial-like identity. The presence of laterally located neurons expressing Phox2b at that stage precluded an unambiguous analysis in the Hoxa1 mutants in which the length of the hindbrain, and thus that of the Phox2b+ neuron-free area, is reduced.
|
).
Met is expressed in trigeminal motoneurons and in the vm neurons of
the salivatory nucleus (Fig.
6A) (Caton et al.,
2000), but not in the r4 derived facial motor nucleus.
|
).
To further examine the identity of the ectopic nuclei, we analysed
expression of cadherin 8 (Cad8) (Korematsu
and Redies, 1997), a member of the Ca2+ dependent
surface adhesion molecules (Takeichi et
al., 1997). The mouse Cad8 is expressed in the facial,
but not the trigeminal motor nucleus from 12.5 dpc into postnatal life
(Korematsu and Redies, 1997).
In wild-type hindbrains, Cad8 is expressed in the r1, r2 and r3
territories in a broad ventral stripe and in the facial motor nucleus
(Fig. 6C,F). At 12.5 dpc there
is also a narrow, longitudinal stripe of expression next to the floorplate in
r1 and r2 but not r3 (Fig. 6C).
At 13.5 dpc, this stripe extended into the r3 territory
(Fig. 6F).
Only a rudimentary facial motor nucleus could be detected in some Hoxa1 mutants at 13.5 dpc and none could be detected in Hoxb1 mutants at either 12.5 or 13.5 dpc. In contrast to the Isl1 expression analysis, the Cad8 probe did not label the r4-derived ectopic nuclei in either Hoxa1 or Hoxb1 mutants (Fig. 6D,G,E,H), supporting the idea that they lacked facial identity. The early caudal expansion of the r3 territory in Hoxa1 mutants was also detected at these stages by means of Cad8 expression (compare Fig. 6D with 6C, and 6G with 6F). The extent of the expansion was variable and not always the same on the left and right sides of the same embryo (compare Fig. 6D with 6C, and 6G with 6F), in accordance with similar observations at earlier stages. In Hoxb1 mutants, Cad8 expression was normal in r1-r3, but upregulated in r4 at 12.5 dpc, resembling the r1/r2 expression pattern (compare Fig. 6E with 6C).
Taken together, these observations suggest that patterning defects in the r3-r5 territories persist well into the phase of neurogenesis and neuronal differentiation. As a direct consequence, r4 and r4-derived motoneurons, which migrate ectopically, have adopted an r2 and trigeminal-like identity, respectively.
Ectopic motor nuclei are lost by 14.5 dpc through cell death
Given that in these mutants there is no corresponding transformation of
their innervation targets, namely the second arch
(Goddard et al., 1996;
Studer et al., 1996), we
wondered whether this mismatch would eventually lead to apoptotic cell death
of these neurons because of lack of proper trophic support. To analyse whether
the ectopic motoneurons were cleared by cell death, we performed TUNEL assays
at 12.5 dpc on hindbrain sections of wild-type and Hoxb1 mutant
embryos, which displayed the most prominent r4-derived ectopic nuclei. Ectopic
cell death was detected in Hoxb1 mutants at positions corresponding
to the AP level of ectopic motoneurons (compare
Fig. 7A with 7B). We then
analysed the fate of motoneurons at later stages in wild-type and mutant
embryos by Isl1 expression analysis.
|
In Hoxa1 mutants no ectopic nuclei were observed at these stages;
however, a rudimentary facial motor nucleus of variable size was retained in
most, but not all cases (Fig.
7D,H). This observation could explain disagreements among earlier
reports on the presence or lack of the facial nucleus in these mutants
(Carpenter et al., 1993;
Mark et al., 1993). In both
Hoxb1 and Hoxb2 mutants, the ectopic nuclei were still
detectable at 13.5 dpc, but not at 14.5 dpc (compare
Fig. 7E,F with 7I,J,
respectively). In agreement with the Isl1 expression at earlier
stages, the facial motor nucleus was absent in Hoxb1 mutants, but
present, albeit variably reduced, in all Hoxb2 mutants examined. The
abducens motor nucleus (VIm) was present in Hoxb1 and Hoxb2
mutants (compare Fig. 7E,I and 7F,J with
the wild type in 7C,G). This nucleus could not be detected in
Hoxa1 mutants, and was consistent with the loss of r5 in these
mutants (7D,H).
Taken together, these results suggest that Isl1+ ectopic nuclei are not retained to any significant extent beyond 13.5 dpc in any of the mutants examined. This is in agreement with the idea that due to their switch in identity, they are unable to respond to trophic support from their innervation targets in the second arch and die by apoptosis. We therefore decided to investigate whether a block in the apoptotic pathway could extend the presence of these nuclei in the hindbrain.
The presence of the ectopic nuclei can be extended by a block in the
apoptotic pathway
Bax, a member of the Bcl2 family, is necessary for the programmed cell
death of many neurons. Facial motoneurons in Bax knockout mice show
increased numbers at birth and sympathetic neurons from these mice can survive
for long periods in culture without trophic support. Thus, this mutation
blocks the apoptotic pathway induced from lack of trophic support
(Deckwerth et al., 1998). To
test whether it was possible to extend the survival of the ectopic motoneurons
we crossed this mutation (Deckwerth et
al., 1998) into the Hoxb1 mutant genetic background.
Loss of Bax function extended the survival of ectopic motor nuclei in the hindbrains of Hoxb1 mutants to 14.5 dpc (compare Fig. 8C with 8D). Interestingly, we also found excess numbers of motoneurons in the ventral domain of the caudal hindbrain of Bax-null mutants between 12.5 and 14.5 dpc (compare Fig. 8A with 8C and data not shown). Their ventral position indicated that they were specified as sm neurons and therefore did not contribute to the IX and X/XI motor nerves, which are mixed branchiomotor and visceromotor nerves.
|
|
Discussion |
|---|
|
TOPSUMMARYIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
;
Maconochie et al., 1997;
Studer et al., 1998). This
pathway may also be important in regulating later events in neural patterning.
In this study, we examined neurogenesis and motoneuron migration defects in
mouse mutants of these three genes and found that there are strong
similarities in the phenotypes that are correlated with their regulatory
relationship. Common defects were largely concentrated to the r4 territory and
included abnormalities in the patterns of neurogenesis and neuronal
differentiation. The r4-derived motoneurons underwent a transformation towards
an r2 identity. This altered identity was maintained until late stages of
hindbrain development, at which point misspecified motoneurons from the
transformed segment migrated to an ectopic position and were cleared by cell
death. Using Bax mutants
(Deckwerth et al., 1998), we
found that survival of the misspecified motoneurons could be prolonged by a
genetic block in the apoptotic pathway. These results suggest that the
regulatory hierarchy between Hoxa1, Hoxb1 and Hoxb2 is not
only required to control early hindbrain patterning, but also shapes patterns
of neurogenesis and the behaviour of differentiating neurons.
Common roles for Hoxb1 and Hoxb2
Rhombomeric and neuronal patterning defects were milder in the
Hoxb2 mutants, compared with Hoxb1–/–
embryos. Furthermore, there were no r4-derived phenotypes in Hoxb2
mutants that were not detected in Hoxb1 mutants. This is consistent
with Hoxb2 being a direct transcriptional target of Hoxb1
(Maconochie et al., 1997) and
raises a number of possibilities concerning the precise regulatory and
functional relationships between Hoxb1 and Hoxb2. Hoxb2 may
act synergistically with Hoxb1 by regulating either distinct target
genes or a set of common target genes in r4, so that their combined activities
are required for the normal differentiation of r4-derived motoneurons. An
alternative mechanism whereby Hoxb2 may synergise with Hoxb1
would be through a role for Hoxb2 in maintaining Hoxb1
expression.
To begin to distinguish between these possibilities, we monitored the r4
status in the Hoxb2 mutants by assaying Hoxb1 expression and
the expression of a the r4-specific transgene (HL5/lacz), which is
known to be a direct target of Hoxb1
(Marshall et al., 1994;
Popperl et al., 1995).
Endogenous Hoxb1 expression (Fig.
9A-F) and staining for the HL5/lacZ transgene
(Fig. 9G-O) are initiated in
the r4 of Hoxb2 mutants (Fig.
3B) but are not maintained at appropriate levels in later stages.
This demonstrates a direct or indirect requirement for Hoxb2 in maintaining
Hoxb1 expression in r4 (Fig.
9P). The observation that Hoxb1 expression is initiated
normally in Hoxb2 mutants, but is not maintained properly could
explain the mixed behaviour of facial motoneurons. Those r4 motoneuron
progenitors that retain sufficient Hoxb1 activity adopt a normal fbm
identity, while the rest adopt trigeminal motoneuron characteristics. We
favour the idea that the effect of Hoxb2 on Hoxb1 expression
is most probably indirect, through regulation of general aspects of r4
identity. Hoxb2 cannot bind the Hoxb1 r4 regulatory element in vitro,
although it is possible that Hoxb2 may bind to an as yet unidentified
Hoxb1 r4 regulatory element. In vivo, ectopic expression of
Hoxb2 does not ectopically activate Hoxb1, whereas
Hoxb1 does transactivate Hoxb2
(Maconochie et al., 1997).
|
). In
Hoxb2, there is a reduction in the numbers of caudally migrating r4
motoneurons (Davenne et al.,
1999) and consistent with reduction of r4 in the Hoxa1
mutants, there is a greatly diminished r4 motoneuron population that migrates
caudally. There were two populations in the expanded r3 territory of these
mutants. One population projected axons in an r3-like pattern to the first
arch and a second variable population projected axons in an even
rhombomere-like pattern to the second arch
(Gavalas et al., 1998). These
populations were often, but not always, intermixed. The detection of an
ectopic nucleus in Hoxb1 (Studer
et al., 1996) and Hoxa1
(Mark et al., 1993) mutants at
later stages suggested an abnormal migratory behaviour of presumptive facial
motoneurons rather than a simple temporal delay of their migration.
To understand the fate of these motoneurons, we followed their migratory
behaviour by monitoring Isl1 expression
(Ericson et al., 1997;
Osumi et al., 1997) at
different stages in all three mutants examined. The migratory pattern and
final location of this population resembled that of r2-derived motoneurons.
The size of the ectopic nucleus and the loss or reduction of the correctly
migrating fbm population varied among the mutants in a manner that resembled
an allelic series. The Hoxb1 and Hoxb2 phenotypes could be
explained by a strong or weak transformation, respectively, of r4 into r2. The
Hoxa1 phenotype was consistent with a partial transformation of r4
into r2 and concurrent loss of cell sorting at the r4/r3 interface.
Presumptive r4 cells that failed to activate Hoxb1 were specified as
r2-like cells and intermingled with r3 cells
(Helmbacher et al., 1998).
This is consistent with the presence of cells with an r2 identity in this
region (del Toro et al., 2001;
Helmbacher et al., 1998).
Therefore, the trigeminal-like ectopic nuclei observed in the Hoxa1
mutants (Mark et al., 1993)
(this study) appeared to be the progeny of misspecified presumptive r4 cells.
Intermixing at the r3/r4 interface may lead to patterning defects in a subset
of r3. This could explain the presence of ectopic motoneurons projecting via
the trigeminal motor root in the brainstem of
Hoxa1–/– pups
(del Toro et al., 2001).
Cells of presumptive r4 able to activate Hoxb1 give rise to the
correctly migrating fbms in Hoxa1 mutants. Consistent with this, we
found a severely reduced facial motor nucleus in some but not all
Hoxa1 mutant embryos. Therefore, the Hoxa1 r4 motoneuron
phenotype is fundamentally similar to that of Hoxb1 mutants, with the
exception of a subset of r4 cells that are properly specified because of later
activation of Hoxb1 expression. These observations are consistent
with a strong, but not absolute, requirement of Hoxa1 for the
activation of Hoxb1 (Studer et
al., 1996).
Transformation and changes in neuronal differentiation
The migratory patterns of the presumptive fbms in all three mutants
suggested a transformation of their territory of origin (r4) towards an r2
identity. To further investigate the extent of this transformation we analysed
patterns of neurogenesis and neural differentiation in these mutants and the
results are summarized in Fig.
10. The r4 territory in the Hoxb1 mutants assumed aspects
of an r2 identity from an early stage in development
(Studer et al., 1996). This
altered specification persisted in later stages, as expression of both
Phox2b and Math3 followed an r2-like pattern along the full
DV extent of the rhombomere. Furthermore, using Gata2
(Nardelli et al., 1999;
Pata et al., 1999) as a marker
for the whole complement of r4 efferent motoneurons, we found that expression
was reduced in ventral r4 and resembled that in the r2 territory. The
presumptive r4 territory in the Hoxb1 mutants may have retained some
aspects of r4 identity since expression of Epha2, an early marker of
this territory, is not lost (Studer et
al., 1998) and expression of Hoxb2 is downregulated but
not abolished (Maconochie et al.,
1997). Therefore, some neuronal progenitors may still be born
following an r4-specific program, but loss of Hoxb1 may result in
their early removal by cell death as observed
(Gaufo et al., 2000). The
reduction of the superior salivatory nucleus, that is primarily derived from
r5 (Jacob and Guthrie, 2000;
McKay et al., 1997), in
Hoxb1 mutants is consistent with early patterning defects found in
the r5 territory of these mutants. Signals derived from r4 may be necessary
for correct patterning of this and other rhombomeres
(Maves et al., 2002;
Studer et al., 1996;
Walshe et al., 2002).
|
) result in a drastically reduced r4 territory, and therefore
it was difficult to determine whether r4-specific patterns of neurogenesis and
differentiation were implemented. Nevertheless, consistent with the hypothesis
that the r4 program is executed although in a reduced territory of
Hoxa1 mutants, we were able to document r4-specific patterns of
Gata2 expression.
Molecular analysis confirmed that the initial changes in segmental identity
persisted at later stages in hindbrain development. Ectopic motor nuclei in
both Hoxb1 and Hoxb2 mutants retained expression of
Phox2b, suggesting that they were specified as branchiomotoneurons.
Similarly, the loss of Cad8 expression, which is characteristic of
fbms at their final position (Garel et
al., 2000; Korematsu and
Redies, 1997), and ectopic expression of the tyrosine kinase
receptor Met (Caton et al.,
2000) were consistent with an r4 to r2 transformation. Ectopic
expression of Cad8 in the ventral r4 territory of the Hoxb1
mutants in an r2-specific pattern suggested that both cell-autonomous (see
above) as well as non cell-autonomous defects may contribute in the
misspecification of the r4-derived motoneurons. The caudal extension of
Cad8 expression was smaller in Hoxa1 mutants, in agreement
with a partial transformation of r4 into r2.
The Hoxb2 motoneuron phenotype represented a milder version of the Hoxb1 phenotype, as only a subpopulation of the presumptive fbms assumed migration and gene expression patterns corresponding to a trigeminal-like identity. Expression of Lhx4 and Er81 support the idea that the ectopic motoneurons have undergone an r4 to r2 change in identity. Their expression was similarly affected in the correctly specified fbms, suggesting a general, late Hoxb2 requirement for fbm specification. This implies that loss of Hoxb2 might reduce the total level of Hoxb activity to threshold levels resulting in a variable phenotype due to the stochastic variation of gene expression. This situation would not affect specific fbm subpopulation(s).
The migratory behaviour of r4 motoneurons and molecu
