|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 November 2003
doi: 10.1242/dev.00875
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Institute of Genetics, University of Nottingham, Queen's Medical Centre,
Nottingham NG7 2UH, UK
2 Medical Research Council Laboratory of Molecular Biology, Hills Road,
Cambridge CB2 2QH, UK
Author for correspondence (e-mail:
roger.patient{at}nottingham.ac.uk)
Accepted 16 September 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Haematopoiesis, Blood, Erythropoiesis, Myelopoiesis, Vasculogenesis, Pronephric duct, Heart, Lateral mesoderm, Somitic mesoderm
| Introduction |
|---|
|
|
|---|
The concept of the haemangioblast has gained support from several findings.
Firstly, angioblasts and haematopoietic progenitors share the expression of
several genes (Keller, 2001
).
Secondly, targeted disruption of the gene for the vascular endothelial growth
factor (VEGF) receptor-2, flk1, in the mouse
(Shalaby et al., 1995
) and
mutation of the zebrafish cloche locus affect both the blood and
endothelial lineages (Stainier et al.,
1995
). Thirdly, single Flk1-positive (Flk1+) cells (so
called blast colony forming cells; BL-CFCs) derived from embryonic stem (ES)
cells can give rise to blast colonies (BL-C) that contain both blood and
endothelial progenitors in vitro (Choi et
al., 1998
; Faloon et al.,
2000
; Nishikawa et al.,
1998
). However, haemangioblasts have not yet been isolated from a
vertebrate embryo. The best in vivo evidence for the existence of the
haemangioblast comes from lineage labelling studies in the chick
(Jaffredo et al., 1998
;
Jaffredo et al., 2000
). These
studies also suggest that definitive HC clusters directly differentiate from
the ventral endothelial lining of the dorsal aorta. Consistent with this idea,
ECs isolated from the AGM region and the vitelline and umbilical arteries of
murine embryos possess haematopoietic stem cell activity
(North et al., 2002
), and ECs
selected from the AGM region, the foetal liver and the foetal bone marrow of
human embryos develop into myelo-lymphoid cells in culture
(Oberlin et al., 2002
).
In zebrafish, primitive erythrocytes and ECs of the major trunk vessels,
the dorsal aorta and the axial vein, form in close association in the
intermediate cell mass (ICM) in the posterior midline of the embryo 1 day
after fertilisation. These cells originate from the posterior lateral mesoderm
(PLM) of the post-gastrula embryo (Zhong
et al., 2001
) (Fig.
1D). Here, overlapping expression patterns of blood and
endothelial genes suggest the existence of haemangioblast-like cells
(Brown et al., 2000
;
Gering et al., 1998
;
Thompson et al., 1998
).
Expression patterns of blood and endothelial genes also overlap in the
anterior lateral mesoderm (ALM, Fig.
1D) which gives rise to ECs
(Roman and Weinstein, 2000
)
and myeloid HCs (Hsu et al.,
2001
). In this paper, we will refer to such cells co-expressing
blood and endothelial genes as haemangioblasts.
|
Gain-of-function studies suggest an earlier role for scl/tal1
consistent with its expression in early lateral mesoderm prior to the
separation of the blood and endothelial lineages. We reported previously that
Scl/Tal1 can induce ectopic development of cells co-expressing both early
blood and endothelial genes mainly from the paraxial mesoderm and that these
cells appeared to give rise to blood and later some ECs
(Gering et al., 1998
). In a
parallel study, forced expression of scl/tal1 was shown to partially
rescue expression of blood and endothelial genes in the zebrafish
cloche mutant (Liao et al.,
1998
). Both studies suggest that Scl/Tal1 can specify blood and
ECs possibly through the specification of the haemangioblast.
Scl/Tal1 forms complexes with other transcription factors. It
heterodimerises with ubiquitously expressed bHLH transcription factors encoded
by the E2a gene, which bind E-boxes in regulatory sequences and activate gene
transcription (Hsu et al.,
1991
; Hsu et al.,
1994
). Scl/Tal1 also interacts with the LIM domain transcription
factors Lmo1 and Lmo2, with whom it shares involvement in T-cell leukaemias
(Rabbitts, 1998
;
Valge-Archer et al., 1994
;
Wadman et al., 1994
). Like
scl/tal1, lmo2 is expressed in endothelial and haematopoietic
progenitors and in cells of the erythroid and megakaryocytic lineage
(Warren et al., 1994
), and is
essential for primitive and definitive haematopoiesis, as well as vascular
remodelling (Warren et al.,
1994
; Yamada et al.,
1998
; Yamada et al.,
2000
). In erythroid cells, Lmo2, which itself does not bind DNA,
acts as a bridging molecule in a complex that contains Ldb1, Scl/Tal1, E2a and
Gata1 and binds composite E-box-GATA sequence motifs
(Wadman et al., 1997
). In
early blood progenitors, Gata2 can replace Gata1, and Sp1 takes the complex to
an essential Sp1 site within the c-kit promoter
(Lecuyer et al., 2002
). Later
in erythroid maturation, the retinoblastoma protein has been reported to
replace the GATA factor (Vitelli et al.,
2000
). Consistent with an important role for the
Lmo2-Scl/Tal1-Gata1/2 complex in erythropoiesis, forced expression of
scl/tal1, lmo2 and gata1 can turn activin or FGF-treated
Xenopus animal caps into erythrocytes and can induce widespread
erythropoiesis in Xenopus embryos
(Mead et al., 2001
). However,
these studies were carried out at concentrations sufficient to induce Bmp4 and
the embryos were ventralised. In addition, only differentiated erythroid cells
were monitored and the effects on other blood cell types or endothelial cell
differentiation were not addressed. Whether the red cells followed their
normal differentiation pathway, developing from haemangioblasts, was also not
determined.
In this report, we describe a role for a synergistic action of Lmo2 and Scl/Tal1 in the early mesoderm. We show that scl/tal1 specifies haemangioblast-like cells in the very tissue in which it can ectopically induce the expression of its interaction partner Lmo2. Co-injection of scl/tal1 and lmo2 mRNAs extends the effect of Scl/Tal1 to other non-axial mesodermal tissues inducing the early blood and endothelial transcription programmes throughout the anteroposterior axis. Blood differentiation, however, is restricted to the pronephric mesoderm where Lmo2 and Scl/Tal1 are able to induce gata1 expression. In the absence of Gata1, Lmo2-Scl/Tal1-induced haemangioblasts differentiate into ECs.
| Materials and methods |
|---|
|
|
|---|
Preparation of mRNA for injection and antisense RNA probes
cDNAs for murine Lmo1, 2 and 4, and zebrafish Gata1, 2 and 5 were cloned
into the expression vector pßUT2-MT
(Gering et al., 1998
). Oligos
were used in PCR reactions on plasmid DNA to introduce suitable restriction
sites at the ends of open reading frames:
PCR fragments were digested with XbaI and XhoI, and
cloned in frame with the Myc-tag of pßUT2. To produce mRNA encoding
zebrafish Scl/Tal1, ß-galactosidase, nuclear localised GFP and murine
MyoD, pFC6 (Gering et al.,
1998
), pCS2lacZ, pCSnlsGFP2 (a linker encoding a nuclear
localisation signal with the sequence
5'GAATTCCCCAAAAAAGAAGAGAAAGGTAGAATTC3' was introduced into the
EcoRI and XbaI sites of pCS2mt-SGP
(Rubenstein et al., 1997
)
(construct made by Maz O'Reilly) and MmyoD.R1/Bam
(Theze et al., 1995
) were
used. mRNAs were transcribed from linearised templates using
mMessage-mMachine-Kits (Ambion, USA). mRNAs were characterised
spectrophotometrically, on agarose gels and by in vitro translation.
Injection of fish embryos
mRNAs (100 pg of each mRNA in all experiments except the
gata1-scl/tal1-lmo2 injections where 25 pg of each mRNA were
injected) were injected in 0.5 nl into one cell at the two or four cell stage
using a Picospritzer II microinjector (Parker Instrumentation). gfp
or lacZ mRNA (20 pg) were co-injected as tracers. The progeny of the
injected cell occasionally came to lie on one side of the embryo, leaving the
uninjected side as an internal control.
Whole-mount in situ hybridisation and sectioning
scl/tal1end. and gata1end.
expression were determined with probes complementary to the 3'UTRs,
which were not in the injected mRNAs. pZE62 contains 0.8 kb of the
scl/tal1 3'UTR (Gering et
al., 1998
). peG1 contains the last 0.3 kb of the 3'UTR of
gata1. It was generated by a HindIII cut-and-shut of the
original plasmid, pGATA1 (Detrich et al.,
1995
). The zebrafish lmo2 probe did not hybridise
significantly to the injected mouse Lmo2 mRNA and could therefore be
used to detect endogenous transcripts. Antisense RNAs for in situ
hybridisation were transcribed from linearised templates using Promega's T3,
T7 and SP6 RNA polymerases in the presence of digoxigenin (DIG)- or
fluorescein-labelled nucleotides (Roche Ltd., UK). Detection of the
DIG/fluorescein antibody-alkaline phosphatase conjugate was done using
BM-Purple and Fast Red (Roche Ltd., UK).
Single and double whole-mount in situ hybridisation on zebrafish embryos
was carried out as previously described
(Jowett and Yan, 1996
). For
sectioning, embryos were transferred into ethanol, embedded in JB4
methacrylate (Agar Scientific Ltd., UK) and sectioned on a microtome (Leica
Jung RM2165). All sections shown are 10 µm.
| Results |
|---|
|
|
|---|
|
This phenotype was specific to the injection of scl/tal1 and
lmo2 mRNAs. Replacing Scl/Tal1 with the murine myogenic bHLH protein
MyoD [which induced ectopic anterior expression of the muscle marker
desmin (Xu et al.,
2000
)] in 12-somite stage embryos (n=13/15) induced no
ectopic scl/tal1end. expression (n=12) and
reduced normal expression in 5/12 embryos. Likewise, embryos co-injected with
Scl/Tal1 and another LIM-only protein, murine Lmo4
(Grutz et al., 1998
;
Kenny et al., 1998
), did not
display widespread ectopic expression of scl/tal1end.
(n=20). In contrast, Lmo1, a Lim-only protein that, like Lmo2 and
Scl/Tal1, is involved in chromosomal translocations in leukaemic T-cells
(Rabbitts, 1998
) and that like
Lmo2 has been reported to interact with Scl/Tal1 in vitro
(Valge-Archer et al., 1994
),
could replace Lmo2 in our assay (n=17). Thus, Lmo2 and Lmo1 are
functionally equivalent in this assay as well as during tumorigenesis
(Rabbitts, 1998
).
Ectopic expression of scl/tal1 and lmo2 abolished normal
cardiac gene expression. At early somite stages, nkx2.5
(n=17/19), gata4 (Reiter
et al., 1999
) (n=10/16), gata6
(n=12/22) and tbx5.1
(Begemann and Ingham, 2000
)
(n=6/12) were down-regulated in scl/tal1-lmo2-injected
embryos (Fig. 2A,C-I, arrows).
Only gata5 (Brown et al.,
2000
; Reiter et al.,
1999
) expression appeared unchanged (weak reduction in 2/18; data
not shown). Control embryos injected with gfp, lmo2 or
scl/tal1 displayed very little reduction in nkx2.5 (0/12,
0/20, 0/21) or gata4 (1/16, 0/20, 1/15) expression at this time.
Consistent with the loss of early heart gene expression, we found a reduction
in ventricular tissue just prior to the fusion of the bilateral heart fields
(Fig. 2J,K, arrow;
n=8/17) and a reduction in the overall size of the myocardium by 34
hpf (Fig. 2L,M;
n=14/17). These results suggest that blood and endothelial
development occurred at the expense of the myocardial fate.
Scl/Tal1 and Lmo2-induced haemangioblasts differentiate into
erythrocytes in a regionally restricted manner
To see whether the induced progenitors develop into erythrocytes, we
examined the expression of two erythroid genes, beta embryonic globin
1 (ßE1) (Quinkertz and
Campos-Ortega, 1999
) and alas2
(Brownlie et al., 1998
), in
scl/tal1-lmo2-injected embryos. At 22 hpf, erythrocytes are usually
located in the ICM in the posterior midline of the embryo
(Fig. 3A). In
scl/tal1-lmo2-injected embryos, mesodermal cells expressing
ßE1 and alas2 were still restricted to the posterior
part of the embryo, albeit remaining in more lateral positions
(Fig. 3B, 10/10, 13/13).
However, the numbers of ßE1+ cells were increased
compared to uninjected embryos. This expansion of erythroid cells requires the
co-injection of lmo2 because there was only minimal expansion with
scl/tal1 alone (Gering et al.,
1998
) (data not shown). Therefore, although many of the early
blood and endothelial progenitors induced in scl/tal1-lmo2-injected
embryos did not become erythrocytes, some local expansion was apparent.
|
|
In summary, our data show that ectopic haemangioblasts induced by Scl/Tal1 and Lmo2 only undergo erythroid differentiation in pronephric mesoderm and that this correlates with the induction of gata1 expression. Importantly, the timing of both the haemangioblast and erythroid gene expression programmes corresponds to the naturally induced cells.
Gata1, Scl/Tal1 and Lmo2 can induce ectopic anterior erythropoiesis
without overt ventralisation of the embryo
To determine if the addition of gata1 to scl/tal1 and
lmo2 could overcome the tissue restrictions to erythroid
differentiation seen in our system, we co-injected mRNAs for all three
transcription factors into zebrafish embryos. By 24 hpf, widespread
development of round, ßE1+ (data not shown;
n=13/13), alas2+
(Fig. 5B, black arrowhead;
n=13/13) and haemoglobin-containing (diaminofluorene+;
data not shown; n=10/10) cells likely to be erythrocytes was seen in
the heart and head regions. Earlier, at the 10 somite stage (14 hpf),
endogenous gata1 (gata1end.) also displayed
ectopic anterior expression (Fig.
5E,F; n=9/9). Ectopic expression of alas2 and
gata1end. was not observed after injection of either
gata1 alone (nalas2=20,
ngata1=19) or with scl/tal1
(Fig. 5C;
nalas2=20, ngata1=35). In fact,
gata1 injection causes morphologic malformations
(Lyons et al., 2002
) and often
led to reduced blood marker expression
(Fig. 5C). The induction of the
erythroid programme is Gata1-specific because Gata1 could not be replaced by
Gata2 (Fig. 5D, n=23)
or Gata5 (data not shown; n=19) in this assay. The gata2 and
gata5 mRNAs were active as gata2 reduced chordin
expression in the embryonic shield (n=7/29)
(Sykes et al., 1998
) and
gata5 induced a slight increase in endodermal
sox17+ cells at 90% epiboly (n=11/20)
(Reiter et al., 2001
;
Weber et al., 2000
) (data not
shown).
|
No ectopic myeloid development in scl/tal1-lmo2-injected embryos
To determine the potential of the induced haemangioblasts to make blood
lineages other than erythroid, expression of early myeloid genes was examined
in scl/tal1-lmo2-injected embryos at the 10-12 somite stage (14-14.5
hpf). The four early myeloid genes analysed, pu.1
(Lieschke et al., 2002
),
runx1 (Kalev-Zylinska et al.,
2002
), c-myb
(Thompson et al., 1998
) and
dra (Herbomel et al.,
1999
), were expressed in the ALM that gives rise to myeloid cells
(Fig. 6A,C,E,G, arrowheads).
They are also expressed in the PLM caudal to somite 5, which mainly gives rise
to red blood cells (Fig.
6A,C,E,G, black arrows). In addition, dra is expressed in
early ventral mesodermal progenitors around the tail bud
(Fig. 6G, green arrow). In
scl/tal1-lmo2-injected embryos, the expression of these four myeloid
genes was not dramatically expanded in the head
(Fig. 6,B,D,F,H, arrowheads).
pu.1+ and c-myb+ cells appeared
disorganised (Fig. 6B,F,
arrowheads; n=23, n=17), while the expression of
runx1 and dra was unaffected or even reduced compared to
uninjected embryos (Fig. 6D,H;
n=19, n=15). c-myb and dra were induced in
the cardiogenic mesoderm (Fig.
6F,H, brackets; n=14/17, n=11/15), however,
runx1 and pu.1 were not expressed there
(Fig. 6B,D; n=0/19,
n=0/23). In addition, the number of L-plastin+
(Herbomel et al., 1999
)
macrophages that develop from the ALM was either unchanged or slightly reduced
but never increased in 20 hpf scl/tal1-lmo2-injected embryos
(Fig. 6I,J; n=18).
|
Widespread endothelial differentiation in
scl/tal1-lmo2-injected embryos
In the absence of erythroid or expanded myeloid differentiation in the head
and heart mesoderm, and in the SPM in scl/tal1-lmo2-injected embryos,
we found that the expression of the early endothelial genes flk1
(Fouquet et al., 1997
;
Liao et al., 1997
;
Sumoy et al., 1997
) and
flt4 (Thompson et al.,
1998
) was expanded in the head
(Fig. 7C,F, arrowheads;
n=20/20, n=15/19), into the heart mesoderm
(Fig. 7C,F, brackets;
n=20/20, n=6/19) and into the SPM
(Fig. 7C,F; arrows;
n=14/20, n=15/19) at 10 somites (14 hpf)
(Fig. 7N). While the expansion
into the head and heart mesoderm required the coinjection of lmo2
with scl/tal1, the latter alone was sufficient to induce
flk1 and flt4 in the SPM
(Fig. 7B,E, arrows; N).
|
| Discussion |
|---|
|
|
|---|
Differential competence of mesodermal tissues
In scl/tal1-lmo2-injected embryos, ectopic blood and endothelial
development occurs at the expense of other mesodermal tissues, in particular
the somitic, pronephric and cardiogenic mesoderm. Scl/Tal1 and Lmo2 appear to
interfere with the endogenous transcription programmes, activating early blood
and endothelial genes instead. Since Scl/Tal1 and Lmo2 activate these genes
synergistically, and since they are known to form transcription factor
complexes (Rabbitts, 1998
), we
assume that gene activation involves recruitment of components of the complex
endogenously. Absence of such endogenous transcription factors is likely to
render ectopic Scl/Tal1 and Lmo2 ineffective. Obvious candidates are proteins
already known to bind Scl/Tal1 and Lmo2, such as the E proteins and Gata
factors, respectively. Their absence might explain why the notochord is always
unaffected (data not shown).
Repression of endogenous transcription programmes could result from
activation of repressors or direct repression by Scl/Tal1-Lmo2 complexes.
Alternatively, Scl/Tal1 and Lmo2 could scavenge transcription factors that are
essential for an alternative transcription programme. Scl/Tal1 is believed to
scavenge E proteins normally required to interact with myogenic bHLH proteins
(Goldfarb and Lewandowska,
1995
; Hofmann and Cole,
1996
) or for the expression of E protein target genes in
pre-leukaemic T-cells, requiring Lmo1/2 in the latter context
(Herblot et al., 2000
;
Larson et al., 1996
). Gata
factors are known to interact with Lmo2 and other Lim-only proteins
(Chang et al., 2003
;
Osada et al., 1995
). In the
PLM, gata1 and gata2 are expressed. In the SPM,
gata2 is induced ectopically by injection of scl/tal1 and
scl/tal1-lmo2 (M.G. and R.K.P., unpublished). In the ALM,
gata2 is expressed together with gata4, 5 and 6,
which are also expressed in the cardiogenic mesoderm
(Reiter et al., 1999
;
Rodaway et al., 1999
) (A.
Gibson and R.K.P., unpublished). Although scl/tal1-lmo2 injection
down-regulates gata4 and 6 in the heart region,
gata5 expression is almost unchanged. It is possible that Scl/Tal1
and Lmo2 recruit heart Gata factors, leading not only to induction of the
early blood and endothelial transcription programmes but also to a blockade of
heart-specific gene expression. It remains to be seen whether Gata4, 5 and 6
can interact with Lmo2 and which interaction partners Scl/Tal1 and Lmo2
require in the various mesodermal tissues in which they can ectopically switch
on blood and endothelial genes.
While induction of the haemangioblast programme requires both Scl/Tal1 and
Lmo2 in the head and the heart mesoderm, injection of scl/tal1 mRNA
is sufficient to induce it in the SPM. We show here that only in this tissue
can Scl/Tal1 induce ectopic lmo2 expression. This suggests that once
lmo2 is activated, the two partners can synergistically drive the
expression of genes like fli1, flk1, flt4, tie1 and tie2. It
does, however, not explain why Scl/Tal1 can induce lmo2 in the SPM in
the first place. It is possible that a Lmo2 paralogue is expressed in the SPM
and assists Scl/Tal1. Alternatively, Scl/Tal1 could simply scavenge E
proteins. This might be enough to abrogate somitic development given the vast
array of bHLH proteins it depends on and, in the absence of other
developmental options, SPM cells may undergo endothelial development. It
should be noted that in mammalian and avian embryos endothelial development
occurs from somites after the onset of blood circulation
(Ambler et al., 2001
;
Beddington and Martin, 1989
;
Pardanaud et al., 1996
;
Wilting et al., 1995
). It is
therefore possible that ectopic scl/tal1 expression induces earlier
expression of the intrinsic endothelial programme.
Gata1, Scl/Tal1 and Lmo2 can induce anterior erythropoiesis without
overt ventralisation of the embryo
Erythropoiesis only proceeds from Scl/Tal1-Lmo2-induced haemangioblasts
located in the PLM, not from the heart, head or somitic mesoderm. This
correlates with where gata1 expression was induced. Consistent with a
previous study (Mead et al.,
2001
), we show that co-injection of Scl/Tal1, Lmo2 and Gata1
causes widespread induction of erythropoiesis. However, we also demonstrate
that this is due to relief of the posterior restriction, leading to induction
of gata1end. expression and erythropoiesis anteriorly. We
additionally show that other Gata factors, in particular Gata2, cannot replace
Gata1. Furthermore, gata1-scl/tal1-lmo2-injected embryos are not
ventralised/posteriorised as eve1 expression is unchanged and
bmp4 expression is not obviously activated, suggesting that
gata1-scl/tal-lmo2-injection can induce anterior erythropoiesis
downstream of the dorsal-ventral patterning of the mesoderm.
In our hands, injection of gata1 alone was not sufficient to
induce either anterior gata1end. expression or head
erythropoiesis. This result conflicts with a recent paper showing that
injected gata1 mRNA can induce expression of a gfp reporter
gene under the control of the gata1 promoter in transgenic zebrafish
(Kobayashi et al., 2001
). We
assume that the difference lies with the transgenic reporter construct used or
its chromosomal integration site. Nevertheless, our data confirm that Gata1
can auto-regulate its own expression, albeit with the help of Scl/Tal1 and
Lmo2.
We observed no increase in the number of myeloid cells in scl/tal1-lmo2-injected embryos, whereas erythropoiesis was expanded laterally and anteriorly. The anterior expansion occurred into the region of the pronephros adjacent to somites 1-5. This is surprising given that scl/tal1 and lmo2 are expressed in this region at the 10 somite stage (14 hpf). However, at the 6 somite stage (13 hpf), they are not expressed in this part of the PLM but are restricted to the PLM posterior to somite 6 (data not shown). Whether their more anterior expression at the 10-somite stage is a result of cell migration or de novo expression of scl/tal1 and lmo2 is currently unknown. Nevertheless, our data argue that premature/ectopic expression of scl/tal1 and lmo2 in the PLM adjacent to somites 1-5 is sufficient to induce ectopic erythropoiesis in a region of the embryo that normally forms the pronephros.
The lateral expansion occurred at the expense of the PND. We showed
previously that PND development was compromised in scl/tal1-injected
embryos, however, initial expression of the PND gene pax2.1 was
normal at the 10-somite stage and only displayed gaps by 22 hpf
(Gering et al., 1998
). In
contrast, in scl/tal1-lmo2-injected embryos, pax2.1 and
pax8 expression was already lost at the 10-somite stage. Thus,
Scl/Tal1 and Lmo2 together are affecting the PND-specific transcription
programme at a much earlier stage than Scl/Tal1 on its own. Loss of
pax2 and pax8 in the mouse completely abrogates pronephric
development (Bouchard et al.,
2002
). Interestingly, lim1 expression was not lost in the
PLM of scl/tal1-lmo2-injected embryos. In the mouse embryo,
lim1 appears to be a competence factor that marks the territory
competent for pronephric induction. Its expression is initially independent of
pax2/8 which is consistent with its continued expression in
scl/tal1-lmo2-injected zebrafish embryos. The continued expression of
lim1 further suggests that Scl/Tal1 and Lmo2 have no negative
influence on its expression and that lim1 expression does not
interfere with erythropoiesis.
Is endothelial differentiation the default fate of
haemangioblasts?
Scl/Tal1 and Lmo2 activated some but not all blood genes in the heart, head
and somitic mesoderm. In the absence of induction of the complete myeloid or
erythroid transcription programmes, blood cells did not develop from these
tissues. Instead, the cells first switched on flk1 and flt4,
later expressed tie1 and tie2 and eventually down-regulated
scl/tal1end. Thus, many Scl/Tal1-Lmo2-induced progenitors
appeared to differentiate into ECs, suggesting that endothelial development
may be the default fate of the haemangioblast.
A role for Lmo2 and Scl/Tal1 in specifying normal
haemangioblasts
Since yolk sac ECs develop in lmo2/
(Warren et al., 1994
;
Yamada et al., 2000
) and
scl/tal1/
(Elefanty et al., 1999
;
Visvader et al., 1998
) mice,
it would appear that Lmo2 and Scl/Tal1 are dispensible for angioblast
formation and only confer haematopoietic competence to the mesodermal tissue
they are expressed in. However, results from studies on
scl/tal1/ ES cells
(Chung et al., 2002
;
Faloon et al., 2000
;
Robertson et al., 2000
) and
the absence of contributions to adult haematopoiesis or angiogenesis by
lmo2-null ES cells in chimeric mice
(Yamada et al., 1998
;
Yamada et al., 2000
), suggest
that these proteins are needed for correctly programmed haemangioblast
formation. Haemangioblast-like BL-CFCs derived from ES cells are highly
enriched in the scl/tal1-positive fraction of Flk1+ cells
(Chung et al., 2002
), and
BL-CFCs do not form in the absence of a functional scl/tal1 gene
(Faloon et al., 2000
;
Robertson et al., 2000
).
Ubiquitous scl/tal1 expression in differentiating ES cells increases
the number of Flk1+ cells and subsequently the number of primitive
blood progenitors among the Flk1+ cells as well as the number of
VE-Cadherin+ definitive blood progenitors (haemogenic ECs)
(Endoh et al., 2002
).
scl/tal1 also negatively influences smooth muscle cell
differentiation from early ES cell-derived Flk1+ cells in favour of
more haemangioblasts (Ema et al.,
2003
). However, ECs do develop from
scl/tal1/ ES cells
(Faloon et al., 2000
;
Robertson et al., 2000
) and
from lmo2/ ES cells (M. M. McCormack and
T.H.R., unpublished) indicating that endothelial development from ES cells can
occur independently of haemangioblast formation and of lmo2 or
scl/tal1 expression. Yet, ECs formed in the absence of lmo2
or scl/tal1 are not normal as they fail to form a primary plexus or
undergo vascular remodelling in the embryo
(Elefanty et al., 1999
;
Visvader et al., 1998
;
Yamada et al., 2000
;
Yamada et al., 2002
). The
molecular basis of these defects is not known. Interestingly, rescue
experiments show that primitive as well as definitive HCs only form from
scl/tal1/ ES cells if Scl/Tal1 function is
restored at the stage when the cells are still of mesodermal character,
suggesting that even the haemogenic ECs that give rise to definitive HCs need
to have experienced scl/tal1 expression long before they give rise to
HCs (Endoh et al., 2002
).
These results suggest that the early lack of Lmo2 or Scl/Tal1 in the mesoderm
can have very late consequences in the endothelial lineage and the data
presented here support a model whereby these two factors cooperate to specify
normal haemangioblasts from early mesodermal progenitors.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Ambler, C. A., Nowicki, J. L., Burke, A. C. and Bautch, V. L. (2001). Assembly of trunk and limb blood vessels involves extensive migration and vasculogenesis of somite-derived angioblasts. Dev. Biol. 234,352 -364.[CrossRef][Medline]
Baer, R. (1993). TAL1, TAL2 and LYL1: a family of basic helix-loop-helix proteins implicated in T cell acute leukaemia. Semin. Cancer Biol. 4,341 -347.[Medline]
Beddington, R. S. and Martin, P. (1989). An in situ transgenic enzyme marker to monitor migration of cells in the mid-gestation mouse embryo. Somite contribution to the early forelimb bud. Mol. Biol. Med. 6,263 -274.[Medline]
Begemann, G. and Ingham, P. W. (2000). Developmental regulation of Tbx5 in zebrafish embryogenesis. Mech. Dev. 90,299 -304.[CrossRef][Medline]
Begley, C. G. and Green, A. R. (1999). The SCL
gene: From case report to critical hematopoietic regulator.
Blood 93,2760
-2770.
Bouchard, M., Souabni, A., Mandler, M., Neubuser, A. and
Busslinger, M. (2002). Nephric lineage specification by Pax2
and Pax8. Genes Dev. 16,2958
-2970.
Brown, L. A., Rodaway, A. R. F., Schilling, T. F., Jowett, T., Ingham, P. W., Patient, R. K. and Sharrocks, A. D. (2000). Insights into vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild type and mutant zebrafish embryos. Mech. Dev. 90,237 -252.[CrossRef][Medline]
Brownlie, A., Donovan, A., Pratt, S. J., Paw, B. H., Oates, A. C., Brugnara, C., Witkowska, H. E., Sassa, S. and Zon, L. I. (1998). Positional cloning of the zebrafish sauternes gene: a model for congenital sideroblastic anaemia. Nat. Genet. 20,244 -250.[CrossRef][Medline]
Chang, D. F., Belaguli, N. S., Iyer, D., Roberts, W. B., Wu, S. P., Dong, X. R., Marx, J. G., Moore, M. S., Beckerle, M. C., Majesky, M. W. et al. (2003). Cysteine-Rich LIM-only proteins CRP1 and CRP2 are potent smooth muscle differentiation cofactors. Dev. Cell 4,107 -118.[CrossRef][Medline]
Chen, J.-N. and Fishman, M. C. (1996). Zebrafish tinman homolog demarcates the heart field and initiates myocardial differentiation. Development 122,3809 -3816.[Abstract]
Choi, K., Kennedy, M., Kazarov, A., Papadimitriou, J. C. and Keller, G. (1998). A common precursor for hematopoietic and endothelial cells. Development 125,725 -732.[Abstract]
Chung, Y. S., Zhang, W. J., Arentson, E., Kingsley, P. D.,
Palis, J. and Choi, K. (2002). Lineage analysis of the
hemangioblast as defined by FLK1 and SCL expression.
Development 129,5511
-5520.
Detrich, H. W., Kieran, M. W., Chan, F. Y., Barone, L. M., Yee,
K., Rundstadler, J. K., Pratt, S., Ransom, D. and Zon, L. I.
(1995). Intraembryonic hematopoietic cell migration during
vertebrate development. Proc. Nat. Acad. Sci. USA
92,10713
-10717.
Drummond, I. A., Majumdar, A., Hentschel, H., Elger, M., Solnica-Krezel, L., Schier, A. F., Neuhauss, S. C., Stemple, D. L., Zwartkruis, F., Rangini, Z. et al. (1998). Early development of the zebrafish pronephros and analysis of mutations affecting pronephric function. Development 125,4655 -4667.[Abstract]
Elefanty, A. G., Begley, C. G., Hartley, L., Papaevangeliou, B.
and Robb, L. (1999). SCL expression in the mouse embryo
detected with a targeted lacZ reporter gene demonstrates its localization to
hematopoietic, vascular, and neural tissues. Blood
94,3754
-3763.
Ema, M., Faloon, P., Zhang, W. J., Hirashima, M., Reid, T.,
Stanford, W. L., Orkin, S., Choi, K. and Rossant, J. (2003).
Combinatorial effects of Flk1 and Tal1 on vascular and hematopoietic
development in the mouse. Genes Dev.
17,380
-393.
Endoh, M., Ogawa, M., Orkin, S. and Nishikawa, S. (2002). SCL/tal-1-dependent process determines a competence to select the definitive hematopoietic lineage prior to endothelial differentiation. EMBO J. 21,6700 -6708.[CrossRef][Medline]
Faloon, P., Arentson, E., Kazarov, A., Deng, C. X., Porcher, C., Orkin, S. and Choi, K. (2000). Basic fibroblast growth factor positively regulates hematopoietic development. Development 127,1931 -1941.[Abstract]
Fouquet, B., Weinstein, B. M., Serluca, F. C. and Fishman, M. C. (1997). Vessel patterning in the embryo of the zebrafish: Guidance by notochord. Dev. Biol. 183, 37-48.[CrossRef][Medline]
Gering, M., Rodaway, A. R. F., Gottgens, B., Patient, R. K. and Green, A. R. (1998). The SCL gene specifies haemangioblast development from early mesoderm. EMBO J. 17,4029 -4045.[CrossRef][Medline]
Goldfarb, A. N. and Lewandowska, K. (1995).
Inhibition of cellular differentiation by the SCL/tal oncoprotein:
transcriptional repression by an Id-like mechanism.
Blood 85,465
-471.
Grutz, G., Forster, A. and Rabbitts, T. H. (1998). Identification of the LMO4 gene encoding an interaction partner of the LIM-binding protein LDB1/NLI1: a candidate for displacement by LMO proteins in T cell acute leukaemia. Oncogene 17,2799 -2803.[CrossRef][Medline]
Hall, M. A., Curtis, D. J., Metcalf, D., Elefanty, A. G.,
Sourris, K., Robb, L., Gothert, J. R., Jane, S. and Begley, C. G.
(2003). The critical regulator of embryonic hematopoiesis, SCL,
is vital in the adult for megakaryopoiesis, erythropoiesis, and lineage choice
in CFU-S12. Proc. Natl. Acad. Sci. USA
100,992
-997.
Herblot, S., Steff, A. M., Hugo, P., Aplan, P. D. and Hoang, T. (2000). SCL and LMO1 alter thymocyte differentiation: inhibition of E2A-HEB function and pre-T alpha chain expression. Nat. Immunol. 1,138 -144.[CrossRef][Medline]
Herbomel, P., Thisse, B. and Thisse, C. (1999). Ontogeny and behaviour of early macrophages. Development 126,3735 -3745.[Abstract]
Hofmann, T. J. and Cole, M. D. (1996). The TAL1/Scl basic helix-loop-helix protein blocks myogenic differentiation and E-box dependent transactivation. Oncogene 13,617 -624.[Medline]
Hsu, H. L., Cheng, J. T., Chen, Q. and Baer, R.
(1991). Enhancer-binding activity of the tal-1 oncoprotein in
association with the E47/E12 helix-loop-helix proteins. Mol. Cell.
Biol. 11,3037
-3042.
Hsu, H. L., Wadman, I., Tsan, J. T. and Baer, R.
(1994). Positive and negative transcriptional control by the TAL1
helix-loop-helix protein. Proc. Natl. Acad. Sci. USA
91,5947
-5951.
Hsu, K., Kanki, J. P. and Look, A. T. (2001). Zebrafish myelopoiesis and blood cell development. Curr. Opin. Hematol. 8,245 -251.[CrossRef][Medline]
Jaffredo, T., Gautier, R., Eichmann, A. and Dieterlen-Lievre, F. (1998). Intraaortic hemopoietic cells are derived from endothelial cells during ontogeny. Development 125,4575 -4583.[Abstract]
Jaffredo, T., Gautier, R., Brajeul, V. and Dieterlen-Lievre, F. (2000). Tracing the progeny of the aortic hemangioblast. Dev. Biol. 224,204 -214.[CrossRef][Medline]
Joly, J. S., Joly, C., Schulte-Merker, S., Boulekbache, H. and Condamine, H. (1993). The ventral and posterior expression of the zebrafish homeobox gene eve1 is perturbed in dorsalized and mutant embryos. Development 119,1261 -1275.[Abstract]
Jowett, T. and Yan, Y. L. (1996). Double fluorescent in situ hybridization to zebrafish embryos. Trends Genet. 12,387 -389.[CrossRef][Medline]
Kalev-Zylinska, M. L., Horsfield, J. A., Flores, M. V., Postlethwait, J. H., Vitas, M. R., Baas, A. M., Crosier, P. S. and Crosier, K. E. (2002). Runx1 is required for zebrafish blood and vessel development and expression of a human RUNX1-CBF2T1 transgene advances a model for studies of leukemogenesis. Development 129,2015 -2030.
Keller, G. (2001). The Hemangioblast. In Stem Cell Biology (ed. D. R. Marshak R. L. Gardner and D. Gottlieb), pp. 329-348. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Kenny, D. A., Jurata, L. W., Saga, Y. and Gill, G. N.
(1998). Identification and characterization of LMO4, an LMO gene
with a novel pattern of expression during embryogenesis. Proc. Nat.
Acad. Sci. USA 95,11257
-11262.
Kobayashi, M., Nishikawa, K. and Yamamoto, M. (2001). Hematopoietic regulatory domain of gata1 gene is positively regulated by GATA1 protein in zebrafish embryos. Development 128,2341 -2350.
Krauss, S., Johansen, T., Korzh, V. and Fjose, A. (1991). Expression of the zebrafish paired box gene pax[zf-b] during early neurogenesis. Development 113,1193 -1206.[Abstract]
Larson, R. C., Lavenir, I., Larson, T. A., Baer, R., Warren, A. J., Wadman, I., Nottage, K. and Rabbitts, T. H. (1996). Protein dimerization between Lmo2 (Rbtn2) and Tal1 alters thymocyte development and potentiates T cell tumorigenesis in transgenic mice. EMBO J. 15,1021 -1027.[Medline]
Lecuyer, E., Herblot, S., Saint-Denis, M., Martin, R., Begley,
C. G., Porcher, C., Orkin, S. H. and Hoang, T. (2002). The
SCL complex regulates c-kit expression in hematopoietic cells through
functional interaction with Sp1. Blood
100,2430
-2440.
Liao, E. C., Paw, B. H., Oates, A. C., Pratt, S. J.,
Postlethwait, J. H. and Zon, L. I. (1998). SCL/Tal-1
transcription factor acts downstream of cloche to specify hematopoietic and
vascular progenitors in zebrafish. Genes Dev.
12,621
-626.
Liao, W., Bisgrove, B. W., Sawyer, H., Hug, B., Bell, B., Peters, K., Grunwald, D. J. and Stanier, D. Y. R. (1997). The zebrafish gene cloche acts upstream of a flk-1 homologue to regulate endothelial cell differentiation. Development 124,381 -389.[Abstract]
Lieschke, G. J., Oates, A. C., Paw, B. H., Thompson, M. A., Hall, N. E., Ward, A. C., Ho, R. K., Zon, L. I. and Layton, J. E. (2002). Zebrafish SPI-1 (PU.1) marks a site of myeloid development independent of primitive erythropoiesis: implications for axial patterning. Dev. Biol. 246,274 -295.[CrossRef][Medline]
Lyons, M. S., Bell, B., Stainier, D. and Peters, K. G. (1998). Isolation of the zebrafish homologues for the tie-1 and tie-2 endothelium-specific receptor tyrosine kinases. Dev. Dyn. 212,133 -140.[CrossRef][Medline]
Lyons, S. E., Lawson, N. D., Lei, L., Bennett, P. E., Weinstein,
B. M. and Liu, P. P. (2002). A nonsense mutation in zebrafish
gata1 causes the bloodless phenotype in vlad tepes. Proc. Natl.
Acad. Sci. USA 99,5454
-5459.
Mead, P. E., Deconinck, A. E., Huber, T. L., Orkin, S. H. and Zon, L. I. (2001). Primitive erythropoiesis in the Xenopus embryo: the synergistic role of LMO-2, SCL and GATA-binding proteins. Development 128,2301 -2308.
Mikkola, H. K., Klintman, J., Yang, H., Hock, H., Schlaeger, T. M., Fujiwara, Y. and Orkin, S. H. (2003). Haematopoietic stem cells retain long-term repopulating activity and multipotency in the absence of stem-cell leukaemia SCL/tal-1 gene. Nature 421,547 -551.[CrossRef][Medline]
Nishikawa, S.-I., Nishikawa, S., Hirashima, M., Matsuyoshi, N. and Kodama, H. (1998). Progressive lineage analysis by cell sorting and culture identifies FLK+VE-cadherin+ cells at a diverging point of endothelial and hemopoietic lineages. Development 125,1747 -1757.[Abstract]
North, T. E., de Bruijn, M. F., Stacy, T., Talebian, L., Lind, E., Robin, C., Binder, M., Dzierzak, E. and Speck, N. A. (2002). Runx1 expression marks long-term repopulating hematopoietic stem cells in the midgestation mouse embryo. Immunity 16,661 -672.[CrossRef][Medline]
Oberlin, E., Tavian, M., Blazsek, I. and Peault, B.
(2002). Blood-forming potential of vascular endothelium in the
human embryo. Development
129,4147
-4157.
Osada, H., Grutz, G., Axelson, H., Forster, A. and Rabbitts, T.
H. (1995). Association of erythroid transcription factors:
Complexes involving the LIM protein RBTN2 and the zinc-finger protein GATA-1.
Proc. Natl. Acad. Sci. USA
92,9585
-9589.
Pardanaud, L., Luton, D., Prigent, M., Bourcheix, L.-M., Catala, M. and Dieterlen-Lievre, F. (1996). Two distinct endothelial lineages in ontogeny, one of them related to hemopoiesis. Development 122,1363 -1371.[Abstract]
Pfeffer, P. L., Gerster, T., Lun, K., Brand, M. and Busslinger, M. (1998). Characterization of three novel members of the zebrafish Pax2/5/8 family: dependency of Pax5 and Pax8 expression on the Pax2.1 (noi) function. Development 125,3063 -3074.[Abstract]
Porcher, C., Swat, W., Rockwell, K., Fujiwara, Y., Alt, F. W. and Orkin, S. H. (1996). The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all haematopoietic lineages. Cell 86,47 -57.[CrossRef][Medline]
Quinkertz, A. and Campos-Ortega, J. A. (1999). A new beta-globin gene from the zebrafish, beta(E1), and its pattern of transcription during embryogenesis. Dev. Genes Evol. 209,126 -131.[CrossRef][Medline]
Rabbitts, T. H. (1998). LMO T-cell
translocation oncogenes typify genes activated by chromosomal translocations
that alter transcription and developmental processes. Genes
Dev. 12,2651
-2657.
Reiter, J., Alexander, J., Rodaway, A., Yelon, D., Patient, R.,
Holder, N. and Stainier, D. (1999). Gata5 is required for the
development of the heart and endoderm in zebrafish. Genes
Dev. 13,2983
-2995.
Reiter, J. F., Kikuchi, Y. and Stainier, D. Y. R. (2001). Multiple roles for Gata5 in zebrafish endoderm formation. Development 128,125 -135.[Abstract]
Rekhtman, N., Radparvar, F., Evans, T. and Skoultchi, A. I.
(1999). Direct interaction of hematopoietic transcription factors
PU.1 and GATA-1: functional antagonism in erythroid cells. Genes
Dev. 13,1398
-1411.
Robb, L., Lyons, I., Li, R. L., Hartley, L., Kontgen, F.,
Harvey, R. P., Meytcalf, D. and Begley, C. G. (1995). Absence
of yolk-sac hematopoiesis from mice with a targeted disruption of the SCL
gene. Proc. Natl. Acad. Sci. USA
92,7075
-7079.
Robb, L., Elwood, N. J., Elefanty, A. G., Kontgen, F., Li, R., Barnett, L. D. and Begley, C. G. (1996). The scl gene product is required for the generation of all haematopoietic lineages in the adult mouse. EMBO J. 15,4123 -4129.[Medline]
Robertson, S. M., Kennedy, M., Shannon, J. M. and Keller, G. (2000). A transitional stage in the commitment of mesoderm to hematopoiesis requiring the transcription factor SCL/tal-1. Development 127,2447 -2459.[Abstract]
Rodaway, A. R. F., Takeda, H., Koshida, S., Price, B. M. J., Smith, J. C., Patient, R. K. and Holder, N. (1999). Induction of the mesendoderm in the zebrafish germ ring by yolk cell derived TGF-ß family signals and discrimination of mesoderm and endoderm by FGF. Development 126,3067 -3078.[Abstract]
Roman, B. L. and Weinstein, B. M. (2000). Building the vertebrate vasculature: research is going swimmingly. BioEssays 22,882 -893.[CrossRef][Medline]
Rubenstein, A., Merriam, J. and Klymkowsky, M. W. (1997). Localizing the adhesive and signaling functions of plakoglobin. Dev. Dyn. 20, 91-102.
Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertenstein, M., Wu, X. F., Breitman, M. L. and Schuh, A. C. (1995). Failure of blood-island formation and vasculogenesis in Flk-1 deficient mice. Nature 376,62 -66.[CrossRef][Medline]
Shivdasani, R., Mayer, E. and Orkin, S. H. (1995). Absence of blood formation in mice lacking the T-cell leukemia oncoprotein tal-1/SCL. Nature 373,432 -434.[CrossRef][Medline]
Stainier, D. Y. R., Weinstein, B. M., Detrich, H. W., Zon, L. I. and Fishman, M. C. (1995). cloche, an early acting zebrafish gene, is required by both the endothelial and hematopoietic lineages. Development 121,3141 -3150.[Abstract]
Sumoy, L., Keasey, J. B., Dittman, T. D. and Kimelman, D. (1997). A role for notochord in axial vascular development revealed by analysis of phenotype and the expression of VEGR-2 in zebrafish flh and ntl mutant embryos. Mech. Dev. 63, 15-27.[CrossRef][Medline]
Sykes, T. G., Rodaway, A. R. F., Walmsley, M. E. and Patient, R. K. (1998). Suppression of GATA factor activity causes axis duplication in Xenopus. Development 125,4595 -4605.
Theze, N., Hardy, S., Wilson, R., Allo, M. R., Mohun, T. and Thiebaud, P. (1995). The MLC1f/3f gene is an early marker of somitic muscle differentiation in Xenopus laevis embryo. Dev. Biol. 171,352 -362.[CrossRef][Medline]
Thompson, M. A., Ransom, D. G., Pratt, S. J., MacLennan, H., Kieran, M. W., Detrich, H. W., Vail, B., Huber, T. L., Paw, B., Brownlie, A. J. et al. (1998). The cloche and spadetail genes differentially affect hematopoiesis and vasculogenisis. Dev. Biol. 197,248 -269.[CrossRef][Medline]
Valge-Archer, V. E., Osada, H., Warren, A. J., Forster, A., Li,
J., Rabbitts, T. H. and Baer, R. (1994). The LIM protein
RBTN2 and the basic helix-loop-helix protein TAL1 are present in a complex in
erythroid cells. Proc. Natl. Acad. Sci. USA
91,8617
-8621.
Visvader, J. E., Fujiwara, Y. and Orkin, S. H.
(1998). Unsuspected role for the T-cell leukemia protein
SCL/tal-1 in vascular development. Genes Dev.
12,473
-479.
Vitelli, L., Condorelli, G., Lulli, V., Hoang, T., Luchetti, L.,
Croce, C. M. and Peschle, C. (2000). A pentamer
transcriptional complex including tal-1 and retinoblastoma protein
downmodulates c-kit expression in normal erythroblasts. Mol. Cell.
Biol. 20,5330
-5342.
Wadman, I., Li, J. X., Bash, R. O., Forster, A., Osada, H., Rabbitts, T. and Baer, R. (1994). Specific in-vivo association between the bHLH and LIM proteins implicated in human t-cell leukaemia. EMBO J. 13,4831 -4839.[Medline]
Wadman, I. A., Osada, H., Grutz, G. G., Agulnick, A. D., Westphal, H., Forster, A. and Rabbitts, T. H. (1997). The LIM-only protein Lmo2 is a bridging molecule assembling an erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and Ldb1/NLI proteins. EMBO J. 16,3145 -3157.[CrossRef][Medline]
Warren, A. J., Colledge, W. H., Carlton, M. B. L., Evans, M. J., Smith, A. J. H. and Rabbitts, T. H. (1994). The oncogenic cysteine-rich lim domain protein rbtn2 is essential for erythroid development. Cell 78,45 -57.[CrossRef][Medline]
Weber, H., Symes, C., Walmsley, M. E., Rodaway, A. R. F. and Patient, R. K. (2000). A role for GATA5 in Xenopus endoderm specification. Development 127,4345 -4360.[Abstract]
Weidinger, G., Wolke, U., Koprunner, M., Thisse, C., Thisse, B.
and Raz, E. (2002). Regulation of zebrafish primordial germ
cell migration by attraction towards an intermediate target.
Development 129,25
-36.
Westerfield, M. (1993). The Zebrafish Book: A Guide for the Laboratory use of Zebrafish (Brachydanio rerio). Eugene, OR: University of Oregon Press.
Wilting, J., Brand-Saberi, B., Huang, R., Zhi, Q., Köntges, G., Ordahl, C. P. and Christ, B. (1995). Angiogenic potential of the avian somite. Dev. Dyn. 202,165 -171.[Medline]
Xu, Y. H. J., Wang, X., Lim, T. M. and Gong, Z. (2000). Asynchronous activation of 10 muscle-specific protein (MSP) genes during zebrafish somitogenesis. Dev. Dyn. 219,201 -215.[CrossRef][Medline]
Yamada, Y., Warren, A. J., Dobson, C., Forster, A., Pannell, R.
and Rabbitts, T. H. (1998). The T cell leukemia LIM protein
Lmo2 is necessary for adult mouse hematopoiesis. Proc. Natl. Acad.
Sci. USA 95,3890
-3895.
Yamada, Y., Pannell, R., Forster, A. and Rabbitts, T. H.
(2000). The oncogenic LIM-only transcription factor Lmo2
regulates angiogenesis but not vasculogenesis in mice. Proc. Natl.
Acad. Sci. USA 97,320
-324.
Yamada, Y., Pannell, R., Forster, A. and Rabbitts, T. H. (2002). The LIM-domain protein Lmo2 is a key regulator of tumour angiogenesis: a new anti-angiogenesis drug target. Oncogene 21,1309 -1315.[CrossRef][Medline]
Yelon, D., Horne, S. A. and Stainier, D. Y. (1999). Restricted expression of cardiac myosin genes reveals regulated aspects of heart tube assembly in zebrafish. Dev. Biol. 214,23 -37.[CrossRef][Medline]
Zhang, P., Zhang, X., Iwama, A., Yu, C., Smith, K. A., Mueller,
B. U., Narravula, S., Torbett, B. E., Orkin, S. H. and Tenen, D. G.
(2000). PU.1 inhibits GATA-1 function and erythroid
differentiation by blocking GATA-1 DNA binding. Blood
96,2641
-2468.
Zhong, T. P., Childs, S., Leu, J. P. and Fishman, M. C. (2001). Gridlock signalling pathway fashions the first embryonic artery. Nature 414,216 -220.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S.-W. Jin and C. Patterson The Opening Act: Vasculogenesis and the Origins of Circulation Arterioscler. Thromb. Vasc. Biol., May 1, 2009; 29(5): 623 - 629. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Peterkin, A. Gibson, and R. Patient Common genetic control of haemangioblast and cardiac development in zebrafish Development, May 1, 2009; 136(9): 1465 - 1474. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Cimato, J. Beers, S. Ding, M. Ma, J. P. McCoy, M. Boehm, and E. G. Nabel Neuropilin-1 Identifies Endothelial Precursors in Human and Murine Embryonic Stem Cells Before CD34 Expression Circulation, April 28, 2009; 119(16): 2170 - 2178. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Liu and R. Patient Genome-Wide Analysis of the Zebrafish ETS Family Identifies Three Genes Required for Hemangioblast Differentiation or Angiogenesis Circ. Res., November 7, 2008; 103(10): 1147 - 1154. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-T. Huang and L.I. Zon Regulation of Stem Cells in the Zebra Fish Hematopoietic System Cold Spring Harb Symp Quant Biol, November 6, 2008; (2008) sqb.2008.73.029v1. [Abstract] [PDF] |
||||
![]() |
S. P. Mudumana, D. Hentschel, Y. Liu, A. Vasilyev, and I. A. Drummond odd skipped related1 reveals a novel role for endoderm in regulating kidney versus vascular cell fate Development, October 15, 2008; 135(20): 3355 - 3367. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-W. Xiong, Q. Yu, J. Zhang, and J. D. Mably An Acyltransferase Controls the Generation of Hematopoietic and Endothelial Lineages in Zebrafish Circ. Res., May 9, 2008; 102(9): 1057 - 1064. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sumanas, G. Gomez, Y. Zhao, C. Park, K. Choi, and S. Lin Interplay among Etsrp/ER71, Scl, and Alk8 signaling controls endothelial and myeloid cell formation Blood, May 1, 2008; 111(9): 4500 - 4510. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Carradice and G. J. Lieschke Zebrafish in hematology: sushi or science? Blood, April 1, 2008; 111(7): 3331 - 3342. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cermenati, S. Moleri, S. Cimbro, P. Corti, L. Del Giacco, R. Amodeo, E. Dejana, P. Koopman, F. Cotelli, and M. Beltrame Sox18 and Sox7 play redundant roles in vascular development Blood, March 1, 2008; 111(5): 2657 - 2666. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kobayashi and M. Yamamoto Regulation of GATA1 Gene Expression J. Biochem., July 1, 2007; 142(1): 1 - 10. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Xu, X. Meng, Y. Cai, H. Liang, L. Nagarajan, and S. J. Brandt Single-stranded DNA-binding proteins regulate the abundance of LIM domain and LIM domain-binding proteins Genes & Dev., April 15, 2007; 21(8): 942 - 955. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Deleuze, E. Chalhoub, R. El-Hajj, C. Dohet, M. Le Clech, P.-O. Couraud, P. Huber, and D. Mathieu TAL-1/SCL and Its Partners E47 and LMO2 Up-Regulate VE-Cadherin Expression in Endothelial Cells Mol. Cell. Biol., April 1, 2007; 27(7): 2687 - 2697. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Patterson, M. Gering, C. E. Eckfeldt, A. R. Green, C. M. Verfaillie, S. C. Ekker, and R. Patient The transcription factors Scl and Lmo2 act together during development of the hemangioblast in zebrafish Blood, March 15, 2007; 109(6): 2389 - 2398. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ema, T. Yokomizo, A. Wakamatsu, T. Terunuma, M. Yamamoto, and S. Takahashi Primitive erythropoiesis from mesodermal precursors expressing VE-cadherin, PECAM-1, Tie2, endoglin, and CD34 in the mouse embryo Blood, December 15, 2006; 108(13): 4018 - 4024. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Alt, O. A. Elsalini, P. Schrumpf, N. Haufs, N. D. Lawson, G. C. Schwabe, S. Mundlos, A. Gruters, H. Krude, and K. B. Rohr Arteries define the position of the thyroid gland during its developmental relocalisation. Development, October 1, 2006; 133(19): 3797 - 3804. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, J.-W. Xiong, C. S. Shelley, H. Park, and M. A. Arnaout The transcription factor ZBP-89 controls generation of the hematopoietic lineage in zebrafish and mouse embryonic stem cells Development, September 15, 2006; 133(18): 3641 - 3650. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gupta, H. Zhu, L. I. Zon, and T. Evans BMP signaling restricts hemato-vascular development from lateral mesoderm during somitogenesis Development, June 1, 2006; 133(11): 2177 - 2187. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Priddle, D. R. E. Jones, P. W. Burridge, and R. Patient Hematopoiesis from Human Embryonic Stem Cells: Overcoming the Immune Barrier in Stem Cell Therapies Stem Cells, April 1, 2006; 24(4): 815 - 824. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ema, S. Takahashi, and J. Rossant Deletion of the selection cassette, but not cis-acting elements, in targeted Flk1-lacZ allele reveals Flk1 expression in multipotent mesodermal progenitors Blood, January 1, 2006; 107(1): 111 - 117. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Juarez, F. Su, S. Chun, M. J. Kiel, and S. E. Lyons Distinct Roles for SCL in Erythroid Specification and Maturation in Zebrafish J. Biol. Chem., December 16, 2005; 280(50): 41636 - 41644. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Schuh, A. J. Tipping, A. J. Clark, I. Hamlett, B. Guyot, F. J. Iborra, P. Rodriguez, J. Strouboulis, T. Enver, P. Vyas, et al. ETO-2 Associates with SCL in Erythroid Cells and Megakaryocytes and Provides Repressor Functions in Erythropoiesis Mol. Cell. Biol., December 1, 2005; 25(23): 10235 - 10250. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Saito, Y. Tabata, A. Muto, K.-i. Arai, and S. Watanabe Melk-Like Kinase Plays a Role in Hematopoiesis in the Zebra Fish Mol. Cell. Biol., August 1, 2005; 25(15): 6682 - 6693. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Weber, S. E. Choe, K. A. Dooley, N. N. Paffett-Lugassy, Y. Zhou, and L. I. Zon Mutant-specific gene programs in the zebrafish Blood, July 15, 2005; 106(2): 521 - 530. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. D'Souza, A. G. Elefanty, and G. Keller SCL/Tal-1 is essential for hematopoietic commitment of the hemangioblast but not for its development Blood, May 15, 2005; 105(10): 3862 - 3870. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Patterson, M. Gering, and R. Patient Scl is required for dorsal aorta as well as blood formation in zebrafish embryos Blood, May 1, 2005; 105(9): 3502 - 3511. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Schlaeger, A. Schuh, S. Flitter, A. Fisher, H. Mikkola, S. H. Orkin, P. Vyas, and C. Porcher Decoding Hematopoietic Specificity in the Helix-Loop-Helix Domain of the Transcription Factor SCL/Tal-1 Mol. Cell. Biol., September 1, 2004; 24(17): 7491 - 7502. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||