|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 November 2003
doi: 10.1242/dev.00863
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Biology, Queens College, and PhD Program in Biochemistry, The
Graduate School and University Center, The City University of New York,
Flushing, NY 11367, USA
2 Department of Molecular Genetics, Albert Einstein College of Medicine, Bronx,
NY 10461, USA
3 Department of Neuroscience, Albert Einstein College of Medicine, Bronx, NY
10461, USA
4 Department of Molecular Biology and Genetics, Cornell University, Ithaca, NY
14853, USA
* Author for correspondence (e-mail: csavage{at}qc1.qc.edu)
Accepted 11 September 2003
| SUMMARY |
|---|
|
|
|---|
Key words: BMP, Schnurri, Transcription factor, Body size, Pattern formation, Alternative splicing
| Introduction |
|---|
|
|
|---|
Drosophila Shn is required for the Dpp BMP-related pathway. Shn
loss of function causes embryonic lethality and ventralization, as does loss
of other pathway components. In vitro, Shn was demonstrated to interact with
the Smad protein Mad, to bind specific DNA sequences,and to recognize a
Dpp-responsive promoter element of the Ubx gene
(Dai et al., 2000
). However,
there is still uncertainty about how Shn functions. One possibility is that it
may regulate Dpp-mediated transcriptional activation of target genes directly
(Torres-Vazquez et al., 2001
),
and another is that it may activate target genes indirectly by transcriptional
repression of brinker, a novel transcriptional repressor
(Campbell and Tomlinson, 1999
;
Jazwinska et al., 1999
;
Marty et al., 2000
;
Muller et al., 2003
). There
are Shn homologs present in vertebrate and C. elegans genomes.
Vertebrate homologs include Shn1
(MBP-1/PRDII-BF1/
A-CRYBP1/GAAP-1/HIV-EP1), Shn2 (MBP-2/HIV-EP2) and
Shn3 (HIV-EP3/KRC); however, no reports have shown their functions in BMP
signaling (Fan and Maniatis,
1990
; Nakamura et al.,
1990
; van't Veer et al.,
1992
; Seeler et al.,
1994
; Gascoigne,
2001
; Takagi et al.,
2001
; Lallemand et al.,
2002
; Oukka et al.,
2002
). The question arises as to whether these proteins play a
conserved role in BMP signaling or not. We have used C. elegans as a
model system to address this question.
In the nematode C. elegans, a BMP-related signaling pathway
regulates body size and patterning of sex-specific tissues of the male
posterior (Patterson and Padgett,
2000
; Savage-Dunn,
2001
). Studies of this pathway have previously been fruitful in
identifying conserved signaling components
(Savage et al., 1996
). The
pathway, which we will refer to as the DBL-1 pathway, is defined by six genes:
ligand dbl-1 (Suzuki et al.,
1999
; Morita et al.,
1999
), type I receptor sma-6
(Krishna et al., 1999
), type
II receptor daf-4 (Estevez et al.,
1993
), and Smads sma-2, sma-3 and sma-4
(Savage et al., 1996
).
Mutations in any of these pathway components cause a small body size (Sma)
phenotype in both hermaphrodites and males, and a male abnormal (Mab)
phenotype due to transformations in male sensory ray identity and defective
morphogenesis of the male copulatory spicules.
To identify additional components of the DBL-1 pathway and in particular
those that confer specific pathway responses, we performed forward genetic
screens for additional mutations affecting body size or male sensory ray
patterning (Savage-Dunn et al.,
2003
; Lints and Emmons,
2002
). Here we report the isolation of the C. elegans shn
homolog sma-9, and provide the first evidence of a conserved role for
Shn proteins in BMP-related signaling. Loss-of-function (lf)
mutations in sma-9, as in DBL-1 pathway genes, cause Sma and Mab
phenotypes. sma-9 expression overlaps with that of DBL-1 pathway
components. Anti-SMA-9 antibody staining reveals that SMA-9 is present in many
tissues, where it localizes to cell nuclei; this is consistent with its
predicted transcriptional cofactor function. In contrast to available reports
on Drosophila shn, we find that the sma-9 locus generates a
complex array of transcripts through alternative splicing, which are predicted
to encode isoforms with differences in the number of nuclear localization
signals (NLS) and zinc finger motifs. The complexity of the sma-9
locus suggests that different isoforms may have diverse functions and
subcellular localizations. Further analysis of the sma-9 mutant
phenotype suggests that SMA-9 activity is spatially and temporally restricted
relative to that of other DBL-1 pathway components. We propose that some SMA-9
isoforms function as Smad transcriptional cofactors to confer specific
responses to DBL-1 pathway activation in regulating body size and male tail
development.
| Materials and methods |
|---|
|
|
|---|
N2 (wild type);
LG III, sma-3(wk30), sma-4(e729), lon-1(e185);
LG IV, dbl-1(wk70);
LG V, sma-1(e30), him-5(e1490), Is[tph-1::gfp + rol-6(su1006)]
(Sze et al., 2000
);
bxIs14 an integrated derivative of pkd-2::gfp-containing
array syEx313 (Barr and Sternberg,
1999
) (L. Jia and S.W.E., unpublished);
LG X, sma-9(wk55, wk62, wk71, wk82)
(Savage-Dunn et al.,
2003
);
sma-9(bx120), lon-2(e678), dbl-1(ctIs40)
(Suzuki et al., 1999
);
cat-2::gfp complex extrachomosomal arrays bxEx44, bxEx45,
bxEx46 and bxEx47 (Lints and Emmons,
1999
); and
mnIs17, an integrated derivative of osm-6::gfp array
mnEx64 (Collet et al.,
1998
).
The isolation of wk and bx alleles was described
previously (Savage-Dunn et al.,
2003
; Lints and Emmons,
2002
). The qc alleles were isolated in a
non-complementation screen. N2 males were mutagenized with EMS
(Brenner, 1974
) and mated with
sma-9(wk62)unc-7(e5) hermaphrodites. The F1 generation was screened
for Sma non-Unc animals. From a screen of approximately 4000 F1 cross progeny,
nine new alleles of sma-9 were isolated.
Mapping
sma-9 was previously mapped to linkage group X
(Savage-Dunn et al., 2003
).
This map position was refined using SNP markers. lon-2sma-9 double
mutants (Sma) were crossed with the Hawaiian strain CB4856. From these
heterozygotes, Lon (Lon-2 non-Sma-9) recombinant progeny were selected. These
progeny were tested for the presence of CB4856 SNP markers on the X-linked
cosmids C36B7 (-2.04), Y49A10A (+1.91) and F11A1 (+2.2). The results
demonstrate that sma-9 maps to the right of cosmid Y49A10A and within
0.1 map units of F11A1.
Body size measurements
Measurement of worm length, pharynx length and seam cell size was performed
as described (Savage-Dunn et al.,
2000
; Wang et al.,
2002
).
Transgenic animals
The plasmid or cosmid DNA was microinjected into the gonadal syncytia of
hermaphrodites, with rol-6 as a marker
(Mello et al., 1991
). 20
ng/µl cosmid DNA was injected into sma-9(wk55) for rescue. 10
ng/µl plasmid DNA of GFP constructs was injected into N2.
Sequencing sma-9 mutants
15 mutant animals were picked into 10 µl lysis buffer (10 mM Tris, pH
8.0; 50 mM KCl; 2.5 mM MgCl2; 0.45% Tween 20; 0.01% gelatin; 60
µg/ml proteinase K) and placed at -80°C for one hour. The frozen
solution was heated to 60°C for 1 hour and then to 95°C for 20 minutes
to generate crude lysate. PCR was carried out on mutant and wild-type genomic
DNA templates, using platinum Taq and platinum Pfx mixture
as the DNA polymerase, and primers within genomic sequence. For wk55,
the region from 5532 to 14827 in T05A10, covering the whole open reading frame
(ORF), was sequenced. For qc3, the regions from 5532 to 7558 and
11151 to 13081 in T05A10 were sequenced. The PCR fragments were sequenced
directly, and all mutation sites were confirmed using a second primer.
Molecular cloning and sequencing
A total of 17 yk cDNA clones were sequenced in order to identify the
structures of sma-9 transcripts. These yk clones were: yk1285a11,
yk128a8, yk1136g02, yk1109f01, yk43h3, yk6d10, yk864c1, yk1134e06, yk856b10,
yk1057a6, yk1216e10, yk1237d01, yk1103h10, yk127d10, yk1264e07, yk328c9
and yk228h6. All yk cDNAs were gifts from Y. Kohara. Details for the
primers used for sequencing the yk clones are available upon request. GenBank
Accession Numbers for yk clone sequences are AY390537-AY390553.
LiCl RNA preparation from wild-type animals was performed as described at by Lui et al. (Lui et al., 1995). RT-PCR was performed using SUPERSCRIPTTM One-Step RT-PCR (Invitrogen). pCS234 was amplified using primers 5'-AAGCGGCCGCATGAGCCATCAGGCAATTGG-3' and 5'-AAGGATCCGGTTCAAGGTTTTGTGTCAC-3', and cloned into pBluescript SK+ at NotI and BamHI. pCS234 starts from the predicted exon 1 (5' variant A in Fig. 3), splices out exon 4 and exon 5, and ends at exon 9, overlapping with yk328c9. pCS272 was amplified using primers 5'-AACCCGGGCCCCTCGCTCTCCAAA-3' and 5'-AAGGATCCTGATGGTCCTTG-3', and cloned into pBluescript SK+ at SmaI and BamHI. pCS272 starts from exon 4 and ends at exon 9 overlapping both yk1285a11 and yk328c9. GenBank Accession Numbers for RT-PCR clone sequences are AY389809 and AY389810.
|
|
5.5 kb, 5'-AAGCGGCCGCGAGTTCACACAGTTTATGAT-3' and 5'-AAGGTACCTTCGCCAATTCTAAAACCACT-3';
8.0 kb, 5'-AAGCGGCCGCCCATCCAATATTCAATTCTT-3' and 5'-AAGGTACCTTCGCCAATTCTAAAACCACT-3';
1.5 kb, 5'-GGCCGCGGAGTTCACACAGTTTATGAT-3' and 5'-GGGCGGCCGCCGAAAATTGCAGGTCTG-3'; and
4.0 kb, 5'-GGCCGCGGCCCATCCAATATTCAATTCTTTA-3' and 5'-GGGCGGCCGCCGAAAATTGCAGGTCTG-3'.
The 2.8 kb fragment was cloned into pPD117.01 at NotI and KpnI (pCS231), then into pBluescript SK+ (BamHI and KpnI), and finally into pPD117.01 at XbaI and KpnI (pCS251). The 5.5 kb fragment was cloned into pBluescript SK+ (NotI and KpnI), then into pPD117.01 at SacII and KpnI (pCS252). The 8.0 kb fragment was cloned into pBluescript SK+ (NotI and KpnI), then into pPD117.01 at SacII and KpnI (pCS253). The 1.5 kb fragment was cloned into pPD117.01 at SacII and NotI (pCS255). The 4.0 kb fragment was cloned into pPD117.01 at SacII and NotI sites (pCS256).
dsRNAi
The templates used were the yk1285a11 cDNA clone [containing
sequences from predicted exons 1-7 and alternative exon 1
(Fig. 3)], and the
yk228h6 cDNA clone [containing sequences from predicted exons 21-25,
which are present in all 3' variants as either translated (Class I
isoforms) or untranslated (Class II and III isoforms) sequences].
yk1285a11 was digested by EcoRI and KpnI;
yk228h6 was digested by SmaI and KpnI. Then the
digested DNA was extracted by phenol:chloroform once, precipitated by ethanol,
dried in air, and dissolved in TE. 1µg of the cut DNA was used to
synthesize RNA by Stratagene RNA Transcription Kit. After that, the reaction
solution was treated by RNase-free DNaseI at 37°C for 15 minutes. Then,
the ssRNA was combined and extracted by phenol:chloroform once, precipitated
by ethanol, dried in air and dissolved in 10µl TE. The purified RNA was
incubated at 68°C for 10 minutes and then at 37°C for 30 minutes. The
dsRNA was microinjected directly into N2 animals without further treatment.
Males with small body size were picked to score the Mab phenotype.
Antibodies and immunostaining
Anti-SMA-9 antibodies were generated against the 70 amino acids that are
unique to the abundantly expressed class II isoforms. Plasmid pJKL547.1, which
contains the cDNA fragment corresponding to the 70 amino acids cloned into
pGEX-2T, was transformed into BL21 cells. Fusion proteins were first purified
using Glutathione sepharose 4B beads (Amersham Biosciences) and further
purified by SDS-PAGE. Gel slices containing the purified fusion proteins were
used to immunize rats by Cocalico Biologicals, PA. The resulting antibodies
were tested by western blot analysis using bacterially generated fusion
proteins. For immunostaining, wild-type N2 and wk55 mutant animals
were fixed following the protocol of Hurd and Kemphues
(Hurd and Kemphues, 2003
). Rat
anti-SMA-9 isoform II antiserum (serum CUMC-RT TB2) was used at 1:2000
dilution. Affinity-purified Cy3-conjugated donkey anti-rat secondary
antibodies (Jackson Immunoresearch Laboratories) were used at 1:100
dilution.
Ray neuron fate expression
A- and B-type ray neuron generation in sma-9, DBL-1 pathway mutant
or wild-type males was assessed by examining the expression of the A- and
B-type neuron marker OSM-6::GFP, and the B-type neuron marker PKD-2::GFP
(Collet et al., 1998
;
Barr and Sternberg, 1999
) (L.
Jia and S.W.E., unpublished). In sma-9 and in DBL-1 pathway mutants,
the expression patterns of these reporters did not differ significantly from
wild type indicating that the absence of dopaminergic or serotonergic marker
expression from certain ray neurons was not due to loss of the affected neuron
(data not shown). The presence of dopamine in male ray neurons was assessed
using formaldehyde-induced fluorescence (FIF) as described by Lints and Emmons
(Lints and Emmon, 1999
). FIF
patterns were found to be consistent with the expression pattern of the
dopaminergic marker CAT-2::GFP in strains examined. Serotonergic fate
expression was assessed by staining the whole animal with anti-serotonin
antisera as described by Loer and Kenyon
(Loer and Kenyon, 1993
). To
assist with B-type ray neuron identification, strains examined also carried a
pkd-2::gfp reporter array (bxIs14)
(Barr and Sternberg, 1999
) (L.
Jia and S.W.E., unpublished). 5HT-antibody staining patterns were found to be
consistent with the expression pattern of the serotonergic fate marker
TPH-1::GFP.
Heat shock and temperature shifts
Heat shock DBL-1 experiments were performed as described
(Lints and Emmons, 1999
).
Individual sma-9 or wild-type males carrying
hs::dbl-1/cat-2::gfp arrays bxEx46, or bxEx47 or
control empty vector/cat-2::gfp arrays bxEx44 or
bxEx45, were staged by examination of seam cells with Nomarski optics
(Sulston and Horvitz, 1977
).
Males of the Rn stage were transferred to a siliconized Eppendorf tube
containing 100 µl of M9 buffer (Brenner,
1974
), which was placed in a 30°C circulating water bath for
30 minutes. After heat-shock, animals were recovered, placed at 20°C on
preequilibrated OP50-seeded plates, allowed to develop to adulthood and then
scored for CAT-2::GFP expression in the rays.
| Results |
|---|
|
|
|---|
To identify additional pathway components, and in particular those that
confer specific responses to pathway activity, we performed forward genetic
screens for mutants affected in body size
(Savage-Dunn et al., 2003
) and
male ray neurotransmitter identity (Lints
and Emmons, 2002
). A total of five recessive mutant alleles of a
newly defined locus, sma-9, were isolated in these screens
(wk and bx alleles). As only viable mutants were selected in
these screens, we wished to determine whether null alleles of sma-9
cause more severe defects or lethality. Because sma-9(wk62)/Df
animals are viable, a screen for mutations that fail to complement
sma-9(wk62) should uncover more severe or homozygous lethal alleles
of sma-9 if they can be created. An additional nine sma-9
alleles were identified in such a screen (see Materials and methods), but none
of them showed lethality or defects more severe than the previously isolated
alleles. Thus, these alleles show the full range of defects associated with
sma-9 loss of function. sma-9(lf) mutants, similar
to DBL-1 pathway mutants, have a small body size, an abnormal sensory ray
identity (ray 8-9 fusions) and crumpled spicules
(Fig. 1,
Table 1), suggesting that
sma-9 might define a new pathway component. Most of our analyses have
been carried out using sma-9(wk55) mutants, which display a strong
mutant phenotype.
|
|
|
A similarity search of GenBank revealed that sma-9 shares high
sequence homology with a zinc finger transcription factor family that includes
Drosophila Shn (BLAST E value=4e-24)
(Arora et al., 1995
) and
vertebrate Shn1 family members, human major histocompatibility complex-binding
protein 1 (MBP1)/PRDII-BF1 (E value=2e-17)
(van't Veer et al., 1992
;
Fan and Maniatis, 1990
) and
mouse
A-crystallin-binding protein 1 (
A-CRYBP1; E value=8e-18)
(Nakamura et al., 1990
).
Similarities among them include the presence of multiple zinc fingers, NLS,
ARD and S/TPKK motifs, as well as stretches of sequences rich in Gln and in
Ser/Thr. In SMA-9, the first pair of zinc fingers has 77% identity to the
second pair in Shn, 76% to the second pair in MBP1/ PRDII-BF1 and 74% to the
second pair in
A-CRYBP1 (Fig.
2B). Therefore, SMA-9, MBP1,
A-CRYBP1 and Shn may derive
from a common ancestral gene, and this pair of zinc fingers may contribute to
a conserved role for Shn proteins. The SMA-9 triplet of zinc fingers has 45%
identity to the Shn triplet. This domain is absent from MBP1 and
A-CRYBP1 (Fig. 2B),
suggesting its elimination during vertebrate evolution or its acquisition in
the fly-worm lineage. The SMA-9 second pair of zinc fingers has no similarity
to the other family members (Fig.
2C), indicating a unique function in C. elegans. An
alternative 70 aa C terminus is also unique to C. elegans.
sma-9 displays complex alternative splicing
To verify the sma-9 ORF predicted by Genefinder, we isolated
sma-9 cDNAs by RT-PCR and analyzed clones available from cDNA
libraries. A total of 17 yk cDNA clones (see Materials and methods) were
sequenced; one other cDNA clone (G-dvpl1458.x) had been previously
identified (Walhout et al.,
2000
). RT-PCR was performed to analyze the transcript structure at
the 5' end of the gene (see Materials and methods). With the exception
of yk1285a11 and yk1237d01 discussed below, none of the cDNA
clones are full length, so we cannot be sure which 5' and 3'
variants are present in contiguous transcripts in vivo.
Analysis of sma-9 cDNA clones showed complex alternative splicing at both 5' and 3' ends (Fig. 3). At least three 5' end forms were detected. Class A (represented by pCS234) contains the predicted initiation ATG (predicted exon 1), but lacks predicted exons 4 and 5 where the first NLS is located. Class B (represented by yk1285a11) contains an alternative upstream exon (alternative exon 1), splices out part of predicted exon 1 including the ATG, and lacks part of exon 4 but contains the first NLS in exon 5. In addition, this transcript is trans-spliced (SL1) and terminates with a poly(A) tail after exon 7. To test whether all exon 4 containing transcripts terminate in exon 7, we performed RT-PCR using primers in exon 4 and exon 9, and generated the product pCS272 (see Materials and methods), representing Class C.
The 3' end of sma-9 is even more diversified than the 5' end. Alternative splicing exists in predicted exons 15, 20 and 21 that would result in variable numbers of zinc finger clusters being expressed in different isoforms (Fig. 3) and in different C termini, including a 70 aa sequence that is unique for C. elegans (Fig. 2A). In Class I isoforms (5 cDNA clones), all of the zinc finger motifs are present; in Class II isoforms (10 cDNA clones), the second pair is missing and the unique 70 aa sequence is present; and in Class III isoforms (1 cDNA clone), only the first pair of zinc fingers is translated. Based on the numbers of cDNA clones isolated, Class II isoforms are predicted to be most abundant. Thus, as a result of alternative splicing, SMA-9 isoforms would differ in the numbers of NLSs, zinc finger motifs and S/TPKK motifs, which could allow differences in subcellular localization, transcriptional activity, DNA binding ability or expression pattern (discussed below).
Interestingly, in one Class IIb cDNA clone, yk1237d01, exon 11 is
trans-spliced to SL2, the trans-spliced leader sequence associated with
downstream genes in polycistronic operons
(Blumenthal et al., 2002
). The
SL2-spliced transcript may therefore form an operon with the upstream
transcript defined by yk1285a11. To our knowledge, this is the first
published report of competing cis- and SL2 trans-splicing to the same splice
acceptor sequence. However, because these cDNAs were rare they might represent
low abundance messages, messages with cell-type specific expression patterns
or spurious events with no functional significance. The region between exons 7
and 11 has some features of an intercistronic region, but is clearly not
typical. Forty-eight nucleotides downstream of exon 7 is an imperfect match to
the AAUAAA sequence necessary for polyadenylation: AAUUAAA. Upstream of exon
11 is a U-rich region, UUAUCCCUUUGUGUUUAAUU, reminiscent of identified
sequences that are necessary for SL2-mediated trans-splicing
(Huang et al., 2001
). However,
the distance between the two transcripts is 2.3 kb, whereas a typical
intercistronic region is between 100 and 120 bp (Blumethal et al., 2002). The
results of RNAi suggest that these trans-spliced messages encode isoforms with
distinct but overlapping functions. Inactivation of exons 1-7 results in a
wild-type male tail phenotype, whereas inactivation of exons 21-25, which
would target the yk1237d01 IIb isoform, results in significant
frequencies of ray 8-9 fusions (Table
1). Conversely, both experiments resulted in a similar Sma body
size (Fig. 1 and data not
shown). The strong male tail phenotype caused by sma-9(wk55), which
should not disrupt either of these isoforms, could be due either to
instability of the transcript containing a premature termination codon, or to
the expression of a truncated protein product with antimorphic properties.
Significantly, no expression of Class II isoforms was detected in
sma-9(wk55) by immunohistochemistry (see below).
sma-9 is widely expressed
To understand sma-9 function during development, we examined the
sma-9 transcriptional expression pattern (by fusing sma-9
upstream promoter regions with a GFP reporter gene) and protein localization
(by immunohistochemistry using anti-SMA-9 antibodies)
(Fig. 4). sma-9
promoter-driven GFP was expressed in the ventral nerve cord (VNC;
Fig. 4A), pharynx and intestine
(Fig. 4B), seam cells
(Fig. 4C), excretory canal,
vulva and spermatheca (data not shown). Expression was observed from L1 to
adult stages but not during embryonic development. Significantly, expression
in the lateral seam coincided with the crucial period for sma-9
activity in body size regulation (see below). sma-9 promoter-driven
GFP was detected in the lateral seam only from the L1 to the L3 stages, and
not in the L4 stage or in the adult.
Endogenous SMA-9 protein localization was examined by immunohistochemistry
using antibodies against the 70 aa C. elegans-specific domain present
in the abundant Class II isoforms (see Materials and methods). Antibody
staining detects SMA-9 protein in most, if not all, somatic nuclei of
wild-type animals, but not in sma-9(wk55) animals
(Fig. 4E,G). The lack of
protein expression in sma-9(wk55) mutants supports our conclusion
that this allele represents a strong loss of function allele. The localization
of SMA-9 to the nucleus is consistent with a function as a transcriptional
cofactor. Furthermore, the immunolocalization confirms SMA-9 expression in the
pharynx (arrowheads), intestine (black arrows), hypodermis (white arrows) and
VNC (Fig. 4I,J). Therefore, the
expression pattern of SMA-9 overlaps with that of DBL-1 pathway components
(Savage-Dunn et al., 2000
;
Krishna et al., 1999
;
Gunther et al., 2000
;
Suzuki et al., 1999
).
Interestingly, different promoter regions do not give rise to the same expression pattern. The 2.8 kb, 5.5 kb and 8.0 kb constructs (upstream of predicted exon 1; Fig. 4K) show strong fluorescence in all detected tissues except the seam cells. The 1.5 kb construct (-5500 bp to -4000 bp relative to predicted exon 1) displays expression in the seam cells, VNC and excretory canal only. The 4.0 kb construct (-8000 bp to -4000 bp) generates the complete expression pattern, indicating the presence of redundant transcriptional elements. The 5.5 kb and 8.0 kb fragments are identical to the 1.5 kb and 4.0 kb fragments, respectively, except for the addition of sequences from -4000 bp to -1 bp that include the alternative exon 1 (Fig. 4K). The addition of these sequences abolishes expression in the seam cells in these reporters. These results could be due to the presence of a seam-cell specific repressor element between -4000 bp and -1 bp. Alternatively, transcription and splicing in the seam cells might specifically generate the Class B variant that initiates translation in alternative exon 1, which would render the GFP sequences in the 5.5 kb and 8.0 kb constructs out of frame.
sma-9 functions downstream of DBL-1 to regulate body
size
The DBL-1 pathway regulates body size throughout post-embryonic development
(Savage-Dunn et al., 2000
). To
understand sma-9 function in body size development, we measured worm
length, pharynx length and the seam cell size of DBL-1 pathway mutants and
sma-9 mutants at various times after embryogenesis. The
sma-9 hatched L1 larva is indistinguishable from both wild type and
the DBL-1 pathway mutants (Fig.
5A). In L2 and L3 stages, sma-9 animals have the same
size and growth rate as the DBL-1 pathway mutants have. Furthermore, the
sma-9(lf) pharynx and seam cell lengths are
indistinguishable from those of DBL-1 pathway mutants at the L3 stage
(Fig. 5B). By contrast, another
Sma mutant, sma-1 (McKeown et
al., 1998
), which does not participate in this pathway, has a very
different distribution of cell and organ sizes
(Wang et al., 2002
). However,
after L3, sma-9 mutant growth rate increases to a wild-type rate and
finally gives the adult animals an intermediate body length
(Fig. 5A). Therefore, although
the DBL-1 pathway regulates body size throughout post-embryonic development,
sma-9 is required only in early larval development and is dispensable
later.
|
sma-9 functions downstream of DBL-1 in regulation of male
sensory ray identity
The male tail bears nine bilateral pairs of sensory rays
(Fig. 1A). Each ray contains
two neurons, an A- and a B-type neuron, and a structural cell. The cells of a
single ray derive from a common precursor cell Rn (n stands for rays 1 to 9)
generated by the posterior seam at L3. The DBL-1 pathway regulates multiple
aspects of male ray identity and morphogenesis of the spicules. In DBL-1
pathway mutants, rays 5, 7 and 9 often fuse with their anterior neighbor
(Savage et al., 1996
;
Morita et al., 1999
;
Krishna et al., 1999
), and the
fate of neurons within these rays is altered. The A-type neurons of rays 5, 7
and 9 (R5A, R7A and R9A) express a dopaminergic (DA) fate with reduced
frequency compared with wild type (Lints
and Emmons, 1999
), and in the B-type neurons of rays 5 and 9 (R5B
and R9B), serotonergic fate is ectopically expressed or abolished,
respectively (R.L. and S.W.E., unpublished)
(Table 2). Reduced DA
expression is associated with reduced expression of the dopaminergic marker
CAT-2::GFP (see Materials and methods), suggesting that cat-2 may be
a direct or indirect target of the DBL-1 pathway. In addition to having ray
defects, the spicules of DBL-1 pathway mutants fail to elongate and are
frequently crumpled.
|
Two observations support the notion that in male ray patterning sma-9 acts downstream of the DBL-1 pathway. First, the sma-9; DBL-1 pathway double mutant phenotype was similar to that of the DBL-1 pathway single mutants. Rays 5, 7 and 9 fuse with their anterior neighbor (Table 1), and serotonergic fate is expressed in ray neurons R1B, R3B and R5B in all animals but not in R9B (Table 2). Second, in a wild-type background, induction of a heat-shock promoter driven dbl-1 transgene (HS::dbl-1) during the Rn stage of ray development causes ectopic expression of the DA marker CAT-2::GFP in R3A, R4A, R6A and R8A (Table 3). By contrast, in a sma-9 mutant background, HS::dbl-1 gene activation does not induce ectopic expression of CAT-2::GFP and animals display a sma-9 mutant phenotype (Table 3). Together, these experiments suggest that sma-9 functions genetically downstream of DBL-1 signaling, and that its activity is necessary for mediating the effects of the DBL-1 pathway in male ray patterning. In addition, the HS::dbl-1 experiments reveal that, like DBL-1 pathway components, sma-9 activity is not restricted to rays 5, 7 and 9, and that the gene can function in other rays.
|
| Discussion |
|---|
|
|
|---|
A-CRYBP1. Based on the similarity of the phenotypes of
sma-9(lf) and DBL-1 pathway mutants, their genetic interactions, the
nuclear localization of endogenous SMA-9 and the overlapping expression with
DBL-1 pathway genes, we propose that SMA-9 functions as a Smad transcriptional
cofactor in the DBL-1 pathway. The similarity of specific aspects of the sma-9 and DBL-1 pathway mutant Sma and Mab phenotypes provides strong support that sma-9 functions in the DBL-1 BMP-related pathway. Like DBL-1 pathway mutants, sma-9(lf) mutants grow slowly during post-embryonic development, and have reduced body length and seam cell size (Fig. 5). From stages L1 to L3, the sma-9 mutant body size is indistinguishable from that of DBL-1 pathway mutants. In the male rays both sma-9 and DBL-1 signaling induce DA fate expression in A-type neurons of rays 5, 7 and 9; in the B-type neurons they suppress inappropriate expression of serotonergic fate in ray 5 and induce this fate in ray 9 (Table 2). Furthermore, sma-9(lf) can suppress the effects of dbl-1 overexpression in both body size and male tail phenotypes (Fig. 1, Table 3). These experiments demonstrate that sma-9 acts genetically downstream in the DBL-1 pathway.
sma-9 functions in a temporally and spatially specific
manner
sma-9(lf) mutants display a stage-specific body size
phenotype. sma-9 mutant growth rate indicates that the wild-type gene
product is required for body growth from the L1 to L3 stage, but is
dispensable at later stages (Fig.
5). As DBL-1 pathway mutants continue to grow slowly throughout
development, this suggests that after L3 some other cofactors might replace
sma-9. In contrast to lon-1 and lon-3, which
function at late larval stages (Maduzia et
al., 2002
; Morita et al.,
2002
; Nystrom et al.,
2002
; Suzuki et al.,
2002
), sma-9 is the first DBL-1 pathway component
contributing only to early larval stage body size development. The large
hypodermal syncytium hyp7 has been shown to be a crucial tissue for body size
regulation (Yoshida et al.,
2001
; Wang et al.,
2002
; Maduzia et al.,
2002
; Morita et al.,
2002
), and is a site of expression for sma-6
(Krishna et al., 1999
),
daf-4 (Gunther et al.,
2000
) and sma-3
(Savage-Dunn et al., 2000
).
SMA-9 is similarly detected in nuclei of hyp7. Furthermore, the expression of
sma-9 promoter-driven GFP is detected in the seam cells from stages
L1 to L3, coincident with the requirement for sma-9 in body size
regulation. The stage-specific sma-9 expression in the lateral seam
suggests that the seam cells, together with hyp7, play an important role in
body size regulation by the DBL-1 pathway.
In the Mab phenotype, sma-9 loss of function appears to have more restricted effects than the loss of other DBL-1 pathway components does. sma-9 mutants display ray 8-9 fusions at high frequency, but never ray 4-5 or ray 6-7 fusions (Table 1). This specificity contrasts with the function of sma-9 in regulating neurotransmitter expression in the same lineages: sma-9, like dbl-1, is required for patterning neurons within rays 5 and 7, as well as in ray 9. Therefore, the sma-9(lf) mutant phenotype is not merely a weaker version of the DBL-1 pathway loss-of-function phenotype, but rather a more specific one. For most aspects of the phenotype that are in common, the sma-9 defects are no less severe than those of DBL-1 pathway mutants. These results lead us to propose the model presented in Fig. 5C, in which target gene specificity is determined in part by the activity of sma-9 and in part by other transcriptional cofactors.
Alternative splicing may produce SMA-9 isoforms with different
activities
The presence of various SMA-9 isoforms suggests multiple functions in
signaling. One purpose of the complex splicing pattern may be to generate
isoforms with different subcellular localizations. Vertebrate Shn isoforms KRC
(Oukka et al., 2002
) and
GAAP-1 (Lallemand et al.,
2002
) have been demonstrated to reside in both the nucleus and the
cytoplasm, suggesting that their activity might be regulated by subcellular
compartmentalization. In the case of SMA-9, the localization properties of
predicted isoforms are not yet known. However, SMA-9 isoforms differ in the
number of NLSs. N-terminal variant A is predicted to lack the strongest NLS
encoded by exon 5 (Fig. 3).
More strikingly, the SL2-spliced variant of isoform IIb would lack all of the
predicted NLS sequences, suggesting either a function in the cytoplasm or a
need to interact with a nuclear-localized factor to shuttle into the nucleus.
A second purpose of alternative splicing may be the generation of cell-type
specific isoforms. The use of diverse regulatory sequences both upstream and
downstream of the alternative exon 1 could contribute to such cell-type
specificity. We suggest that various SMA-9 isoforms have distinct but
overlapping functions in the DBL-1 pathway. Finally, some SMA-9 isoforms may
not function in the DBL-1 pathway but may serve other functions.
Interestingly, sma-9(lf) mutants have a mesodermal defect
that is independent of DBL-1 function (M.L.F. and J. Liu, unpublished).
Conservation of Shn/SMA-9 function in BMP signaling
In Drosophila, Shn has been identified as a Smad cofactor in the
Dpp BMP-related pathway (Dai et al.,
2000
). The identification of SMA-9, a Shn homolog, in a BMP
signaling pathway in a distantly related animal phylum provides the first
evidence for a conserved role for Shn proteins in BMP signaling.
Drosophila shn mutants have a less severe phenotype than dpp
null mutants (Arora et al.,
1995
). Similarly, sma-9 mutants at first appear to
display weaker defects in both body size and male tail pattern than DBL-1
pathway mutants do. However, because sma-9 mutants are viable, we
have been able to analyze phenotypes throughout the course of development, and
we make the assessment that the sma-9 mutant phenotype is not weaker
but rather is more specific than that of the DBL-1 pathway mutants as
discussed above. These results suggest that Shn may also function in a
specific manner in the Drosophila Dpp pathway.
Vertebrate homologs of SMA-9 and Shn have been identified, but have not been shown to function in BMP signaling. Our results on SMA-9 suggest that it may be necessary to consider the existence of multiple isoforms with divergent functions. One motif that may be associated with a conserved function is the first pair of zinc fingers in SMA-9, which is highly conserved among these proteins (Fig. 2C). Other motifs may be associated with unique functions. It is likely that the complexity of functions mediated by this family is only just beginning to be appreciated.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Arora, K., Dai, H., Kazuko, S. G., Jamal, J., O'Connor, M. B., Letsou, A. and Warrior, R. (1995). The Drosophila schnurri gene acts in the Dpp/TGF beta signaling pathway and encodes a transcription factor homologous to the human MBP family. Cell 81,781 -790.[CrossRef][Medline]
Barr, M. M. and Sternberg, P. W. (1999). A polycystic kidney-disease gene homologue required for male mating behaviour in C. elegans. Nature 401,386 -389.[CrossRef][Medline]
Blumenthal, T., Evans, D., Link, C. D., Guffanti, A., Lawson, D., Thierry-Mieg, J., Thierry-Mieg, D., Chiu, W. L., Duke, K., Kiraly, M. and Kim, S. K. (2002). A global analysis of Caenorhabditis elegans operons. Nature 417,851 -854.[CrossRef][Medline]
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Campbell, G. and Tomlinson, A. (1999). Transducing the Dpp morphogen gradient in the wing of Drosophila: regulation of Dpp targets by brinker. Cell 96,553 -562.[CrossRef][Medline]
Chen, X., Rubock, M. J. and Whitman, M. (1996). A transcriptional partner for Mad proteins in TGF-ß signalling. Nature 389,691 -696.
Collet, J., Spike, C. A., Lundquist, E. A., Shaw, J. E. and
Herman, R. K. (1998). Analysis of osm-6, a gene that
affects sensory cilium structure and sensory neuron function in
Caenorhabditis elegans. Genetics
148,187
-200.
Dai, H., Hogan, C., Gopalakrishnan, B., Torres-Vazquez, J., Nguyen, M., Park, S., Raftery, L. A., Warrior, R. and Arora, K. (2000). The zinc finger protein schnurri acts as a Smad partner in mediating the transcriptional response to decapentaplegic. Dev. Biol. 227,373 -387.[CrossRef][Medline]
Estevez, M., Attisano, L., Wrana, J. L., Albert, P. S., Massague, J. and Riddle, D. L. (1993). The daf-4 gene encodes a bone morphogenetic protein receptor controlling C. elegans dauer larva development. Nature 365,644 -649.[CrossRef][Medline]
Fan, C. M. and Maniatis, T. (1990). A
DNA-binding protein containing two widely separated zinc finger motifs that
recognize the same DNA sequence. Genes Dev.
4, 29-42.
Gascoigne, N. R. (2001). Positive selection in a Schnurri. Nat. Immunol. 2, 989-991.[CrossRef][Medline]
Grieder, N. C., Nellen, D., Burke, R., Basler, K. and Affolter, M. (1995). Schnurri is required for Drosophila Dpp signaling and encodes a zinc finger protein similar to the mammalian transcription factor PRDII-BF1. Cell 81,791 -800.[CrossRef][Medline]
Gunther, C. V., Georgi, L. L. and Riddle, D. L. (2000). A Caenorhabditis elegans type I TGF beta receptor can function in the absence of type II kinase to promote larval development. Development 127,3337 -3347.[Abstract]
Hata, A., Seoane, J., Lagna, G., Montalvo, E., Hemmati-Brivanlou, A. and Massague, J. (2000). OAZ uses distinct DNA- and protein-binding zinc fingers in separate BMP-Smad and Olf signaling pathways. Cell 100,229 -240.[CrossRef][Medline]
Hill, C. S., Packman, L. C. and Thomas, J. O. (1990). Phosphorylation at clustered -Ser-Pro-X-Lys/Argmotifs in sperm-specific histones H1 and H2B. EMBO J. 9, 805-813.[Medline]
Hogan, B. L. (1996). Bone morphogenetic proteins in development. Curr. Opin. Genet. Dev. 6, 432-438.[CrossRef][Medline]
Huang, T., Kuersten, S., Deshpande, A. M., Spieth, J.,
MacMorris, M. and Blumenthal, T. (2001). Intercistronic
region required for polycistronic premRNA processing in Caenorhabditis
elegans. Mol. Cell. Biol.
21,1111
-1120.
Hurd, D. D. and Kemphues, K. J. (2003). PAR-1 is required for morphogenesis of the Caenorhabditis elegans vulva. Dev. Biol. 253,54 -65.[CrossRef][Medline]
Jazwinska, A., Kirov, N., Wieschaus, E., Roth, S. and Rushlow, C. (1999). The Drosophila gene brinker reveals a novel mechanism of Dpp target gene regulation. Cell 96,563 -573.[CrossRef][Medline]
Krishna, S., Maduzia, L. L. and Padgett, R. W. (1999). Specificity of TGFbeta signaling is conferred by distinct type I receptors and their associated SMAD proteins in Caenorhabditis elegans. Development 126,251 -260.[Abstract]
Lallemand, C., Palmieri, M., Blanchard, B., Meritet, J. F. and Tovey, M. G. (2002). GAAP-1: a transcriptional activator of p53 and IRF-1 possesses pro-apoptotic activity. EMBO Rep. 3,153 -158.[CrossRef][Medline]
Lints, R. and Emmons, S. W. (1999). Patterning of dopaminergic neurotransmitter identity among Caenorhabditis elegans ray sensory neurons by a TGFbeta family signaling pathway and a Hox gene. Development 126,5819 -5831.[Abstract]
Lints, R. and Emmons, S. W. (2002). Regulation
of sex-specific differentiation and mating behavior in C. elegans by a new
member of the DM domain transcription factor family. Genes
Dev. 16,2390
-2402.
Liu, Z., Kirch, S. and Ambros, V. (1995). The C. elegans heterodronic gene pathway controls stage-specific transcription of collagen genes. Development 121,2471 -2478.[Abstract]
Loer, C. M. and Kenyon, C. J. (1993). Serotonin-deficient mutants and male mating behavior in the nematode Caenorhabditis elegans. J. Neurosci. 13,5407 -5417.[Abstract]
Maduzia, L. L., Gumienny, T. L., Zimmerman, C. M., Wang, H., Shetgiri, P., Krishna, S., Roberts, A. F. and Padgett, R. W. (2002). lon-1 regulates Caenorhabditis elegans body size downstream of the dbl-1 TGF beta signaling pathway. Dev. Biol. 246,418 -428.[CrossRef][Medline]
Marty, T., Muller, B., Basler, K. and Affolter, M. (2000). Schnurri mediates Dpp-dependent repression of brinker transcription. Nat. Cell Biol. 2, 745-749.[CrossRef][Medline]
Massague, J. (1998). TGF-beta signal transduction. Annu. Rev. Biochem. 67,753 -791.[CrossRef][Medline]
McKeown, C., Praitis, V. and Austin, J. (1998). sma-1 encodes a betaH-spectrin homolog required for Caenorhabditis elegans morphogenesis. Development 125,2087 -2098.[Abstract]
Mello, C. C., Kramer, J. M., Stinchcomb, D. T. and Ambros, V. (1991). Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10,3959 -3970.[Medline]
Morita, K., Chow, K. L. and Ueno, N. (1999). Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of TGF-beta family. Development 126,1337 -1347.[Abstract]
Morita, K., Flemming, A. J., Sugihara, Y., Mochii, M., Suzuki, Y., Yoshida, S., Wood, W. B., Kohara, Y., Leroi, A. M. and Ueno, N. (2002). A Caenorhabditis elegans TGF-beta, DBL-1, controls the expression of LON-1, a PR-related protein, that regulates polyploidization and body length. EMBO J. 21,1063 -1073.[CrossRef][Medline]
Muller, B., Hartmann, B., Pyrowolakis, G., Affolter, M. and Basler, K. (2003). Conversion of an extracellular Dpp/BMP morphogen gradient into an inverse transcriptional gradient. Cell. 113,221 -233.[CrossRef][Medline]
Nakamura, T., Donovan, D. M., Hamada, K., Sax, C. M., Norman,
B., Flanagan, J. R., Ozato, K., Westphal, H. and Piatigorsky, J.
(1990). Regulation of the mouse alpha A-crystallin gene:
isolation of a cDNA encoding a protein that binds to a cis sequence motif
shared with the major histocompatibility complex class I gene and other genes.
Mol. Cell. Biol. 10,3700
-3708.
Nakayama, T., Cui, Y. and Christian, J. L. (2000). Regulation of BMP/Dpp signaling during embryonic development. Cell. Mol. Life Sci. 57,943 -956.[CrossRef][Medline]
Nystrom, J., Shen, Z. Z., Aili, M., Flemming, A. J., Leroi, A.
and Tuck, S. (2002). Increased or decreased levels of
Caenorhabditis elegans lon-3, a gene encoding a collagen, cause reciprocal
changes in body length. Genetics
161, 83-97.
Oukka, M., Kim, S. T., Lugo, G., Sun, J., Wu, L. C. and Glimcher, L. H. (2002). A mammalian homolog of Drosophila schnurri, KRC, regulates TNF receptor-driven responses and interacts with TRAF2. Mol. Cell. 9,121 -131.[CrossRef][Medline]
Patterson, G. I. and Padgett, R. W. (2000). TGF beta-related pathways. Roles in Caenorhabditis elegans development. Trends Genet. 16,27 -33.[CrossRef][Medline]
Randall, R. A., Germain, S., Inman, G. J., Bates, P. A. and Hill, C. S. (2002). Different Smad2 partners bind a common hydrophobic pocket in Smad2 via a defined proline-rich motif. EMBO J. 21,145 -156.[CrossRef][Medline]
Savage, C., Das, P., Finelli, A. L., Townsend, S. R., Sun, C.
Y., Baird, S. E. and Padgett, R. W. (1996). Caenorhabditis
elegans genes sma-2, sma-3, and sma-4 define a conserved family of
transforming growth factor beta pathway components. Proc. Natl.
Acad. Sci. USA 93,790
-794.
Savage-Dunn, C. (2001). Targets of TGF beta-related signaling in Caenorhabditis elegans. Cytokine Growth Factor Rev. 12,305 -312.[CrossRef][Medline]
Savage-Dunn, C., Tokarz, R., Wang, H., Cohen, S., Giannikas, C. and Padgett, R. W. (2000). SMA-3 Smad has specific and critical functions in DBL-1/SMA-6 TGFbeta-related signaling. Dev. Biol. 223,70 -76.[CrossRef][Medline]
Savage-Dunn, C., Maduzia, L. L., Zimmerman, C. M., Roberts, A. F., Cohen, S., Tokarz, R. and Padgett, R. W. (2003). A genetic screen for small body size mutants in C. elegans reveals many TGFß pathway components. Genesis 35,239 -247.[CrossRef][Medline]
Seeler, J. S., Muchardt, C., Suessle, A. and Gaynor, R. B.
(1994). Transcription factor PRDII-BF1 activates human
immunodeficiency virus type 1 gene expression. J.
Virol. 68,1002
-1009.
Shi, Y., Wang, Y. F., Jayaraman, L., Yang, H., Massague, J. and Pavletich, N. P. (1998). Crystal structure of a Smad MH1 domain bound to DNA: insights on DNA binding in TGF-beta signaling. Cell 94,585 -594.[CrossRef][Medline]
Staehling-Hampton, K., Laughon, A. S. and Hoffmann, F. M. (1995). A Drosophila protein related to the human zinc finger transcription factor PRDII/MBPI/HIV-EP1 is required for dpp signaling. Development 121,3393 -3403.[Abstract]
Sulston, J. E. and Horvitz, H. R. (1977). Post-embryonic cell lineages of the nematode Caenorhabditis elegans. Dev. Biol. 56,110 -156.[CrossRef][Medline]
Suzuki, Y., Yandell, M. D., Roy, P. J., Krishna, S., Savage-Dunn, C., Ross, R. M., Padgett, R. W. and Wood, W. B. (1999). A BMP homolog acts as a dose-dependent regulator of body size and male tail patterning in Caenorhabditis elegans. Development 126,241 -250.[Abstract]
Suzuki, Y., Morris, G. A., Han, M. and Wood, W. B. (2002). A cuticle collagen encoded by the lon-3 gene may be a target of TGF-beta signaling in determining caenorhabditis elegans body shape. Genetics 162,1631 -1639.