|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 8 October 2003
doi: 10.1242/dev.00575
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Developmental and Cell Biology, University of California,
Irvine, CA 92697, USA
2 Max-Planck-Institut für Entwicklungsbiologie, Spemannstrasse 35, 72076,
Tübingen, Germany
* Author for correspondence (e-mail: tschilli{at}uci.edu)
Accepted 1 May 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Danio rerio, Craniofacial, Pigment, Apoptosis, Montblanc, AP2, Hox
| Introduction |
|---|
|
|
|---|
Two secreted signals have been suggested to induce neural crest during
gastrulation, bone morphogenetic proteins (Bmps) and Wnts
(Nieto, 2001
;
Aybar and Mayor, 2002
). One key
step is thought to be attenuation of Bmp signaling in the neural plate by
specific antagonists (Chordin, Noggin) and posteriorizing signals (Wnt, Fgf
and Retinoic acid) from adjacent mesoderm. Recent evidence has also supported
the role of Wnt expressed in the adjacent ectoderm as a neural crest inducer
(Garcia-Castro et al., 2002
),
and Delta/Notch signaling in the specification of trunk neural crest
(Cornell and Eisen, 2000
;
Cornell and Eisen, 2002
;
Endo et al., 2002
). Following
its induction, the location of a neural crest cell in the ectoderm prior to
migration then plays a crucial role in determining its segment and cell-type
specific fates. Cranial neural crest cells that will migrate into the
pharyngeal arches are organized along the anteroposterior axis into regions
fated to form each arch segment (Lumsden
et al., 1991
; Schilling and
Kimmel, 1994
; Kontges and
Lumsden, 1996
). In zebrafish, the position within the mediolateral
(ML) axis of the premigratory neural crest also determines if a cell will
adopt a pigment cell fate over a neural or glial fate
(Schilling and Kimmel, 1994
;
Kelsh and Raible, 2002
). Wnt
signals arising from the dorsal midline of the ectoderm bias this choice of
cell type; activation of Wnt signaling promotes pigment cell fates
(Dorsky et al., 1998
). Thus,
the same signals that induce neural crest cells may also specify their future
migration patterns and fates within the embryo.
In addition to signaling molecules, a growing list of transcription factors
appear to function in the early premigratory crest. These include the related
zinc-finger genes snail, slug
(Nieto et al., 1994
;
Sefton et al., 1998
;
del Barrio and Nieto, 2002
)
and twist (Soo et al.,
2002
), the forkhead transcription factor foxd3
(Dottori et al., 2001
;
Kos et al., 2001
;
Sasai et al., 2001
), Zic genes
(Nakata et al., 1997
;
Nakata et al., 1998
), and the
paired transcription factor pax3
(Epstein et al., 1991
;
Tassabehji et al., 1993
).
Another family of transcription factors implicated in early neural crest
development is the Activator Protein 2 (AP2) family, defined by a unique,
highly conserved DNA-binding domain
(Hilger-Eversheim et al.,
2000
). There are at least four AP2 genes in mice (Tcfap2a,
Tcfap2b, Tcfap2g and Tcfap2d), three of which are co-expressed
in the early ectoderm and neural crest
(Mitchell et al., 1991
;
Chazaud et al., 1996
;
Moser et al., 1995
;
Moser et al., 1997
;
Werling and Schorle, 2002
).
Mice mutant for AP2 family genes reveal important functions in development,
for example Tcfap2a mutant mice have craniofacial, neural tube, body
wall, limb and eye defects (Schorle et
al., 1996
; Zhang et al.,
1996
; Morriss-Kay,
1996
). Chimaeric analyses using Tcfap2a mutant mice show
that these five classes of defects are independent of one another, implicating
Tcfap2a in multiple processes of development
(Nottoli et al., 1998
). The
craniofacial defects in Tcfap2a/ mice are
correlated with extensive cell death in the cranial neural crest and neural
tube. Neural crest derived pharyngeal cartilages and middle ear bones, as well
as cardiac neural crest of the heart outflow tract are malformed and reduced
(Brewer et al., 2002
). However,
two early cranial crest markers, Pax3 and Twist, show no
disruption in these mutant mice and neural crest migration appears to occur
normally, as shown by combining a Wnt1-lacZ transgene with the
Tcfap2a/ mutation. This implicates
Tcfap2a in the development of several neural crest populations, yet
relatively little is known about the roles of Tcfap2 at early stages
of neural crest development.
We show that the craniofacial mutant lockjaw (low) disrupts a zebrafish tfap2a that is required for the formation of subsets of neural crest-derived cell types (subsets of sensory neurons, cartilages and pigment cells) and pharyngeal segments (second pharyngeal arch). Zebrafish tfap2a is expressed in the non-neural ectoderm during gastrulation and then is upregulated in premigratory neural crest. We find that low is required at these early stages for the survival of neural crest migrating from the hindbrain and spinal cord. This is reflected in disruption and loss of early gene expression in the neural crest, including that of tfap2a itself. We focus on the subpopulations of neural crest disrupted in low mutants and show that the requirement for low for neural crest cell survival is cell autonomous and segment specific. This is the first evidence for such segment and cell-type-restricted functions of tfap2a in neural crest.
| Materials and methods |
|---|
|
|
|---|
Mapping and cloning
The lowts213mutation was mapped using bulked segregant
analysis of F2 embryos and genome scanning with SSLPs
(Geisler, 2002
). A candidate
gene for lowts213, tfap2a, mapped within 6 cM of
our map position for lowts213 as does the
montblanc (mobm819) mutation (W. Driever,
personal communication). tfap2a was cloned from low mutants
and wild-type siblings using primers designed against the published sequence
(GenBank: AF457191). The fifth exon of tfap2a was amplified from
genomic DNA preparations of individual low mutants and wild-type
siblings using primers designed against flanking intron sequence (forward:
CGCTCAGGTCTTATAAATAGGC and reverse: CTGAGAGGTGGCTATTTCCCG). Restriction enzyme
digest of PCR-amplified exon five by BlpI (New England Biolabs) was
used to identify low mutants and heterozygotes from a panel of 192
mutant and wild-type siblings. Sequencing of DNA was performed using the
BigDye Terminator Sequencing reagent on a thermal sequencer and reactions run
on an ABI PRISM 310 sequencer (PE Applied Biosystems).
Ectopic expression and rescue experiments
PAC DNA clones (library obtained from C. Amemiya) containing
tfap2a were identified by PCR directed to exon five (as above) and
confirmed using Southern analysis (Amemiya
et al., 1999
). DNA purified for injection was diluted to a
concentration of 1ug/µl and
10 nl were injected into low
mutants at the one- to two-cell stage
(Fishman et al., 1997
). Rescue
was defined by the presence of small numbers of melanophores at 24 hpf, which
are never seen in uninjected low mutant embryos.
Fate mapping and apoptosis assays
Wild-type and lowts213 mutant embryos were injected
with 10 kDa DMNB-caged fluorescein (5 mg/ml). Fluorescein was then activated
when embryos reached the eight-somite stage along the dorsal and lateral
neural keel (David et al.,
2002
). Labeled cells were then inspected at 28 hpf either visually
or by immunodetection of fluorescein. Apoptotic cell death was detected in
whole embryos by terminal transferase dUTP nick-end labeling (TUNEL) using
modifications suggested by the manufacturer (In Situ Cell Death Detection Kit;
POD; Roche). Embryos were fixed for 3-4 hours at room temperature in 4%
paraformaldehyde, permeabilized in acetone and blocked in 2% goat serum for
2-3 hours at room temperature.
Cell transplantation
Wild-type and mutant donor embryos were injected at the one- to two-cell
stage with a mixture of 3% TRITC-dextran (neutral, 10,000
Mr) and 3% biotinylated-dextran (lysine-fixable, 10,000
Mr). At the three-somite stage, labeled premigratory
neural crest cells were transplanted into low mutant hosts as
described previously (Schilling et al.,
1996a
), into segment-specific locations according to the fate map
(Schilling and Kimmel, 1994
).
Hindbrain cells are often co-transplanted with neural crest cells in these
experiments, conveniently marking their segments of origin.
Morpholinos
Three different morpholino antisense oligonucleotides (translation start
site of tfap2a1, ATGmo ATTTCCAAAGCATTTTCATTGGTTG; intron 3
splice donor junction; 3.1mo GAAATTGCTTACCTTTTTTGATTAC; intron 5
splice acceptor junction, 5.1mo CCTCCATTCTTAGATTTGGCCCTAT) were
obtained from Gene Tools (Philomath, OR) and injected at the one- to two-cell
stage. Efficacy of morpholinos directed against splice sites was evaluated
using RT-PCR (Fig. 2F) with
forward primers tfap2a-3f and tfap2a-4f designed to 464 bp and 777 bp of
tfap2a1 (GenBank Accession Number AF457191) (GGTCACGGCATTGATACTGG;
CTGAGTGCCTGAACGCTTCC) in conjunction with reverse primer tfap2a-3r designed to
1184 bp of tfap2a1 (GTCAAACAGCTCTGAATCCC).
|
| Results |
|---|
|
|
|---|
30% reduction in pigment cell
number, small eyes and a ventrally protruding jaw
(Fig. 1C). Cartilage
differentiates in the jaw and pharyngeal arches of wild-type larvae at 72 hpf
(Fig. 1D,F), but
lowts213 mutant cartilages are severely reduced,
particularly in the second or hyoid arch
(Schilling et al., 1996b
|
As a direct demonstration that tfap2a is responsible for the low phenotype we performed rescue experiments. We took advantage of the consistent absence of melanophores in lowts213 mutant embryos between 24-27 hpf. Microinjection of 5-10 ng of a PAC (19:226) containing the tfap2a gene into embryos at the one- to two-cell stage, rescued local patches of melanophores in 28% (14/50) of low mutants, or in some cases gave unilateral rescue over large areas (Fig. 2D), while control PAC (D17:5) injections failed to do so (Fig. 2D).
To show further that reduction in tfap2a function causes the
low phenotype, we injected one- to two-cell stage wild-type embryos
with morpholino antisense oligonucleotides targeted to tfap2a
(Fig. 2E-G). We first injected
a morpholino directed against the putative translation start site of the
tfap2a1 splice form (ATGmo) but as much as 10 ng/embryo had no
specific effect on neural crest derived pigment or cartilage. In zebrafish,
there are multiple splice forms of tfap2a, with three alternative
first exons as in mouse (Meier et al.,
1995
). Therefore, we tried morpholinos targeted to a splice donor
site at the third exon (3.1mo) and to a splice acceptor site at the fifth exon
(5.1mo), at positions 537 and 819 of the tfap2a1 mRNA sequence,
respectively (Fig. 2E). Five
nanograms/embryo of the 5.1mo alone was sufficient to effectively phenocopy
the pigment and jaw defects characteristic of low mutants
(Fig. 2G;
Table 1). This phenotype
correlated with a dramatic change in tfap2a transcripts, in which
regions of adjoining introns are not spliced correctly, as detected by RT-PCR
using primers that amplify over these splice sites
(Fig. 2F). Microinjection of
the 3.1mo caused only a subtle delay in pigmentation when injected at 5
ng/embryo, but more effectively reduced pigmentation at 10-20 ng/embryo
concentrations and this correlated with weaker affects on tfap2a RNA
splicing (Fig. 2F). Notably,
morpholino injections did not increase the severity of the phenotype when
injected into homozygous lowts213 mutants, supporting the
notion that lowts213 is a complete loss-of-function
mutation.
|
|
To determine if expression of tfap2a mRNA was disrupted in low mutants we performed in situ hybridization at 12 and 24 hpf. Although in wild-type controls, dark labeling of tfap2a-expressing cells was achieved with coloration reactions lasting only a few hours, in low mutants incubation overnight gave very weak labeling (Fig. 3J,K). These results suggest either that the mutant mRNA is unstable and degraded after transcription or, alternatively, that tfap2a function is required for its own expression.
Defects in early neural crest specification in low
mutants
To determine the stage at which neural crest development is disrupted in
low mutants, we analyzed the expression of molecular markers of
premigratory and migrating crest. Cranial neural crest is first visible
morphologically at 10 hpf and becomes progressively more prominent posteriorly
during somitogenesis. In six-somite stage wild-type embryos, the forkhead
transcription factor foxd3 is expressed throughout neural crest cells
emerging from midbrain, hindbrain and anterior spinal regions, while
crestin (ctn) is strongly expressed only in neural crest
posterior to the otic vesicle (Fig.
4A,C,E). In low mutants, ctn expression is
virtually eliminated, while, surprisingly, foxd3 expression is
reduced in hindbrain neural crest, but not in more anterior neural crest
adjacent to the midbrain or at more posterior somite levels
(Fig. 4B,D,F). Furthermore,
several other genes expressed prior to this stage in the premigratory neural
crest including snail2 (sna2) and sox9b are
expressed in the correct locations in low mutants (data not shown).
By mid-migratory stages (14-18 hpf), there are dramatic reductions in
sox9b (Fig. 4G,H), but
sna2 remains relatively unaffected, particularly when compared by
two-color in situ hybridization with defects in ctn expression
(Fig. 4I-L). These results
suggest that there are distinct requirements for tfap2a in
specification of subpopulations within the crest.
|
|
10% (Fig. 5G,H). By 72
hpf, mutants lack enteric neurons derived from neural crest
(Fig. 5Q,R), as well as
sympathetic neurons (data not shown), while dorsal root ganglia are less
affected (Fig. 5O,P). Tyrosine
hydroxylase (TH)-positive neurons of the carotid bodies, which form just
ventral to the hyoid arch, are also reduced in low
(Fig. 5S,T), as are other
TH-positive neurons in the CNS (data not shown). Thus, neuronal defects in
low mutants include a variety of sensory neurons derived from both
neural crest, and epidermal placodes, but spare many sensory neurons and glia
of cranial and spinal ganglia.
Neural crest migration and survival in low
The changes in gene expression in the neural crest of low could
reflect a downregulation of target gene expression or, alternatively, a
failure of neural crest cells to migrate, proliferate or survive. To
distinguish between these possibilities, we followed cranial neural crest
morphogenesis in living low mutant embryos
(Fig. 6A-D). Morphological
inspection with Nomarski optics at 24 hpf revealed the presence of reduced
arch primordia within which cells appear disorganized and not arranged in
linear rows as in wild type (data not shown). To examine the segmental origins
of these disorganized arches, we followed labeled neural crest cells in
low mutants using the fate map for premigratory neural crest
generated for 12 hpf embryos (Schilling
and Kimmel, 1994
). The photoactivatable dye DMNB-caged fluorescein
was injected into the progeny of low heterozygotes at the one-cell
stage and the dye was UV-activated in a local region of the cranial
neuroepithelium when embryos reached the eight- to ten-somite stage. This
technique typically labeled both neural tube and neural crest cells, marking
the segmental origins of the crest cells. In both wild-type and low
mutant embryos, fluorescent cells were found to migrate to the appropriate
pharyngeal arch. For example, photoactivation in the region immediately
posterior to the eye labels stream I and later the mandibular arch
(Fig. 6A,B), while labeling
just anterior or posterior to the otic vesicle labels stream II and the hyoid
or stream III and the branchial arches, respectively
(Fig. 6A-D). These results
suggest that low mutant neural crest cells migrate and roughly
populate the appropriate segments along the anteroposterior axis.
|
Segment-specific requirements for low in the cranial neural
crest
The mandibular arch is much less affected in low mutants than
other pharyngeal arches, and in some cases the first and second arch
cartilages appear to fuse, reminiscent of a homeotic transformation of the
second arch into a first arch identity
(Fig. 1)
(Hunter and Prince, 2002
). In
wild-type embryos at 32 hpf, dlx2 is strongly expressed in five out
of the eventual seven pharyngeal arches as well as in the forebrain
(Fig. 7A,C). In low
mutants, only expression in the mandibular and weak expression in some
branchial arches can be detected, yet the mandibular expression domain is
approximately the normal size and shape
(Fig. 7B,D). Mandibular neural
crest is Hox negative, in contrast to crest migrating into the hyoid arch,
which expresses Hox group 2 genes. To determine if the pharyngeal arch defects
in low are due to disruption of Hox gene expression we examined the
expression of hoxa2 and hoxb2 at 28 hpf. Both are
dramatically reduced in the hyoid arch in low mutants, but not in the
hindbrain (Fig. 7E,F). This is
similar to results from analyses of the enhancer elements driving mouse
Hoxa2 expression in the hyoid neural crest, which are regulated by
AP2 genes (Maconochie et al.,
1999
). Defects in the hyoid arch are most severe dorsally with
loss of the hyosymplectic and fusion of its remnant with the mandibular
skeleton. This correlates with a loss of gsc expression in the dorsal
hyoid at 36 hpf (Fig. 7G-J)
(Miller at al., 2000
). A loss
of Hox2 group genes in the second arch, coupled with the loss of dlx2
and gsc could account for some of the segmental fusions and abnormal
jaw articulations we observe in low mutants.
|
|
| Discussion |
|---|
|
|
|---|
|
This function in preventing apoptosis is conserved between other vertebrate
and Drosophila AP2 genes (Kerber
et al., 2001
). AP2 proteins form a complex with retinoblastoma
protein to activate transcription of Bcl2 in mammalian epithelial
cells, which directly prevents apoptosis
(Decary et al., 2002
) and can
also prevent apoptosis through inhibition of DNA binding by the cell-cycle
progression factor Myc (Hilger-Eversheim
et al., 2000
). These established roles for AP2 proteins in
promoting cell survival suggest that the low phenotype may be due to
increased neural crest cell death following loss of tfap2a function.
In support of this, we found that some dying cells in low express
ctn, a neural crest-specific marker. Apoptosis occurs throughout the
neural crest and in the dorsal epidermis, but occurs only during a brief
interval of development, between 12-15 hpf, which might account for the
partial loss of neural crest derivatives. These results suggest that the
low phenotype might be explained by apoptosis.
An alternative hypothesis for the low phenotype is that some
neural crest is not specified correctly early in development, resulting in an
absence of a subset of pigment and skeletal cells. In support of this, a
number of early neural crest markers are reduced or absent in premigratory
cranial neural crest cells of low, but expression of Sna2
(orthologous to mammalian Snail), is unaffected in the same cells.
The expression of Snail2 is also unaffected at stages in which we
observe most apoptosis in putative neural crest, suggesting that many neural
crest cells remain in low. Given the very early role of the
Snail gene family in neural crest specification and migration in
Xenopus and chick (LaBonne and
Bronner-Fraser, 1998
; del Barrio et al., 2002) (reviewed by
Nieto, 2002
), this suggests
that neural crest cells are specified in low, but later patterning is
disrupted, possibly leading to apoptosis. These early expression defects of
some genes in the neural crest of low correlate with later
differentiation of a subset of neural crest derivatives. Thus, in this model
we would argue that the loss of certain subpopulations of neural crest in
low is a direct result of early patterning defects. This model does
not preclude death of these cells by apoptosis at later stages, although we do
not have direct evidence that the gene expression defects and patterns of
apoptosis are related. Rather apoptosis, when it occurs, appears widespread in
low and not confined to any particular regions of the head, as might
be expected if death accounted for the regional defects in neural crest in the
arches.
low reveals a cell autonomous role of tfap2a in
specifying neural crest subpopulations
Neural crest cells form many different cell types after migration from the
neural tube, and interactions between these migrating cells and their
environment are known to regulate crest cell fates
(LeDouarin, 1982
;
Noden, 1983
;
Graham and Smith, 2001
). In
order to show whether the pigment, neuronal and skeletal defects in
low are due to a disruption in signals from their environment or a
result of a cell intrinsic defect in the neural crest, we performed
transplants of neural crest between wild type and low. These
transplants show that tfap2a is required in a cell-autonomous manner
for at least a subset of neural crest to migrate and contribute to the
pharyngeal arches. In some cases, wild-type crest cells alone rescued
surrounding pharyngeal muscles in low, revealing interactions between
skeletogenic crest and surrounding mesodermally derived muscles
(Noden, 1983
;
Schilling et al., 1996a
).
Transplanted neural crest cells taken from low mutants showed reduced
migration into wild-type arches, yet many of these cells appeared to migrate
normally. This was supported by photoactivation of fluorescein in premigratory
neural crest cells in low, many of which then migrated normally into
the pharyngeal arches. These results do not resolve which particular subset of
neural crest is affected in low, an issue that will require lineage
analyses of individual crest cells, but they do suggest that tfap2a
function is only required in some of these cells.
In zebrafish, the most lateral premigratory neural crest cells that migrate
early form neurons, in contrast to more medial cells (which will form pigment
cells and cartilage) (Schilling and
Kimmel, 1994
; Raible and Eisen, 1994). One explanation for the
differential affects on neural crest-derived cells in low, is that
tfap2a is only required during a short period of crest development,
perhaps only in early or late migrating cells. Supporting this hypothesis,
neural crest-derived neurons and glia of the dorsal root and cranial ganglia
are only mildly disrupted in low, in contrast to pigment cells and
craniofacial cartilages which are severely reduced.
Even among pigment or cartilage derived from neural crest, only
subpopulations appear to require low function, suggesting a more
restricted role of tfap2a. For example, melanocytes are heavily
reduced in low, in contrast to xanthophores or iridophores, which are
less affected. Consistent with this, genes expressed exclusively in
melanoblasts (kit, dct) are more severely affected in low
than others reported to be expressed in both melanoblasts and xanthophores
(gch) (Parichy et al.,
1999
; Kelsh et al.,
2000
; Pelletier et al.,
2001
). In mammals, the proto-oncogene Kit is directly
regulated by AP2 genes, and in zebrafish a homolog of this gene has been shown
to have a crucial role in melanoblast development
(Baldi et al., 2001
;
Parichy et al., 1999
). Our
data point to a conserved function of tfap2a. in melanocyte
development through the regulation of kit and implicate
tfap2a in specifying subsets of neural crest-derived pigment
cells.
tfap2a patterns neural crest arising from a restricted
region of the hindbrain
Not all neural crest is affected to the same extent along the
anteroposterior axis in low. For example, the cartilages of the
mandibular arch are well formed in mutants while other pharyngeal cartilages
are reduced or absent. Likewise, the pattern of foxd3 expression
appears to be unaffected in neural crest at midbrain levels that contribute to
the mandibular arch in low, but strongly reduced in more posterior
neural crest that forms other arches. ctn expression is only mildly
reduced in the trunk in mutants but absent from cranial neural crest migrating
adjacent to the otic vesicle. Both neural crest of the ectomesenchymal lineage
(which forms cartilage) and pigment precursors are affected at this position,
as shown by a striking loss of all gch+ pigment precursors at the
level of the otic vesicle, as well as loss of sox9b- and
dlx2-expressing presumptive skeletogenic cells.
The neural crest that arises immediately adjacent to the otic vesicle, in
rhombomeres 4 and 5, migrates anterior to the otic vesicle into the hyoid
arch, whereas neural crest from more posterior rhombomeres migrates posterior
to the otic vesicle into the branchial arches
(Schilling and Kimmel, 1994
).
The regional defects in neural crest expression during their migration into
the arches of low, suggest that tfap2a is required for
patterning of a population of neural crest which arise from a restricted
region of the hindbrain. This correlates with segment-specific defects in
pharyngeal cartilages; while the hyoid arch is severely disrupted in all
cases, the mandibular arch is only slightly reduced. More posterior branchial
arches are consistently present but reduced in low.
One significant feature of neural crest migrating into the hyoid and more
posterior arches, is that they express Hox group 2 genes, in contrast to
neural crest that forms the mandibular arch
(Hunt et al., 1991
;
Prince and Lumsden, 1994
).
Hoxa2, in particular, has been shown to be required for the segmental
identity of the hyoid arch, which undergoes a partial transformation to a
mandibular morphology in Hoxa2 mutant mice
(Rijli et al., 1993
;
Gendron-Maguire et al., 1993
).
In low, both hoxa2 and hoxb2 expression are
severely reduced in the hyoid and branchial arches, suggesting that
tfap2a regulation of Hox genes may be an essential requirement in
correct patterning of the cranial neural crest. Although we have not found
clear evidence for segmental transformations, as observed in Hoxa2
mutant mice, some of the arch fusions and abnormal jaw articulations observed
in low may occur as a consequence of loss of expression of Hox2 group
genes. Furthermore, we have not detected defects in expression of
hoxa2 or hoxb2 in the hindbrain or in patterning of
rhombomeres in low, consistent with an independent regulation in the
CNS and in neural crest (Prince and
Lumsden, 1994
; Maconochie et
al., 1999
; Tumpel et al.,
2002
). Analysis of enhancer elements in mouse Hoxa2 has
shown a requirement for AP2 genes in regulating expression of Hoxa2
in hyoid and branchial arch neural crest
(Maconochie et al., 1999
). Our
results indicate that regulation of Hox group 2 gene expression in neural
crest is a conserved function of tfap2a in vertebrates, and we
propose that the defects in the craniofacial skeleton of low are a
direct result of loss of Hox gene function.
However, this loss of Hox group 2 expression is not complete, as shown by
reduced ventral expression of hoxa2 in the hyoid and branchial
arches, but appears to be specific to the dorsal arch. This dorsal specific
defect is even more apparent in the loss of gsc expression
specifically in the dorsal hyoid arch. This loss of dorsal hyoid arch
expression may account for the cartilage phenotype in low, in which
the dorsal element of the hyoid, the hyposymplectic is absent. Interestingly,
this segmental restriction of tfap2a function in patterning the
hyoid, may also be conserved in vertebrates, as it has been reported that in a
mouse Tcfap2a null background, ventrally restricted expression of a
Hoxa2 enhancer construct is still present
(Maconochie et al., 1999
). It
is interesting to speculate as to how dorsoventral specificity arose in the
pharyngeal arches, as the putative vertebrate ancestor is proposed to have had
unjointed arches that show no regional differences along the DV axis, as
evidenced for an agnathan, lamprey (de
Beer, 1937
). Independent regulation of patterning genes in the
dorsal and ventral arch may have allowed the innovation of novel vertebrate
structures, such as jaws.
tfap2a is an early, essential gene in neural crest
development
Neural crest originated after the divergence of cephalochordates and
vertebrates, commensurate with an increase in genome complexity and gene
number (Shimeld and Holland,
2000
). AP2 expression in neural crest is basal to the vertebrate
lineage, implying a conserved function of these genes in neural crest
development that arose at the origin of vertebrates
(Meulemans and Bronner-Fraser,
2002
). Disruption of Tcfap2a gene function in mice
revealed an essential role in neural crest survival, in addition to neural
tube closure and middle ear development
(Schorle et al., 1996
;
Zhang et al., 1996
). We show
that a zebrafish mutant in tfap2a displays similar defects in neural
crest-derived tissues as those seen in the mouse Tcfap2a mutant.
However, we have not detected similar defects in other ectodermal derivatives
such as the neural tube, possibly reflecting differences in its development
between fish and mouse.
In addition, we document a surprisingly early disruption of neural crest in low mutants, prior to migration, unlike that described in the mouse. Apoptosis in the neural crest of the pharyngeal arches was proposed as the cause of the mutant mouse phenotype, but no defects in neural crest migration or expression of early markers was described. We show that loss of tfap2a function in zebrafish disrupts early patterning of several populations of neural crest cells that form pigment, neurons and cartilage. Differences between the mouse and zebrafish mutants may be due to compensation by other AP2 genes in the mouse, such as Tcfap2b, which are expressed in the neural crest and may compensate for loss of Tcfap2a function. However, double mutant Tcfap2a/Tcfap2b mice still do not show early neural crest defects (T. Williams, personal communication). Alternatively, heterochronic differences in the timing of neural crest development of mouse compared with zebrafish might account for the observation that mouse Tcfap2a has a later function in pharyngeal arch neural crest development. We believe this unlikely, however, as such similar sets of neural crest derivatives are affected in mouse and zebrafish, all with a common origin in the hindbrain, implying an early requirement for tfap2a in their development. More detailed analyses of genes expressed in the neural crest in Tcfap2a mutant mice, should resolve these issues.
An important consequence of disruption of tfap2a function, is the
loss of Hox group 2 gene expression in the hyoid and branchial arches. This
requirement for tfap2a function in regulating Hox group 2 expression
is conserved between mouse and zebrafish, and both mutants show disruption of
the cartilages that in mammals give rise to the bones of the middle ear. Mice
that are mutant for Tcfap2a display a range of phenotypes in which
the middle ear bones are reduced or malformed (K. B. Avraham and K. P. Steel,
personal communication). Human TFAP2A maps to chromosome 6p24.2 and a
number of deafness syndromes have been mapped near to this location
(Law et al., 1998
).
Furthermore, an individual has been described in whom TFAP2A is
deleted, who has a reduced jaw, microphthalmia, proximally positioned thumbs
and abnormal ear morphology (Davies et
al., 1999
). This suggests that Tfap2a has a highly
conserved role in vertebrate development with many implications for human
craniofacial and deafness syndromes.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Akimenko, M. A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994). Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J. Neurosci. 14,3475 -3486.[Abstract]
Amemiya, C. T., Zhong, T. P., Silverman, G. A., Fishman, M. C. and Zon, L. I. (1999). Zebrafish YAC, BAC and PAC genomic libraries. Methods Cell Biol. 60,235 -258.[Medline]
Amores, A., Force, A., Yan, Y.-L., Joly, L., Amemiya, C., Fritz,
A., Ho, R. K., Langeland, J., Prince, V., Wang, Y.-L. et al.
(1998). Zebrafish hox clusters and vertebrate genome evolution.
Science 282,1711
-1714.
Aybar, M. J. and Mayor, R. (2002). Early induction of neural crest cells: lessons learned from frog, fish and chick. Curr. Opin. Genet. Dev. 12,452 -458.[CrossRef][Medline]
Baldi, A., Santini, D., Battista, T., Dragonetti, E., Ferranti, G., Petitti, T., Groeger, A. M., Angelini, A., Rossiello, R., Baldi, F. et al. (2001). Expression of AP-2 transcription factor and of its downstream target genes c-kit, E-cadherin and p21 in human cutaneous melanoma. J. Cell Biochem. 83,364 -372.[CrossRef][Medline]
Brewer, S., Jiang, X., Donaldson, S., Williams, T. and Sucov, H. M. (2002). Requirement for AP-2alpha in cardiac outflow tract morphogenesis. Mech. Dev. 110,139 -149.[CrossRef][Medline]
Chazaud, C., OuladAbdelghani, M., Bouillet, P., Decimo, D., Chambon, P. and Dolle, P. (1996). AP-2.2, a novel gene related to AP-2, is expressed in the forebrain, limbs and face during mouse embryogenesis. Mech. Dev. 54, 83-94.[CrossRef][Medline]
Christiansen, J. H., Coles, E. G. and Wilkinson, D. G. (2000). Molecular control of neural crest formation, migration and differentiation. Curr. Opin. Cell Biol. 12,719 -724.[CrossRef][Medline]
Cornell, R. A. and Eisen, J. S. (2000). Delta signaling mediates segregation of neural crest and spinal sensory neurons from zebrafish lateral neural plate. Development 127,2873 -2882.[Abstract]
Cornell, R. A. and Eisen, J. S. (2002).
Delta/Notch signaling promotes formation of zebrafish neural crest by
repressing Neurogenin 1 function. Development
129,2639
-2648.
David, N. B., Saint-Etienne, L., Tsang, M., Schilling, T. F. and
Rosa, F. M. (2002). Requirement for endoderm and FGF3 in
ventral head skeleton formation. Development
129,4457
-4468.
Davies, A. F., Mizra, G., Flinter, F. and Ragoussis, J.
(1999). An interstitial deletion of 6p24-p25 proximal to the
FKHL7 locus and including AP-2
that affects anterior
eye chamber development. J. Med. Genet.
36,708
-710.
de Beer, G. (1937). The Development of the Vertebrate Skull. Oxford: Oxford University Press.
Decary, S., Decesse, J. T., Ogryzko, V., Reed, J. C.,
Naguibneva, I., Harel-Bellan, A. and Cremisi, C. E. (2002).
The retinoblastoma protein binds the promoter of the survival gene bcl-2 and
regulates its transcription in epithelial cells through transcription factor
AP-2. Mol. Cell. Biol.
22,7877
-7888.
del Barrio, M. G. and Nieto, M. A. (2002).
Overexpression of Snail family members highlights their ability to promote
chick neural crest formation. Development
129,1583
-1593.
Dorsky, R. I., Moon, R. T. and Raible, D. W. (1998). Control of neural crest cell fate by the Wnt signaling pathway. Nature 396,370 -373.[CrossRef][Medline]
Dottori, M., Gross, M. K., Labosky, P. and Goulding, M.
(2001). The winged helix factor FoxD3 suppresses interneuron
differentiation and promotes neural crest cell fate.
Development 128,4127
-4138.
Endo, Y., Osami, N. and Wakamatsu, Y. (2002). Bimodal function of Notch-mediated signaling are involved in neural crest formation during avian ectodermal development. Development 129,863 -873.
Epstein, D. J., Vekemans, M. and Gros, P. (1991). Splotch (Sp2H) a mutation affecting the development of the mouse neural tube shows a deletion within the paired homeodomain of Pax3. Cell 67,767 -774.[CrossRef][Medline]
Epstein, J. A. (2001). Developing models of DiGeorge syndrome. Trends Genet. 17, 13-17.[CrossRef][Medline]
Fishman, M. C., Stainier, D. Y., Breitbart, R. E. and Westerfield, M. (1997). Zebrafish: genetic and embryological methods in a transparent vertebrate embryo. Methods Cell Biol. 52,67 -82.[Medline]
Furthauer, M., Thisse, C. and Thisse, B. (1997). A role for FGF-8 in the dorsoventral patterning of the zebrafish gastrula. Development 124,4253 -4264.[Abstract]
Garcia, M. A., Campillos, M., Ogueta, S., Valdivieso, F. and Vazquez, J. (2000). Identification of amino acid residues of transcription factor AP-2 involved in DNA binding. J. Mol. Biol. 301,807 -816.[CrossRef][Medline]
Garcia-Castro, M. I., Marcelle, C. and Bronner-Fraser, M.
(2002). Ectodermal Wnt function as a neural crest inducer.
Science 297,848
-851.
Geisler, R. (2002). Mapping and cloning. In Zebrafish: A Practical Approach (ed. C. Nusslein-Volhard and R. Dahm), pp. 175-212. Oxford: Oxford University Press.
Graham, A. and Smith, A. (2001). Patterning the pharyngeal arches. BioEssays 23, 54-61.[CrossRef][Medline]
Gendron-Maguire, M., Mallo, M., Zhang, M. and Gridley, T. (1993). Hoxa2 mutant mice exhibit homeotic transformation of skeletal elements derived from cranial neural crest. Cell 75,1317 -1331.[CrossRef][Medline]
Guo, S., Brush, J., Teraoka, H., Goddard, A., Wilson, S. W., Mullins, M. C. and Rosenthal, A. (1999). Development of noradrenergic neurons in the zebrafish hindbrain requires BMP, FGF8, and the homeodomain protein soulless/Phox2a. Neuron 24,555 -566.[CrossRef][Medline]
Hilger-Eversheim, K., Moser, M., Schorle, H. and Buettner, R. (2000). Regulatory roles of AP-2 transcription factors in vertebrate development, apoptosis and cell-cycle control. Gene 260,1 -12.[CrossRef][Medline]
Huang, S., Jean, D., Luca, M., Tainsky, M. A. and Bar-Eli, M. (1998). Loss of AP-2 results in downregulation of c-KIT and enhancement of melanoma tumorigenicity and metastasis. EMBO J. 17,4358 -4369.[CrossRef][Medline]
Hunt, P., Wilkinson, D. and Krumlauf, R. (1991). Patterning the vertebrate head: murine Hox 2 genes mark distinct subpopulations of premigratory and migrating cranial neural crest. Development 112,43 -50.[Abstract]
Hunter, M. P. and Prince, V. E. (2002). Zebrafish hox paralogue group 2 genes function redundantly as selector genes to pattern the second pharyngeal arch. Dev. Biol. 247,367 -389.[CrossRef][Medline]
Inoue, A., Takahashi, M., Hatta, K., Hotta, Y. and Okamoto, H. (1994). Developmental regulation of islet-1 mRNA expression during neuronal differentiation in embryonic zebrafish. Dev. Dyn. 199,1 -11.[Medline]
Isogai, S., Horiguchi, M. and Weinstein, B. M. (2001). The vascular anatomy of the developing zebrafish: an atlas of embryonic and early larval development. Dev. Biol. 230,278 -301.[CrossRef][Medline]
Kelsh, R. N., Schmid, B. and Eisen, J. S. (2000). Genetic analysis of melanophore development in zebrafish embryos. Dev. Biol. 225,277 -293.[CrossRef][Medline]
Kelsh, R. N. and Raible, D. W. (2002). Specification of zebrafish neural crest. Results Prob. Cell Diff. 40,216 -236.
Kerber, B., Monge, I., Mueller, M., Mitchell, P. J. and Cohen, S. M. (2001). The AP-2 transcription factor is required for joint formation and cell survival in Drosophila leg development. Development 128,1231 -1238.[Abstract]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Kimmel, C. B., Miller, C. T., Kruze, G., Ullmann, B., BreMiller, R. A., Larison, K. D. and Snyder, H. C. (1998). The shaping of pharyngeal cartilages during early development of the zebrafish. Dev. Biol. 203,245 -263.[CrossRef][Medline]
Kontges, G. and Lumsden, A. (1996). Rhombencephalic neural crest segmentation is preserved throughout craniofacial ontogeny. Development 122,3229 -3242.[Abstract]
Kos, R., Reedy, M. V., Johnson, R. L. and Erickson, C. A. (2001). The winged helix transcription factor FoxD3 is important for establishing the neural crest lineage and repressing melanogenesis in avian embryos. Development 128,1467 -1479.[Abstract]
LaBonne, C. and Bronner-Fraser, M. (1998). Neural crest induction in Xenopus: evidence for a two-signal model. Development 125,2403 -2414.[Abstract]
Law, C. J., Fisher, A. M. and Temple, I. K.
(1998). Distal 6p deletion syndrome: a report of a case with
anterior chamber eye anomaly and review of published reports. J.
Med. Genet. 35,685
-689.
LeDouarin, N. M. (1982). The Neural Crest. Cambridge, UK: Cambridge Univ. Press.
Li, M., Zhao, C., Wang, Y., Zhao, Z. and Meng, A. (2002). Zebrafish sox9b is an early neural crest marker. Dev. Genes Evol. 212,203 -206.[CrossRef][Medline]
Lister, J. A., Robertson, C. P., Lepage, T., Johnson, S. L. and Raible, D. W. (1999). nacre encodes a zebrafish microphthalmia-related protein that regulates neural-crest-derived pigment cell fate. Development 126,3757 -3767[Abstract]
Lister, J. A. (2002) Development of pigment cells in the zebrafish embryo. Microsc. Res. Tech. 58,435 -441.[CrossRef][Medline]
Lumsden, A., Sprawson, N. and Graham, A. (1991). Segmental origin and migration of neural crest cells in the hindbrain region of the chick embryo. Development 113,1281 -1291.[Abstract]
Luo, R., An, M., Arduini, B. L. and Henion, P. D. (2001). Specific pan-neural crest expression of zebrafish Crestin throughout embryonic development. Dev. Dyn. 220,169 -174.[CrossRef][Medline]
Luo, T., Matsuo-Takasaki, M., Thomas, M. L., Weeks, D. L. and Sargent, T. D. (2002). Transcription factor AP-2 is an essential and direct regulator of epidermal development in Xenopus. Dev. Biol. 245,136 -144.[CrossRef][Medline]
Maconochie, M., Krishnamurthy, R., Nonchev, S., Meier, P., Manzanares, M., Mitchell, P. J. and Krumlauf, R. (1999). Regulation of Hoxa2 in cranial neural crest cells involves members of the AP-2 family. Development 126,1483 -1494.[Abstract]
Manie, S., Santoro, M., Fusco, A. and Billaud, M. (2001). The RET receptor: function in development and dysfunction in congenital malformation. Trends Genet. 10,580 -589.
Marusich, M. F., Furneaux, H. M., Henion, P. D. and Weston, J. A. (1994). Hu neuronal proteins are expressed in proliferating neurogenic cells. J. Neurobiol. 25,143 -155.[CrossRef][Medline]
Maschhoff, K. L. and Baldwin, H. S. (2000). Molecular determinants of neural crest migration. Am. J. Med. Genet. 97,280 -288.[CrossRef][Medline]
Meier, P., Koedood, M., Philipp, J., Fontana, A. and Mitchell, P. J. (1995). Alternative mRNAs encode multiple isoforms of transcription factor AP-2 during murine embryogenesis. Dev. Biol. 169,1 -14.[CrossRef][Medline]
Meulemans, D. and Bronner-Fraser, M. (2002).
Amphioxus and lamprey AP-2 genes: implications for neural crest evolution and
migration patterns. Development
129,4953
-4962.
Miller, C. T., Schilling, T. F., Lee, K., Parker, J. and Kimmel, C. B. (2000). Sucker encodes a zebrafish Endothelin-1 required for ventral pharyngeal arch development. Development 127,3815 -3828.[Abstract]
Mitchell, P. J., Timmons, P. M., Hebert, J. M., Rigby, P. W. J.
and Tijan, R. (1991). Transcription factor Ap-2 is
expressed in neural crest cell lineages during mouse embryogenesis.
Genes Dev. 5,105
-119.
Morriss-Kay, G. M. (1996). Craniofacial defects in AP-2 null mutant mice. BioEssays 18,785 -788.[CrossRef][Medline]
Moser, M., Imhof, A., Pscherer, A., Bauer, R., Amselgruber, W., Sinowatz, F., Hofstadter, F., Schule, R. and Buettner, R. (1995). Cloning and characterization of a second AP-2 transcription factor: AP-2 beta. Development 121,2779 -2788.[Abstract]
Moser, M., Ruschoff, J. and Buettner, R. (1997). Comparative analysis of AP-2 alpha and AP-2 beta expression during murine embryogenesis. Dev. Dyn. 208,115 -124.[CrossRef][Medline]
Nakata, K., Nagai, T., Aruga, J. and Mikoshiba, K.
(1997). Xenopus Zic3, a primary regulator both in neural
and neural crest development. Proc. Natl. Acad. Sci.
USA 94,11980
-11985.
Nakata, K., Nagai, T., Aruga, J. and Mikoshiba, K. (1998). Xenopus Zic family and its role in neural and neural crest development. Mech. Dev. 75, 43-51.[CrossRef][Medline]
Neave, B., Rodaway, A., Wilson, S. W., Patient, R. and Holder, N. (1995). Expression of zebrafish gata 3 (gta3) during gastrulation and neurulation suggests a role in the specification of cell fate. Mech. Dev. 51,169 -182.[CrossRef][Medline]
Neuhauss, S. C., Solnica-Krezel, L., Schier, A. F., Zwartkruis, F., Stemple, D. L., Malicki, J., Abdelilah, S., Stainier, D. Y. and Driever, W. (1996). Mutations affecting craniofacial development in zebrafish. Development 123,357 -367.[Abstract]
Nieto, M. A., Sargent, M. G., Wilkinson, D. G. and Cooke, J.
(1994). Control of cell behavior during vertebrate development by
Slug, a zinc finger gene. Science
264,835
-839.
Nieto, M. A. (2001). The early steps of neural crest development. Mech. Dev. 105, 27-35.[CrossRef][Medline]
Nieto, M. A. (2002). The Snail superfamily of zinc-finger transcription factors. Nat. Rev. Cell Mol. Biol. 3,155 -166.
Noden, D. M. (1983). The role of the neural crest in patterning of avian cranial skeletal, connective and muscle tissues. Dev. Biol. 96,144 -165.[CrossRef][Medline]
Nottoli, T., Hagopian-Donaldson, S., Zhang, J., Perkins, A. and
Williams, T. (1998). AP-2-null cells disrupt
morphogenesis of the eye, face and limbs in chimeric mice. Proc.
Natl. Acad. Sci. USA 95,13714
-13719.
Odenthal, J. and Nusslein-Volhard, C. (1998). Forkhead domain genes in zebrafish. Dev. Genes Evol. 208,245 -258.[CrossRef][Medline]
Parichy, D. M., Rawls, J. F., Pratt, S. J., Whitfield, T. T. and Johnson, S. L. (1999). Zebrafish sparse corresponds to an orthologue of c-kit and is required for the morphogenesis of a subpopulation of melanocytes, but is not essential for hematopoiesis or primordial germ cell development. Development 126,3425 -3436.[Abstract]
Parichy, D. M., Ransom, D. G., Paw, B., Zon, L. I. and Johnson, S. L. (2000a). An orthologue of the kit-related gene fms is required for development of neural crest-derived xanthophores and a subpopulation of adult melanocytes in the zebrafish, Danio rerio. Development 127,3031 -3044.[Abstract]
Parichy, D. M., Mellgren, E. M., Rawls, J. F., Lopes, S. S., Kelsh, R. N. and Johnson, S. L. (2000b). Mutational analysis of endothelin receptor b1 (rose) during neural crest and pigment pattern development in the zebrafish (Danio rerio). Dev. Biol. 227,294 -306.[CrossRef][Medline]
Pelletier, I., Bally-Cuif, L. and Ziegler, I. (2001). Cloning and developmental expression of zebrafish GTP cyclohydrolase I. Mech. Dev. 109, 99-103[CrossRef][Medline]
Pfisterer, P., Ehlermann, J., Hegen, M. and Schorle, H.
(2002). A subtractive gene expression screen suggests a role of
transcription factor AP-2 alpha in control of proliferation and
differentiation. J. Biol. Chem.
277,6637
-6644.
Prince, V. and Lumsden, A. (1994). Hoxa-2 expression in normal and transposed rhombomeres: independent regulation in the neural tube and neural crest. Development 120,911 -923.[Abstract]
Prince, V. E., Moens, C. B., Kimmel, C. B. and Ho, R. K. (1998). Zebrafish hox genes: expression in the hindbrain region of wild-type and mutants of the segmentation gene, valentino.Development 125,393 -406.[Abstract]
Rijli, F. M., Mark, M., Lakkaraju, S., Dierich, A., Dolle, P. and Chambon, P. (1993). A homeotic transformation is generated in the rostral branchial region of the head by disruption of Hoxa-2, which acts as a selector gene. Cell 75,1333 -1349.[CrossRef][Medline]
Rubinstein, A. L., Lee, D., Luo, R., Henion, P. D. and Halpern, M. E. (2000). Genes dependent on zebrafish cyclops function identified by AFLP differential gene expression screen. Genesis 26,86 -97.[CrossRef][Medline]
Sasai, N., Mizuseki, K. and Sasai, Y. (2001).
Requirement for FoxD3-class signaling for neural crest determination in
Xenopus. Development
128,2525
-2536.
Schilling, T. F. (1997). Genetic analysis of craniofacial development in the vertebrate embryo. BioEssays 19,459 -468.[CrossRef][Medline]
Schilling, T. F. and Kimmel, C. B. (1994). Segment and cell type lineage restrictions during pharyngeal arch development in the zebrafish embryo. Development 120,2945 -2960.[Abstract]
Schilling, T. F., Walker, C. and Kimmel, C. B. (1996a). The chinless mutation and neural crest cell interactions during zebrafish jaw development. Development 122,1417 -1426.[Abstract]
Schilling, T. F., Piotrowski, T., Grandel, H., Brand, M., Heisenberg, C.-P., Jiang, Y. J., Beuchle, D., Hammerschmidt, M., Kane, D. A., Mullins, M. et al. (1996b). Jaw and branchial arch mutants in zebrafish I: branchial arches. Development 123,329 -344.[Abstract]
Schorle, H., Meier, P., Buchert, M., Jaenisch, R. and Mitchell, P. J. (1996). Transcription factor AP-2 essential for cranial closure and craniofacial development. Nature 381,235 -238.[CrossRef][Medline]
Sefton, M., Sanchez, S. and Nieto, M. A. (1998). Conserved and divergent roles for members of the Snail family of transcription factors in the chick and mouse embryo. Development 125,3111 -3121.[Abstract]
Shimeld, S. M. and Holland, P. W. H. (2000).
Vertebrate innovations. Proc. Natl. Acad. Sci. USA
97,4449
-4452.
Soo, K., O-Rourke, M. P., Khoo, P. L., Steiner, K. A., Wong, N., Behringer, R. R. and Tam, P. P. (2002). Twist function is required for the morphogenesis of the neural tube and the differentiation of the cranial neural crest cells in the mouse embryo. Dev. Biol. 247,251 -270.[CrossRef][Medline]
Stachel, S. E., Grunwald, D. J. and Myers, P. Z. (1993). Lithium perturbation and goosecoid expression identify a dorsal specification pathway in the pregastrula zebrafish. Development 117,1261 -1274.[Abstract]
Tassabehji, M., Read, A. P., Newton, V. E., Patton, M., Gruss, P., Harris, R. and Strachan, T. (1993). Mutations in the PAX3 gene causing Waardenburg syndrome type 1 and type 2. Nat. Genet. 3,26 -30.[CrossRef][Medline]
Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J. H. (1993). Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119,1203 -1215.[Abstract]
Thisse, C., Thisse, B. and Postlethwait, J. H. (1995). Expression of snail2, a second member of the zebrafish snail family, in cephalic mesendoderm and presumptive neural crest of wild-type and spadetail mutant embryos. Dev. Biol. 172,88 -96.
Tumpel, S., Maconochie, M., Wiedemann, L. M. and Krumlauf, R. (2002). Conservation and diversity in the cis-regulatory networks that integrate information controlling expression of Hoxa2 in hindbrain and cranial neural crest cells in vertebrates. Dev. Biol. 246,45 -56.[CrossRef][Medline]
Werling, U. and Schorle, H. (2002).
Transcription factor gene AP-2 gamma essential for early murine development.
Mol. Cell. Biol. 22,3149
-3156.
Williams, T. and Tjian, R. (1991). Analysis of
the DNA-binding and activation properties of the human transcription factor
AP-2. Genes Dev. 5,670
-682.
Zhang, J. A., Hagopian-Donaldson, S., Serbedzija, G., Elsemore, J., Plehn-Dujowich, D., McMahon, A. P., Flavell, R. A. and Williams, T. (1996). Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2. Nature 381,238 -241.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
B. L. Arduini, K. M. Bosse, and P. D. Henion Genetic ablation of neural crest cell diversification Development, June 15, 2009; 136(12): 1987 - 1994. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Le Pape, T. Passeron, A. Giubellino, J. C. Valencia, R. Wolber, and V. J. Hearing Microarray analysis sheds light on the dedifferentiating role of agouti signal protein in murine melanocytes via the Mc1r PNAS, February 10, 2009; 106(6): 1802 - 1807. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nikitina, T. Sauka-Spengler, and M. Bronner-Fraser Gene Networks in Development and Evolution Special Feature Sackler Colloquium: Dissecting early regulatory relationships in the lamprey neural crest gene network PNAS, December 23, 2008; 105(51): 20083 - 20088. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sauka-Spengler and M. Bronner-Fraser Insights From a Sea Lamprey Into the Evolution of Neural Crest Gene Regulatory Network Biol. Bull., June 1, 2008; 214(3): 303 - 314. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Feng, J. Huang, J. Zhang, and T. Williams Identification and Analysis of a Conserved Tcfap2a Intronic Enhancer Element Required for Expression in Facial and Limb Bud Mesenchyme Mol. Cell. Biol., January 1, 2008; 28(1): 315 - 325. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Smolen, B. J. Schott, R. A. Stewart, S. Diederichs, B. Muir, H. L. Provencher, A. T. Look, D. C. Sgroi, R. T. Peterson, and D. A. Haber A Rap GTPase interactor, RADIL, mediates migration of neural crest precursors Genes & Dev., September 1, 2007; 21(17): 2131 - 2136. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wendl, D. Adzic, J. J. Schoenebeck, S. Scholpp, M. Brand, D. Yelon, and K. B. Rohr Early developmental specification of the thyroid gland depends on han-expressing surrounding tissue and on FGF signals Development, August 1, 2007; 134(15): 2871 - 2879. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Luo, Y. Xu, T. L. Hoffman, T. Zhang, T. Schilling, and T. D. Sargent Inca: a novel p21-activated kinase-associated protein required for cranial neural crest development Development, April 1, 2007; 134(7): 1279 - 1289. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. F. Leung, P. Ma, and J. E. Dowling Gene Expression Profiling of Zebrafish Embryonic Retinal Pigment Epithelium In Vivo Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 881 - 890. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nair, W. Li, R. Cornell, and T. F. Schilling Requirements for Endothelin type-A receptors and Endothelin-1 signaling in the facial ectoderm for the patterning of skeletogenic neural crest cells in zebrafish Development, January 15, 2007; 134(2): 335 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nowak and M. Hammerschmidt Ubc9 Regulates Mitosis and Cell Survival during Zebrafish Development Mol. Biol. Cell, December 1, 2006; 17(12): 5324 - 5336. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Lucas, F. Muller, R. Rudiger, P. D. Henion, and H. Rohrer The bHLH transcription factor hand2 is essential for noradrenergic differentiation of sympathetic neurons Development, October 15, 2006; 133(20): 4015 - 4024. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Braasch, W. Salzburger, and A. Meyer Asymmetric Evolution in Two Fish-Specifically Duplicated Receptor Tyrosine Kinase Paralogons Involved in Teleost Coloration Mol. Biol. Evol., June 1, 2006; 23(6): 1192 - 1202. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Rentzsch, J. Zhang, C. Kramer, W. Sebald, and M. Hammerschmidt Crossveinless 2 is an essential positive feedback regulator of Bmp signaling during zebrafish gastrulation Development, March 1, 2006; 133(5): 801 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pietsch, J.-M. Delalande, B. Jakaitis, J. D. Stensby, S. Dohle, W. S. Talbot, D. W. Raible, and I. T. Shepherd lessen encodes a zebrafish trap100 required for enteric nervous system development Development, February 1, 2006; 133(3): 395 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Knight, Y. Javidan, T. Zhang, S. Nelson, and T. F. Schilling AP2-dependent signals from the ectoderm regulate craniofacial development in the zebrafish embryo Development, July 1, 2005; 132(13): 3127 - 3138. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-L. Yan, J. Willoughby, D. Liu, J. G. Crump, C. Wilson, C. T. Miller, A. Singer, C. Kimmel, M. Westerfield, and J. H. Postlethwait A pair of Sox: distinct and overlapping functions of zebrafish sox9 co-orthologs in craniofacial and pectoral fin development Development, March 1, 2005; 132(5): 1069 - 1083. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. K. Quigley, J. L. Manuel, R. A. Roberts, R. J. Nuckels, E. R. Herrington, E. L. MacDonald, and D. M. Parichy Evolutionary diversification of pigment pattern in Danio fishes: differential fms dependence and stripe loss in D. albolineatus Development, January 1, 2005; 132(1): 89 - 104. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. K. Quigley, J. M. Turner, R. J. Nuckels, J. L. Manuel, E. H. Budi, E. L. MacDonald, and D. M. Parichy Pigment pattern evolution by differential deployment of neural crest and post-embryonic melanophore lineages in Danio fishes Development, December 15, 2004; 131(24): 6053 - 6069. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Miller, L. Maves, and C. B. Kimmel moz regulates Hox expression and pharyngeal segmental identity in zebrafish Development, May 15, 2004; 131(10): 2443 - 2461. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Holzschuh, A. Barrallo-Gimeno, A.-K. Ettl, K. Durr, E. W. Knapik, and W. Driever Noradrenergic neurons in the zebrafish hindbrain are induced by retinoic acid and require tfap2a for expression of the neurotransmitter phenotype Development, December 1, 2003; 130(23): 5741 - 5754. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||