|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 October 2003
doi: 10.1242/dev.00807
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Genes and Development Research Group and Department of Biochemistry and Molecular Biology, University of Calgary, 3330 Hospital Dr NW, Calgary, AB, Canada, T2N 4N1
Author for correspondence (e-mail:
mains{at}ucalgary.ca)
Accepted 20 August 2003
| SUMMARY |
|---|
|
|
|---|
Key words: C. elegans, Rho-binding kinase, Myosin phosphatase, Nonmuscle myosin, Morphogenesis
| Introduction |
|---|
|
|
|---|
let-502/Rho-binding kinase (ROK) and mel-11/myosin
phosphatase targeting subunit (MYPT or myosin-binding subunit MBS) regulate
the cell shape changes within the lateral epidermal cells to drive elongation.
Based on genetic data coupled with the known functions of their vertebrate
homologs in the regulation of smooth muscle contraction and focal adhesions
formation (Kaibuchi et al.,
1999
; Pfitzer,
2001
; Piekny et al.,
2000
; Shelton et al.,
1999
; Somlyo and Somlyo,
2000
; Wissmann et al.,
1997
), let-502 and mel-11 probably regulate
elongation by altering the activity of myosin. Contraction is triggered by
phosphorylation of regulatory myosin light chain (rMLC, mlc-4 in
C. elegans) by myosin light chain kinase or integrin-linked kinase
(Pfitzer, 2001
;
Somlyo and Somlyo, 2000
).
Myosin phosphatase in turn removes the activating phosphate from rMLC,
preventing contraction. Activation of ROK by the small GTPase Rho results in
an inhibitory phosphorylation of the targeting subunit MYPT of myosin
phosphatase, releasing the block to contraction. let-502/ROK and
mlc-4/rMLC mutants fail to elongate, while mel-11/MYPT
mutants hypercontract.
The Drosophila homologs Drok/ROK and MYPT similarly regulate
morphogenetic processes. Nonmuscle MHC zipper and rMLC
spaghetti-squash, Drok and Mypt/Dmbs are required for dorsal closure
(Mizuno et al., 2002
;
Tan et al., 2003
;
Winter et al., 2001
;
Young et al., 1993
). These
molecules also are involved in other developmental processes such as epidermal
planar polarization (Winter et al.,
2001
). Therefore, nonmuscle myosin, ROK and MYPT probably comprise
a conserved `cassette' that is used for many developmentally-specific
contractile processes during animal development.
To identify new components of the C. elegans elongation pathway,
we screened for suppressors of the mel-11 hypercontraction phenotype
(Piekny et al., 2000
). Here,
we describe nmy-1, which encodes a nonmuscle myosin heavy chain
(MHC). Genetic evidence is consistent with nmy-1 acting as a partner
for MLC-4/rMLC, the downstream target for LET-502/ROK and MEL-11/MYPT.
However, the nmy-1 null mutant phenotype is less severe than
mlc-4 or let-502, suggesting that nmy-1 functions
redundantly. Indeed, we found that nmy-2, previously known only for
its requirement in the early embryo (Cuenca
et al., 2003
; Guo and
Kemphues, 1996
) acts in concert with nmy-1. In addition,
NMY-1 antisera reveal that this protein forms filamentous-like structures in
the lateral epidermal cells during elongation.
The expression pattern of LET-502 and MEL-11, determined by GFP
transcriptional reporters, is consistent with their functioning as regulators
of elongation (Wissmann et al.,
1999
). LET-502, the trigger for contraction, is expressed in the
same lateral epidermal cells as MLC-4 that drive elongation
(Shelton et al., 1999
;
Wissmann et al., 1999
).
MEL-11, the negative regulator of contraction, is also expressed within these
cells; however, at lower levels than in the neighboring dorsal and ventral
epidermal cells (Wissmann et al.,
1999
). A caveat is that these reporters revealed only zygotic
transcription, although either maternal or zygotic activity of the two genes
suffices for viability. Therefore we do not know precisely in which cells the
genes act nor the mechanism by which LET-502 and MEL-11 regulate epidermal
cell shape changes. For example, they could regulate myosin contraction and/or
tether actin cables to the membrane during morphogenesis. Using antisera
against LET-502 and MEL-11, we show that both proteins are expressed in the
lateral epidermal cells during elongation. Although LET-502 localizes near
myosin throughout elongation, MEL-11 becomes sequestered away from the
contractile apparatus in response to LET-502 activity. Thus, LET-502 and
MEL-11 act at the level of myosin contractility.
| Materials and methods |
|---|
|
|
|---|
Nomenclature follows that of Horvitz et al.
(Horvitz et al., 1979
). Genes,
alleles and balancer chromosomes listed are below; descriptions can be found
in Edgley et al. (Edgley et al.,
1995
), Hodgkin (Hodgkin,
1997
) and in Wormbase
(www.wormbase.org).
Linkage Group I: let-502(ca201, sb106ts and sb108), dpy-5(e61), rde-2(ne221). Linkage Group II: mel-11(it26ts and sb55), unc-4(e120), sqt-1(sc13). Linkage Group III: mlc-4(or253). Linkage Group V: sma-1(e30). Linkage Group X: unc-115(e2225), dpy-8(e130), unc-78(e1217), spc-1(ra409), nmy-1(sb92, sb113 and sb115), unc-2(e55). Balancer chromosomes: the crossover suppressor mnC1 II was used to balance mel-11.
Single nucleotide polymorphism mapping
Single nucleotide polymorphism mapping was performed as described by Wicks
et al. (Wicks et al., 2001
).
The Dumpy (Dpy) and Lumpy phenotype of sb113 was mapped to the left
arm of LGX by crossing with the Hawaiian strain CB4856 and using
primers indicated in Wicks et al. (Wicks
et al., 2001
). Another mutant, sb115, was mapped to the
left arm of LGX between dpy-8 and unc-115 via
classical genetics. sb92 has no phenotype on its own but was mapped
between unc-2 and unc-78 based on suppression of mel-11.
sb115 dpy-8 was crossed to CB4856, and Lumpy non-Dpy and Dpy non-Lumpy
recombinants were selected, mapping sb115 between polymorphisms
Y41G9A and F52E4 (data submitted to Wormbase). Cosmid F52B10 is within this
region and contains nmy-1. Two independent PCR products spanning
nmy-1 in sb92, sb113 and sb115, were sequenced
(University of Calgary Core DNA Sequencing Laboratory)
(Piekny et al., 2000
) and were
found to contain mutations (see Results).
Microscopy and immunofluorescence
Embryos were dissected from gravid hermaphrodites that had been incubated
without food for 1 hour. This induces animals to hold their eggs, enriching
for mid-stage embryos. Embryos were mounted in M9 solution
(Horvitz and Sulston, 1980
) or
larva and adults were placed in anaesthetizing solution (0.1% tricaine, 0.01%
tetramisole) on 3% agarose pads. Specimens were examined by Nomarski optics on
a Zeiss Axioplan 2 microscope, and images were photographed using the
Hamamatsu Orca ER digital camera and collected using Axiovision 3.0 for
Windows NT.
For indirect immunofluorescence, mid-staged embryos were placed on
polylysine-coated slides in M9. A cover slip was placed on each slide, and the
embryos were frozen on dry ice for at least 30 minutes. The cover slips were
cracked off, and slides were placed in 20°C methanol for 10
minutes, followed by 20 minutes in 20°C acetone, then rehydrated
with 90% ethanol for 10 minutes at 20°C, 60% ethanol for 10 minutes
at 20°C, then 30% ethanol for 10 minutes at room temperature. For
actin and some NMY-1 staining, freeze-cracked slides were placed in a 3.7%
formaldehyde solution (w/v) in 1x phosphate-buffered saline (PBS) at
room temperature for 10 minutes and then placed in 1x PBS with 0.1%
Tween-20 (PBT). For all methods, the slides were placed directly into
1xPBT for a minimum of 1 hour, then incubated with appropriate dilutions
of antisera in PBT with 20% normal goat or donkey serum (Jackson
Immunoresearch Laboratories). F-actin was stained with phalloidin-Alexa 488
(Molecular Probes; 10 µl/slide was placed into a tube and the methanol was
evaporated overnight, then 1xPBT was added with 20% normal goat serum
and other antisera if needed). Rabbit anti-NMY-2 polyclonal antibodies
(Guo and Kemphues, 1996
) were
used at a 1:50 dilution, rabbit anti-MEL-11 polyclonal antibodies at 1:50
(Piekny et al., 2002), rat anti-LET-502 polyclonal antibodies at 1:50 (Piekny
et al., 2002), rat anti-NMY-1 polyclonal antibodies (see below) at 1:200 and
rabbit anti-NMY-1 polyclonal antibodies (see below) at 1:1000. All slides were
incubated with primary antibodies for 1 hour to overnight at room temperature
and washed three times with PBT. Anti-rat IgG conjugated to indocarbocyanine
(Cy-3; Jackson Immunoresearch Laboratories) and anti-rabbit IgG conjugated to
Alexa 488 (Molecular Probes) were used at a 1:100 dilution in PBT, and slides
were incubated at room temperature for 1 hour. Slides were washed three times
with PBT and soaked in 1 µg/ml DAPI (Roche) for 1 minute at room
temperature, washed with PBT, then mounted with a drop of Slowfade Light
Antifade solution (Molecular Probes). Images were collected using Axiovision
3.0 for Windows NT as stacks of 20x1 µm from a Zeiss Axioplan 2
microscope using a 63x oil objective with the Hamamatsu Orca ER digital
camera. Stacks were digitally deconvolved using the constrained iterative
algorithm of Axiovision 3.0 for Windows NT. Superficial stacks corresponding
to epidermal cells or internal stacks corresponding to the
pharyngeal/intestinal region were analyzed with Adobe Photoshop version 4.0
for Windows.
RNA-mediated interference (RNAi)
Double-stranded RNA (dsRNA) was generated for nmy-1 and
nmy-2. The primers for nmy-1 were made to the C-terminal
region of the coding sequence (sequence identity <80% with nmy-2).
The primers were: forward primer (including the T3 promoter)
5'AATTAACCCTCACTAAAGGGGCAACATCAACTGACGAG3' and reverse primer
(including the T7 promoter)
5'TAATACGACTCACTATAGGGAGCATCGAGAAGATCGTC3'. Primers for
nmy-2 similarly were made to the C-terminal portion of the coding
sequence showing lower sequence homology to nmy-1. The primers were:
forward primer (including the T3 promoter)
5'AATTAACCCTCACTAAAGGGGACGAGACTCGATGCTGA3' and reverse primer
(including the T7 promoter)
5'TAATACGACTCACTATAGGGATCTCTGGAGAGTGTCTC3'. dsRNA was made from
the PCR products and used for soaking worms as described in Piekny and Mains
(Piekny and Mains, 2002
).
dsRNA to nmy-1, nmy-2 and both together were injected as described by
Fire et al. (Fire et al., 1998
)
with concentrations varying from 10-6 µg/µl to 1 µg/µl
for each gene. Some nmy-2 RNAi experiments were performed using
bacteria expressing dsRNA from the feeding library described by Fraser et al.
(Fraser et al., 2000
). L4 or
young adult were cultured for 1-2 days until first broods were obtained and
were passaged to plates seeded with normal E. coli for subsequent
broods.
NMY-1 antisera
Rat polyclonal antibodies were generated using a GST-NMY-1 fusion encoding
C-terminal region amino acids 941-1133, which was amplified using the
following primers: forward (containing the BamHI restriction site)
5'TACAGGATCCGAGAAACCGTCCGTGATCTC3' and reverse (containing the
EcoRI restriction site)
5'CGAGGAATTCCCTTGTCATTTCTGCCTTAT3' and cloned directionally into
the pGEX-3X vector (Pharmacia). Rat injections were performed as described
previously (Piekny and Mains,
2002
). Rabbit polyclonal antibodies were raised against a
GST-NMY-1 fusion by the Peptide Group from Macromolecular Resources. All
antisera were purified by subtracting against a glutathione-sepharose 4B
column (Pharmacia). Western blot analysis showed that all of the antisera
recognized a predominant band above 200 kDa (expected
230 kDa) with
gravid adult hermaphrodite extracts obtained by 1xPBS and with extracts
further solubilized with 1 M NaCl, implying that pools of NMY-1 are both
cytoplasmic and associated with the cytoskeleton (data not shown). The band
was blocked by adding excess GST-NMY-1 to the antisera (data not shown) and
immunostaining was not detectable in nmy-1(sb115) (data not shown but
see results), which truncates the protein before the region used for
immunization.
| Results |
|---|
|
|
|---|
|
|
6000 bp,
similar to the predicted length of 6383 nucleotides (data not shown).
Sequencing confirmed the predicted intron/exon structure of nmy-1
found at Wormbase
(www.wormbase.org).
In addition, microarray data predicts that nmy-1 is most highly
expressed during embryogenesis (Hill et
al., 2000
A previous large-scale RNAi survey reported sterility, lethality and Dpy
and uncoordinated (Unc) phenotypes for nmy-1
(Kamath et al., 2003
).
However, short regions of high DNA sequence identity to nmy-2 in the
myosin head domain could result in RNAi crossreactivity. We performed
nmy-1 gene-specific RNAi (Materials and methods) and observed little
embryonic lethality but did see Dpy Lumpy phenotypes identical to those of our
nmy-1 alleles sb113 and sb115. Like our
nmy-1 alleles, injection of nmy-1 dsRNA suppressed
mel-11 lethality (Table
1).
nmy-1 alleles behave as semi-dominant suppressors of mel-11 with stronger suppression when homozygous (Table 1). Although suppressed mel-11; nmy-1 embryos hatch, a large proportion of the early larva with sb113 and sb115 arrested with an elongation phenotype similar to let-502 and mlc-4. For example, 84% of mel-11(it26); nmy-1(sb113) larva that hatched at 25°C displayed L1 arrest without elongation, in comparison to nmy-1(sb113) alone, which displayed 1-4% L1-L3 larva arrest/slow growth (Table 2). All escapers showed the sb113 Dpy, Lumpy phenotype, indicating that mel-11 did not reciprocally suppress the nmy-1 morphological defects. All mel-11(it26); nmy-1(sb115) larva displayed L1 arrest compared with 30% for sb115 alone (data not shown).
|
|
NMY-1 is redundant with NMY-2
Although NMY-1 is predicted to partner with MLC-4, nmy-1(null) is
viable while the mlc-4(null) is lethal
(Shelton et al., 1999
); all
mlc-4 mutant larva arrest at L1 with failed elongation
(Fig. 2B). This result implies
that nmy-1 is not the only myosin target of the
let-502/mel-11 pathway. NMY-2 is a nonmuscle MHC with high levels of
sequence similarity to NMY-1 (Fig.
1) and has been characterized for its role in anterior/posterior
polarity and cytokinesis using RNAi (Cuenca
et al., 2003
; Guo and
Kemphues, 1996
). Because RNAi results in early, lethal defects,
the role of nmy-2 in elongation has not been explored.
To determine if nmy-2 could potentially function redundantly with nmy-1, we stained wild-type embryos with NMY-2 antisera to determine if the protein persists through elongation. NMY-2 expression levels decreased with time, but it is presented at low levels in all cells, including epidermal cells, until after the onset of elongation, and this pattern was not altered in nmy-1 mutant (Fig. 3A-I).
|
|
NMY-1, LET-502 and MEL-11 localization during elongation
Our genetic results predict NMY-1 expression in the lateral epidermis
during elongation. NMY-1 antisera revealed that it is indeed highly expressed
in these cells at the onset of elongation
(Fig. 4B), similar to that
observed by Shelton et al. (Shelton et
al., 1999
) for MLC-4. NMY-1 was also present at the adherens
junctions (AJs) of the developing pharynx (data not shown). As elongation
proceeded, NMY-1 became more punctate (Fig.
4D) and organized into filamentous-like structures
(Fig. 4F). Embryos of similar
stages stained for actin showed a similar pattern, albeit filamentous
structures become apparent earlier (Fig.
4A,C,E; embryos were not co-stained because NMY-1 and actin
require incompatible fixation methods). Both actin and myosin organize into
filaments that run perpendicular to the axis of elongation and are thus
potentially arrayed to draw the lateral epidermal cells together in the
dorsal/ventral axis, causing embryonic elongation.
|
|
|
|
-spectrin), hmr-1 (cadherin) and
hmp-1 and hmp-2 (catenins), the products of which are
required to tether actin filaments to the membranes of the lateral epidermal
cells (Costa et al., 1998
MEL-11 requires NMY-1 for membrane localization
Drosophila Zipper/nonmuscle myosin requires Spaghetti squash/rMLC
for localization (Edwards and Kiehart,
1996
; Jordan and Karess,
1997
; Wheatley et al.,
1995
). We found that NMY-1 similarly failed to form
filamentous-like structures in mlc-4-null mutant embryos, with NMY-1
collapsing into large foci (Fig.
8A).
|
| Discussion |
|---|
|
|
|---|
|
Similar to what is seen in Drosophila
(Edwards and Kiehart, 1996
;
Jordan and Karess, 1997
;
Wheatley et al., 1995
), NMY-1
fails to form filaments in mlc-4 mutants but instead forms discrete
foci, suggesting that MLC-4 is required for the proper myosin organization. In
higher eukaryotes, rMLC is not required for MHC to assemble into contractile
units, but rMLC phosphorylation establishes contacts between myosin and actin
filaments (Trybus, 1996
).
Perhaps actin association is required to assemble NMY-1 into the ordered
arrays we observe in C. elegans embryos. In the absence of
mlc-4/rMLC, NMY-1 assembly is more random, forming the large foci
rather than parallel arrays.
In addition to a role for LET-502 and MEL-11 in regulating the contraction
of actin, an alternative model would suggest that like their mammalian
homologs in focal adhesion formation, LET-502 and MEL-11 could regulate the
attachment of actin cables at the apical surfaces of lateral epidermal cells.
The C. elegans
and ßH-spectrin genes,
spc-1 and sma-1, respectively, display elongation defects
not unlike those seen in let-502 or mlc-4 mutants
(McKeown et al., 1998
;
Norman and Moerman, 2002
), and
we observed that spc-1 and sma-1 are epistatic to
mel-11 hypercontraction (Table
1). However, Norman and Moerman
(Norman and Moerman, 2002
)
showed that the actin cables were not disrupted in let-502 and
mlc-4 mutants, and we found that this was also the case for
mel-11 and nmy-1. Moreover, the immunolocalization patterns
for LET-502 and MEL-11 are opposite to that predicted by the actin anchoring
model: LET-502, which would be predicted to tether actin to the membrane,
remains cytoplasmic, while MEL-11, which would release the cables, is found at
the membrane. Therefore, these results support a role for the LET-502/MEL-11
pathway in regulating the contraction of actin/myosin rather than anchoring of
actin filaments.
nmy-2 is partially redundant with nmy-1 during
elongation
Our analysis of nmy-1 suggests that it functions redundantly with
another gene during embryonic elongation. The nmy-1 null phenotype, a
mis-shapen adult, is much less severe than expected if it were the only MHC to
regulate this process as mlc-4, the only rMLC known to function
during elongation, displays arrest as unelongated L1 larva
(Shelton et al., 1999
). We
demonstrated that a second MHC gene, nmy-2, functions redundantly
with nmy-1. nmy-2(RNAi) disrupts AP polarity and cytokinesis in the
early embryo (Cuenca et al.,
2003
; Guo and Kemphues,
1996
), which prevented examining nmy-2 function later in
embryogenesis. However, we found that NMY-2 is present in epidermal cells at
the onset of elongation, where it likely assembles into filamentous structures
similar to NMY-1. Furthermore, nmy-2(weak RNAi); nmy-1
double mutants displayed elongation-defective phenotypes similar to
mlc-4 that were not seen for either nmy-2(weak RNAi) or
nmy-1 alone (Table 3). Therefore, we have uncovered a role for nmy-2 in elongation.
To summarize, we have isolated a new component of the let-502/mel-11 pathway, nmy-1, which encodes a nonmuscle MHC that functions with mlc-4/rMLC to regulate the contractile process of embryonic elongation. nmy-1 functions redundantly with a second nonmuscle MHC gene, nmy-2. Together the two MHCs ensure the successful elongation of embryos into the characteristic long, thin worm.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
* Present address: Research Institute of Molecular Pathology, Dr Bohr-Gasse
7, A-1030, Vienna, Austria ![]()
| REFERENCES |
|---|
|
|
|---|
Amano, M., Ito, M., Kimura, K., Fukata, Y., Chihara, K., Nakano,
T., Matsuura, Y. and Kaibuchi, K. (1996).
Phosphorylation and Activation of Myosin by Rho-associated Kinase
(Rho-kinase). J. Biol. Chem.
271,20246
-20249.
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Chin-Sang, I. D. and Chisholm, A. D. (2000). Form of the worm: genetics of epidermal morphogenesis in C. elegans.Trends Genet. 16,544 -551.[CrossRef][Medline]
Costa, M., Raich, W., Agbunag, C., Leung, B., Hardin, J. and
Priess, J. R. (1998). A putative catenin-cadherin system
mediates morphogenesis of the Caenorhabditis elegans embryo.
J. Cell Biol. 141,297
-308.
Cuenca, A. A., Schetter, A., Aceto, D., Kemphues, K. and
Seydoux, G. (2003). Polarization of the C. elegans
zygote proceeds via distinct establishment and maintenance phases.
Development 130,1255
-1265.
Edgley, M., Baillie, D. L., Riddle, D. L. and Rose, A. M. (1995). Genetic balancers. In Caenorhabditis elegans: Modern Biological Analysis of an Organism (ed. H. F. Epstein and D. C. Shakes), pp. 147-184. San Diego: Academic Press.
Edwards, K. A. and Kiehart, D. P. (1996). Drosophila nonmuscle myosin II has multiple essential roles in imaginal disc and egg chamber morphogenesis. Development 122,1499 -1511.[Abstract]
Fire, A., Xu, S., Montgomery, M. K., Kosatas, S. A., Driver, S. E. and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.Nature 391,806 -811.[CrossRef][Medline]
Fraser, A. G., Kamath, R. S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000). Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408,325 -330.[CrossRef][Medline]
Guo, S. and Kemphues, K. J. (1996). A non-muscle myosin required for embryonic polarity in Caenorhabditis elegans. Nature 382,455 -458.[CrossRef][Medline]
Hill, A. A., Hunter, C. P., Tsung, B. T., Tucker-Kellogg, G. and
Brown, E. L. (2000). Genomic analysis of gene
expression in C. elegans. Science
290,809
-812.
Hodgkin, J. (1997) Genetics. In C. elegans II (ed. D. L. Riddle, T. Blumenthal, B. J. Meyer and J. R. Priess), pp. 881-1047. New York: Cold Spring Harbor Press.
Horvitz, H. R., Brenner, S., Hodgkin, J. and Herman, R. K. (1979). A uniform genetic nomenclature for the nematode Caenorhabditis elegans. Mol. Gen. Genet. 175,129 -133.[CrossRef][Medline]
Horvitz, H. R. and Sulston, J. E. (1980).
Isolation and genetic characterization of cell-lineage mutants of the nematode
Caenorhabditis elegans. Genetics
96,435
-454.
Jordan, P. and Karess, R. (1997). Myosin light
chain-activating phosphorylation sites are required for oogenesis in
Drosophila. J. Cell Biol.
139,1805
-1819.
Kaibuchi, K., Kuroda, S. and Amano, M. (1999). Regulation of the cytoskeleton and cell adhesion by the Rho family GTPases in mammalian cells. Annu. Rev. Biochem. 68,459 -486.[CrossRef][Medline]
Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., le Bot, N., Moreno, S., Sohrmann, M. et al. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421,232 -237.
Mains, P. E., Sulston, I. A. and Wood, W. B. (1990). Dominant maternal-effect mutations causing embryonic lethality in Caenorhabditis elegans. Genetics 125,351 -369.[Abstract]
Mansfield, S. G., al-Shirawi, D. Y., Ketchum, A. S., Newbern, E. C. and Kiehart, D. P. (1996). Molecular organization and alternative splicing in zipper, the gene that encodes the Drosophila non-muscle myosin II heavy chain. J. Mol. Biol. 255,98 -109.[CrossRef][Medline]
McKeown, C., Praitis, V. and Austin, J. (1998). sma-1 encodes a ßH-spectrin homolog required for Caenorhabditis elegans morphogenesis. Development 125,2087 -2098.[Abstract]
Mizuno, T., Tsutsui, K. and Nishida, Y. (2002).
Drosophila myosin phosphatase and its role in dorsal closure.
Development 129,1215
-1223.
Norman, K. R. and Moerman, D. G. (2002).
spectrin is essential for morphogenesis and body wall muscle formation
in Caenorhabditis elegans. J. Cell Biol.
157,665
-667.
Pfitzer, G. (2001). Signal transduction in
smooth muscle. Invited review: regulation of myosin phosphorylation in smooth
muscle. J. Appl. Physiol.
91,497
-503.
Philips, C. L., Yamakawa, K. and Adelstein, R. S. (1995). Cloning of the cDNA encoding human nonmuscle myosin heavy chain-B and analysis of human tissues with isoform-specific antibodies. J. Muscle Res. Cell Motil. 16,379 -389.[CrossRef][Medline]
Piekny, A. J., Wissmann, A. and Mains, P. E.
(2000). Embryonic morphogenesis in Caenorhabditis
elegans integrates the activity of LET-502 Rho-binding kinase, MEL-11
myosin phosphatase, DAF-2 insulin receptor and FEM-2 PP2c phosphatase.
Genetics 156,1671
-1689.
Piekny, A. J. and Mains, P. E. (2002).
Rho-binding kinase (LET-502) and myosin phosphatase (MEL-11) regulate
cytokinesis in the early Caenorhabditis elegans embryo. J.
Cell Sci. 115,2271
-2282.
Priess, J. R. and Hirsh, D. I. (1986). Caenorhabditis elegans morphogenesis: the role of the cytoskeleton in elongation of the embryo. Dev. Biol. 117,156 -173.[CrossRef][Medline]
Shelton, C. A., Carter, J. C., Ellis, G. C. and Bowerman, B.
(1999). The nonmuscle myosin regulatory light chain gene
mlc-4 is required for cytokinesis, anterior-posterior polarity, and
body morphology during Caenorhabditis elegans
embryogenesis. J. Cell Biol.
146,439
-451.
Shin, H. M., Je, H. D., Gallant, C., Tao, T. C., Hartshorne, D.
J., Ito, M. and Morgan, K. G. (2002). Differential
association and localization of myosin phosphatase subunits during
agonist-induced signal transduction in smooth muscle. Circ.
Res. 90,546
-553.
Simske, J. S. and Hardin, J. (2001). Getting into shape: epidermal morphogenesis in Caenorhabditis elegans embryos. BioEssays 23,12 -23.[CrossRef][Medline]
Somlyo, A. P. and Somlyo, A. V. (2000). Signal
transduction by G-proteins, Rho-kinase and protein phosphatase to smooth
muscle and non-muscle myosin II. J. Physiol.
522,177
-185.
Tabara, H., Sarkissian, M., Kelly, W. G., Fleenor, J., Grishok, A., Timmons, L., Fire, A. and Mello, C. C. (1999). The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99,123 -132.[CrossRef][Medline]
Tan, C., Stronach, B. and Perrimon, N. (2003).
Roles of myosin phosphatase during Drosophila development.
Development 130,671
-681.
Trybus, K. M. (1996). Myosin regulation and assembly. In Biochemistry of Smooth Muscle Contraction (ed. M. Barany), pp. 37-45. San Diego: Academic Press.
Wheatley, S., Kulkarni, S. and Karess, R. (1995). Drosophila nonmuscle myosin II is required for rapid cytoplasmic transport during oogenesis and for axial nuclear migration in early embryos. Development 121,1937 -1946.[Abstract]
Wicks, S. R., Yeh, R. T., Gish, W. R., Waterston, R. H. and Plasterk, R. H. (2001). Rapid gene mapping in Caenorhabditis elegans using a high density polymorphism map. Nat. Genet. 28,160 -164.[CrossRef][Medline]
Winter, C. G., Wang, B., Ballew, A., Royou, A., Karess, R., Axelrod, J. D. and Luo, L. (2001). Drosophila Rho-associated kinase (Drok) links Frizzled-mediated planar cell polarity signaling to the actin cytoskeleton. Cell 105, 81-91.[CrossRef][Medline]
Wissmann, A., Ingles, J., McGhee, J. D. and Mains, P. E.
(1997). Caenorhabditis elegans LET-502 is related to
Rho-binding kinases and human myotonic dystrophy kinase and interacts
genetically with a homolog of the regulatory subunit of smooth muscle myosin
phosphatase to affect cell shape. Genes Dev.
11,409
-422.
Wissmann, A., Ingles, J. and Mains, P. E. (1999). The Caenorhabditis elegans mel-11 myosin phosphatase regulatory subunit affects tissue contraction in the somatic gonad and the embryonic epidermis and genetically interacts with the Rac signaling pathway. Dev. Biol. 209,111 -127.[CrossRef][Medline]
Young, P. E., Richman, A. M., Ketchum, A. S. and Kiehart, D.
P. (1993). Morphogenesis in Drosophila requires
nonmuscle myosin heavy chain function. Genes Dev.
7, 29-41.
This article has been cited by other articles:
![]() |
D. C. Weiser, R. H. Row, and D. Kimelman Rho-regulated Myosin phosphatase establishes the level of protrusive activity required for cell movements during zebrafish gastrulation Development, July 15, 2009; 136(14): 2375 - 2384. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Huang, H. Ruan, M. Y. Aw, A. Hussain, L. Guo, C. Gao, F. Qian, T. Leung, H. Song, D. Kimelman, et al. Mypt1-mediated spatial positioning of Bmp2-producing cells is essential for liver organogenesis Development, October 1, 2008; 135(19): 3209 - 3218. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Deng, D. Xia, B. Fang, and H. Zhang The Flightless I Homolog, fli-1, Regulates Anterior/Posterior Polarity, Asymmetric Cell Division and Ovulation During Caenorhabditis elegans Development Genetics, October 1, 2007; 177(2): 847 - 860. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Diogon, F. Wissler, S. Quintin, Y. Nagamatsu, S. Sookhareea, F. Landmann, H. Hutter, N. Vitale, and M. Labouesse The RhoGAP RGA-2 and LET-502/ROCK achieve a balance of actomyosin-dependent forces in C. elegans epidermis to control morphogenesis Development, July 1, 2007; 134(13): 2469 - 2479. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-J. Rodrigues, G. Coppola, C. Santos, M. d. C. Costa, M. Ailion, J. Sequeiros, D. H. Geschwind, and P. Maciel Functional genomics and biochemical characterization of the C. elegans orthologue of the Machado-Joseph disease protein ataxin-3 FASEB J, April 1, 2007; 21(4): 1126 - 1136. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||