|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 November 2003
doi: 10.1242/dev.00874
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Genetics, University of Cambridge, Downing Street, Cambridge, CB2 3EH, UK
* Author for correspondence (e-mail: bs251{at}mole.bio.cam.ac.uk)
Accepted 2 September 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Dally, Wingless, heparan sulphate proteoglycan, signal transduction, RNA interference
| Introduction |
|---|
|
|
|---|
One avenue of research is to identify the protein cores of HSPGs that are
required for each signalling pathway. Two types of proteoglycans bear the
majority of heparan sulphate chains at the cell surface: the syndecans and the
glypicans (Bernfield et al.,
1999
). Mutations in the latter produce developmental defects in
mice, zebrafish and Drosophila, making glypicans good candidates for
having a role in signalling (Bernfield et
al., 1999
; Perrimon and
Bernfield, 2000
; Selleck,
2000
; Song and Filmus,
2002
). Glypicans are glycosylphosphatidylinositol (GPI)-anchored
proteins, which are thought to be permanently glycanated, and that carry
several heparan sulphate chains linked to serine residues adjacent to the
plasma membrane. The Drosophila genome contains two glypicans:
dally and dally-like (dlp). Dally has been implicated in the
regulation of Wg and Dpp signalling, and Dlp in the regulation of Wg
signalling (Jackson et al.,
1997
; Lin and Perrimon,
1999
; Tsuda et al.,
1999
; Baeg et al.,
2001
).
We have tested the requirement of the two Drosophila glypicans for
Wg and Hh signalling in the embryonic epidermis. Wg is a secreted glycoprotein
that activates the receptors Frizzled and Frizzled2, which then turn on a
downstream signalling cascade leading to the activation or repression of
target genes (Wodarz and Nusse,
1998
). The full-length Hh protein undergoes an autocatalytic
processing in the secreting cells and is further modified by addition of two
lipids, a cholesterol and a palmitoyl moiety. Hh binds its receptor Patched
(Ptc) on the receiving cells, and this relieves Ptc inhibition on another
transmembrane protein, Smoothened (Smo), which in turn transduces the Hh
signal (Ingham and McMahon,
2001
). Wg and Hh are expressed in stripes in the embryonic
segments and their functions in epidermal patterning are now well understood
(Martinez Arias, 1993
;
Hatini and Dinardo, 2001
;
Sanson, 2001
). Early in
embryogenesis, Wg is required to maintain the transcription of
engrailed (en) in adjoining cells. Once the expression of
en becomes independent of Wg, around stage 11, Wg is required for the
specification of cells that secrete a smooth or 'naked' cuticle, through the
repression of the gene shavenbaby. The en-expressing cells
secrete Hh, which in turn is required to maintain the transcription of
wg, its main target in the epidermis. Thus wg, en and
hh form a regulatory loop in the embryonic epidermis and loss of Wg
or Hh signalling leads to the loss of expression of all three genes,
generating an identical phenotype at the end of embryogenesis. This
characteristic segment polarity phenotype results from the simultaneous loss
of polarity within each segment and the loss of naked cuticle
(Fig. 1). Importantly, embryos
without maternal and zygotic sgl, sfl, ttv or frc exhibit
this phenotype (Binari et al.,
1997
; Hacker et al.,
1997
; Haerry et al.,
1997
; Lin and Perrimon,
1999
; The et al.,
1999
; Selva et al.,
2001
; Goto et al.,
2001
). Also, RNA interference (RNAi) against dlp or
dally generates embryos with weak segment polarity phenotypes
(Lin and Perrimon, 1999
;
Tsuda et al., 1999
;
Baeg et al., 2001
). Because
these phenotypes can result from either a loss of Hh or Wg, it has been
difficult to analyse the requirement of these genes in embryonic patterning.
To circumvent this problem, we used heterologous expression to uncouple Wg and
Hh signalling in the embryonic epidermis, and tested the requirement of the
Drosophila glypicans for these two pathways. Since no null mutations
are available for dally and dlp, we took advantage of RNA
interference to silence the function of both genes in embryos.
|
| Materials and methods |
|---|
|
|
|---|
We used the UAS/Gal4 system to drive ectopic expression
(Brand and Perrimon, 1993
). All
overexpression experiments were carried out at 25°C. The transgenic
strains used were: armGal411, armGal4<FRT<VP16 and KB19
(Sanson et al., 1996
), simGal4
(Golembo et al., 1996
), UASwg
(Lawrence et al., 1996
), UAShh
(Fietz et al., 1995
), UAShh-N
(Porter et al., 1996
), UASdlp
(Baeg et al., 2001
), UASnuclacZ
(Mark Muskavitch, Indiana University, USA), ftzlacZ (Jean Paul Vincent, Mill
Hill, UK).
Genotypes of embryos are as follow: armGal4; UASwg (Fig. 3B,C), simGal4; simGal4/UASwg (Fig. 3D-F), armGal4; UAShh (Fig. 4B,C), simGal4/UASnuclacZ; simGal4 (Fig. 4D), simGal4; simgal4/UAShh (Fig. 4E,F), armGal4; UAShh-N (Fig. 5A,C), UAShh-N; armGal4; hhAC/hhAC.ftzLacZ (Fig. 5B) UAShh-N; simGal4; simGal4 (Fig. 5D,F), UAShh-N; simGal4; hhAC/hhAC.ftzlacZ (Fig. 5E), armGal4VP16/UASdlp (Fig. 6A), enGal4; UAShh (Fig. 6B), enGal4; UAShh-N (Fig. 6C), ptcIIW/ptcIIW (Fig. 6D,E), ptcIIW/CyOftzlacZ (Fig. 6F).
|
|
|
|
RNA interference
For the synthesis of dsRNA, small regions of the plasmids pBS(KS)dlp
(Baeg et al., 2001
) and
pBS(KS)-dally (Nakato et al.,
1995
) were amplified by PCR with primers pairs containing a T7
promoter sequence at the 5' end (5'TAATACGACTCACTATAGG3').
The PCR products were used as templates for T7 transcription reactions with
the Ribomax Large Scale Production kit (Roche). In these reactions, the two
strands of RNA self-anneal. The dsRNA was extracted with phenol/choloroform,
precipitated with ethanol and resuspended in injecting buffer. The
concentration of dsRNA was evaluated on 1% agarose gel before and after
extraction, and the volume of injection buffer adjusted to have a final
concentration of about 5 µg/µl. Two dsRNA were prepared for silencing
dlp (CG32146, NCBI accession noAE003554): 326 nucleotides (nt) from
position 169 (primers 5'ACCATGTTGCACTTCAA3' and
5'CTGCAATGCAGATGTTGT3'), 364nt from position 37772 (primers
5'AAGAATCCGCTCATCCACAC3' and
5'AATTTTGGACTCGCATTTCG3'). Three dsRNA were prepared for silencing
dally (CG4974, NCBI accession noAE003533): 333nt from position 372
(primers 5'GCTCTCTCTTCGACCACCAC3' and
5'CAGACACAGTGGATGATGGG3'), 394nt from position 59157 (primers
5'TGACTTGCACGAGGACTACG3' and
5'ATGGGTGGTGACCAGATTGT3'), and 303nt from position 61246 (primers
5'TAGCCAGCGATATAATCCCG3' and
5'GACTCCACTTCGTTGGTGGT3'). All sequences were submitted to BLAST
and chosen to minimise the homology with other sequences. Injections were
initially performed with each sequence to ensure that the results obtained
were reproducible (see Table
1). The 3' dsRNA sequences for both dlp and
dally were then used for subsequent RNAi experiments. For injection
of both dsRNA (Fig. 3F), 5
µg/µl dally 3' dsRNA was mixed in a 1:1 ratio with 5
µg/µl dlp 3' dsRNA.
|
RT-PCR
The RNAi efficiency was estimated by measuring endogenous mRNA levels using
semiquantitative RT-PCR. Total RNA was isolated from batches of 60 injected
embryos, after washing them with heptane to remove the Voltalef oil. The large
number of embryos used in an extract was to ensure that the whole range of
phenotypes observed with RNAi would be represented. Embryos were homogenised
in 300 µl Trizol + 0.2 µg Linear Polyacrylamide as a carrier (Sigma),
followed by chloroform extraction and isopropanol precipitation. Extracted RNA
was resuspended in 30 µl water, and 10 µl were used for reverse
trancription, priming with oligo(dT). Reverse transcription reactions (20
µl) contained 10 µl RNA extract, 1 µl oligo(dT) 10 µM, 4 µl
Superscript buffer, 2 µl DTT 0.1 M, 2 µl dNTPs 10 mM, 0.5 µl RNasout
and 0.5 µl Superscript Reverse Transcriptase (all reagents are from
Invitrogen, unless specified). After incubation for 1 hour at 42°C, the
reactions were stopped by heating for 10 minutes at 65°C. PCR reactions
(50 µl) used 1 µl of the reverse transcription reaction (which
corresponds to 1 embryo equivalent of cDNA) and contained 5 µl 10x
PCR buffer, 1 µl dNTPs 20 mM, TaqPlus polymerase 0.5 µl (Stratagene) and
2.5 µl of each primer (10 µM). Samples were denaturated for 2 minutes at
94°C before cycling 30 times 1 minute at 55°C, 1 minute 30 seconds at
72°C and 30 seconds at 94°C. Primers used were:
5'AGCAAAACAATCGCGACG3' and 5'GCCATTTGAGCTGTTTGC3' for
dlp (301nt product from positions 49658 to 59016). and
5'ATTTGCGGCGGAAACTG3' and 5'TGGCCATTGCTGTTCGTA3' for
dally (305nt product from positions 37011 to 37354). 10 µl of each
PCR reaction were resolved on 1% agarose gel stained with ethidium bromide,
and quantification was done using the AlphaImager imaging system. Reactions
with increasing numbers of cycles were initially run to determine the
geometric phase: we could detect a geometric increase of PCR products between
25 and 35 cycles for both primer pairs, thus we used 30 cycles for subsequent
RT-PCR reactions.
Embryo preparations
For in situ hybridisation, embryos were fixed and hybridised with
digoxigenin or fluoresceine-labelled single stranded RNA probes as described
by Jowett (Jowett, 1997
),
except that no proteinase K treatment was performed. wg, en and
rho cDNAs were a gift from J. P. Vincent, and lacZ a gift
from V. Morel.
Immunochemistry was done according to standard protocols. Primary
antibodies used were mouse anti-En (1:50) (Hybridoma Bank) and rabbit anti-Dlp
(1:50) (Baeg et al., 2001
).
For cuticle preparations, embryos were mounted in Hoyer's/lactic acid (1:1) and visualised with dark-field microscopy.
| Results |
|---|
|
|
|---|
To check the efficiency of the RNAi, we used semiquantitative RT-PCR to monitor the levels of dally or dlp mRNAs in injected embryos. Total RNA was extracted from batches of 60 injected embryos after 7 hours of development (stage 11/12), and the derived cDNAs were amplified by PCR using oligonucleotide pairs targeting a 300 nt sequence just upstream of the 3' dsRNA sequences (Fig. 1D). RT-PCR on extracts from buffer-injected embryos detected similar mRNA levels for dally and dlp (Fig. 1E). RT-PCR on extracts from embryos injected with the 3' dsRNA sequence of dally showed a strong reduction of dally mRNA as expected, while dlp mRNA levels were unchanged (Fig. 1E). The converse is true for RT-PCR on extracts of embryos injected with the 3' dsRNA sequence of dlp: dlp, but not dally, mRNA levels were strongly reduced (Fig. 1E). This demonstrates that RNAi efficiently silences both dally and dlp, and also that RNAi directed at one gene does not affect the other.
These results show that RNAi silencing of dlp produces a severe
and penetrant segment polarity phenotype. Since dlp mRNA is produced
maternally as well as zygotically (Khare
and Baumgartner, 2000
), the strength of the phenotype suggests
that injection of dsRNA inactivates both pools of mRNA. The full phenotype is
identical to wg or hh loss-of-function phenotypes in embryos
(compare Fig. 1I with B,C). Previous work reported weaker segment polarity phenotypes in the cuticle
following dlp RNAi (Baeg et al.,
2001
). A possibility is that the use of small dsRNA sequences
(300-400nt) in our study, rather than dsRNA corresponding to larger parts of
the gene, allowed us to inject higher concentrations of dsRNA, and as a
consequence to obtain stronger phenotypes.
In contrast to previous reports (Lin
and Perrimon, 1999
; Tsuda et
al., 1999
; Baeg et al.,
2001
), we did not obtain any segment polarity phenotypes with
dally RNAi, despite testing three different dsRNA sequences and using
a high concentration of dsRNA. Furthermore, the RT-PCR controls show that
dally had been efficiently silenced in our experiments. A possible
explanation for this discrepancy is that, in previous studies, the use of a
dsRNA corresponding to large sequences of dally had resulted in
partial silencing of dlp, because of small regions of sequence
homology.
dally-like RNAi mimics hedgehog loss of function in
the embryonic epidermis
All mutations that give strong segment polarity phenotypes disrupt either
Wg or Hh signalling, leading to a loss of en expression at
mid-embryogenesis. Wg is required to maintain the expression of en
across the parasegmental boundary, whereas Hh is secreted by the en
cells, and in turn maintains wg expression
(Fig. 2E)
(Martinez Arias, 1993
). In
wg null mutant embryos, En protein disappears completely from the
ectoderm of the trunk by stage 11 (Fig.
2B). In a hh null mutant, En starts disappearing at stage
11 and is mostly gone at stage 12 (Fig.
2C,H). In dlp RNAi embryos, En starts to be lost at stage
11, and by late stage 12 only patches of En remain in the ectoderm
(Fig. 2D,I). The timing of the
loss of En resembles that of a hh null mutant rather than a
wg null mutant. In contrast, dally RNAi embryos did not show
any defects in the pattern of En (data not shown).
|
RNAi silencing of dlp and dally do not inhibit Wg
signalling
To uncouple the regulatory loop between Wg and Hh signalling in embryos, we
expressed UASwg under the control of two Gal4 drivers, armadillo-Gal4
(armGal4) and singleminded-Gal4 (simGal4), and looked at two different targets
of Wg signalling: the transcription of en and the specification of
naked cuticle. ArmGal4 drives expression ubiquitously
(Sanson et al., 1996
), and
simGal4 drives expression in the ventral midline
(Golembo et al., 1996
). As Wg
specifies naked cuticle in most segments through the repression of the
zinc-finger transcription factor shavenbaby
(Payre et al., 1999
), the
secretion of naked cuticle gives a convenient read-out of Wg signalling
activity (Lawrence et al.,
1996
; Sanson et al.,
1999
).
In armGal4/UASwg embryos, en transcription was enlarged from a stripe about two cells wide to a stripe spanning about half a segment, which coincided with the domain of competence for en transcription (Fig. 3A,B). In armGal4/UASwg [dlp RNAi] embryos, en ectopic expression is unaffected (Fig. 3C). Expression using simGal4 allows the examination of non cell-autonomous signalling, because Wg is secreted by the midline cells and acts on the adjoining epidermal cells. In simGal4/UASwg embryos, cells specified naked cuticle in the ectoderm a few cell diameters away on either sides of the midline (Fig. 3D). We could not look at en transcription in this experiment because simGal4 expression starts at stage 11, when en expression has become independent of Wg signalling. In simGal4/UASwg [dlp RNAi] embryos, naked cuticle specification was unaffected around the midline (Fig. 3E). The epidermis also exhibited a strong segment polarity phenotype lateral to the stripe of naked cuticle, demonstrating that dlp has been silenced efficiently and thus providing an internal control for the experiment. Together, the simGal4 and armGal4 experiments suggest that Dlp is not required for Wg signalling in the embryo.
It is possible that Dally and Dlp function redundantly in Wg signalling in embryos. To test this, we injected dally and dlp 3' dsRNAs together into simGal4/UASwg embryos. As for the injection of dlp dsRNA alone, a segment polarity phenotype was produced in the lateral domain (Fig. 3F). However, the stripe of naked cuticle at the ventral midline was unaffected, showing that silencing both dally and dlp is not sufficient to inhibit Wg signalling in embryos. As a control, we also injected dally 3' dsRNA into simGal4/UASwg embryos, and found that no segment polarity phenotype could be detected in the lateral domain, as expected, and that the formation of naked cuticle was unaffected at the midline (not shown). These experiments suggest that dally and dlp are dispensable for Wg signalling in embryos, and that they do not function redundantly in this pathway.
Dally-like is required for Hedgehog signalling
Since dlp RNAi gives a strong segment polarity phenotype but does
not affect Wg signalling, it is probable that Dlp is required for either Hh
transcription or Hh signalling. To test this, we expressed Hh ubiquitously
with armGal4, and used the activation of wg transcription as a
read-out of Hh signalling. In armGal4/UAShh embryos, wg expression
was enlarged from a stripe one cell wide to a stripe covering about half a
segment, which corresponded to the domain of competence for wg
transcription (Fig. 4A,B). In
armGal4/UAShh embryos injected with dlp dsRNA, both ectopic and
endogenous wg expression were lost at stage 11
(Fig. 4C). We also looked at
the non cell-autonomous effect of Hh, expressing UAShh under the control of
simGal4 (Fig. 4D). In
simGal4/UAShh embryos, Hh activated the transcription of wg in the
ectoderm, a few cell diameters on either side of the midline, within the
wg competence domain of each segment
(Fig. 4E). In simGal4/UAShh
[dlp RNAi] embryos, both endogenous and ectopic wg expression were
lost at stage 11 (Fig. 4F).
Since dlp RNAi does not affect the activity of the armGal4 and
simGal4 drivers (see previous section), these experiments demonstrate that Dlp
is required for Hh signalling.
Dally-like is required downstream of Hedgehog processing
Dlp could be required either for Hh secretion from the signalling cells,
for Hh movement, or for Hh signal transduction. In the secreting cells, Hh
undergoes an intramolecular cleavage which is catalysed by the C terminus of
the protein. The liberated N-terminal fragment (the active ligand) is coupled
to a cholesterol moiety (Ingham and
McMahon, 2001
). To determine whether dlp is required in
the signalling cells, we expressed an engineered form of Hh, Hh-N, which is
pre-cleaved and not modified by cholesterol
(Porter et al., 1995
) and
tested whether Hh-N could bypass the requirement for dlp.
ArmGal4/UAShh-N embryos ectopically expressed wg in the same pattern
as armGal4/UAShh embryos (compare Fig.
4B and Fig. 5A).
SimGal4/UAShh-N embryos ectopically expressed wg on both sides of the
midline, as in simGal4/UAShh embryos, but over a longer distance from the
midline (compare Fig. 4E and
Fig. 5D). This is consistent
with previous findings that Hh-N moves further in a field of cells than Hh
(Burke et al., 1999
;
Porter et al., 1996
). In both
armGal4/UAShh-N and simGal4/UAShh-N embryos injected with dlp dsRNA,
wg ectopic expression is completely lost along with wg
endogenous expression (Fig.
5C,F).
The activity of Hh-N is partially dependent upon the activity of wild-type
Hh in embryos (Gallet et al.,
2003
). To control for this, we overexpressed UASHh-N in a
hh null mutant background. Most of wg ectopic expression
remained in armGal4/UAShh-N[hh-] embryos
(Fig. 5B), whereas small
patches of wg ectopic expression remained in
simGal4/UAShh-N[hh-] embryos
(Fig. 5E). This indicates that
Hh-N can still signal in the absence of endogenous Hh, but that Hh-N might be
dependent upon Hh for its movement from cell to cell. In contrast, all
wg expression was lost in armGal4 or simGal4/UAShh-N[dlp RNAi]
embryos (Fig. 5C,F), showing
that the activity of Hh-N is absolutely dependent on Dlp. We conclude that Dlp
is required downstream of Hh processing and cholesterol modification.
Increasing the concentration of Dally-like does not increase the
range of Hedgehog signalling
To test if Dlp facilitates the movement of Hh in the ectoderm, we
overexpressed Dlp in embryos, and assessed the range of Hh signalling by
looking at the width of the wg stripe
(Fig. 6A). Overexpressing
UASdlp with either enGal4 or ptcGal4 did not have any effect on wg
expression and the embryos were viable (data not shown). As a control, we
immunostained for the Dlp protein in enGal4/UASdlp embryos, and found Dlp
expressed in stripes as expected (not shown). Also, enGal4/UASdlp adult flies
exhibited notched wings as previously observed
(Baeg et al., 2001
) and
ptcGal4/UASdlp flies died at the pharate stage (data not shown), thus
indicating that UASdlp expressed an active protein. To increase the quantity
of Dlp protein made, we used the armGal4VP16 driver, which is the strongest
driver available in embryos (Sanson et
al., 1996
). We could not detect any enlargement of the wg
stripe in armGal4VP16/UASdlp embryos (Fig.
6A). As a comparison, expressing UAShh in en cells did
lead to a moderate but detectable enlargement of the wg stripe at
stage 11 (Porter et al., 1996
)
(Fig. 6B). Furthermore,
overexpression of UAShh-N in the same cells lead to a larger stripe of
wg expression, consistent with the idea that Hh-N can travel a longer
distance than Hh (Porter et al.,
1996
) (Fig. 6C). We
conclude that increasing the concentration of Dlp in embryos does not increase
the range of Hh signalling.
Dally-like is required upstream or at the level of the Patched
receptor
Since Dlp is not required for Hh processing and cholesterol modification,
and does not stimulate Hh movement when overexpressed, it is probable that Dlp
is required for the transduction of the signal. In absence of the Patched
(Ptc) receptor, Smoothened constitutively activates the Hh intracellular
pathway (Ingham and McMahon,
2001
). We looked at this constitutive signalling in ptc
mutants, in the presence or absence of dlp, using wg
transcription as a readout. In embryos homozygous for the null mutation
ptcIIW, wg transcription was enlarged in a pattern similar
to that in armGal4/UAShh embryos (Fig.
6D). When we injected dlp dsRNA into
ptcIIW embryos, most of the homozygous embryos maintained
wg ectopic expression (Fig.
6E). Three homozygous embryos out of thirty (10%) had partially
lost wg expression, but close examination showed that loss of
expression was always associated with a disrupted epithelium. Thus, in
ptc-embryos, injection of dlp dsRNA does not abolish Hh
constitutive signalling. In contrast, wg endogenous expression
disappeared in 78% of the heterozygous embryos (n=58), showing that
dlp has been efficiently silenced in this experiment
(Fig. 6F). We conclude that
ptc is epistatic to dlp. This indicates that Dlp acts either
upstream or at the level of the Ptc receptor.
| Discussion |
|---|
|
|
|---|
Role of Dally-like in the Hedgehog pathway
dlp is a bona fide segment polarity gene since dlp RNAi
generates embryos that fail to maintain en and wg expression
at mid-embryogenesis, and exhibit a full segment polarity phenotype in the
cuticle at the end of embryogenesis (Fig.
1,
2 and not shown). The late
disappearance of en expression and the single stripe of rho
expression in dlp embryos suggest a loss of Hh activity
(Fig. 2). This is confirmed by
the fact that when hh expression is under heterologous control,
ectopic wg transcription is lost in dlp RNAi embryos,
whether Hh is provided autonomously (armGal4 experiments) or non-autonomously
(simGal4 experiments) (Fig. 4).
These experiments demonstrate unambiguously that dlp is required for
Hh signalling and rule out a requirement for hh transcription.
Dlp is a GPI-anchored protein and is likely to be localised at the cell
surface. This leaves two plausible roles for Dlp: either it is required for
the release of active Hh from the secreting cells, or it is required for the
interpretation of the Hh signal on the receiving cells. Our experiments
eliminate several possibilities. First, Dlp is required for the activity of
Hh-N, an engineered form of Hh which is pre-processed and unmodified by
cholesterol (Fig. 5). This
suggests that Dlp is necessary downstream of Hh processing and cholesterol
modification. Downstream of these events, Hh undergoes another lipid
modification, the addition of a palmitoyl moiety. The segment polarity gene
rasp codes for an acyltransferase which is thought to be needed for
Hh palmitoylation (Amanai and Jiang,
2001
; Chamoun et al.,
2001
; Lee and Treisman,
2001
; Micchelli et al.,
2002
). Thus, Dlp could be required for the function of
rasp in the signalling cells. However, whereas palmitolylation is
essential for Hh-N activity, a recent report shows that it is not strictly
required for the activity of wild-type Hh in Drosophila embryos
(Gallet et al., 2003
). This
suggests that the cholesterol and palmitoylate modifications might be
partially redundant for the activity of wild-type Hh, at least in embryos.
Thus, although Dlp could still act at the level of rasp on another
function, loss of palmitoylation alone cannot account for the complete loss of
Hh signalling seen in dlp RNAi embryos. It seems therefore more
likely that dlp functions in the responding cells.
We show that ptc is epistatic to dlp, indicating that Dlp
acts upstream or at the level of the Ptc receptor
(Fig. 6D-F). One possibility is
that Dlp binds Hh and facilitates its interaction with Ptc. Increasing the
concentration of Hh in receiving cells in either armGal4/UAShh or
armGal4/UAShh-N experiments, does not abolish the requirement for Dlp. This
argues against a role of Dlp in merely increasing the concentration of Hh
ligand at the cell surface, and suggests a more specific role. Recent evidence
supports a model in which, upon Hh binding, Ptc is endocytosed and inactivated
by degradation, and this in turn indirectly activates Smoothened and the Hh
intracellular pathway (Denef et al.,
2000
; Martin et al.,
2001
; Strutt et al.,
2001
). Dlp may localise Hh and Ptc in membrane microdomains
required for Ptc endocytosis and subsequent degradation.
While we were completing this manuscript, Lum and colleagues
(Lum et al., 2003
) reported
that Dlp is required for the transduction of the Hh signal in cultured
Drosophila cells, using RNAi silencing. The design of the experiment
eliminates the requirement for Hh secretion or distribution, showing that Dlp
is required for the reception of the signal in cultured cells. In agreement
with our results, Lum and colleagues find that the requirement for Dlp is
suppressed by Ptc RNAi, showing that Dlp acts upstream or at the level of Ptc
in their assay (Lum et al.,
2003
). There are two differences, however, between the in vivo and
in vitro data. First, they found that the requirement for Dlp in Hh signal
transduction is suppressed by expressing Hh in responding cells. We did not
find this in either armGal4/UAShh or armGal4/UAShh-N experiments. This
difference may be due to differences in dose: transfection of Hh in cultured
cells may generate protein levels well above physiological levels, whereas
Gal4 expression levels are in the range of endogenous expression levels.
Another difference is that overexpression of Dlp in cultured cells stimulates
the response to Hh, in a manner comparable to overexpression of Cubitus
interruptus (Ci), the downstream component of the Hh pathway. Using UASdlp and
several Gal4 drivers including armGal4VP16, we were not able to detect any
stimulation of wg transcription in embryos following Dlp
overexpression (Fig. 6A). In
contrast, overexpression of Ci in embryos does stimulate wg
transcription (Alexandre et al.,
1996
) (data not shown). A possibility is that endogenous
dlp is expressed at low levels in cultured cells and is therefore
limiting, but is not limiting in embryos.
Drosophila glypicans and Wingless signalling
We did not find a requirement for the fly glypicans Dlp and Dally in Wg
signalling in the embryonic epidermis. In agreement with our findings in vivo,
Lum and colleagues showed that RNAi of dally or dlp does not
affect Wg signalling in a cell culture assay
(Lum et al., 2003
). We found
that when Wg expression is under heterologous control (using armGal4 or
simGal4), and thus independent of Hh signalling, en maintenance and
naked cuticle secretion are normal in dlp RNAi embryos
(Fig. 3). Since these two
events are under direct control by Wg in the ventral epidermis, this suggests
that Dlp is not necessary for Wg signalling in embryos. RNAi silencing of
dally, using three different dsRNA sequences and high concentration
of dsRNA, did not give any segment polarity phenotype in the cuticle and did
not affect the pattern of en expression or the secretion of naked
cuticle (Table 1, Fig.
1 and
3, not shown). Our RT-PCR
experiment demonstrates that dally RNAi has worked and leads to a
strong reduction in dally mRNA levels
(Fig. 1E). This result is in
contrast with previous reports showing weak segment polarity phenotypes
following dally RNAi (Lin and
Perrimon, 1999
; Tsuda et al.,
1999
; Baeg et al.,
2001
). It is possible that the use of dsRNA corresponding to
larger parts of the dally sequence, in these earlier reports, might
have resulted in partial silencing of dlp through short stretches of
sequence homology. To avoid this potential problem, we used short sequences
(300-400 nt), and chose sequences with the least homology between
dally and dlp or any other sequences in the genome. Our
RT-PCR experiments confirm that RNAi silencing of dally did not
affect the mRNA levels of dlp and vice versa
(Fig. 1E).
A possible explanation for an absence of effect in Wg signalling after
dally or dlp RNAi is that the two genes function redundantly
in Wg signalling in embryos, as it is the case for the Wg receptors Frizzled
and Frizzled2 (Wodarz and Nusse,
1998
). We tested this hypothesis by co-injecting dally
and dlp dsRNA in simGal4/UASwg embryos, and show that ectopic Wg
signalling is unaffected (Fig.
3F). Importantly, the simGal4 experiments effectively mimic the
production of ligand in the wild type because (1) the UAS transgene is
expressed in a thin stripe, which allows the monitoring of non-cell autonomous
signalling, and (2) the UAS transgene is expressed at levels similar to
endogenous transcription (see Fig.
4D). In conclusion, our work suggests strongly that Dally and Dlp,
separately or together, are not necessary for Wg signalling in embryos. It has
to be noted, however, that if RNAi decreases dramatically the amount of
zygotic and maternal mRNAs in embryos, it does not affect the maternal protein
stores, and thus we cannot formally rule out that some maternal Dally and/or
Dlp protein are sufficient for rescuing Wg signalling in our experiments.
Germline clones of null mutations in dally and dlp, to
remove maternal and zygotic contribution of both genes, will need to be
performed to definitively settle this issue.
Dally and Dlp could affect Wg distribution or movement without being
required for Wg signalling in embryos. We could detect a slight increase in
the extent of naked cuticle secreted in enGal4/UASwg [dally RNAi] embryos,
which is the assay we use to look at the range of Wg (S.D. and B.S.,
unpublished). Lum and colleagues also mentioned that Wg distribution at the
cell surface is changed in cultured cells silenced for dally by RNAi
(Lum et al., 2003
). This is
compatible with an earlier suggestion that HSPGs are needed for the retention
of Wg at the surface and within the secretory pathway of expressing cells
(Pfeiffer et al., 2002
). So
removal of Dally might affect Wg distribution in embryos or cell culture, but
without detectable impact on Wg signalling. In the wing disc, overexpression
of Dlp, but not Dally, has been shown to stabilise Wg at the cell surface
(Baeg et al., 2001
;
Strigini and Cohen, 2000
). It
has been hypothesised that Notum, which has similarities with pectin
acetylesterases, could modify the affinity of Dally and Dlp for Wg
(Gerlitz and Basler, 2002
;
Giraldez et al., 2002
). Thus
different modifications of the glypicans by tissue-specific enzymes such as
Notum, could account for the differences between the embryo and the wing disc.
However, it has not yet been proved that there is a direct interaction between
Wg and Dally and Dlp, and if this interaction has a biological
significance.
Drosophila glypicans and glycosaminoglycan
modifications
So far, four genes coding for enzymes necessary for heparan sulphate
biosynthesis give a segment polarity phenotype in Drosophila embryos:
sugarless (sgl), sulfateless (sfl),
tout-velu (ttv) and fringe connection
(frc). The segment polarity phenotypes are seen after removal of both
maternal and zygotic contribution of any of these genes and are identical to
wg or hh null mutant phenotypes
(Binari et al., 1997
;
Hacker et al., 1997
;
Haerry et al., 1997
;
Lin and Perrimon, 1999
;
The et al., 1999
;
Selva et al., 2001
;
Goto et al., 2001
). sgl,
sfl, ttv and frc have similarities with vertebrate genes coding
for a UDP-glucose dehydrogenase, a N-deacetylase/N-sulphotransferase, a
heparan sulphate co-polymerase (Ext1), and a UDP sugar transporter,
respectively. Consistent with this, mutations in all four genes affect
glycosaminoglycan biosynthesis: Sgl affects both chondroitin and heparan
sulphate synthesis, Sfl reduces the proportion of sulphated disaccharides in
heparan sulphate, Ttv dramatically decreases all forms of heparan sulphate and
Frc reduces the amount of heparan sulphate in embryos
(Toyoda et al., 2000
;
The et al., 1999
;
Selva et al., 2001
). Since
glypicans carry heparan sulphate chains, they have been hypothesised to be the
target of these enzymes. However, sfl and sgl have both been
implicated in Wg signalling but not Hh signalling in embryos
(Binari et al., 1997
;
Hacker et al., 1997
;
Haerry et al., 1997
;
Lin and Perrimon, 1999
). The
fact that neither dally nor dlp seem to be required for Wg
signalling in embryos (our study) or in cultured cells
(Lum et al., 2003
) poses a
paradox. A possibility is that dally and dlp are solely
required for Wg distribution and/or transport, as opposed to Wg signal
transduction, and that this requirement is not revealed after RNAi in embryos
or in cells. Alternatively, Sfl and Sgl might be required for the function of
another heparan sulphate proteoglycan or for the glycosylation of a protein
with a central role in Wg signalling. The fourth gene, ttv, was found
to act specifically in the Hh signalling pathway, and thus could exhibit a
segment polarity phenotype because of loss of Dlp activity. However, Ttv is
required for Hh movement in wing discs, but not for Hh signalling per se
(Bellaiche et al., 1998
;
The et al., 1999
). Dlp is
strictly required for Hh signalling but does not seem to influence its
movement in embryos, at least in an overexpression assay
(Fig. 6A). Furthermore, RNAi
silencing of ttv and its two Drosophila homologues
Ext2 and Ext3, individually or in combination, does not
inhibit Hh signalling in cell culture (Lum
et al., 2003
). Thus, the basis for the segment polarity phenotype
of ttv mutants remains to be clarified.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alexandre, C., Jacinto, A. and Ingham, P. W.
(1996). Transcriptional activation of hedgehog target genes in
Drosophila is mediated directly by the cubitus interruptus protein, a member
of the GLI family of zinc finger DNA-binding proteins. Genes
Dev. 10,2003
-2013.
Alexandre, C., Lecourtois, M. and Vincent, J. P.
(1999). Wingless and Hedgehog pattern Drosophila denticle belts
by regulating the production of short-range signals.
Development 126,5689
-5698.[Abstract]
Amanai, K. and Jiang, J. (2001). Distinct roles
of Central missing and Dispatched in sending the Hedgehog signal.
Development 128,5119
-5127.
Baeg, G. H., Lin, X., Khare, N., Baumgartner, S. and Perrimon,
N. (2001). Heparan sulfate proteoglycans are critical for the
organization of the extracellular distribution of Wingless.
Development 128,87
-94.[Abstract]
Bellaiche, Y., The, I. and Perrimon, N. (1998).
Tout-velu is a Drosophila homologue of the putative tumour suppressor EXT-1
and is needed for Hh diffusion. Nature
394, 85-88.[CrossRef][Medline]
Bernfield, M., Gotte, M., Park, P. W., Reizes, O., Fitzgerald,
M. L., Lincecum, J. and Zako, M. (1999). Functions of
cell surface heparan sulfate proteoglycans. Annu. Rev.
Biochem. 68,729
-777.[CrossRef][Medline]
Binari, R. C., Staveley, B. E., Johnson, W. A., Godavarti, R.,
Sasisekharan, R. and Manoukian, A. S. (1997). Genetic
evidence that heparin-like glycosaminoglycans are involved in wingless
signaling. Development
124,2623
-2632.[Abstract]
Brand, A. H. and Perrimon, N. (1993). Targeted
gene expression as a means of altering cell fates and generating dominant
phenotypes. Development
118,401
-415.[Abstract]
Burke, R., Nellen, D., Bellotto, M., Hafen, E., Senti, K. A.,
Dickson, B. J. and Basler, K. (1999). Dispatched, a novel
sterol-sensing domain protein dedicated to the release of cholesterol-modified
hedgehog from signaling cells. Cell
99,803
-815.[CrossRef][Medline]
Chamoun, Z., Mann, R. K., Nellen, D., von Kessler, D. P.,
Bellotto, M., Beachy, P. A. and Basler, K. (2001).
Skinny hedgehog, an acyltransferase required for palmitoylation and activity
of the hedgehog signal. Science
293,2080
-2084.
Denef, N., Neubuser, D., Perez, L. and Cohen, S. M.
(2000). Hedgehog induces opposite changes in turnover and
subcellular localization of patched and smoothened.
Cell 102,521
-531.[CrossRef][Medline]
Fietz, M. J., Jacinto, A., Taylor, A. M., Alexandre, C. and
Ingham, P. W. (1995). Secretion of the amino-terminal
fragment of the hedgehog protein is necessary and sufficient for hedgehog
signalling in Drosophila. Curr. Biol.
5, 643-650.[CrossRef][Medline]
Gallet, A., Rodriguez, R., Ruel, L. and Therond, P. P.
(2003). Cholesterol modification of hedgehog is required for
trafficking and movement, revealing an asymmetric cellular response to
hedgehog. Dev. Cell 4,191
-204.[CrossRef][Medline]
Gerlitz, O. and Basler, K. (2002). Wingful, an
extracellular feedback inhibitor of Wingless. Genes
Dev. 16,1055
-1059.
Giraldez, A. J., Copley, R. R. and Cohen, S. M.
(2002). HSPG modification by the secreted enzyme Notum shapes the
Wingless morphogen gradient. Dev. Cell
2, 667-676.[CrossRef][Medline]
Golembo, M., Raz, E. and Shilo, B. Z. (1996).
The Drosophila embryonic midline is the site of Spitz processing, and induces
activation of the EGF receptor in the ventral ectoderm.
Development 122,3363
-3370.[Abstract]
Goto, S., Taniguchi, M., Muraoka, M., Toyoda, H., Sado, Y.,
Kawakita, M. and Hayashi, S. (2001). UDP-sugar
transporter implicated in glycosylation and processing of Notch.
Nat. Cell Biol. 3,816
-822.[CrossRef][Medline]
Hacker, U., Lin, X. and Perrimon, N. (1997).
The Drosophila sugarless gene modulates Wingless signaling and
encodes an enzyme involved in polysaccharide biosynthesis.
Development 124,3565
-3573.[Abstract]
Haerry, T. E., Heslip, T. R., Marsh, J. L. and O'Connor, M.
B. (1997). Defects in glucuronate biosynthesis disrupt
Wingless signaling in Drosophila. Development
124,3055
-3064.[Abstract]
Hatini, V. and DiNardo, S. (2001). Divide and
conquer: pattern formation in Drosophila embryonic epidermis.
Trends Genet. 17,574
-579.[CrossRef][Medline]
Ingham, P. W. and McMahon, A. P. (2001).
Hedgehog signaling in animal development: paradigms and principles.
Genes Dev. 15,3059
-3087.
Jackson, S. M., Nakato, H., Sugiura, M., Jannuzi, A., Oakes, R.,
Kaluza, V., Golden, C. and Selleck, S. B. (1997).
dally, a Drosophila glypican, controls cellular responses to the
TGF-ß-related morphogen, Dpp. Development
124,4113
-4120.[Abstract]
Jowett, T. (1997). Tissue in situ
hybridization: methods in animal development. An EMBO Practical
Course.
Khare, N. and Baumgartner, S. (2000).
Dally-like protein, a new Drosophila glypican with expression overlapping with
wingless. Mech. Dev. 99,199
-202.[CrossRef][Medline]
Lawrence, P. A., Sanson, B. and Vincent, J. P.
(1996). Compartments, wingless and engrailed: patterning the
ventral epidermis of Drosophila embryos.
Development 122,4095
-4103.[Abstract]
Lee, J. D. and Treisman, J. E. (2001).
Sightless has homology to transmembrane acyltransferases and is required to
generate active Hedgehog protein. Curr. Biol.
11,1147
-1152.[CrossRef][Medline]
Lin, X., Buff, E. M., Perrimon, N. and Michelson, A. M.
(1999). Heparan sulfate proteoglycans are essential for FGF
receptor signaling during Drosophila embryonic development.
Development 126,3715
-3723.[Abstract]
Lin, X. and Perrimon, N. (1999). Dally
cooperates with Drosophila Frizzled 2 to transduce Wingless signalling.
Nature 400,281
-284.[CrossRef][Medline]
Lum, L., Yao, S., Mozer, B., Rovescalli, A., Von Kessler, D.,
Nirenberg, M. and Beachy, P. A. (2003). Identification of
Hedgehog pathway components by RNAi in Drosophila cultured cells.
Science 299,2039
-2045.
Martin, V., Carrillo, G., Torroja, C. and Guerrero, I.
(2001). The sterol-sensing domain of Patched protein seems to
control Smoothened activity through Patched vesicular trafficking.
Curr. Biol. 11,601
-607.[CrossRef][Medline]
Martinez Arias, A. (1993). Development and
patterning of the larval epidermis of Drosophila. In The
Development of Drosophila melanogaster (ed. M. Bate and A.
Martinez Arias), pp. 517-608. New York: Cold Spring
Harbor Press.
Micchelli, C. A., The, I., Selva, E., Mogila, V. and Perrimon,
N. (2002). Rasp, a putative transmembrane acyltransferase, is
required for Hedgehog signaling. Development
129,843
-851.
Nakato, H., Futch, T. A. and Selleck, S. B.
(1995). The division abnormally delayed (dally) gene: a putative
integral membrane proteoglycan required for cell division patterning during
postembryonic development of the nervous system in Drosophila.Development 121,3687
-3702.[Abstract]
Payre, F., Vincent, A. and Carreno, S. (1999).
ovo/svb integrates Wingless and DER pathways to control epidermis
differentiation. Nature
400,271
-275.[CrossRef][Medline]
Perrimon, N. and Bernfield, M. (2000).
Specificities of heparan sulphate proteoglycans in developmental processes.
Nature 404,725
-728.[CrossRef][Medline]
Pfeiffer, S., Ricardo, S., Manneville, J. B., Alexandre, C. and
Vincent, J. P. (2002). Producing cells retain and
recycle Wingless in Drosophila embryos. Curr. Biol.
12,957
-962.[CrossRef][Medline]
Porter, J. A., von Kessler, D. P., Ekker, S. C., Young, K. E.,
Lee, J. J., Moses, K. and Beachy, P. A. (1995). The
product of hedgehog autoproteolytic cleavage active in local and long-range
signalling. Nature 374,363
-366.[CrossRef][Medline]
Porter, J. A., Ekker, S. C., Park, W. J., von Kessler, D. P.,
Young, K. E., Chen, C. H., Ma, Y., Woods, A. S., Cotter, R. J., Koonin,
E. V. et al. (1996). Hedgehog patterning activity: role of a
lipophilic modification mediated by the carboxy-terminal autoprocessing
domain. Cell 86,21
-34.[CrossRef][Medline]
Sanson, B. (2001). Generating patterns from
fields of cells: Examples from Drosophila segmentation. EMBO
Reports 12,1083
-1088.[CrossRef]
Sanson, B., White, P. and Vincent, J. P.
(1996). Uncoupling cadherin-based adhesion from wingless
signalling in Drosophila. Nature
383,627
-630.[CrossRef][Medline]
Sanson, B., Alexandre, C., Fascetti, N. and Vincent, J. P.
(1999). Engrailed and hedgehog make the range of Wingless
asymmetric in Drosophila embryos. Cell
98,207
-216.[CrossRef][Medline]
Selleck, S. B. (2000). Proteoglycans and
pattern formation: sugar biochemistry meets developmental genetics.
Trends Genet. 16,206
-212.[CrossRef][Medline]
Selva, E. M., Hong, K., Baeg, G. H., Beverley, S. M., Turco, S.
J., Perrimon, N. and Hacker, U. (2001). Dual role of
the fringe connection gene in both heparan sulphate and fringe-dependent
signalling events. Nat. Cell Biol.
3, 809-815.[CrossRef][Medline]
Song, H. H. and Filmus, J. (2002). The role of
glypicans in mammalian development. Biochim. Biophys.
Acta 1573,241
-246.[Medline]
Strigini, M. and Cohen, S. M. (2000). Wingless
gradient formation in the Drosophila wing. Curr. Biol.
10,293
-300.[CrossRef][Medline]
Strutt, H., Thomas, C., Nakano, Y., Stark, D., Neave, B.,
Taylor, A. M. and Ingham, P. W. (2001). Mutations in
the sterol-sensing domain of Patched suggest a role for vesicular trafficking
in Smoothened regulation. Curr. Biol.
11,608
-613.[CrossRef][Medline]
The, I., Bellaiche, Y. and Perrimon, N. (1999).
Hedgehog movement is regulated through tout velu-dependent synthesis of a
heparan sulfate proteoglycan. Mol. Cell
4, 633-639.[CrossRef][Medline]
Toyoda, H., Kinoshita-Toyoda, A., Fox, B. and Selleck, S. B.
(2000). Structural analysis of glycosaminoglycans in animals
bearing mutations in sugarless, sulfateless, and tout-velu. Drosophila
homologues of vertebrate genes encoding glycosaminoglycan biosynthetic
enzymes. J. Biol. Chem.
275,21856
-21861.
Tsuda, M., Kamimura, K., Nakato, H., Archer, M., Staatz, W.,
Fox, B., Humphrey, M., Olson, S., Futch, T., Kaluza, V. et al.
(1999). The cell-surface proteoglycan Dally regulates Wingless
signalling in Drosophila. Nature
400,276
-280.[CrossRef][Medline]
Turnbull, J., Powell, A. and Guimond, S.
(2001). Heparan sulfate: decoding a dynamic multifunctional cell
regulator. Trends Cell Biol.
11, 75-82.[CrossRef][Medline]
Vincent, J. P. and O'Farrell, P. H. (1992). The
state of engrailed expression is not clonally transmitted during early
Drosophila development. Cell
68,923
-931.[CrossRef][Medline]
Wodarz, A. and Nusse, R. (1998). Mechanisms of
Wnt signaling in development. Annu. Rev. Cell Dev.
Biol. 14,59
-88.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
D. Yan and X. Lin Shaping Morphogen Gradients by Proteoglycans Cold Spring Harb Perspect Biol, September 1, 2009; 1(3): a002493 - a002493. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shao, Z.-Z. Liu, C.-D. Wang, H.-Y. Li, C. Carron, H.-W. Zhang, and D.-L. Shi Down syndrome critical region protein 5 regulates membrane localization of Wnt receptors, Dishevelled stability and convergent extension in vertebrate embryos Development, June 15, 2009; 136(12): 2121 - 2131. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Kirkpatrick and S. B. Selleck Heparan sulfate proteoglycans at a glance J. Cell Sci., June 1, 2007; 120(11): 1829 - 1832. [Full Text] [PDF] |
||||
![]() |
J. S. McLellan, S. Yao, X. Zheng, B. V. Geisbrecht, R. Ghirlando, P. A. Beachy, and D. J. Leahy From the Cover: Structure of a heparin-dependent complex of Hedgehog and Ihog PNAS, November 14, 2006; 103(46): 17208 - 17213. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Wendler, X. Franch-Marro, and J.-P. Vincent How does cholesterol affect the way Hedgehog works? Development, August 15, 2006; 133(16): 3055 - 3061. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Pilot, J.-M. Philippe, C. Lemmers, J.-P. Chauvin, and T. Lecuit Developmental control of nuclear morphogenesis and anchoring by charleston, identified in a functional genomic screen of Drosophila cellularisation Development, February 15, 2006; 133(4): 711 - 723. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Callejo, C. Torroja, L. Quijada, and I. Guerrero Hedgehog lipid modifications are required for Hedgehog stabilization in the extracellular matrix Development, February 1, 2006; 133(3): 471 - 483. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Capurro, W. Shi, S. Sandal, and J. Filmus Processing by Convertases Is Not Required for Glypican-3-induced Stimulation of Hepatocellular Carcinoma Growth J. Biol. Chem., December 16, 2005; 280(50): 41201 - 41206. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ding, M. Lopez-Burks, J. A. Sanchez-Duran, M. Korc, and A. D. Lander Growth factor-induced shedding of syndecan-1 confers glypican-1 dependence on mitogenic responses of cancer cells J. Cell Biol., November 21, 2005; 171(4): 729 - 738. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Hanson, A. C. Kelley, and M. Bienz Loss of Drosophila borealin causes polyploidy, delayed apoptosis and abnormal tissue development Development, November 1, 2005; 132(21): 4777 - 4787. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Desbordes, D. Chandraratna, and B. Sanson A Screen for Genes Regulating the Wingless Gradient in Drosophila Embryos Genetics, June 1, 2005; 170(2): 749 - 766. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Franch-Marro, O. Marchand, E. Piddini, S. Ricardo, C. Alexandre, and J.-P. Vincent Glypicans shunt the Wingless signal between local signalling and further transport Development, February 15, 2005; 132(4): 659 - 666. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Song, W. Shi, Y.-Y. Xiang, and J. Filmus The Loss of Glypican-3 Induces Alterations in Wnt Signaling J. Biol. Chem., January 21, 2005; 280(3): 2116 - 2125. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Lin Functions of heparan sulfate proteoglycans in cell signaling during development Development, December 15, 2004; 131(24): 6009 - 6021. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Zhu and M. P. Scott Incredible journey: how do developmental signals travel through tissue? Genes & Dev., December 15, 2004; 18(24): 2985 - 2997. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lum and P. A. Beachy The Hedgehog Response Network: Sensors, Switches, and Routers Science, June 18, 2004; 304(5678): 1755 - 1759. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Perrimon, U. Hacker, B. Sanson, and T. Tabata Wingless, Hedgehog and Heparan Sulfate Proteoglycans Development, June 1, 2004; 131(11): 2509 - 2513. [Full Text] [PDF] |
||||
![]() |
C. Torroja, N. Gorfinkiel, and I. Guerrero Patched controls the Hedgehog gradient by endocytosis in a dynamin-dependent manner, but this internalization does not play a major role in signal transduction Development, May 15, 2004; 131(10): 2395 - 2408. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||