|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online October 22, 2003
doi: 10.1242/10.1242/dev.00799
RESEARCH ARTICLE: DEVELOPMENT AND DISEASE |
1 Comparative and Developmental Genetics Section, MRC Human Genetics Unit,
Western General Hospital, Crewe Road, Edinburgh EH4 2XU, UK
2 Institute of Human Genetics, University of Newcastle upon Tyne, International
Centre for Life, Central Parkway, Newcastle upon Tyne NE1 3BZ, UK
3 Victor Chang Cardiac Research Institute, 384 Victoria Street, Darlinghurst,
Sydney 2010, Australia
4 Department of Molecular and Cell Biology, University of California Berkeley,
555 Life Sciences Addition #3200, Berkeley, CA 94720-3200, USA
* Author for correspondence (e-mail: dbassett{at}hgu.mrc.ac.uk)
Accepted 12 August 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Myomuscular junctions, Myotendinous junctions, Dystrophin, sapje, Muscle attachments, Muscular dystrophy, Congenital myopathy
| Introduction |
|---|
|
|
|---|
2, and is enriched at junctional as
well as non-junctional specialisations of the sarcolemma such as the
neuromuscular junction (NMJ), myotendinous junction (MTJ)
(Clerk et al., 1993
Although most attention has focused on the role of the DAPC in maintaining
the integrity of the non-junctional sarcolemma, several mouse models of
muscular dystrophies also show structural MTJ defects, although in vivo
failure at this site has yet to be observed. Dystrophin-deficient mdx
mice (Dmd mice Mouse Genome Informatics, however, possess a
much milder muscle pathology than Duchenne muscular dystrophy (DMD) sufferers,
probably because of a more efficient process of fibre regeneration and
upregulation of the autosomal orthologue of dystrophin, utrophin, within the
sarcolemma of mdx muscle fibres, which can compensate for dystrophin
loss. However, mdx mice do show reduced membrane folding at MTJs
(Law and Tidball, 1993
;
Ridge et al., 1994
;
Law et al., 1995
) and mice
deficient in another component of the DAPC complex,
-dystrobrevin, also
show this relatively mild MTJ phenotype
(Grady et al., 2003
).
mdx/utrophin double mutant and laminin-
2-deficient
(dy) mice, which more completely lack the DAPC as a mechanical link,
show a striking near absence of folding at the MTJ
(Grady et al., 1997
;
Deconinck et al., 1997
;
Deconinck et al., 1998
;
Desaki, 1992
). These results
clearly suggest that utrophin can compensate for dystrophin at junctional
sarcolemmal sites within mammalian muscle fibres, and that the DAPC is
required at least for normal MTJ formation. Mice lacking
7-integrin
also show changes at MTJs, but are viable and have not been reported to suffer
MTJ failure. Despite these clear abnormalities, however, there have been no
reports that MTJs fail in any mouse models of muscular dystrophy or congenital
myopathy. Indeed, mechanical testing of isolated muscle fibres has shown that
in mdx mice there is no apparent loss of strength in the MTJ compared
with wild-type (WT) (Law et al.,
1995
), although similar tests have not yet been performed on mice
completely lacking DAPC function. Therefore, this lack of effect may represent
a further area in which the mdx mouse differs from DMD, as utrophin
has been postulated to substitute for dystrophin at the MTJ in mice to a
greater extent than in human muscle (Grady
et al., 1997
; Deconinck et
al., 1997
; Deconinck et al.,
1998
).
However, to date, the MTJ has not been reported as a site of pathology in
inherited disorders of human muscle, and thus it remains unclear as to what
extent MTJ failure might contribute to Duchenne or other human muscular
dystrophies and myopathies. This is in part because biopsies of patients'
muscle tissue are often deliberately taken at a distance from the tendon in
order to simplify histology and minimise the effects of removal. This
necessary practice may have hitherto reduced opportunities for the observation
of damage to this structure. However, there are indications from non-invasive
methods of observation that the MTJ might be affected in DMD. Magnetic
resonance imaging (MRI) studies are difficult in DMD patients because of the
difficulties they encounter in maintaining an appropriate position, but there
have been studies suggesting that damage in the thigh region is most severe
towards the ends of muscles, near the MTJs
(Nagao et al., 1991
;
Hasegawa et al., 1992
).
Within some mammalian muscles, dystrophin is also enriched at specialised
MMJs that transmit force between the ends of muscle fibres
(Paul et al., 2002
). These
attachment sites occur as either intrafascicular fibre terminations (IFTs),
connecting series of single fibres end-to-end or end-to-side
(Snobl et al., 1998
), or as
fibrous sheets called tendinous intersections (TIs) that separate segmented
blocks of non-overlapping fibres. Tendinous intersections such as those
between blocks of the mammalian rectus abdominis bear a striking structural
resemblance to the non-cellular embryonic attachments present between somites,
and have been suggested to be evolutionarily analogous to somite boundaries
(Snobl et al., 1998
;
Hijikata and Ishikawa,
1997
).
In order to address the extent to which damage to muscle attachments might
contribute to muscle degeneration and to fully understand the role of the DAPC
in muscle attachment, it is necessary to study the effects of removal or
reduction of the complex in vivo in animal models. However, whereas mammalian
models have been complicated by the incomplete penetrance of the phenotype of
dystrophin removal in vivo, invertebrate systems appear to lack an analogous
function for the DAPC in muscle attachment. Genetic studies in both the
nematode Caenorhabditis elegans and the fruit fly Drosophila
melanogaster have implicated several genes in the formation and
maintenance of muscle attachments. In C. elegans, mutations including
the mua class affect attachments between the body wall muscles and
epithelia, and those cloned so far correspond to structural components of an
integrin complex analogous to the focal adhesion complex
(Bercher et al., 2001
;
Plenefisch et al., 2000
;
Bosher et al., 2003
). By
contrast, the C. elegans homologues of dystrophin and utrophin,
dys-1 (Bessou et al.,
1998
), and other DAPC components
(Grisoni et al., 2002
), are
required for cholinergic signalling at neuromuscular junctions rather than
muscle attachment or integrity. In Drosophila, mutations have been
identified that affect the positioning and assembly of focal muscle
attachments that resemble MTJs. Zinc finger transcription factors of the
Broad-complex (Sandstrom and Restifo,
1999
; Sandstrom et al.,
1997
), the EGF pathway and the integrin complex
(Beumer et al., 1999
;
Martin-Bermudo, 2000
;
Becker et al., 1997
;
Volk, 1992
;
Volk, 1999
;
Yarnitzky et al., 1997
)
combine to direct these processes, with Broad-complex genes being required in
the epithelial tendon cells to maintain correct muscle-tendon attachments.
There is, however, no genetic evidence as to the function of the DAPC in
Drosophila, although the reduced complement of components has been
suggested to make the fly a suitable model for its study
(Greener and Roberts, 2000
).
Similar data are not available in relation to vertebrate muscle attachment, so
it is important to identify mutations with analogous phenotypes.
In the present study we have investigated sapje (sap), a
member of a small class of recessive, lethal mutations which cause
embryonic-onset, progressive degeneration of skeletal muscle in the zebrafish
(Danio rerio) (Granato et al.,
1996
). We show that embryonically the mechanism of degeneration in
sap homozygotes is the separation of somitic muscle fibres from their
attachment points on myosepta, which are tendon-like sheets of extracellular
matrix (ECM). Furthermore, we identify the sapje locus as
dmd (Bolanos-Jimenez et al.,
2001
), the zebrafish orthologue of the human DMD gene, and show
that dystrophin is required for the stability of the muscle attachments in the
zebrafish embryo.
| Materials and Methods |
|---|
|
|
|---|
In situ hybridisation
We performed in situ hybridisation as previously described
(Macdonald et al., 1997
).
Embryos were fixed in 4% paraformaldehyde in phosphate-buffered saline.
Evans blue dye (EBD) labelling
Dye (Sigma) was injected at 0.1 mg ml1 directly into the
pre-cardiac sinous of anaesthetised embryos, which were examined and
photographed 4-6 hours later.
Confocal microscopy
We used a Zeiss LSM 510 and Zeiss LSM software. Embryos were mounted in a
cavity slide in 80% glycerol in phosphate-buffered saline.
Fish strains and maintenance
Complementation analysis of the dystrophic mutant class was performed on
mutations obtained from the Tübingen Stock Centre. In this analysis
sapjetm90c and a second unnamed mutation, ta222a,
failed to complement. Subsequent analysis has shown that extant stocks of both
strains held in Edinburgh and Tübingen carry identical point mutations,
suggesting that these strains may result from a single founder mutation within
the original mutant screen. We therefore refer here to
sapjeta222a, although analysis was performed on both
strains.
Mapping
dmd was previously mapped using the LN54 radiation panel to
between Z5508 and Z5085 (Bolanos-Jimenez et
al., 2001
). We established linkage between sap and
dmd using Z5508 on individual embryos from a mapping cross versus the
Wik strain.
Cloning of zebrafish dmd and identification of point
mutation
Initial identification of zebrafish sequences was performed by comparing
human dystrophin Dp427m with the zebrafish whole-genome shotgun-sequencing
project
(www.sanger.ac.uk).
Exonic sequences were used to design primers for PCR from cDNA pools. We
extracted mRNA from WT and mutant embryos using magnetic poly-T DynaBeads
(Dynal) and made cDNA pools (using a Roche kit). PCR products were cloned in
pGem-T (Promega), sequenced, and assembled and compared using Sequencher.
Morpholino antisense oligonucleotides
We purchased morpholino MO1 from GeneTools, (AAAGCGAAAGCACCTGTGGCTGTGG),
and injected a 0.5 mM solution at 1- and 2-cell stages in water using a
Narishige pressure apparatus.
Sequence analysis
One dystrophin and one utrophin orthologue were identified in both
Danio rerio and Fugu rubripes. Sequences were aligned using
CLUSTALW v1.82, and positions in alignments containing gaps were omitted from
subsequent analyses. All phylogenetic trees were constructed by the
neighbour-joining method based on the proportion of amino acid sites at which
sequences compared were different. The reliability of each interior branch of
a given topology was assessed using the bootstrap interior branch test with
1000 bootstrap replications. Phylogenetic trees were constructed using MEGA
v2.1
(www.megasoftware.net)
and alignments were examined and formatted in GeneDoc
(www.psc.edu/biomed/genedoc).
The Fugu data has been provided freely by the Fugu Genome Consortium
for use in this publication/correspondence only.
Electron microscopy
We used a Philips CM12 transmission electron microscope. Samples were fixed
in 3% glutaraldehyde and embedded in Araldite.
GenBank accession numbers
Danio rerio 5' dystrophin (dmd) sequence
is AY162403 and the Fugu rubripes predicted dystrophin
5' sequence is BK000643.
| Results |
|---|
|
|
|---|
-actin promoter GFP transgene, Tg(acta:GFP)
(Higashijima et al., 1997
|
|
|
sapje corresponds to the zebrafish orthologue of the DMD
gene
As loss of dystrophin and retention of dystroglycan also occur in
mdx mice and DMD (Spence et al.,
2002
), we considered dmd a strong candidate for
sap. Comparing the human dystrophin protein with the zebrafish genome
using BLAST (Altschul et al.,
1997
) identified fragments of the dmd gene, which we
subsequently joined by PCR to recover cDNA sequences representing nearly the
complete open reading frame. Analysis of vertebrate dystrophin and utrophin
protein sequences, including dmd and novel predicted Fugu
rubripes proteins which we identified, confirmed that zebrafish
dmd is the true orthologue of human DMD
(Fig. 4B). Only one orthologue
each of DMD and Utrophin were identified in both the zebrafish and Fugu
rubripes, each clustering with the mammalian genes in phylogenetic
analyses. The previously reported radiation hybrid position of the C-terminal
of zebrafish dmd is on Linkage Group/Chromosome 1 close to the
markers Z5508 and Z5058 (Bolanos-Jimenez et
al., 2001
). Given the probable large size of the dmd
locus, the degenerative phenotype of sap and the absence of
dystrophin immunoreactivity, we tested for linkage between sap and
dmd using the SSLP marker Z5508. We examined 124 homozygous mutant
embryos from a cross against the Wik strain, as 4 pools of 25, and 24
individually, for the presence of the Wik-derived allele by PCR, but could not
detect it in any pool or detect any recombinants among the individual embryos,
indicating a genetic distance of within 2.4 cM. The lack of dystrophin from
muscle but not other sites suggested that sapjeta222a
might be a mutation in an exon of dmd retained at embryonic stages
exclusively in large, muscle-specific isoforms. This, and the large size of
the human locus led us to initiate mutation detection within 5' exons of
dmd homologous to those of Dp427m, the isoform that predominates in
mammalian muscle (Spence et al.,
2002
). Within exon 4 of dmd from
sapjeta222a we found an A'T transversion causing a
nonsense mutation at position K76 which segregates in the homozygous state
exclusively with the sap phenotype
(Fig. 4A,C). By comparison, a
nonsense mutation in exon 4 of human DMD causes DMD, indicating that
this exon is essential in human muscle
(Sitnik et al., 1997
). The
N-terminal location of this mutation indicates that other shorter isoforms
produced from downstream alternative first exons should be expressed normally
in other tissues, as confirmed by immunohistochemistry
(Fig. 3J).
|
Muscle attachment failure in sapje occurs at the terminal
membrane and can involve damage to the sarcolemma
In order to understand the cellular basis for muscle degeneration present
within sap homozygotes, we continuously monitored mutant somites in
vivo using both light microscopy and EBD, which in muscular dystrophies labels
cells with compromised plasma membranes
(Hamer et al., 2002
).
Injection of EBD into the pre-cardiac sinus results in the passage of the dye
through the larval circulatory system, and consequent uptake by damaged fibres
in sap homozygotes. Uptake was never seen within muscle fibres of WT
embryos (Fig. 3D). Within
sap homozygotes most EBD-positive cells extended only a small
distance across the somite from a myoseptum, indicating that they had become
detached at their opposite end (Fig.
3E). However, EBD did label a few fibres prior to detachment and
we were consequently able to observe single mutant fibres in vivo detaching
from myosepta (Fig. 5A,B). Some
of these cells exhibited a dumb-bell morphology reminiscent of that of
mammalian muscle fibres mechanically injured and subsequently overloaded to
induce severing and retraction of the contractile apparatus, leaving behind a
collapsed sleeve of sarcolemma known as a retraction zone
(Tidball and Chan, 1989
). This
suggests that in sap mutants fibre degeneration sometimes involves
separation of the terminal sarcomeres from the terminal sarcolemma, as well as
tearing and detachment of the terminal sarcolemma from the myoseptum
(Fig. 3E, Fig. 5A,B). Utilising
three-dimensional confocal microscopy of fixed GFP-transgenic animals to trace
detached fibres along the entirety of their length revealed sporadic lesions
and many detached fibres. These often displayed a normal diameter and a
distinct blunt or multi-faceted appearance to their free ends, suggesting that
detachment in these fibres involved separation of the terminal sarcolemma from
the basal lamina of the myoseptum (Fig.
5C,D). Thus, the degeneration of muscle tissue in sap
mutants is because of the detachment of muscle fibre ends, which occurs with
an associated loss of membrane integrity. In order to determine precisely
where detachment and membrane damage occurs we examined sap
homozygotes at single-cell resolution using immunohistochemistry to detect
proteins normally localised either within the terminal membrane or immediately
intracellular to it. In sap mutants ß-dystroglycan protein
remains associated with the myoseptum when fibres detach, consistent with
failure at the level of dystrophin, which lies immediately intracellular to
the sarcolemma (Fig. 5E,F). As
a marker of terminal cytoplasm, we used an antibody specific to
tyrosine-397-phosphorylated focal adhesion kinase, a cytoplasmic protein
enriched at ends of muscle fibres in integrin complexes
(Henry et al., 2001
).
Anti-p(tyr397)FAK immunoreactivity is retained in the stumps of detached
fibres, indicating that failure occurs within the membrane plane of the
sarcolemma (Fig. 5G,H). These
observations are consistent with a structural failure of the dystrophin
linkage between the actin cytoskeleton and the basal lamina of the myoseptum
in the region of the sarcolemma causing the observed detachments.
|
|
| Discussion |
|---|
|
|
|---|
The role of the DAPC in zebrafish
Translation-blocking morpholinos targeted to a zebrafish dystrophin exon 1
sequence were recently reported to cause an uncharacterised disorganisation of
the somites similar to that seen in degenerating sap mutant embryos,
and reduced levels of the DAPC component
-sarcoglycan, although no
specific defect in muscle fibre integrity was reported
(Guyon et al., 2003
). However,
these also cause reduced activity and curvature of the body axis that are not
present in either sap-homozygote or MO1-injected morpholinos. This
may suggest that there are multiple isoforms of dystrophin, possibly using
different promoters, that are affected differently in these three
deficiencies, all of which perturb different exons of this highly
alternatively spliced gene. Body curvature might alternatively reflect a
midline defect resulting in the removal of an isoform expressed in the
notochord or neural tube or, as suggested by Guyon et al., a genetic
background effect. Several products of zebrafish dmd have been
detected by western blotting (Guyon et
al., 2003
; Chambers et al.,
2001
; Bolanos-Jimenez et al.,
2001
), including the short Dp71 isoform, which should not be
affected in any of these cases, and which has been detected by in situ
hybridisation in both embryonic somites and notochord. It remains to be seen
where other isoforms are required. In addition, the behaviour and efficacy of
splice-blocking morpholinos are not yet well characterised, so these data may
not be directly comparable with the MO1 phenotype presented here (for a
review, see Bassett et al., 2003).
Compensation by utrophin is unlikely to affect the sapje
phenotype
The surprising effect of dystrophin deficiency in zebrafish may be because
of several factors, including the lack of compensation by utrophin, and the
simple nature of muscle attachment sites in the zebrafish somites by
comparison with the complex array of cell types and ECM within
bone-tendon-muscle found in the head or limbs of fish and mammalian muscle
attachments. Within sap homozygotes, compensation for loss of
dystrophin by utrophin is unlikely to affect the stability of the embryonic
muscle attachment, as utrophin is not present at detectable levels at this
site. Thus, as in severe mouse models
(Sicinski et al., 1989
;
Deconinck et al., 1997
;
Grady et al., 1997
),
sap mutant muscle attachments lack significant DAPC-mediated linkage,
exposing them to failure. Equivalent abnormalities, and therefore possibly
fibre detachment, may be present in human muscular dystrophies or myopathies.
One other possible contributory factor to the severe effects of loss of
dystrophin in zebrafish embryos is their precocious use of locomotion, which
may strain early DAPC-mediated linkages at muscle attachments before the
deposition of other structural protein complexes such as the integrins.
sapje provides a model of a novel pathological mechanism
that may contribute to human muscle disease
The specificity of the phenotype of sap mutant embryos to the
somite boundaries is suggestive of an essential role for the DAPC in the
stability of the highly similar MMJs, as those head and fin muscles unaffected
embryonically are of the MTJ-attached type and work against the endoskeleton
as opposed to the myosepta and notochord. If the failure of MMJs were a
significant factor in muscle disease, their differential deployment might
contribute to the observed variations in pathology between individual muscles,
and between different dystrophic animal models. Our data strongly suggest that
the MMJ, and possibly the MTJ, warrants further examination as a site of
pathology in human muscular dystrophies.
Collectively, these results provide the first in vivo genetic evidence that dystrophin can be required not only for the normal morphology and ultrastructure of vertebrate muscle attachments, as has been found in mdx mice, but also for their stability, and that failure of these attachments can lead to a progressive muscular dystrophy. sap mutants therefore provide a model for the novel pathological mechanism of junctional failure that could well contribute to some of the many different human muscular dystrophies or congenital myopathies. The treatment of muscular dystrophies using pharmaceuticals remains elusive in part because of a lack of suitable targets, however, such proteins might be identified using sapje in future via a genetic approach. The amenity of the zebrafish to large-scale genetic screening makes the prospect of screening for second-site mutations that suppress or enhance dystrophin-deficiency in a vertebrate feasible. These results suggest that sap is a useful addition to our range of models for understanding the roles of the dystrophin complex, in particular at muscle attachments, and for increasing the range of approaches available to the question of relevant therapies.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J.,
Zhang, Z., Miller, W. and Lipman, D. J. (1997). Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res. 25,3389
-3402.
Bartels, H. (1987). Intramembrane aspects of
myotendinous and myomuscular junctions: a freeze-fracture study of the gill
sac-muscle of the Atlantic hagfish, Myxine glutinosa. Anat.
Rec. 218,249
-255.[CrossRef][Medline]
Bassett, D. I. and Currie, P. D. (2003). The
zebrafish as a model for muscular dystrophy and congenital myopathy.
Hum. Mol. Genet. 12,R256
-R270.
Becker, S., Pasca, G., Strumpf, D., Min, L. and Volk, T.
(1997). Reciprocal signaling between Drosophila
epidermal muscle attachment cells and their corresponding muscles.
Development 124,2615
-2622.[Abstract]
Bercher, M., Wahl, J., Vogel, B. E., Lu, C., Hedgecock, E. M.,
Hall, D. H. and Plenefisch, J. D. (2001). mua-3, a
gene required for mechanical tissue integrity in Caenorhabditis
elegans, encodes a novel transmembrane protein of epithelial attachment
complexes. J. Cell Biol.
154,415
-426.
Bessou, C., Giugia, J. B., Franks, C. J., Holden-Dye, L. and
Segalat, L. (1998). Mutations in the Caenorhabditis
elegans dystrophin-like gene dys-1 lead to hyperactivity and
suggest a link with cholinergic transmission.
Neurogenetics 2,61
-72.[CrossRef][Medline]
Beumer, K. J., Rohrbough, J., Prokop, A. and Broadie, K.
(1999). A role for PS integrins in morphological growth and
synaptic function at the postembryonic neuromuscular junction of
Drosophila. Development
126,5833
-5846.[Abstract]
Blake, D. J., Weir, A., Newey, S. E. and Davies, K. E.
(2002). Function and genetics of dystrophin and
dystrophin-related proteins in muscle. Physiol. Rev.
82,291
-329.
Bolanos-Jimenez, F., Bordais, A., Behra, M., Strahle, U., Sahel,
J. and Rendon, A. (2001). Dystrophin and Dp71, two
products of the DMD gene, show a different pattern of expression during
embryonic development in zebrafish. Mech. Dev.
102,239
-241.[CrossRef][Medline]
Bosher, J. M., Hahn, B. S., Legouis, R., Sookhareea, S., Weimer,
R. M., Gansmuller, A., Chisholm, A. D., Rose, A. M., Bessereau, J. L.
and Labouesse, M. (2003). The Caenorhabditis elegans
vab-10 spectraplakin isoforms protect the epidermis against internal and
external forces. J. Cell Biol.
161,757
-768.
Bremner, H. A. and Hallett, I. C. (1985).
Muscle fibre-connective tissue connections in the fish blue grenadier
(Macruronus novaezelandiae). A scanning electron microscope study.
J. Food Sci. 50,975
-980.[CrossRef]
Chambers, S. P., Dodd, A., Overall, R., Sirey, T., Lam, L. T.,
Morris, G. E. and Love, D. R. (2001). Dystrophin in
adult zebrafish muscle. Biochem. Biophys. Res. Commun.
286,478
-483.[CrossRef][Medline]
Clerk, A., Morris, G. E., Dubowitz, V., Davies, K. E. and Sewry,
C. A. (1993). Dystrophin-related protein, utrophin, in normal
and dystrophic human fetal skeletal muscle. Histochem.
J. 25,554
-561.[Medline]
Deconinck, A. E., Rafael, J. A., Skinner, J. A., Brown, S. C.,
Potter, A. C., Metzinger, L., Watt, D. J., Dickson, J. G., Tinsley, J.
M. and Davies, K. E. (1997). Utrophin-dystrophin-deficient
mice as a model for Duchenne muscular dystrophy. Cell
90,717
-727.[CrossRef][Medline]
Deconinck, N., Rafael, J. A., Beckers-Bleukx, G., Kahn, D.,
Deconinck, A. E., Davies, K. E. and Gillis, J. M.
(1998). Consequences of the combined deficiency in dystrophin and
utrophin on the mechanical properties and myosin composition of some limb and
respiratory muscles of the mouse. Neuromuscular
Disord. 8,362
-370.[CrossRef][Medline]
Desaki, J. (1992). Scanning electron
microscopical study of skeletal muscle fiber ends in normal and dystrophic
mice. Arch. Histol. Cytol.
55,449
-452.[Medline]
Draper, B. W., Morcos, P. A. and Kimmel, C. B.
(2001). Inhibition of zebrafish fgf8 pre-mRNA splicing with
morpholino oligos: a quantifiable method for gene knockdown.
Genesis 30,154
-156.[CrossRef][Medline]
Gembella, S. and Vogel, F. (2002). Spatial
arrangements of white muscle fibres and myoseptal tendons in fishes.
Comp. Biochem. Physiol. A Mol. Integr. Physiol.
133,1013
-1037.[CrossRef][Medline]
Grady, R. M., Teng, H., Nichol, M. C., Cunningham, J. C.,
Wilkinson, R. S. and Sanes, J. R. (1997). Skeletal and
cardiac myopathies in mice lacking utrophin and dystrophin: a model for
Duchenne muscular dystrophy. Cell
90,729
-738.[CrossRef][Medline]
Grady, R. M., Akaaboune, M., Cohen, A. L., Maimone, M. M.,
Lichtman, J. W. and Sanes, J. R. (2003).
Tyrosine-phosphorylated and nonphosphorylated isoforms of alpha-dystrobrevin:
roles in skeletal muscle and its neuromuscular and myotendinous junctions.
J. Cell Biol. 160,741
-752.
Granato, M., van Eeden, F. J., Schach, U., Trowe, T., Brand, M.,
Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P. and
Jiang, Y. J. et al. (1996). Genes controlling and mediating
locomotion behavior of the zebrafish embryo and larva.
Development 123,399
-413.[Abstract]
Greener, M. J. and Roberts, R. G. (2000).
Conservation of components of the dystrophin complex in Drosophila.FEBS Lett. 482,13
-18.[CrossRef][Medline]
Grisoni, K., Martin, E., Gieseler, K., Mariol, M. C. and
Segalat, L. (2002). Genetic evidence for a
dystrophin-associated protein complex (DAPC) in Caenorhabditis elegans.Gene 294,77
-86.[CrossRef][Medline]
Guyon, J. R., Mosley, A. N., Zhou, Y., O'Brien, K. F., Sheng,
X., Chiang, K., Davidson, A. J., Volinski, J. M., Zon, L. I. and
Kunkel, L. M. (2003). The dystrophin associated protein
complex in zebrafish. Hum. Mol. Genet.
12,601
-615.
Hallett, I. C. (1987). Fine structure of the
myocommata-muscle fibre junctionin hoki (Macruronus novaezelandiae).
J. Sci. Food Agric. 44,245
-261.[CrossRef]
Hamer, P. W., McGeachie, J. M., Davies, M. J. and Grounds, M.
D. (2002). Evans Blue Dye as an in vivo marker of myofibre
damage: optimising parameters for detecting initial myofibre membrane
permeability. J. Anat.
200, 69-79.[CrossRef][Medline]
Hasegawa, T., Matsumura, K., Hashimoto, T., Ikehira, H., Fukuda,
H. and Tateno, Y. (1992). Intramuscular degeneration
process in Duchenne muscular dystrophy: investigation by longitudinal MR
imaging of the skeletal muscles. Rinsho Shinkeigaku
32,333
-335.[Medline]
Henry, C. A., Crawford, B. D., Yan, Y. L., Postlethwait, J.,
Cooper, M. S. and Hille, M. B. (2001). Roles for zebrafish
focal adhesion kinase in notochord and somite morphogenesis. Dev.
Biol. 240,474
-487.[CrossRef][Medline]
Higashijima, S., Okamoto, H., Ueno, N., Hotta, Y. and Eguchi,
G. (1997). High-frequency generation of transgenic zebrafish
which reliably express GFP in whole muscles or the whole body by using
promoters of zebrafish origin. Dev. Biol.
192,289
-299.[CrossRef][Medline]
Hijikata, T. and Ishikawa, H. (1997).
Functional morphology of serially linked skeletal muscle fibers.
Acta Anat. 159,99
-107.[Medline]
Khurana, T. S., Watkins, S. C., Chafey, P., Chelly, J., Tome, F.
M., Fardeau, M., Kaplan, J. C. and Kunkel, L. M.
(1991). Immunolocalization and developmental expression of
dystrophin related protein in skeletal muscle. Neuromuscular
Disord. 1,185
-194.[CrossRef][Medline]
Law, D. J., Caputo, A. and Tidball, J. G.
(1995). Site and mechanics of failure in normal and
dystrophin-deficient skeletal muscle. Muscle Nerve
18,216
-223.[CrossRef][Medline]
Law, D. J. and Tidball, J. G. (1993).
Dystrophin deficiency is associated with myotendinous junction defects in
prenecrotic and fully regenerated skeletal muscle. Am. J.
Pathol. 142,1513
-1523.[Abstract]
Macdonald, R., Scholes, J., Strahle, U., Brennan, C., Holder,
N., Brand, M. and Wilson, S. W. (1997). The Pax
protein Noi is required for commissural axon pathway formation in the rostral
forebrain. Development
124,2397
-2408.[Abstract]
Martin-Bermudo, M. D. (2000). Integrins
modulate the Egfr signaling pathway to regulate tendon cell differentiation in
the Drosophila embryo. Development
127,2607
-2615.[Abstract]
Nagao, H., Morimoto, T., Sano, N., Takahashi, M., Nagai, H.,
Tawa, R., Yoshimatsu, M., Woo, Y. J. and Matsuda, H.
(1991). Magnetic resonance imaging of skeletal muscle in patients
with Duchenne muscular dystrophy - serial axial and sagittal section studies.
No To Hattatsu 23,39
-43.[Medline]
Parsons, M. J., Campos, I., Hirst, E. M. and Stemple, D. L.
(2002). Removal of dystroglycan causes severe muscular dystrophy
in zebrafish embryos. Development
129,3505
-3512.
Paul, A. C., Sheard, P. W., Kaufman, S. J. and Duxson, M. J.
(2002). Localization of alpha7 integrins and dystrophin suggests
potential for both lateral and longitudinal transmission of tension in large
mammalian muscles. Cell Tissue Res.
308,255
-265.[CrossRef][Medline]
Plenefisch, J. D., Zhu, X. and Hedgecock, E. M.
(2000). Fragile skeletal muscle attachments in dystrophic mutants
of Caenorhabditis elegans: isolation and characterization of the mua
genes. Development 127,1197
-1207.[Abstract]
Ridge, J. C., Tidball, J. G., Ahl, K., Law, D. J. and Rickoll,
W. L. (1994). Modifications in myotendinous junction surface
morphology in dystrophin-deficient mouse muscle. Exp. Mol.
Pathol. 61,58
-68.[CrossRef][Medline]
Roy, M. N., Prince, V. E. and Ho, R. K. (1999).
Heat shock produces periodic somitic disturbances in the zebrafish embryo.
Mech. Dev. 85,27
-34.[CrossRef][Medline]
Sandstrom, D. J., Bayer, C. A., Fristrom, J. W. and Restifo, L.
L. (1997). Broad-complex transcription factors regulate
thoracic muscle attachment in Drosophila. Dev. Biol.
181,168
-185.[CrossRef][Medline]
Sandstrom, D. J. and Restifo, L. L. (1999).
Epidermal tendon cells require Broad Complex function for correct attachment
of the indirect flight muscles in Drosophila melanogaster. J. Cell
Sci. 112,4051
-4065.[Abstract]
Sicinski, P., Geng, Y., Ryder-Cook, A. S., Barnard, E. A.,
Darlison, M. G. and Barnard, P. J. (1989). The molecular
basis of muscular dystrophy in the mdx mouse: a point mutation.
Science 244,1578
-1580.
Sitnik, R., Campiotto, S., Vainzof, M., Pavanello, R. C.,
Takata, R. I., Zatz, M. and Passos-Bueno, M. R.
(1997). Novel point mutations in the dystrophin gene.
Hum. Mutat. 10,217
-222.[CrossRef][Medline]
Snobl, D., Binaghi, L. E. and Zenker, W.
(1998). Microarchitecture and innervation of the human latissimus
dorsi muscle. J. Reconstr. Microsurg.
14,171
-177.[Medline]
Spence, H. J., Chen, Y. J. and Winder, S. J.
(2002). Muscular dystrophies, the cytoskeleton and cell adhesion.
BioEssays 24,542
-552.[CrossRef][Medline]
Tidball, J. G. and Chan, M. (1989). Adhesive
strength of single muscle cells to basement membrane at myotendinous
junctions. J. Appl. Physiol.
67,1063
-1069.
Tidball, J. G. and Law, D. J. (1991).
Dystrophin is required for normal thin filament-membrane associations at
myotendinous junctions. Am. J. Pathol.
138, 17-21.[Abstract]
Volk, T. (1992). A new member of the spectrin
superfamily may participate in the formation of embryonic muscle attachments
in Drosophila. Development
116,721
-730.[Abstract]
Volk, T. (1999). Singling out
Drosophila tendon cells: a dialogue between two distinct cell types.
Trends Genet. 15,448
-453.[CrossRef][Medline]
Waterman, R. E. (1969). Development of the
lateral musculature in the teleost, Brachydanio rerio: a fine structural
study. Am. J. Anat. 125,457
-493.[CrossRef][Medline]
Xu, X., Meiler, S. E., Zhong, T. P., Mohideen, M., Crossley, D.
A., Burggren, W. W. and Fishman, M. C. (2002).
Cardiomyopathy in zebrafish due to mutation in an alternatively spliced exon
of titin. Nat. Genet.
30,205
-209.[Medline]
Yarnitzky, T., Min, L. and Volk, T. (1997). The
Drosophila neuregulin homolog Vein mediates inductive interactions
between myotubes and their epidermal attachment cells. Genes
Dev. 11,2691
-2700.
Related articles in Development:
This article has been cited by other articles:
![]() |
R. Zhang, J. Yang, J. Zhu, and X. Xu Depletion of zebrafish Tcap leads to muscular dystrophy via disrupting sarcomere-membrane interaction, not sarcomere assembly Hum. Mol. Genet., November 1, 2009; 18(21): 4130 - 4140. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Jacoby, E. Busch-Nentwich, R. J. Bryson-Richardson, T. E. Hall, J. Berger, S. Berger, C. Sonntag, C. Sachs, R. Geisler, D. L. Stemple, et al. The zebrafish dystrophic mutant softy maintains muscle fibre viability despite basement membrane rupture and muscle detachment Development, October 1, 2009; 136(19): 3367 - 3376. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Merrick, L. K. J. Stadler, D. Larner, and J. Smith Muscular dystrophy begins early in embryonic development deriving from stem cell loss and disrupted skeletal muscle formation Dis. Model. Mech., July 1, 2009; 2(7-8): 374 - 388. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. W. Ingham The power of the zebrafish for disease analysis Hum. Mol. Genet., April 15, 2009; 18(R1): R107 - R112. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Guyon, J. Goswami, S. J. Jun, M. Thorne, M. Howell, T. Pusack, G. Kawahara, L. S. Steffen, M. Galdzicki, and L. M. Kunkel Genetic isolation and characterization of a splicing mutant of zebrafish dystrophin Hum. Mol. Genet., January 1, 2009; 18(1): 202 - 211. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Thornhill, D. Bassett, H. Lochmuller, K. Bushby, and V. Straub Developmental defects in a zebrafish model for muscular dystrophies associated with the loss of fukutin-related protein (FKRP) Brain, June 1, 2008; 131(6): 1551 - 1561. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Squire, C. Knupp, and P. K. Luther Zebrafish--Topical, Transparent, and Tractable for Ultrastructural Studies J. Gen. Physiol., May 1, 2008; 131(5): 439 - 443. [Full Text] [PDF] |
||||
![]() |
J. J. Zoeller, A. McQuillan, J. Whitelock, S.-Y. Ho, and R. V. Iozzo A central function for perlecan in skeletal muscle and cardiovascular development J. Cell Biol., April 21, 2008; 181(2): 381 - 394. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Hall, R. J. Bryson-Richardson, S. Berger, A. S. Jacoby, N. J. Cole, G. E. Hollway, J. Berger, and P. D. Currie The zebrafish candyfloss mutant implicates extracellular matrix adhesion failure in laminin {alpha}2-deficient congenital muscular dystrophy PNAS, April 24, 2007; 104(17): 7092 - 7097. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Svetic, G. E. Hollway, S. Elworthy, T. R. Chipperfield, C. Davison, R. J. Adams, J. S. Eisen, P. W. Ingham, P. D. Currie, and R. N. Kelsh Sdf1a patterns zebrafish melanophores and links the somite and melanophore pattern defects in choker mutants Development, March 1, 2007; 134(5): 1011 - 1022. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hirata, L. Saint-Amant, J. Waterbury, W. Cui, W. Zhou, Q. Li, D. Goldman, M. Granato, and J. Y. Kuwada accordion, a zebrafish behavioral mutant, has a muscle relaxation defect due to a mutation in the ATPase Ca2+ pump SERCA1 Development, November 1, 2004; 131(21): 5457 - 5468. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Soustelle, C. Jacques, B. Altenhein, G. M. Technau, T. Volk, and A. Giangrande Terminal tendon cell differentiation requires the glide/gcm complex Development, September 15, 2004; 131(18): 4521 - 4532. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Engels, S. van 't Padje, L. Blonden, L.-a. Severijnen, B. A. Oostra, and R. Willemsen Characterization of Fxr1 in Danio rerio; a simple vertebrate model to study costamere development J. Exp. Biol., September 1, 2004; 207(19): 3329 - 3338. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||