|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online November 3, 2003
doi: 10.1242/10.1242/dev.00861
1 Institute of Molecular Animal Breeding and Biotechnology, Gene Center,
Ludwig-Maximilian University, Munich, Germany
2 Division of Developmental Biology, Children's Hospital Research Foundation,
Department of Pediatrics, University of Cincinnati, College of Medicine,
Cincinnati, OH 45229, USA
3 Department of Molecular Genetics, Biochemistry and Microbiology, University of
Cincinnati, College of Medicine, Cincinnati, OH 45267, USA
4 The Jackson Laboratory, Bar Harbor, ME 04609, USA
5 GSF National Research Center for Environment and Health, Institute of
Human Genetics, Neuherberg, Germany
* Author for correspondence (e-mail: krebs{at}lmb.uni-muenchen.de)
Accepted 4 September 2003
| SUMMARY |
|---|
|
|
|---|
1 Mb
away, within the Lmbr1 gene. In homozygous mutants, the expression of
Shh mRNA and Shh protein is severely downregulated to about 20% of
wild-type limb buds, but Shh expression appears normal throughout the
remainder of the embryo. Correspondingly, Gli3 expression is
upregulated and posteriorly expanded in the raz/raz limb bud. We
propose that the double anterior zeugopod and symmetrical central polydactyly
are due to an increased and uniform concentration of the Gli3 repressor form
because of lowered Shh signaling.
Key words: Sonic hedgehog, Gli3, Central polydactyly, Radial and tibial dimelia, Mouse
| Introduction |
|---|
|
|
|---|
The molecular basis of polarizing activity is sonic hedgehog, Shh
(Riddle et al., 1993
). In the
limb bud, Shh expression is localized exclusively to the posterior
mesenchyme coincident with the ZPA, and ectopic Shh or Shh can induce
limb duplications indistinguishable from those induced by ZPA grafts
(Lopez-Martinez et al., 1995
;
Riddle et al., 1993
;
Yang et al., 1997
).
Recently, it has become evident that the function of Shh in AP limb
patterning is based on its regulation of the processing of the Zn finger
transcription factor Gli3 (Litingtung et
al., 2002
; te Welscher et al.,
2002
). Gli3 is present in the vertebrate limb bud in two forms, a
full-length transcriptional activator and a processed transcriptional
repressor (Wang et al., 2000
).
The processing of Gli3 to its repressor form is prevented by Shh signaling
leading to graded repressor activity, high anteriorly in the limb bud where
Shh is not expressed and lower posteriorly in the presence of Shh
(Wang et al., 2000
). Notably,
Gli3/Shh double-null mice possess a limb phenotype
indistinguishable from the Gli3-null phenotype
(Litingtung et al., 2002
;
te Welscher et al., 2002
).
There is a similar interaction between Gli3 and Shh in
forebrain morphogenesis (Railu, 2002).
Evidence in the literature supports the concept that increased Shh
signaling leads to extra digits, polydactyly, whereas lowered Shh signaling
leads to fewer digits, ectrodactyly or oligodactyly. Thus, the loss of Shh
signaling by targeted knockout induces loss of digits 2-5
(Chiang et al., 2001
;
Kraus et al., 2001
) and this
phenotype is reproduced in the chick ozd mutant, a regulatory
mutation that induces a loss of Shh expression in the limb
(Ros et al., 2003
). A less
severe loss of Shh signaling as seen in a conditional limb knockout of
Shh (Lewis et al.,
2001
), in the Wnt7a knockout
(Parr and McMahon, 1995
), in
teratogen-exposed limbs (Bell et al.,
1999
) and cyclopamine-induced regenerating axolotl limbs
(Roy and Gardiner, 2002
) leads
to the loss of only the most posterior digits, usually digit 5 or 4 and 5.
However, ectopic Shh signaling in the anterior limb bud mesenchyme
(Yang et al., 1997
) leads to
an excess number of digits. Polydactyly is observed in mutants with ectopic
anterior mesenchyme Shh expression domains
(Chan et al., 1995
;
Masuya et al., 1995
;
Masuya et al., 1997
;
Sharpe et al., 1999
;
Lettice et al., 2002
),
decreased Ptch signaling
(Milenkovic et al., 1999
),
activation of the pathway by ectopic Ihh
(Crick et al., 2003
;
Yang et al., 1998
) and altered
vesicular transport function in the Rab23 mutation
(Eggenschwiler et al.,
2001
).
Thus, we were surprised to recover a mutant mouse with polydactyly, but
with undetectable Shh expression in the limb bud using whole-mount in
situ hybridization. Further study of the phenotype indicated a consistent
alteration of zeugopod morphogenesis, leading to a symmetrical appearance of
the two skeletal elements having anterior structural features. This led us to
name the mutant replicated anterior zeugopod (raz). We have examined
various aspects of Shh signaling in the limb buds of raz/raz
embryos and have found that Shh transcription and translation are
downregulated to about 20% of that in wild-type limb buds. Assays for
Shh signaling activity, including polarizing activity and a
luciferase reporter Shh-LIGHT2 cell assay, were both negative in
raz/raz limb buds. Further down the Shh signaling pathway,
Ptch and Gli1 expression were undetectable in
raz/raz limb buds, whereas the Gli3 expression domain was
upregulated and expanded to include posterior limb bud mesenchyme. We propose
that this near uniform, increased expression of Gli3, presumably in
the repressor form due to low Shh signaling, leads to the symmetrical zeugopod
phenotype and central polydactyly. This presumption is based on the idea that
graded levels of Gli3 repressor underlie AP limb patterning
(Wang et al., 2000
).
| Materials and methods |
|---|
|
|
|---|
Chromosomal localization and linkage analysis
The initial chromosomal localization was detected by segregation analysis
of 83 animals from the (C3H/HeJ-raz x C57BL/6)F1 x
C57BL/6 backcross following our standard laboratory protocol
(Favor et al., 1997
). A second
more extensive backcross of 553 animals from the (C3H/HeJ-raz x
BALB/c)F1 x C3H/HeJ backcross was used for fine mapping, using the
chromosome 5 markers D5Mit346, D5Mit354, D5Mit149, D5Mit13, D5Mit148,
D5Mit386, D5Mit348, D5Mit353, D5Mit79, D5Mit297 and D5Mit80. Linkage analysis
of the segregation data was carried out with Map Manager classic
(Manly, 1998
), and the gene
order was determined by minimizing the number of double recombinants.
Cytogenetic analysis for the occurrence of anaphase bridges followed the
procedure as previously described
(Roderick, 1971
).
Genotyping
The embryos were genotyped by PCR analysis of embryonic DNA extracted from
the yolk sac after proteinase K digestion, phenol/chloroform extraction and
ethanol precipitation. The tightly linked polymorphic microsatellite D5Mit148
was used for genotyping the embryos.
Skeletal staining
The skin and viscera of perinates were removed and the conceptus fixed in
95% ethanol. Combined Alcian Blue staining of cartilage and Alizarin Red
staining of bone was done as previously described
(Kuczuk and Scott, 1984
).
Polarizing activity
E11.5 mouse ZPA or anterior limb tissue derived from all three genotypes
was grafted into the anterior margin of stage 20/21 chick wings and the
resulting digit pattern evaluated as previously described
(Bell et al., 1999
).
Shh activity assay
Pregnant wild-type/raz females were sacrificed on E11.5 of
gestation. Implantation sites were removed, frozen in liquid nitrogen, and
stored at 80°C until use in the assay.
For each sample of cell extract, implantation sites were thawed and the embryos dissected free of their surrounding membranes. Forelimbs and hindlimbs of each genotype were pooled separately in Eppendorf tubes. Excess dissection fluid was removed and replaced with 200 µl serum-free DMEM. Samples were sonicated and DNA measured using the Hoefer DyNA Quant 200 Fluorimeter. After DNA quantification, fetal bovine serum was added so that the final concentration of serum was 0.5%.
Shh-LIGHT2 cells were cultured in DMEM containing 10% fetal bovine serum in
a 96-well plate (2.5x105 cells/well) for
24 hours
(confluency). The medium was removed and limb bud lysate containing 50 or 25
ng/ml of DNA in 100 µl of DMEM (0.5% FBS) was added to duplicate wells. A
duplicate set of wells contained only 100 µl of DMEM (0.5% FBS) to serve as
background. Cells were incubated for 24 hours. Using the Dual-Luciferase
Reporter Assay System (Promega, Catalog number E1910), luciferase activity was
measured and normalized to a Renilla control.
RT-PCR
Total RNA was extracted from freshly dissected embryonic mouse tissue using
TriPure Isolation Reagent (Roche Diagnostics, Mannheim, Germany).
DNaseI-treated total RNA was used as a template for first-strand cDNA
synthesis using random hexamer primers (Gibco Invitrogen, Karlsruhe, Germany).
Molony murine leukemia virus (MMLV) reverse transcriptase was used for the
extension, according to the manufacturer's instruction (Gibco Invitrogen,
Karlsruhe, Germany). Second-strand cDNA was synthesized during a single PCR
cycle with a thermostable polymerase (Qiagen, Hilden, Germany). Each PCR cycle
was: 94°C for 30 seconds; 60°C for 30 seconds (Shh and
Gapdh) or 64°C for 30 seconds (Gli3); 72°C for 1
minute and a final extension of 5 minutes at 72°C. We used 35 cycles for
each assay. The sense and antisense primers used for each gene and the size of
the PCR product were as follows: Shh, 5'TCTGTGATGAACCAGTGGCC
and 5'GCCACGGAGTTCTCTGCTTT (241 bp); Gapdh
5'GTGGCAAAGTGGAGATTGTTGCC and 5'GATGATGACCCGTTTGGCTCC (289 bp);
and Gli3 5'CACACCCCTACATCAACCCAT and
5'GGTGTCGAACTCTCTGGTGCA (901 bp)
(Takabatake et al., 1997
). For
control, RT-PCR was performed with the same reaction mixture as for test
samples, but without RNA template.
Western analysis
Western blot analysis was performed on the excised limb buds from 4 E11.5
raz/raz, wild-type/raz, and four wild-type/wild-type embryos
by first lysing in RIPA buffer in the presence of protease inhibitor cocktail.
Samples were homogenized by passing through a narrow gauge needle and water
bath sonication. Samples were centrifuged at 2000 g for five
minutes. Laemmli buffer (5x) was then added to the samples and boiled
for 10 minutes. Samples were then run on SDS-PAGE gels and transferred to
nitrocellulose. After probing the membranes for Shh with a rabbit polyclonal
antibody (Santa Cruz, H160), the membranes were stripped and probed using a
monoclonal antibody to tubulin (ß-tubulin mouse monoclonal, Sigma, TUB
2.1). Using ImageQuant 5.1 software, the signals from Shh were adjusted based
on the signals from the unaffected tubulin protein levels. The level of Shh
protein was normalized to the wild-type limb buds.
Reagents
RIPA buffer: 150 mM NaCl, 50 mM NaF, 10 mM NaPO4 (pH 7.4), 2 mM
EDTA, 1% NP-40, 1% DOC, 0.1% SDS, plus PIC Protease Inhibitor Cocktail (PIC)
[1 mM Pefebloc, 0.01 mM benzamadine-HCl, aprotinin (10 µg/ml), leupeptin
(10 µg/ml) and pepstatin A (10 µg/ml)].
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed as described by Bell et al.
(Bell et al., 1999
) with minor
modifications. Embryos were treated with different concentrations of
proteinase K (10-20 µg/ml) for 3 (E10.5) or 7 minutes (E13.5) at 25°C.
The anti-digoxigenin alkaline phosphatase-conjugated antibody (Roche
Diagnostics GmbH) was centrifuged for 5 minutes at 4°C to avoid
nonspecific staining and diluted 1:3500-1:5000.
| Results |
|---|
|
|
|---|
|
Limb phenotype
Heterozygotes
All eight heterozygotes subjected to skeletal analysis exhibited preaxial
polydactyly, generally on all four limbs. Some forelimbs (7/16) had only a
piece of freestanding cartilage anterior to digit 1, usually adjacent to the
proximal phalanx (Fig. 2B,
arrow). Eight forelimbs had anterior duplication of digit 1 beginning at the
metacarpal. (Fig. 2E,H).
|
|
The signature feature of the raz/raz phenotype is found in the zeugopod, in both the forelimb and hindlimb of mutant fetuses, where the posterior skeletal element is transformed into a replica of the anterior skeletal element. We were led to this conclusion by the absence of an olecranon process (elbow) in the forelimb (compare Fig. 2D with 2F) and the equalization of bone size in the hindlimb (compare Fig. 3G with 3I). Further anatomical characteristics supporting this conclusion are provided in Data S1 at http://dev.biologists.org/supplemental/.
The concept of an anteriorized limb was carried distally into the proximal autopod. Wild-type fetuses have two skeletal elements in the proximal carpus and tarsus (Fig. 2G, Fig. 3D). raz/raz fetuses usually possess a single bone in the proximal carpus and tarsus that is structurally characteristic of the anterior skeletal element (Fig. 2I, Fig. 3F). However, there are physical signs of posterior patterning in the carpus and tarsus. In the tarsus there is frequently a small variable sized skeletal structure posteriorly that we consider an attempt to construct a calcaneus (Fig. 3L). Similarly, in the carpus there was a variable presence of a recognizable falciform anteriorly and a pisiform posteriorly (data not shown). Delineation of the distal carpus was impossible in the forelimb because of fusions. Fusions were not as severe in the hindlimb, therefore the cuboid (d4) was usually recognizable (Fig. 3L), again indicating some posterior patterning activity in the raz/raz autopod. Furthermore, the structural relationship between the distal tarsals and the metatarsals indicates that the peripheral digits 1 and 5 are missing in raz/raz mutants (compare Fig. 3J with 3L).
The phenotype of the distal autopod, the hand and foot, of raz/raz limbs represents an attempt to retain the mirror image symmetry of the zeugopod. A bar of cartilage traverses the AP axis of the autopod, both fore and hind (Fig. 2I, Fig. 3L). From the periphery of this cartilaginous bar, both anteriorly and posteriorly, a metacarpal or metatarsal arose that was closely jointed to the cartilage bar (red arrow in Fig. 2I and Fig. 3L). In between lay three or four digits in which the metacarpals or metatarsals were connected only tenuously to the cartilage bar (Fig. 3L). In the forelimb of raz/raz fetuses, these peripheral digits and the digits that lie immediately to their interior usually possessed two phalanges whereas those within the center of the hand had three phalanges (Fig. 2I). Often the metacarpals of these central digits were fused (Fig. 2I). In the feet of raz/raz limbs, most digits, including the peripheral digits, were constructed of three phalanges (Fig. 3L). As with the forelimb, the central metatarsals were often fused (Fig. 3L).
Another feature of the raz/raz phenotype is the disorganization of the autopod across the dorsoventral (DV) axis. About half (9/20) of raz/raz forelimbs had some indication of digit rudiments in different DV planes; usually a single central digit was involved, but in rare cases most of the digits within a limb were duplicated (Fig. 4).
|
|
|
Shh signaling activity of raz/raz limb buds
Polarizing activity
The ability of posterior limb bud mesenchyme to induce a limb duplication
when grafted to the anterior margin of a chick wing bud is designated as
polarizing activity (Balcuns et al.,
1970
). Results of grafting posterior limb mesenchyme from E11.5
wild-type/wild-type, wild-type/raz and raz/raz limb buds to
the anterior margin of stage 20/21 chick wing buds are summarized in
Fig. 7. The wild-type forelimb
posterior mesenchyme induced a polarizing score of 74, consistent with our
previous studies of mouse ZPA tissue (Bell
et al., 1999
). raz/raz embryos had no polarizing activity
in their ZPA (Fig. 7). As
expected, polarizing activity of the ZPA from wild-type/raz
E11.5 forelimbs was about 50% of that from wild-type/wild-type embryos
(Fig. 7). We also searched for
polarizing activity in the anterior forelimb mesenchyme of
wild-type/raz and raz/raz embryos as other mouse mutants
with preaxial polydactyly have been shown to have ectopic anterior ZPA
activity (Chan et al., 1995
;
Masuya et al., 1997
;
Masuya et al., 1995
). There
was no polarizing activity in the anterior mesenchyme of E11.5 forelimbs from
wild-type/raz or raz/raz embryos (data not shown).
|
Shh-LIGHT2 cell assay
A more specific test of Shh signaling activity is provided by the
Shh-LIGHT2 cell assay. 3T3 cells stably transfected with a Gli/luc reporter
and constitutively expressing a Renilla luciferase yield a
quantitative response to Shh signaling
(Taipale et al., 2000
) and
have been useful in monitoring Shh activity in the chick wing bud
(Zeng et al., 2001
). Lysates
of E11.5 embryo limb buds, fore or hind, revealed that raz/raz
embryos had no activity in this assay (Fig.
7). Hindlimb buds from wild-type/raz embryos had 45% of
the activity of wild-type hindlimbs, whereas forelimb buds had 36% of
wild-type activity (Fig.
7).
Ptch expression
Ptch acts as a receptor for Shh, and is upregulated at sites of
Shh expression (Ingham and
McMahon, 2001
). Thus, the expression of Ptch is a
sensitive indicator of Shh signaling. The expression of Ptch in the
posterior limb mesenchyme is not detectable in raz/raz mutants
(compare Fig. 5M with 5O and 5P with
5R), although non-limb expression of Ptch was not
noticeably affected (compare Fig. 5J with
5L).
Gli expression
Downstream of Ptch, Shh signaling affects the expression of Gli
family genes. Gli1 expression is positively regulated by Shh
signaling in the posterior limb mesenchyme
(Marigo et al., 1996
;
Büscher and Rüther,
1998
) seen here in wild-type/wild-type E11.5 forelimb bud
(Fig. 8A). The expression of
Gli1 in raz/raz forelimbs on E11.5 is undetectable by
whole-mount in situ hybridization (Fig.
8C) in keeping with the very reduced Shh signaling activity in the
homozygous mutant limb bud.
|
The importance of the ratio of Gli3 to Shh expression for
limb morphogenesis has recently been documented
(Litingtung et al., 2002
).
These two studies clearly show that the major function of Shh signaling in the
limb is to modify the activity of Gli3 signaling. Thus, we chose to examine
Gli3 expression more closely, using PCR analyses of limb bud AP
halves to examine the effect of the raz mutation on expression levels
of this important limb gene. Values were normalized to the wild-type/wild-type
body, and in keeping with the limb specific effect of the raz
mutation, Gli3 expression in the body was the same regardless of
genotype (Fig. 8J,K). This was
certainly not the case in the limb bud where the raz mutation led to
a greatly enhanced level of Gli3 expression, especially in the
raz/raz limb buds. This enhanced expression level was generally seen
in both the anterior and posterior halves of the limb, but even in
wild-type/wild-type embryos we did not measure any huge difference in
Gli3 expression between anterior and posterior halves. In keeping
with the observation that Shh signaling is a negative regulator, Gli3
expression is generally increased in raz/raz limb buds
(Marigo et al., 1996
) although
the increased Gli3 expression in the posterior half of heterozygote
and homozygote mutant hindlimb samples was not as great as expected.
Molecular markers of the A/P axis
We also examined other AP molecular markers of limb morphogenesis including
Hand2 (previously dHAND) Pax9 and members of the
Hoxd cluster. The raz/raz mutation leads to a severe downregulation
of Hand2 expression so only a very small domain of expression remains
at the posterior border (see Fig. S2 at
http://dev.biologists.org/supplemental/).
By contrast, the expression of Pax9 and Hoxd family members are
observed across the AP axis of the limb instead of being anteriorly or
posteriorly restricted (see Figs S1, S2 at
http://dev.biologists.org/supplemental/).
Combined, these findings indicate that the raz/raz limb bud acquires
anterior characteristics early on in morphogenesis leading to the final
replicated anterior zeugopod phenotype.
| Discussion |
|---|
|
|
|---|
We have shown that the raz mutation is associated with an
inversion in the proximal region of chromosome 5 where a number of `limb'
genes are within or near this inversion including Shh, Msx1, Hx, Hm
and Luxate. Using whole-mount in situ hybridization we were unable to
detect Shh expression in limb buds of raz/raz
embryos, yet expression elsewhere in the embryo appeared normal. Cis
regulatory elements that specifically affect limb Shh expression have
recently been identified (Hill et al.,
2003
; Lettice et al.,
2002
; Sharpe et al.,
1999
), and these elements are embedded within the Lmbr1
gene on mouse chromosome 5 (Clark et al.,
2000
). Several independent mutations within the Lmbr1
gene lead to different limb phenotypes. A transgene insertion within intron 5
of murine Lmbr1 leads to preaxial polydactyly and the mutation was
designated Sasquatch (Lettice et
al., 2002
; Sharpe et al.,
1999
). Preaxial polydactyly was mapped to 7q36 in humans and
disruption of intron 5 of the LMBR1 gene
(Lettice et al., 2002
).
Presumably this mutation in the human infant leads to ectopic anterior limb
expression of Shh as it does in the Ssq mutation
(Sharpe et al., 1999
). Another
human disorder, acheiropodia
(Toledo et al., 1972
;
Fett-Conte and Richieri-Costa,
1990
) is caused by a 4-6 kb deletion including exon 4 of the
LMBR1 gene (Ianakiev et al.,
2001
). The acheiropodia limb phenotype resembles that of
the Shh knockout mouse (Chiang et
al., 2001
; Kraus et al.,
2001
; Toledo and Saldanha,
1969
; Toledo et al.,
1972
), leading to the speculation that a 4-6 kb deletion disrupts
a regulatory element responsible for normal ZPA expression of Shh
(Hill et al., 2003
;
Lettice et al., 2002
). We
expect that the raz mutant likewise represents the alteration of a
regulatory site responsible for ZPA expression of Shh, but whether
this site is within the Lmbr1 gene or elsewhere on chromosome 5
cannot be determined at this time. Recently, it has been suspected that the
chick mutation ozd, which abolishes Shh limb expression and
induces loss of posterior skeletal elements, also represents an alteration of
a regulatory domain responsible for ZPA expression of Shh
(Ros et al., 2003
).
The downregulation of Shh in the limb bud caused by the raz
mutation, in contrast to the complete loss of Shh in ozd or
targeted Shh knockout, leads invariably to the presence of two
symmetrical skeletal elements in the fore and hindlimb zeugopod. From
structural characteristics these bones appear to possess an anterior
character. We have been unable to find a phenotype exactly analogous to
raz/raz. Clinically there are two observations of duplicated
radius (Mennen et al., 1997
;
Peterffy and Jona, 1942
), and
in both cases the zeugopod had an ulna as well. A few other examples are
summarized by O'Rahilly (O'Rahilly,
1951
) who concludes that it is difficult to find a case of radial
dimelia with ulna deficiency. This conclusion can be extended to mutants in
the chick and mouse. Duplicate
(Landauer, 1956
),
diplopodia 4 (MacCabe et al.,
1975
) and Strong's luxoid
(Forsthoefel, 1962
) all
display duplication of the anterior zeugopod skeletal element, but a posterior
bone, the ulna or fibula is always present. In contrast to the diminished
level of Shh expression in raz/raz limb buds,
molecular analysis of diplopodia 4 wing buds revealed normal levels
of posteriorly restricted Shh expression although ectopic anterior
expression domains of Hoxd genes, Bmp2 and Fgf4 are observed
(Rodriguez et al., 1996
).
Strong's luxoid (Alx4) limb buds revealed normal posterior
and ectopic anterior expression domains of Shh, Hoxd12 and
Fgf4 (Chan et al.,
1995
; Qu et al.,
1997
). Presumably, the normal posterior expression of these genes
leads to the formation of posterior skeletal structures in contrast to the
raz/raz phenotype with an anteriorized zeugopod with lowered
Shh and unrestricted 5' Hoxd expression.
However, increased Shh signaling in the limb bud can lead to a duplicated
posterior zeugopod in the absence of any anterior structure. This phenotype
has been induced by aberrant expression of the posteriorly restricted genes,
Hoxb8 and Hand2, throughout the limb bud mesoderm
(Charite et al., 1994
;
Charite et al., 2000
). In both
cases, an ectopic domain of Shh expression was documented in the
anterior limb bud mesenchyme accompanied by ectopic expression of
Hoxd11. A striking example of duplicated posterior zeugopod is seen
clinically in the Laurin-Sandrow syndrome (LSS)
(Kantaputra, 2001
). The LSS
phenotype has been suggested to be related to preaxial polydactyly based on a
familial appearance of LSS and tibial hemimelia-polysyndactyly-triphalangeal
thumb syndrome (THPTTS), in father and daughter (Kantraputra, 2001). This is
significant because THPTTS has been mapped to 7q36
(Balci et al., 1999
;
Heus et al., 1999
;
Zguricas et al., 1999
), a
location syntenic with the regulatory region for Shh expression in
the limb bud (Lettice et al.,
2002
). Thus, it seems plausible that children with LSS who have
ulnar and/or fibular dimelia are another example of excess Shh signaling.
The aforementioned zeugopod phenotypes that result from increased Shh
signaling are reproduced in the chick wing after deposition of retinoic acid
(RA) to the anterior limb mesenchyme
(Summerbell, 1983
). When RA
was deposited at stage 17, the lowest dosage, 0.25 mg, induced a duplicated
radius with the ulna still present. As the dose of RA was raised, the
duplicated radius was not seen again, but was replaced by a duplicated ulna
with no radius present. RA induces higher Shh signaling
(Riddle et al., 1993
;
Helms et al., 1994
;
Helms et al., 1996
), providing
support for the concept that the quantitative level of Shh signaling in the
early limb bud will influence the anteroposterior character of the zeugopodal
skeletal elements. The concept of a quantitative influence of Shh signaling on
AP patterning in the autopod has been clearly shown by Yang et al.
(Yang et al., 1997
), but
Fig. 1B in that manuscript also
reveals a quantitative effect of Shh protein on AP zeugopod morphogenesis.
A summary of the varied zeugopod phenotypes and their relationship to the intensity of Shh signaling suggests that a quantitative relationship exists (Table 1). Loss of the ulna is associated with the absence of Shh signaling. At the other end of the relationship is the induction of a replicated posterior zeugopod with no anterior structure because of supernormal Shh signaling. Between these extremes is normal limb development at 50% Shh signaling, while 20% Shh signaling is associated with replicated radius/tibia and absence of ulna/fibula.
|
Furthermore, we suggest that a low ubiquitous level of Shh activity allows
a posteriorly expanded and thus uniform expression of Gli3.
Presumably, these limb mesenchymal cells retain only a small fraction of
Gli3 as an activator rather than conversion to the repressor form, as
normal Shh signaling is required for processing in the vertebrate limb bud
(Litingtung et al., 2002
;
Wang et al., 2000
). Thus, we
predict that there is a high ratio of Gli3 repressor/Gli3 activator throughout
the limb bud, mimicking what is usually present in the central to anterior
limb bud mesenchyme where Shh signaling is normally low.
We take as support for this concept the zeugopod phenotype of
Shh/; Gli3+/
fetuses (Litingtung et al.,
2002
; te Welscher et al.,
2002
). Here, one can predict that Gli3 will be predominantly in
the repressor form as there is no Shh activity; and that there is less than
the usual amount of Gli3 due to one null allele of Gli3. The zeugopod
phenotype in these Shh null, Gli3 heterozygotes is the
closest in structural similarity to the raz/raz phenotype
that we have seen. In Shh/;
Gli3+/ forelimbs
(Litingtung et al., 2002
;
te Welscher et al., 2002
), as
in the raz/raz forelimbs, the zeugopod begins as a single
bone, with no olecranon process, suggesting it is the anterior skeletal
element, the radius. Within a short distance distally, the bone divides into
two bones, which continue partially fused to the wrist. The hindlimb zeugopod
phenotype in Shh/;
Gli3+/ mice is not strikingly symmetrical across
the AP axis (Litingtung et al.,
2002
). Yet the fibula, the posterior bone, does not have a typical
wild-type appearance. Rather, it has a proximal epiphysis resembling that of
the tibia and proceeds in parallel with the tibia to the ankle rather then
following the tortuous course seen in wild-type legs.
In support of this general concept, many of the altered expression patterns
of `limb' genes were very similar in Shh/;
Gli3+/ limbs to those seen in
raz/raz limbs. These include 5' Hoxd genes, Ptch,
Gli1, Gli3 and Hand2
(Litingtung et al., 2002
;
te Welscher et al., 2002
).
The concept that this putative high uniform ratio of Gli3R/Gli3A in
raz/raz limbs might also account for the autopod phenotype is
challenged by the dogma that low Shh activity leads to limb reduction, not
limb excess deformities. However, the clinical condition of Pallister-Hall
syndrome leads to central polydactyly
(Hall et al., 1980
) caused by
truncating mutations of Gli3
(Kang et al., 1997
). In the
mouse model for Pallister-Hall syndrome
(Bose et al., 2002
) homozygous
mutants have two features of limb morphogenesis similar to raz/raz
limbs, including central/insertional polydactyly and digits localized in
different dorsal/ventral planes (Bose et
al., 2002
). Moreover, the biochemical activity of Gli3 truncation
proteins constructed to epitomize PHS mutations act as transcriptional
repressors (Shin et al., 1999
)
so that limb buds developing in such an organism would experience high levels
of Gli3 repressor activity. Thus, we believe that altered Gli3 processing
induces both the raz/raz zeugopod phenotype and also leads to the
unique autopod phenotype of central polydactyly with near mirror-image
symmetry. Support for the concept of a role for Gli3 repressor/activator
distribution within the limb bud as a mediator of AP patterning can also be
found in the studies of talpid chick mutants that lead to an autopod
with 7-10 similar digits with no recognizable AP polarity
(Hinchliffe and Ede, 1967
;
Abbott et al., 1959). In contrast to our predictions for the raz/raz
limb bud, the talpid2 mutant has a very high level of Gli3
activator throughout the limb bud (Wang et
al., 2000
) correlated with digits that all have posterior
character (Caruccio et al.,
1999
). Conversely, the talpid3 mutant would be
predicted to have a uniform Gli3 repressor/activator ratio throughout the limb
bud, as Gli3 expression is expanded into the posterior mesenchyme and
Ptch expression is low and uniform throughout the limb
(Lewis et al., 1999
), thereby
permitting Shh to diffuse throughout the limb. The 5' Hoxd expression in
talpid3 limb buds suggests that the digits have a
posterior character. Clearly, the interaction of Shh signaling leading to Gli3
processing is crucial for normal limb patterning across the AP axis
(Wang et al., 2000
;
Litingtung et al., 2002
) and
slight skewing of this balance can lead to a variety of limb phenotypes.
The raz/raz mutation skews this balance to heavily favor Gli3 repressor. However, it must be borne in mind that the mutant phenotype is derived from a large chromosomal inversion potentially affecting the expression of many other genes, some of which are known to participate in limb morphogenesis. Altered function of some of these genes, e.g. Luxate and Msx1, may contribute to the unique limb phenotype in raz/raz mutants. In addition, they might contribute to aspects of the phenotype not easily explained by reduced Shh signaling such as the scapular defects and preaxial polydactyly in heterozygotes. Additional genetic dissection of the raz/raz phenotype, perhaps through breeding to other mutants in this chromosomal region, will be required to assign the true cause of this unique limb phenotype.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Abbott, U. K. (1959). Further studies on
diplopodia. II. Embryological features. J. Genet.
56,179
-196.
Balci, S., Demirtas, M., Civelek, B., Piskin, M., Sensoz, O.,
and Akarsu, A. N. (1999). Phenotypic variability of
triphalangeal thumb-polysyndactyly syndrome linked to chromosome 7q36.
Am. J. Med. Genet. 87,399
-406.[CrossRef][Medline]
Balcuns, A., Gasseling, M. T., and Saunders, J. W.
(1970). Spatio-temporal distribution of a zone that controls
antero-posterior polarity in the limb bud of the chick and other bird embryos.
Am. Zool. 10,323
.
Bell, S. M., Schriener, C. M. and Scott, W. J., Jr
(1999). Disrupting the establishment of polarizing activity by
teratogen exposure. Mech. Dev.
88,147
-157.[CrossRef][Medline]
Bose, J., Grotewold, L. and Ruther, U. (2002).
Pallister-Hall syndrome phenotype in mice mutant for Gli3. Hum.
Mol. Genet. 11,1129
-1135.
Büscher, D. and Rüther, U. (1998).
Expression profile of Gli family members and Shh in normal and mutant mouse
limb development. Dev. Dyn.
211, 88-96.[CrossRef][Medline]
Caruccio, N. C., Martinez-Lopez, A., Harris, M., Dvorak, L.,
Bitgood, J., Simandl, B. K. and Fallon, J. F. (1999).
Constitutive activation of Sonic hedgehog signaling in the chicken mutant
talpid2: Shh-independent outgrowth and polarizing
activity. Dev. Biol.
212,137
-149.[CrossRef][Medline]
Chan, D. C., Wynshaw-Boris, A. and Leder, P.
(1995). Formin isoforms are differentially expressed in the mouse
embryo and are required for normal expression of fgf-4 and
shh in the limb bud. Development
121,3151
-3162.[Abstract]
Charite, J., Graaff, D. W., Shen, S. and Deschamps, J.
(1994). Ectopic expression of Hoxb-8 causes duplication of the
ZPA in the forelimb and homeotic transformation of axial structure.
Cell 78,589
-601.[CrossRef][Medline]
Charite, J., McFadden, D. G. and Olson, E. N.
(2000). The bHLH trnascription factor dHAND controls Sonic
hedgehog expression and establishment of the zone of polarizing activity
during limb development. Development
127,2461
-2470.[Abstract]
Chiang, C., Litingtung, Y., Harris, M. P., Simandl, B. K., Li,
Y., Beachy, P. A. and Fallon, J. F. (2001).
Manifestation of the limb prepattern: limb development in the absence of sonic
hedgehog function. Dev. Biol.
236,421
-435.[CrossRef][Medline]
Clark, R. M., Marker, P. C. and Kingsley, D. M.
(2000). A novel candidate gene for mouse and human preaxial
polydactyly with altered expression in limbs of Hemimelic extra-toes
mutant mice. Genomics
67, 19-27.[CrossRef][Medline]
Crick, A. P., Babbs, C., Brown, J. M. and Morriss-Kay, G. M.
(2003). Developmental mechanisms underlying polydactyly in the
mouse mutant Doublefoot. J. Anat.
202, 21-26.[CrossRef][Medline]
Davis, A. P. and Capecchi, M. R. (1994). Axial
homeosis and appendicular skeleton defects in mice with a targeted disruption
of hoxd-11. Development
120,2187
-2198.[Abstract]
Echelard, Y., Epstein, D. J., St-Jaques, B., Shen, L., Mohler,
J., MacMahon, J. A. and MacMahon, A. P. (1993). Sonic
hedgehog, a member of a family of putative signaling molecules, is implicated
in the regulation of CNS polarity. Cell
75,1417
-1430.[CrossRef][Medline]
Eggenschwiler, J. T., Espinoza, E. and Anderson, K. V.
(2001). Rab23 is an essential negative regulator of the mouse
Sonic hedgehog signalling pathway. Nature
412, 194.[CrossRef][Medline]
Favor, J., Neuhauser-Klaus, A. and Ehling, U. H.
(1987). Radiation-induced forward and reverse specific locus
mutations and dominant cataract mutations in treated strain BALB/c and
DBA/2male mice. Mutat. Res.
177,161
-169.[CrossRef][Medline]
Favor, J., Grimes, P., Neuhauser-Klaus, A., Pretsch, W. and
Stambolian, D. (1997). The mouse Cat4 locus maps to
Chromosome 8 and mutants express lens-corneal adhesion. Mamm.
Genome 8,403
-406.[CrossRef][Medline]
Fernandez-Teran, M., Piedra, M. E., Kathiriya, I. S., Srivasta,
D., Rodriguez-Rey, J. C. and Ros, M. A. (2000). Role
of dHAND in the anterior-posterior polarization of the limb bud: implications
for the sonic hedgehog pathway. Development
127,2133
-2142.[Abstract]
Fett-Conte, A. C. and Richieri-Costa, A.
(1990). Acheiropodia: report on four new Braziliam patients.
Am. J. Med. Gen. 36,341
-344.[CrossRef][Medline]
Forsthoefel, P. F. (1962). Genetics and
manifold effects of Strong's luxoid gene in the mouse, including its
interactions with Green's luxoid and Carter's luxate genes. J.
Morphol. 110,391
-420.
Hall, J. G., Pallister, P. D., Clarren, S. K., Beckwith, J. B.,
Wiglesworth, F. W., Fraser, F. C., Cho, S., Benke, P. J. and Reed, S.
D. (1980). Congenital hypothalamic hamartoblastoma,
hypopituitarism, imperforate anus, and postaxial polydactyly a new
syndrome? Part I: Clinical, causal, and pathogenetic considerations.
Am. J. Med. Genet. 7,47
-74.[CrossRef][Medline]
Helms, J. A., Thaller, C. and Eichele, G.
(1994). Relationship between retinoic acid and sonic
hedgehog, two polarizing signals in the chick wing bud.
Development 120,3267
-3274.[Abstract]
Helms, J. A., Kim, C. H., Eichele, G. and Thaller, C.
(1996). Retinoic acid signaling is required during early chick
limb development. Development
122,1385
-1394.[Abstract]
Heus, H. C., Hing, A., van Baren, M. J., Joosse, M., Breedveld,
G. J., Wang, J. C., Burgess, A., Donnis-Keller, H., Berglund, C. et
al. (1999). A physical and transcriptional map of the
preaxial polydactyly locus on chromosome 7q36.
Genomics 57,342
-351.[CrossRef][Medline]
Hill, R. E., Heaney, J. H. and Lettice, L. A.
(2003). Sonic hedgehog: restricted expression and limb
dysmorphologies. J. Anat.
202, 13-20.[CrossRef][Medline]
Hinchliffe, J. R. and Ede, D. A. (1967). Limb
development in the polydactylous talpid3 mutant of the foul.
J. Embryol. Exp. Morphol.
17,385
-404.
Ianakiev, P., von Baren, M. J., Daly, M. J., Toledo, S. P. A.,
Cavalcanti, M. G., Neto, J. C., Silveira, E. L., Freire-Maia, A.,
Heutink, P., Kilpatrick, M. W. et al. (2001). Acheiropodia is
caused by a genomic deletion in C7orf2, the human orthologue of the Lmbr1
gene. Am. J. Hum. Genet.
68, 38-45.[CrossRef][Medline]
Ingham, P. W. and McMahon, A. P. (2001).
Hedgehog signaling in animal development: paradigms and principles.
Genes Dev. 15,3059
-3087.
Johnson, D. R. (1967). Extra-toes: a new mutant
gene causing multiple abnormalities in the mouse. J. Embryol. Exp.
Morphol. 17,543
-581.[Medline]
Johnson, R. L. and Tabin, C. J. (1997).
Molecular models for vertebrate limb development. Cell
90,979
-990.[CrossRef][Medline]
Kang, S., Graham, J. M., Jr, Olney, A. H. and Biesecker, L.
G. (1997). GLI3 frameshift mutations cause autosomal
dominant Pallister-Hall syndrome. Nat. Genet.
15,266
-268.[CrossRef][Medline]
Kantaputra, P. N. (2001). Laurin-Sandrow
syndrome with additional associated manifestations. Am. J. Med.
Genet. 98,210
-215.[CrossRef][Medline]
Kraus, P., Fraidenraich, D. and Loomis, C. A.
(2001). Some distal limb stractures develop in mice lacking Sonic
hedgehog signaling. Mech. Dev.
100, 45-58.[CrossRef][Medline]
Kuczuk, M. H. and Scott, W. J. (1984).
Potentiation of acetazolamide-induced ectrodactyly in SWV and C57BL/6J mice by
cadmium sulfate. Teratology
29,427
-435.[CrossRef][Medline]
Landauer, W. (1956). Rudimentation and
duplication of the radius in the duplicate mutant form of fowl. J.
Genet. 54,199
-218.
Lettice, L. A., Horikoshi, T., Heaney, S. J. H., van Baren, M.
J., van der Linde, H. C., Breedveld, G. J., Joosse, M., Akarsu, N.,
Oostra, B. A., Endo, N. et al. (2002). Disruption of a
long-range cis-acting regulator for Shh causes preaxial polydactyly.
Proc. Natl. Acad. Sci
99,7548
-7553.
Lewis, K. E., Drossopoulou, G., Paton, I. R., Morrice, D. R.,
Robertson, K. E., Burt, D. W., Ingham, P. W. and Tickle, C.
(1999). Expression of ptc and gli genes in
talpid3 suggests bifurcation in Shh pathway.
Development 126,2397
-2407.[Abstract]
Lewis, P. M., Dunn, M. P., McMahon, J. A., Logan, M., Martin, J.
F., St-Jaques, B. and McMahon, A. P. (2001). Cholesterol
modification of sonic hedgehog is required for long-range singaling acitivity
and effective modulation of singaling by Ptc1. Cell
105,599
-612.[CrossRef][Medline]
Litingtung, Y., Dahn, R. D., Li, Y., Fallon, J. F. and Chiang,
C. (2002). Shh and Gli3 are dispensable for limb skeleton
formation but regulate digit number and identity.
Nature 418,979
-983.[CrossRef][Medline]
Lopez-Martinez, A., Chang, D. T., Chiang, C., Porter, J. A.,
Ros, M. A., Simandl, B. K., Beachy, P. A. and Fallon, J. F.
(1995). Limb-patterning activity and restricted posterior
localization of the amino-terminal product of sonic hedgehog cleavage.
Curr. Biol. 5,791
-795.[CrossRef][Medline]
Lyon, M. F., Quinney, R., Glenister, P. H., Kerscher, S.,
Guillot, P. and Boyd, Y. (1996). Doublefoot: a new
mouse mutant affecting development of limbs and head. Genet. Res.
Camb. 68,221
-231.[Medline]
MacCabe, J. A., MacCabe, A. B., Abbott, U. K. and McCarrey, J.
R. (1975). Limb development in diplopodia4: A polydactylous
mutation in the chicken. Exp. Zool.
191,383
-393.
Manly, K. F. (1998). User's manual
for Map Manager Classic and Map Manager QT. New York:
Springer-Verlag.
Marigo, V., Johnson, R. L., Vortkamp, A. and Tabin, C. J.
(1996). Sonic hedgehog differentially regulates expression of
GLI1 and GLI3 during limb development. Dev. Biol.
180,273
-283.[CrossRef][Medline]
Masuya, H., Tomoko, S., Wakana, S., Moriwaki, K. and Shiroishi,
T. (1995). A duplicated zone of polarizing activity in
polydactylous mouse mutants. Genes Dev.
9,1645
-1653.
Masuya, H., Sagai, T., Moriwaki, K. and Shiroishi, T.
(1997). Multigenic control of the localization of the zone of
polarizing activity in limb morphogenesis in the mouse. Dev.
Biol. 182,42
-51.[CrossRef][Medline]
Mennen, U., Deleare, O. and Matime, A. (1997).
Upper limb triplication with radial dimelia. J. Hand
Surg. 22B,80
-83.
Milenkovic, L., Goodrich, L. V., Higgins, K. M. and Scott, M.
P. (1999). Mouse patched1 controls body size determination
and limb patterning. Development
126,4431
-4440.[Abstract]
O'Rahilly, R. (1951). Morphological patterns in
limb deficiencies and duplications. Am. J. Anat.
89,135
-193.[CrossRef][Medline]
Parr, B. and McMahon, A. (1995). Dorsalizing
signal Wnt-7a required for normal polarity of D-V and A-P axes of
mouse limb. Nature 374,350
-353.[CrossRef][Medline]
Peterffy, P. and Jona, S. (1942). Zwei Falle
von seltener anomalie der oberarmentwicklung. Zentralblatt fur
Chirurgie 69,878
-887.
Qu, S., Niswender, K. D., Ji, Q., van der Meer, R., Keeney, D.,
Magnuson, M. A. and Wisdom, R. (1997). Polydactyly and
ectopic ZPA formation in Alx-4 mutant mice.
Development 124,3999
-4008.[Abstract]
Railu, R., Machold, R., Gaiana, N., Corbin, J., MaMahon, A. M.,
and Fishell, G. (2002). Dorsoventral patterning is
established in the telencephalon of mutants lacking both Gli3 and Hedgehog
signaling. Development
129,4963
-4974.
Riddle, R. D., Johnson, R. L., Laufer, E. and Tabin, C.
(1993). Sonic hedgehog mediates the polarizing activity
of the ZPA. Cell 75,1401
-1416.[CrossRef][Medline]
Roderick, T. H. (1971). Producing and detecting
paracentric chromosomal inversions in mice. Mutat.
Res. 11,59
-69.[Medline]
Rodriguez, D., Kos, R., Macias, D., Abbott, U. K. and Belmonte,
J. C. I. (1996). Shh, HoxD, Bmp-2, and
Fgf-4 gene expression during development of the polydactylous
talpid2, diplopodia1, and
diplopodia4 mutant chick limb buds. Dev.
Genet. 19,26
-32.[CrossRef][Medline]
Ros, M. A., Dahn, R. D., Fernandez-Teran, M., Rashka, K.,
Caruccio, N. C., Hasso, S. M., Bitgood, J. J., Lancman, J. J. and
Fallon, J. F. (2003). The chick oligozeugodactyly (ozd)
mutant lacks sonic hedgehog function in the limb.
Development 130,527
-537.
Roy, S. and Gardiner, D. M. (2002). Cyclopamine
induces digit loss in regenerating Axolotl limbs. J. Exp.
Zool. 293,186
-190.[CrossRef][Medline]
Saunders, J. J. W. and Gasseling, M. T. (1968).
Ectodermal-mesenchymal interactions in the origin of limb symmetry. In
Epithelial-Mesenchymal Interaction (ed. R.
Fleischmeyer and R. E. Billingham), pp. 78-97.
Baltimore: Williams and Wilkins.
Searle, A. G. (1964). The genetics and
morphology of two luxoid mutants in the house mouse. Genet.
Res. 5,171
-197.
Sharpe, J., Lettice, L., Hecksher-Sorensen, J., Fox, M., Hill,
R. and Krumlauf, R. (1999). Identification of
Sonic hedgehog as a candidate gene responsible for the polydactylous
mouse mutant Sasquatch. Curr. Biol.
9, 97-100.[CrossRef][Medline]
Shin, S. H., Kogerman, Lindstrom, E., Toftgard, R. and
Biesecker, L. G. (1999). GLI3 mutations in human disorders
mimic Drosophile Cubitus interruptus protein functions and localization.
Proc. Natl. Acad. Sci. USA
96,2880
-2884.
Summerbell, D. (1974). Interaction between the
proximo-distal and anteroposterior co-ordinates of positional value during the
specification of positional information in the early development of the chick
limb-bud. J. Embryol. Exp. Morphol.
32,227
-237.[Medline]
Summerbell, D. (1983). The effect of local
application of retinoic acid to the anterior margin of the developing chick
limb. J. Embryol. Exp. Morphol.
78,269
-289.[Medline]
Taipale, J., Chen, J. K., Cooper, M. K., Wang, B., Mann, R. K.,
Milenkovic, L., Scott, M. P. and Beachy, P. A. (2000).
Effects of oncogenic mutations in Smoothened and Patched can
be reversed by cyclopamine. Nature
406,1005
-1009.[CrossRef][Medline]
Takabatake, T., Ogawa, M., Takahashi, T. C., Mizuno, M.,
Okamoto, M. and Takeshima, K. (1997). Hedgehog and patched
hene expression in adult ocular tissues. FEBS Lett.
410,485
-489.[CrossRef][Medline]
te Welscher, P., Zuniga, A., Kuijper, S., Drenth, T., Goedemans,
H. J., Meijlink, F. and Zeller, R. (2002). Progression
of vertebrate limb development through SHH-mediated counteraction of GLI3.
Science 298,827
-830.
Tickle, C., Summerbell, D. and Wolpert, L.
(1975). Positional signalling and specification of digits in
chick limb morphogenesis. Nature
254,199
-202.[CrossRef][Medline]
Toledo, S. P. and Saldanha, P. H. (1969). A
radiological and genetic investigation of acheiropody in a kindred including
six cases. J. Genet. Hum.
17, 81-94.[Medline]
Toledo, S. P., Saldanha, P. H., Borelli, A. and Cintra, A.
B. (1972). Further data on acheiropody. J. Genet.
Hum. 20,253
-258.[Medline]
Wang, B., Fallon, J. F. and Beachy, P. A.
(2000). Hedgehog-regulated processing of Gli3 produces and
anterior/posterior repressor gradient in the developing limb.
Cell 100,423
-434.[CrossRef][Medline]
Yang, Y., Drossopoulou, G., Chuang, P. T., Duprez, D., Marti,
E., Bumcrot, D., Vargesson, N., Clarke, J., Niswander, L., McMahon, A.
et al. (1997). Relationship between dose, distance and time
in Sonic Hedgehog-mediated regulation of anteroposterior polarity in
the chick limb. Development
124,4393
-4404.[Abstract]
Yang, Y., Guillot, P., Boyd, Y., Lyon, M. F. and McMahon, A.
P. (1998). Evidence that preaxial polydactyly in the
Doublefoot mutant is due to ectopic Indian Hedgehog signaling.
Development 125,3123
-3132.[Abstract]
Zeng, X., Goetz, J. A., Suber, L. M., Scott, W. J., Jr,
Schreiner, C. M. and Robbins, D. J. (2001). A freely
diffusible form of Sonic hedgehog mediates long-range signalling.
Nature 411,716
-720.[CrossRef][Medline]
Zguricas, J., Heus, H., Morales-Peralta, E., Breeveld, G., Kuyt,
B., Mumcu, E. F., Bakkar, W., Akarsu, N., Kay, S. P. J., Hovius, S. E.
R. et al. (1999). Clinical and genetic studies on 12 preaxial
polydactyly families and refinement of the localisation of the responsible
gene to a 1.9 cM region on chromosome 7q36. J. Med.
Genet. 36,32
-40.
This article has been cited by other articles:
![]() |
N. Gao, K. Ishii, J. Mirosevich, S. Kuwajima, S. R. Oppenheimer, R. L. Roberts, M. Jiang, X. Yu, S. B. Shappell, R. M. Caprioli, et al. Forkhead box A1 regulates prostate ductal morphogenesis and promotes epithelial cell maturation Development, August 1, 2005; 132(15): 3431 - 3443. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Lallemand, M.-A. Nicola, C. Ramos, A. Bach, C. S. Cloment, and B. Robert Analysis of Msx1; Msx2 double mutants reveals multiple roles for Msx genes in limb development Development, July 1, 2005; 132(13): 3003 - 3014. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||