|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 November 2003
doi: 10.1242/dev.00894
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Department of Molecular and Cell Biology, University of California, Berkeley, Berkeley, CA 94720-3204, USA
Author for correspondence (e-mail:
garriga{at}uclink4.berkeley.edu)
Accepted 22 September 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Caenorhabditis elegans, HLH-14, HLH-2, bHLH, Proneural, Neuroblast
| Introduction |
|---|
|
|
|---|
The first proneural genes identified were the Achaete-Scute (A-S) Complex
genes in Drosophila. Genes in this family include achaete
(ac), scute (sc), lethal of scute
(lsc) and asense (ase), and are required for
external sense organ development
(Garcia-Bellido, 1979
;
Gonzalez et al., 1989
;
Villares and Cabrera, 1987
).
Later work in Drosophila identified atonal (ato),
the founding member of another proneural bHLH gene family, as crucial for the
development of internal sense organs, the chordotonal organs
(Jarman et al., 1993
). Other
fly Atonal family members are also involved in sense organ development and
include absent of MD neurons and olfactory sensilla (amos)
and cousin of atonal (cato)
(Goulding et al., 2000a
;
Goulding et al., 2000b
;
Huang et al., 2000
).
Proneural genes can act as developmental switches that control neural fate.
In general, proneural gene expression promotes the generation of neuroblasts
at the expense of adjacent cell types, like epidermal cells. Flies lacking
ac and sc function, for example, are missing most of their
mechanosensory and chemosensory organs
(Bertrand et al., 2002
;
Garcia-Bellido, 1979
) because
of a failure to select sensory organ progenitors from the ectoderm. Ectopic
expression of A-S genes in the ectoderm can induce the development of ectopic
sensory organs at the expense of dermal cells
(Dominguez and Campuzano,
1993
; Rodriguez et al.,
1990
). Similarly, flies lacking ato gene function are
missing their chordotonal sensory organs, and ectopic expression of Atonal
family members promotes the formation of extra chordotonal organs
(Chien et al., 1996
;
Goulding et al., 2000b
;
Huang et al., 2000
;
Jarman et al., 1993
).
In vertebrates, members of the A-S, Atonal and Neurogenin (Ngn) bHLH
families all exhibit proneural characteristics. Again, specification of
neuroblast cell fate is a crucial function of these factors. For example, the
A-S protein Ash1 is present in most, if not all, vertebrates
(Allende and Weinberg, 1994
;
Ball et al., 1993
;
Ferreiro et al., 1993
;
Frowein et al., 2002
;
Verma-Kurvari et al., 1996
).
Mice lacking functional Mash1 (mouse Ash1) have neurogenesis defects in the
ventral telencephalon and olfactory sensory epithelium
(Casarosa et al., 1999
;
Guillemot et al., 1993
;
Horton et al., 1999
). These
defects are correlated with an absence of progenitor cells, consistent with
Mash1 promoting neurogenesis.
C. elegans, like Drosophila and vertebrates, has a number
of neural bHLH proteins. To date, the most extensively characterized is
LIN-32, the sole C. elegans Atonal family member
(Ledent et al., 2002
;
Zhao and Emmons, 1995
).
Reminiscent of Drosophila atonal mutants, lin-32 mutants
lack some sensory organs (Portman and
Emmons, 2000
; Zhao and Emmons,
1995
). In particular, lin-32 mutant males lack rays,
peripheral sensory organs of the male tail that are important for sensing
hermaphrodites during mating (Zhao and
Emmons, 1995
). Ectopic expression of LIN-32 under a ubiquitous
heat-shock promoter is sufficient to generate ectopic ray papillae structures
(Zhao and Emmons, 1995
).
bHLH proteins usually activate transcription of target genes as
heterodimers with members of the E/Daughterless (DA) bHLH family
(Cabrera and Alonso, 1991
;
Johnson et al., 1992
;
Massari and Murre, 2000
).
Heterodimer formation is mediated by the helices of the bHLH proteins, while
the basic regions are important for binding to DNA sequences with an E-box
motif, CANNTG. In C. elegans, both LIN-32 and the A-S protein HLH-3
can bind to the C. elegans E/DA homolog, HLH-2, in the presence of
E-box motifs (Krause et al.,
1997
; Portman and Emmons,
2000
; Thellmann et al.,
2003
). Both LIN-32 and HLH-3 are expressed in many of the same
neuronal lineages as HLH-2 and probably require heterodimerization for the
proper execution of some of these lineages
(Krause et al., 1997
;
Portman and Emmons, 2000
;
Thellmann et al., 2003
).
In this study, we characterize a new C. elegans A-S family member, HLH-14. We find that hlh-14 function is required for the production of specific neurons, notably three lineally related neurons: the PVQ interneuron, the HSN motoneuron, and the PHB sensory neuron. Like other A-S factors, HLH-14 is expressed in neuronal precursors and has proneural characteristics. Yet HLH-14 does not have a strictly proneural role; it appears to act in neuronal differentiation as well. Additionally, genetic data suggest that hlh-14 and hlh-2 act together in neurogenesis.
Surprisingly, we find that loss of hlh-14 function causes an asymmetric cell division defect. Specifically, in hlh-14 mutants, the PVQ/HSN/PHB neuroblast appears to assume characteristics of its sister cell, the hyp7/T blast cell. Taken together with previous studies in nematodes, we propose that C. elegans proneural genes play slightly different roles from their Drosophila or vertebrate counterparts. In particular, C. elegans proneural genes such as hlh-14 can promote neurogenesis, in part, by regulating asymmetric cell divisions. Additionally, C. elegans proneural genes lack the specificity of their homologs and promote neuroblast lineages that generate neural cells of disparate function.
| Materials and methods |
|---|
|
|
|---|
Strains with the following mutant alleles, chromosomal aberrations or transgenic arrays were used in this work. Unreferenced strains were generated in the course of this study.
Linkage Group (LG) I
unc-13(e51) (Brenner,
1974
), hlh-2(bx115)
(Portman and Emmons, 2000
),
ynIs45[flp-15::gfp] (Li
et al., 1999
), nuIs11[osm-10::gfp]
(Hart et al., 1999
) and
kyIs39[sra-6::gfp]
(Troemel et al., 1995
).
LG II
bli-2(st1016) (Nonet
et al., 1997
), lin-4(e912)
(Horvitz and Sulston, 1980
),
dpy-10(e128) (Brenner,
1974
), clr-1(e1745)
(Way and Chalfie, 1988
),
hlh-14(gm34), hlh-14(ju243) (W.-M. Woo and
A. Chisholm, personal communication), gmIs20[hlh-14::gfp],
mIn1 (Edgley and Riddle,
2001
), maDf4 (V. Ambros, personal communication),
ccDf5 (Chen et al.,
1992
).
LG III
gmIs12[srb-6::gfp] (N. Hawkins, personal communication)
(Troemel et al., 1995
),
gmIs21[nlp-1::gfp] (Li
et al., 1999
).
LG IV
kyIs179[unc-86::gfp]
(Gitai et al., 2003
),
ham-1(n1811) (Desai et
al., 1988
; Guenther and
Garriga, 1996
), ced-3(n717)
(Ellis and Horvitz, 1986
).
LG V
gmIs22[nlp-1::gfp]
(Li et al., 1999
).
Extrachromosomal arrays
gmEx281[hlh-14::gfp],
leEx887[C50B6.8::gfp]
(Mounsey et al., 2002
).
Isolation of hlh-14 mutants and cloning of hlh-14
hlh-14(gm34) was isolated in a genetic screen for mutants
with missing or misplaced HSN motoneurons (G.G., unpublished), and
hlh-14(ju243) was isolated in a screen for mutants with
morphological defects (W.-M. Woo and A. Chisholm, personal communication). As
the two alleles displayed similar defects and mapped to the same region of
LG II, a complementation test was performed, confirming that they are
allelic.
hlh-14(gm34) was genetically mapped between bli-2 and lin-4 on LG II. From worms of the parental genotype hlh-14(gm34)/bli-2(st1016) lin-4(e912), 4/11 Bli nonLin recombinant progeny segregated the hlh-14(gm34) mutation. Corroborating this map position, the deficiency maDf4 fails to complement hlh-14(gm34), but the deficiency ccDf5 complements hlh-14(gm34). Few C. elegans cosmid clones are in the region corresponding to these mapping data. Rescue of Hlh-14 phenotypes was achieved with injection of two of the cosmids in this region, F22C7 and C18A3, both of which contain the hlh-14-coding region, C18A3.8.
Detection of hlh-14 mutant lesions
To detect lesions in hlh-14 mutants, we PCR amplified the genomic
region of hlh-14 from mutant genomic DNA and sequenced the amplicons.
To obtain mutant genomic DNA, we picked about five mutant worms into the cap
of a PCR tube containing 10 µl of lysis buffer (10 mM Tris pH 8.2, 50 mM
KCl, 2.5 mM MgCl2, 0.45% Tween 20, 0.05% gelatin). The tubes were
briefly centrifuged to bring down the lysis buffer and worms and then placed
on dry ice for 10 minutes. The tubes were thawed at room temperature and then
placed in the PCR machine for a lysis reaction (60 minutes at 60°C,
followed by 15 minutes at 95°C). Lysate (3 µl) was used as a genomic
DNA template for PCR reactions.
To amplify the hlh-14-coding region for sequencing, the primers C18A3.8-L1 (5' AGACAATGCAAATTGGGAGG 3') and C18A3.8-R1 (5' GCTAATTGACTCTCGTCCGC 3') were used. The resulting 5.9 kb product was used as a template to reamplify the region with the primers C18A3.8-L2 (5' TACATCGCCTGCAGTAGTGG 3') and C18A3.8-R2 (5' TTGGTATGGGAGGAGAGTGC 3'), yielding a 5.2 kb product.
To sequence the hlh-14-coding region, the primers bg1-s1 (5' ATACCTCCCACATTTTGG 3'), bg1-s2 (5' CACCACCGTCTTCCCT 3'), bg1-s4 (5' TCACAAGTAGTATTCTTCC 3') and bg1-s5 (5' CATAGAAGTACACATGATTG 3') were used. Sequencing reactions with bg1-s2 and bg1-s5 reliably detected the hlh-14 lesions.
hlh-14 5' and 3' RACE
To perform 5' and 3' RACE, 5' and 3' C.
elegans cDNA libraries were made using the SMARTTM RACE cDNA
Amplification Kit protocol (Clontech). Using these libraries as a template,
3' RACE PCR was performed using the primers BG1-GSPL2 (5'
CAGAAATGAGAGAGAACGCAAGCG 3') and Clontech's UPM primer mix. This
reaction amplified the 3' cDNA end common to all hlh-14
cDNAs.
5' RACE was performed using a number of different primers. Using library template, the UPM primer mix and the primer BG1-GSPR1 (5' TGCTGTTGTTCATCGTGTAGTCGG 3'), we amplified the 5' end of one hlh-14 transcript, designated hlh-14 Short; this cDNA represents the shortest hlh-14 transcript. We believe this is the 5' end of the most common hlh-14 transcript because it is the only one we can amplify without a second nested reaction. The 5' ends of two other transcripts were detected with nested reactions. They were amplified with a primary PCR reaction using library template, the UPM primer mix and the primer BG1-GSPR3 (5' GCTAATGGTGAGAGGAAAGGCGGG 3'). The resulting amplicon was used as a template to detect the 5' ends of the less common hlh-14 transcripts. The primers for this second, nested reaction were Clontech's NUP primer and BG1-GSPR4 (5' GGATATTGGCACAAACCGTATTGGC 3').
Generation of hlh-14::gfp transgenes
To generate the full-length hlh-14::gfp transgene, the primers
BG1GFP-L4 (5' AAATGTCGACCAACATGCAAAAGCTAATGGG 3') and BG1GFP-R2
(5' CCAAGGATCCATGGTGTGGATAATTGGAATATGA 3') were used to amplify
the promoter and coding regions of hlh-14, using the cosmid F22C7 as
a template. The resulting 8.4 kb genomic product and the GFP vector pPD95.77
(A. Fire, S. Xu, J. Ahnn and G. Seydoux, unpublished) were double digested
with SalI and BamHI and ligated together. The resulting
construct was co-injected into hlh-14(gm34)/mIn1
animals at a concentration of 0.5 ng/µl with the pRF4 plasmid
(Mello et al., 1991
) at a
concentration of 50 ng/µl. Rescued hlh-14(gm34) animals
were found among the transgenic progeny, establishing the extrachromosomal
array line gmEx281. Rescued animals were identified by the absence of
the mIn1 GFP balancer, the presence of the array (pRF4-bearing Rol
progeny), and the absence of Hlh-14 morphological defects. Prior to array
integration, hlh-14(gm34); gmEx281 animals were
backcrossed to wild-type animals, and gmEx281 was recovered in a
wild-type background.
The extrachromosomal array gmEx281 was integrated into the genome by UV irradiation. L4 stage gmEx281 worms were washed four times with M9 and placed on a NGM agar plate without bacteria. The worms were irradiated in a UV Stratalinker at a strength of 250 µJx100 and allowed to recover on bacteria at 15°C overnight and lay eggs the next day. Approximately 150 F1 progeny were cloned to individual plates and allowed to produce F2 progeny; two or three F2 animals per F1 plate were cloned to new individual plates. F3 progeny were then scored for 100% transgenic animals (pRF4 Rol phenotype). In this way, the integrated array gmIs20 was generated.
Detection and analysis of specific neurons
The HSN neurons were detected in larvae using the unc-86::gfp
reporter, kyIs179 (Gitai et al.,
2003
). The HSN neurons were detected in adult worms using the
serotonin staining procedure as described
(Garriga et al., 1993
). The
PHB neurons were detected with two different GFP reporters. The
srb-6::gfp reporter (Troemel et
al., 1995
), which was integrated onto LG III to form the
strain gmIs12 (N. Hawkins, personal communication), detected both the
PHA and PHB phasmid neurons. The nlp-1::gfp reporter
(Li et al., 1999
)
gmEx285 was integrated onto LG III and LG V to form
the arrays gmIs21 and gmIs22, respectively; these arrays
specifically detected the PHB neurons. The PHA neurons were detected using the
flp-15::gfp reporter ynIs45
(Li et al., 1999
) and the
osm-10::gfp reporter nuIs11
(Hart et al., 1999
)
(PHA-specific in adults). The PVQ neurons were detected using the
sra-6::gfp reporter kyIs39
(Troemel et al., 1995
).
All neurons were visualized using a Zeiss Axioskop compound microscope. Some images were captured using Elite Chrome 100 color film (Kodak) and developed into slides. Other images were captured with a Hamamatsu ORCA-ER digital camera and saved as OpenLab files. Images were formatted using Adobe Photoshop.
Lineage analysis of living embryos
Lineage analysis was performed for two experiments: determining that
hlh-14::gfp is expressed in the PVQ/HSN/PHB neuroblast lineage; and
determining the cell lineage defect of hlh-14(gm34) embryos.
For both experiments, embryos were mounted on 5% agar pads in 2 µl of M9
buffer and examined on a Zeiss Axioskop compound microscope by Nomarski
optics. Specific cells were identified relative to nearby landmark cell deaths
(Sulston et al., 1983
). In the
analysis of hlh-14(gm34) embryos, lineaging began at the
four-cell stage and was followed for only one of the two bilaterally symmetric
lineages. Lineages were observed until the comma stage of development.
RNA interference and analyses
RNA interference experiments were performed on two genes, hlh-14
and hlh-2. hlh-14 sequences were amplified from C. elegans
cDNA library template (see 5' and 3' RACE Methods) using the
primers BG1-LHIS1 (5' GAATCTGCAGCAATGGGTCTGAGCTCAGATTTTC 3') and
BG1-RHIS3 (5' CAAAAAGCTTTTAATGGTGTGGATAATTGGAATATG 3'), yielding a
0.7 kb product. hlh-2 sequences were amplified from C.
elegans genomic DNA using the primers HLH-2L (5'
GTTGACTACAATCATCAATTCCCACC 3') and HLH-2R (5'
TTAAAACCGTGGATGTCCAAACTGC 3'), yielding a 0.8 kb product.
PCR products were cloned into the TA cloning vector, pGEM T-Easy (Promega). This vector is equipped with T7 and SP6 promoters flanking the site of DNA insertion. Following the protocols of Promega's Ribomax in vitro transcription kit, sense and antisense RNAs were made using the T7 and SP6 sites. Sense and antisense RNAs (1 µl of each) were run side by side on a 1.7% agarose gel to estimate relative concentrations. Based on this estimation, equimolar amounts of sense and antisense RNA were mixed with PBS (1x final concentration), incubated at 65°C for 15 minutes, and then incubated at 37°C for 30 minutes to complete the annealing reaction. To confirm the annealing reactions had worked, 1 µl of each ssRNA species was run on a 1.7% agarose gel next to 1 µl of dsRNA. A shifted banding pattern indicated successful annealing.
To control for general effects of RNAi, we injected dsRNA molecules of genes used in a separate study. Control RNAi injections did not phenocopy hlh-14 and hlh-2 dsRNA injections. To make control dsRNA molecules, we obtained cDNA phage clones from Yuji Kohara: yk394g5 (egr-1), yk73c3 (chd-3) and yk72d6 (chd-4). cDNAs were excised from phage following protocols provided by Yuji Kohara. After excision, the cDNAs were in the pBluescript plasmid, which is equipped with T7 and T3 transcription sites flanking the sites of cDNA insertion. Using both the T7 and T3 sites, sense and antisense transcripts were made for each clone, according to the protocol described in Promega's RiboMax in vitro transcription kit. Annealing and RNA integrity analyses were performed as described above.
For RNA interference, dsRNA was always injected into young adult worms at the maximum possible concentration; it was never diluted after the annealing reactions. Injected animals were picked to plates seeded with bacteria, allowed to lay eggs for 24 hours, and then transferred to fresh plates. Progeny laid after the first 24 hours were likely to display RNAi defects.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
In the posterior embryo, we first detect HLH-14::GFP in the bilaterally symmetric blast cells ABplapppa and ABprapppa. Respectively, we call these cells the left and right PVQ/HSN/PHB neuroblasts (Fig. 3B,D) because they generate the PVQ interneurons, the HSN motoneurons, and the PHB sensory neurons. A centrally located posterior blast cell expresses HLH-14::GFP a little later. We have tentatively identified this centrally located cell as C.aapa (Fig. 3F).
|
hlh-14 mutants are missing HSN motoneurons and PHB sensory
neurons
In hermaphrodite larvae, a left/right bilaterally symmetric pair of HSN
motoneurons is found at the middle of the animal, near the presumptive gonad.
By Nomarski optics, we only rarely found the HSNs in hlh-14 mutant
worms; when we did find them, they were displaced posteriorly, having failed
to complete their normal migratory routes (data not shown). We corroborated
this observation using an HSN reporter, unc-86::gfp
(Gitai et al., 2003
).
unc-86 encodes a POU homeodomain protein, and this promoter fusion
always expresses GFP in the HSNs of wild-type larvae
(Fig. 4A). By contrast, we
never saw HSNs expressing GFP in hlh-14(gm34);
unc-86::gfp larvae (Fig.
4B; Table 2).
|
The PHB sensory neuron is the sister cell of the HSN. As hlh-14
mutants lack HSNs, we hypothesized that they might also lack PHBs. To test
this possibility, we used the reporter srb-6::gfp, which expresses
GFP in both the PHA and PHB phasmid neurons, sensory neurons that are located
in the tail. srb-6 encodes a seven transmembrane receptor protein
expressed in several sensory neurons
(Troemel et al., 1995
).
Wild-type srb-6::gfp animals always had two GFP-expressing neurons on
each side of the tail, one PHA and one PHB
(Fig. 4C;
Table 1). By contrast,
hlh-14; srb-6::gfp larvae almost always had only a single
GFP-expressing neuron per side, consistent with hlh-14 mutants
missing their PHB neurons (Fig.
4D, Table 1).
To eliminate the possibility that hlh-14 mutants lacked PHAs and
not PHBs, we used more specific markers (data not shown). With the
PHB-specific neuropeptide-like promoter fusion nlp-1::gfp
(Li et al., 1999
), we found
that hlh-14 mutants lacked PHB neurons. With the PHA-specific
promoter fusions flp-15::gfp (Li
et al., 1999
) and osm-10::gfp
(Hart et al., 1999
)
(PHA-specific in adults), we found no alteration in the number of PHA neurons
in hlh-14 mutants.
hlh-14 mutations are epistatic to mutations that disrupt the
HSN/PHB neuroblast division
hlh-14 mutants have the opposite neuronal phenotype as
ham-1 mutants. ham-1 encodes a novel protein involved in
executing the asymmetric divisions of neuroblasts
(Guenther and Garriga, 1996
).
In ham-1 mutants, the HSN/PHB neuroblast divides symmetrically,
inappropriately generating two HSN/PHB precursor cells, and subsequently,
extra HSN and PHB neurons. This phenotype can be seen using
srb-6::gfp, where PHB neuron duplications generate extra
GFP-expressing phasmid neurons about 25% of the time in ham-1 mutants
(Table 1). In ham-1
ced-3 double mutants, the phenotype is more striking
(Table 1). Concurrent removal
of the novel protein HAM-1 and the caspase CED-3, which is necessary for
normal programmed cell death (Ellis and
Horvitz, 1986
; Yuan et al.,
1993
), can increase the penetrance of extra PHB neurons to over
90% (Guenther and Garriga,
1996
).
We reasoned that if hlh-14 mutations were affecting the overall ability to determine neuronal fate, hlh-14 should be epistatic to ham-1. Indeed this is the case, as hlh-14; ham-1 double mutants were always missing their PHB neurons (Table 1). To rule out the possibility that the effects we saw in hlh-14 mutants were simply due to inappropriate programmed cell death, we examined hlh-14; ham-1 ced-3 triple mutants. As with hlh-14 single mutants, these triply mutant animals were always missing their PHB neurons (Table 1). We conclude that hlh-14 mutations are epistatic to mutations that alter the HSN/PHB neuroblast division. Furthermore, hlh-14 mutants are not missing neurons because of inappropriate programmed cell death. Therefore, hlh-14 appears to be a vital factor in determining the HSN/PHB neuroblast fate, or the fate of a cell that generates the HSN/PHB neuroblast.
hlh-14 mutants are missing PVQ neurons
Considering the HLH-14::GFP expression pattern, we hypothesized that the
PVQ neurons might be missing or defective in hlh-14 mutants. Analysis
of the tails of hlh-14 mutants by Nomarski optics suggested that the
PVQs were missing (data not shown). To test this hypothesis directly, we used
the PVQ-specific GFP reporter, sra-6::gfp
(Troemel et al., 1995
).
Wild-type sra-6::gfp animals always had PVQ neurons expressing GFP
(Fig. 4E;
Table 3). By contrast,
sra-6::gfp; hlh-14(gm34) animals never had PVQ
neurons expressing GFP (Fig.
4F; Table 3).
hlh-14 mutants have a cell division defect in the
PVQ/HSN/PHB neuroblast lineage
The preceding data are consistent with HLH-14 acting to promote the PVQ,
HSN and PHB fates. HLH-14 could act directly in these neurons. However, as
HLH-14 is an A-S family member, it could play a proneural role, acting earlier
to ensure the proper execution of the entire PVQ/HSN/PHB neuroblast lineage.
To address this possibility, we directly observed the cell division patterns
of hlh-14(gm34) mutant embryos.
We examined two PVQ/HSN/PHB neuroblast lineages in
hlh-14(gm34) embryos. In wild-type embryonic lineages
(Fig. 5A), the ABpl/rappp cell
divides to generate the PVQ/HSN/PHB neuroblast and the hyp7/T blast cell
around 170 minutes after fertilization
(Sulston et al., 1983
). This
division occurred at the right time in each hlh-14(gm34)
mutant lineage. Approximately 230 minutes after fertilization in wild-type
embryos, the PVQ/HSN/PHB neuroblast divides to generate the PVQ neuroblast and
the HSN/PHB neuroblast (Fig.
5A). This division also appeared to occur normally in
hlh-14(gm34) embryos. Approximately 280 minutes after
fertilization in wild-type embryos, the HSN/PHB neuroblast divides, and at
310 minutes, the PVQ neuroblast divides
(Fig. 5A). Neither of these
divisions occurred in the hlh-14(gm34) embryos.
|
In hlh-14 mutants, the PVQ/HSN/PHB neuroblast may be
transformed into its sister cell
We questioned why the HSN/PHB neuroblast and the PVQ neuroblast both failed
to divide in hlh-14 mutants. They may have withdrawn from the cell
cycle prematurely, or they may have inappropriately assumed the fates of other
cells. Considering this latter possibility, we noted that in hlh-14
mutant embryos, the division pattern of the presumptive PVQ/HSN/PHB neuroblast
was similar to the normal division pattern of its sister cell, the hyp7/T
blast cell (Fig. 5A,B). We
hypothesized that the PVQ/HSN/PHB neuroblast may adopt the fate of its sister
cell in hlh-14 mutants. Such a cell fate transformation would signify
a defect in asymmetric cell division, which is defined as the process by which
sister cells adopt distinct fates (Horvitz
and Herskowitz, 1992
).
If the PVQ/HSN/PHB neuroblast were transformed into an extra hyp7/T blast
cell, then hlh-14 mutants should have extra T cells, a type of dermal
blast cell in the tail. To test whether hlh-14 mutants have extra T
cells, we used a C50B6.8::gfp reporter. C50B6.8 is a C.
elegans gene that is expressed in the ten hypodermal seam cells,
including the T cells (Mounsey et al.,
2002
) (Fig. 5C). C50B6.8 encodes a protein with a domain similar to the ligand binding domains
of nuclear hormone receptors (Mounsey et
al., 2002
). With this GFP reporter, we observed that
hlh-14 mutants often have extra GFP-expressing cells in the tail,
presumably extra T (or T-like) cells (Fig.
5D). This observation is consistent with the PVQ/HSN/PHB
neuroblast assuming a hyp7/T blast cell fate in hlh-14 mutants.
Notably, these supernumerary T-like cells are smaller than normal T cells (Fig. 5D). They are also located slightly medial to the seam cells, which is consistent with the positions of the presumptive PVQ/HSN/PHB neuroblast daughter cells in hlh-14 mutants. Collectively, our observations indicate that the PVQ/HSN/PHB neuroblasts can adopt characteristics of hyp7/T blast cells in hlh-14 mutants.
HLH-14 determines cell fate in the descendants of the PVQ/HSN/PHB
neuroblasts
HLH-14 appears to determine PVQ/HSN/PHB neuroblast fate, a proneural
characteristic. Yet HLH-14::GFP is expressed not only in the PVQ/HSN/PHB
neuroblast but also in its descendants. In addition to HLH-14 acting like a
proneural factor, we wondered whether HLH-14 might also act like a neural
differentiation bHLH factor and determine the fates of cells late in this
neuroblast lineage.
To examine this possibility, we took advantage of the partial loss-of-function phenotype of hlh-14(RNAi). hlh-14(RNAi) treatment does not cause a complete loss of PVQ, HSN or PHB neurons (Tables 2, 3, 4). Therefore, we were able to test whether the loss of one neuron type was correlated with the loss of another neuron type in hlh-14(RNAi) animals. A correlation between HSN loss and PVQ loss, for example, could indicate a defect in their common precursor, the PVQ/HSN/PHB neuroblast. A lack of correlation could indicate a role for HLH-14 later in the cell lineage, perhaps in the neurons themselves.
We first looked for a correlation between HSN and PHB loss in hlh-14(RNAi) animals. We subjected worms bearing the nlp-1::gfp transgene, which expresses GFP in the PHB neurons, to hlh-14(RNAi) treatment. We isolated F1 progeny as adults and double stained them with anti-serotonin and anti-GFP antibodies to examine the HSNs and PHBs. A large majority of the time, HSN loss (or presence) correlated with PHB loss (or presence; 69/78 sides scored correlated). Occasionally, however, one cell or the other was lost (9/78 sides scored). Additionally, several of the HSN neurons that were detected in hlh-14(RNAi) animals were not fully migrated, and some had axon outgrowth defects (data not shown). Together, these results indicate that in addition to determining the fates of HSN and PHB precursors, HLH-14 plays roles in determining the fates of the HSN and PHB neurons themselves.
In a similar experiment, we looked for a correlation between HSN and PVQ loss in sra-6::gfp; hlh-14(RNAi) worms. We found that HSN loss is not at all correlated with PVQ loss in these animals (21/54 sides scored correlated). The PVQ neurons are lost significantly more often than the HSN neurons (Tables 2, 3), accounting for most of the differences we observe. The PVQ neuroblast or PVQ neuron appear to be especially sensitive to hlh-14 loss, by our assay. We conclude that although hlh-14 may play a role in determining PVQ/HSN/PHB neuroblast fate, it also appears to determine the fates of the descendants of the neuroblast.
Loss of hlh-2 function can cause neuron loss and exacerbate
hlh-14(RNAi) neuron loss
Neural bHLH proteins often regulate transcription by forming heterodimers
with the E/Daughterless (DA) proteins, a ubiquitously expressed family of bHLH
proteins. Therefore, we wondered whether the C. elegans E/DA family
member, HLH-2, might function with HLH-14 in the PVQ/HSN/PHB neuroblast
lineage. Indeed, previous work demonstrated that HLH-2 is expressed in this
lineage (Krause et al.,
1997
).
To date, no strong loss-of-function hlh-2 mutants exist or have
been reported, so we used RNAi treatment to see what effects hlh-2
loss could exert on PVQ, HSN and PHB neuron development. Consistent with
previous studies, hlh-2(RNAi) treatment caused nearly
complete embryonic lethality (Kamath et
al., 2003
; Krause et al.,
1997
). However, a small percentage of animals escaped this
lethality. Like hlh-14 mutants, these hlh-2(RNAi)
escapers had gross phenotypes, including posterior morphological defects and
larval lethality (data not shown). Most relevant to our study, they often
lacked PVQ, HSN and PHB neurons (Table
4).
Partial loss-of-function hlh-2 mutations generate no phenotypes on
their own, but a prior study demonstrated that they can exacerbate the male
tail ray loss phenotype of hypomorphic lin-32 mutants; HLH-2 and
LIN-32 act together to execute neuronal fates in the ray lineage
(Portman and Emmons, 2000
). We
wondered if the mutation, hlh-2(bx115), could also enhance
hlh-14(RNAi), which produces a partial loss-of-function
phenotype (Fig. 1C,D; Tables
2,
3,
4). Although
hlh-2(bx115) mutants have a normal number of HSN and PHB
neurons, hlh-2(bx115); hlh-14(RNAi)
animals lack more HSN and PHB neurons than hlh-14(RNAi)
animals, showing that a weak hlh-2 mutant can enhance partial
hlh-14 loss (Table
4).
| Discussion |
|---|
|
|
|---|
hlh-14 and other Achaete-Scute family genes: similarities
and differences
Aside from its conserved sequence, there are a number of similarities
between hlh-14 and previously characterized A-S genes. The most
obvious similarity is that hlh-14 mutants lack neurons. A-S family
members in Drosophila specify external sense organs. In the absence
of A-S genes, neuronal cell types needed for the function of these organs are
lost (Garcia-Bellido, 1979
;
Gonzalez et al., 1989
;
Villares and Cabrera, 1987
).
Vertebrate A-S family members generate a wide variety of neuronal precursors,
including the progenitors of the cerebral cortex and progenitors in the
ventral telencephalon (Casarosa et al.,
1999
; Guillemot et al.,
1993
; Horton et al.,
1999
). In this study, we have clearly established that
hlh-14 function is required for normal PVQ, HSN, and PHB neuron
development.
Yet a close look at the types of neurons specified by hlh-14 reveals an important difference between hlh-14 and other A-S genes. While Drosophila and mammalian A-S genes appear to specify neuroblast lineages dedicated to generating neuronal cells of a particular type or coordinated function, hlh-14 specifies a neuroblast lineage dedicated to generating three disparate types of neuron: an interneuron (PVQ), a motoneuron (HSN) and a sensory neuron (PHB). There is no known coordinated function that these three neurons perform. Why is hlh-14 less specific than fellow A-S family members in this regard? One possibility is that C. elegans must adapt the function of neural bHLH genes such as hlh-14 in order to generate its diverse collection of 302 neurons (of 118 distinct types) out of only 959 somatic cells. Such adaptation may allow hlh-14 to specify lineally related, yet functionally distinct, collections of neurons.
A second similarity between hlh-14 and other A-S-like genes is the
genetic interaction between hlh-14 and hlh-2, the C.
elegans E/DA homolog. In Drosophila, heterodimers between DA and
A-S family members are essential for neurogenesis
(Cabrera and Alonso, 1991
). In
C. elegans, the A-S factor HLH-3 can bind E/DA HLH-2 in vitro, and
the expression patterns of HLH-3 and HLH-2 overlap in a number of neuronal
lineages (Krause et al., 1997
;
Thellman et al., 2003). Taken together, four facts suggest that HLH-14 and
HLH-2 act together in the PVQ/HSN/PHB lineage to regulate neuronal
development. First, A-S proteins, as well as other types of bHLH proteins, are
known to interact physically with E/DA family members to form functional
heterodimers in a number of organisms
(Cabrera and Alonso, 1991
;
Johnson et al., 1992
;
Krause et al., 1997
;
Massari and Murre, 2000
).
Second, both HLH-14 and HLH-2 are expressed in the PVQ/HSN/PHB lineage (this
study) (Krause et al., 1997
).
Third, loss of function of either gene results in the loss of neurons in this
lineage. Fourth, a weak hlh-2 mutant can enhance the partial neuronal
loss defects of hlh-14(RNAi).
Another similarity that HLH-14 shares with certain A-S family members is that it possesses proneural characteristics. Not only is hlh-14 necessary for neuron development, but also it is expressed early in neurogenesis. We see hlh-14::gfp expressed in the PVQ/HSN/PHB neuroblast, the first cell in this lineage solely dedicated to generating neurons.
Individual neural bHLH factors can assume multiple roles in C.
elegans
Even though hlh-14 has proneural characteristics, a notable
difference between hlh-14 and some A-S genes is that hlh-14
is not strictly proneural. Numerous pieces of evidence point to this
conclusion. First, hlh-14::gfp expression is not restricted to early
neuroblasts. We observe hlh-14::gfp expression in the lineal
descendants of the PVQ/HSN/PHB neuroblast, including the PVQ neuron, a
postmitotic cell. Second, hlh-14 mutants do not display wholesale
neuron loss for all the neurons we examined. For example, the HSNs are not
always lost. Furthermore, of the HSNs that are generated, many fail to migrate
and project their axons properly. Finally, HSN loss is not perfectly
correlated with PHB and PVQ loss in hlh-14(RNAi) animals.
Collectively, these results demonstrate that hlh-14 plays important
roles in the descendants of the PVQ/HSN/PHB neuroblast, not just the
neuroblast itself.
There are other A-S genes that are not strictly proneural. For example, the
Drosophila gene asense has proneural characteristics; its
ectopic expression induces the generation of ectopic sense organs
(Dominguez and Campuzano,
1993
). However, unlike other proneural factors, asense is
not normally expressed early in neuroblast lineages. It is expressed later, in
the precursors of sensory organ cells
(Dominguez and Campuzano,
1993
; Gonzalez et al.,
1989
). Among A-S genes that have been characterized,
hlh-14 appears unique in the sense that it is expressed early in a
lineage to establish neuroblast fate, but nevertheless persists in subsequent
generations to execute the fates of neuronal precursors and neurons.
This characteristic of hlh-14 is shared by other C.
elegans neural bHLH factors. For example, the C. elegans Atonal
homolog, LIN-32, both establishes ray neuroblast fate and helps execute the
fates of cells at multiple steps in the ray lineage
(Portman and Emmons, 2000
;
Zhao and Emmons, 1995
). The
C. elegans NeuroD bHLH homolog, CND-1, is expressed in both neuronal
precursors and postmitotic neurons and appears to be important to keep these
precursors from withdrawing from their lineages
(Hallam et al., 2000
). The
only other neural bHLH that has been described in any detail in C.
elegans is the A-S protein HLH-3. It has not been reported how HLH-3
promotes neurogenesis, but embryonic expression of an hlh-3::gfp
transgene is extensive and shows considerable overlap with HLH-2 expression in
neuronal lineages (Krause et al.,
1997
). Therefore, it seems plausible that HLH-3 could affect both
early and late events in neuronal development.
It is unclear why some C. elegans bHLH factors act at several
steps in neuronal lineages, seemingly unlike their Drosophila or
vertebrate counterparts. It is not because nematodes have fewer neural bHLH
proteins at their disposal; indeed, there are five A-S-like genes in C.
elegans, but only four in Drosophila, and three in mouse
(Ledent et al., 2002
). The
fact that individual C. elegans bHLH factors appear sufficient to
drive both early and late events in neural development contrasts with the
progressive determination model formulated from studies in Drosophila
and vertebrates (Dambly-Chaudiere and
Vervoort, 1998
; Ghysen and
Dambly-Chaudiere, 1989
; Jan
and Jan, 1994
). According to this model, neuronal lineages consist
of cells whose fates become more restricted with each generation. A sequential
cascade of bHLH factors helps drive this process, with proneural factors
defining neuroblast lineages and signaling through Notch to promote the
expression of differentiation bHLH factors that promote later developmental
events. In C. elegans, however, a single neural bHLH protein appears
capable of functioning in each of these steps, at least in some cell
lineages.
C. elegans bHLH mutations can disrupt asymmetric cell
divisions
An additional difference between hlh-14 and other A-S family
members comes from analyzing Hlh-14 mutant phenotypes. The loss of neurons is
expected for the loss of an A-S family member like hlh-14. What is
unexpected is the inappropriate duplication of a lineally related sister cell.
In hlh-14 mutants, there appear to be duplications of the hyp7/T
blast cell at the expense of its sister cell, the PVQ/HSN/PHB neuroblast.
While these duplications are not completely penetrant, they do occur with
reasonable frequency, as assayed by the presence of extra T-like cells in
hlh-14 mutants (Fig.
5D). The incomplete penetrance may be due to incomplete or partial
transformations of PVQ/HSN/PHB neuroblast fate.
Asymmetric cell division is defined as any division in which a mother cell
gives rise to two daughter cells of distinct fates
(Horvitz and Herskowitz,
1992
). It is a fundamental mechanism employed by metazoans to
generate cellular diversity. The vast majority of C. elegans
non-germline cell divisions are asymmetric
(Kimble and Hirsh, 1979
;
Sulston and Horvitz, 1977
;
Sulston et al., 1983
).
Normally, ABpl/rappp divides asymmetrically, generating the PVQ/HSN/PHB
neuroblast and the hyp7/T blast cell. Our data suggest that this asymmetric
division is disrupted in hlh-14 mutants because the PVQ/HSN/PHB
neuroblast can be partially transformed into its sister cell.
The disruption of an asymmetric cell division is not unprecedented for the
loss of a neural bHLH factor in C. elegans. This phenomenon is what
one observes in the V5.pa cell lineage in lin-32 mutants and in the
NSM cell lineage in hlh-3 mutants. In wild-type animals, the V5.pa
cell becomes a neuroblast called the postdeirid neuroblast. However, in
lin-32 mutants, lineage analysis shows that V5.pa can assume the fate
of its sister cell, the V5.pp hypodermal blast cell
(Zhao and Emmons, 1995
). In
hlh-3 mutants, the sister cell of the NSM neuron can forego a
programmed cell death fate and assume an NSM-like fate instead
(Thellmann et al., 2003
).
Why might some nematode asymmetric divisions become symmetric upon losing a bHLH factor? The answer is unclear, but it seems instructive to consider the cellular context in which neurons are generated in different organisms. In Drosophila, proneural genes are first expressed in the neuroectoderm in order to select neuronal precursors. Without proneural activity, neuroblast lineages are not selected, resulting in an absence of neuronal organs and excess dermal cells. In vertebrates, proneural genes are first expressed in neuroepithelial cells. Proneural expression induces the selection of neuronal precursors that then delaminate from the neuroepithelium and divide a finite number of times to generate neuronal cell types. Some neuroepithelial cells that are not selected to be neuroblasts delaminate and generate glia instead. Loss of proneural function can lead to a loss of neurons, but extra glia in vertebrates.
By contrast, C. elegans does not select most of its neuroblast
lineages from populations of dermal cells. Instead, C. elegans works
within the context of its cell lineage, which generates only 959 somatic cells
in the adult (Kimble and Hirsh,
1979
; Sulston and Horvitz,
1977
; Sulston et al.,
1983
). Considering this, and considering our work, it seems
possible that neural bHLH factors can act like a switch between one of two
sister cell fate decisions in nematodes. This is not entirely dissimilar from
what has been observed in Drosophila and vertebrates, where proneural
bHLH factors act like a switch between neuroblast and ectodermal or
epithelial/glial cell fates. The difference is that in flies and vertebrates
cell fate is regulated spatially, while in C. elegans, cell fate may
be distributed asymmetrically at mitosis. As a result, loss of a neural bHLH
factor can result in the disruption of an asymmetric cell division.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Allende, M. L. and Weinberg, E. S. (1994). The expression pattern of two zebrafish achaete-scute homolog (ash) genes is altered in the embryonic brain of the cyclops mutant. Dev. Biol. 166,509 -530.[CrossRef][Medline]
Ball, D. W., Azzoli, C. G., Baylin, S. B., Chi, D., Dou, S.,
Donis-Keller, H., Cumaraswamy, A., Borges, M. and Nelkin, B. D.
(1993). Identification of a human achaete-scute homolog highly
expressed in neuroendocrine tumors. Proc. Natl. Acad. Sci.
USA 90,5648
-5652.
Bertrand, N., Castro, D. S. and Guillemot, F. (2002). Proneural genes and the specification of neural cell types. Nat. Rev. Neurosci. 3, 517-530.[CrossRef][Medline]
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Cabrera, C. V. and Alonso, M. C. (1991). Transcriptional activation by heterodimers of the achaete-scute and daughterless gene products of Drosophila. EMBO J. 10,2965 -2973.[Medline]
Casarosa, S., Fode, C. and Guillemot, F. (1999). Mash1 regulates neurogenesis in the ventral telencephalon. Development 126,525 -534.[Abstract]
Chen, L., Krause, M., Draper, B., Weintraub, H. and Fire, A.
(1992). Body-wall muscle formation in Caenorhabditis
elegans embryos that lack the MyoD homolog hlh-1.
Science 256,240
-243.
Chien, C. T., Hsiao, C. D., Jan, L. Y. and Jan, Y. N.
(1996). Neuronal type information encoded in the
basic-helix-loop-helix domain of proneural genes. Proc. Natl. Acad.
Sci. USA 93,13239
-13244.
Dambly-Chaudiere, C. and Vervoort, M. (1998). The bHLH genes in neural development. Int. J. Dev. Biol. 42,269 -273.[Medline]
Desai, C., Garriga, G., McIntire, S. L. and Horvitz, H. R. (1988). A genetic pathway for the development of the Caenorhabditis elegans HSN motor neurons. Nature 336,638 -646.[CrossRef][Medline]
Dominguez, M. and Campuzano, S. (1993). asense, a member of the Drosophila achaete-scute complex, is a proneural and neural differentiation gene. EMBO J. 12,2049 -2060.[Medline]
Edgley, M. L. and Riddle, D. L. (2001). LG II balancer chromosomes in Caenorhabditis elegans: mT1(II;III) and the mIn1 set of dominantly and recessively marked inversions. Mol. Genet. Genomics 266,385 -395.[CrossRef][Medline]
Ellis, H. M. and Horvitz, H. R. (1986). Genetic control of programmed cell death in the nematode C. elegans. Cell 44,817 -829.[CrossRef][Medline]
Ferreiro, B., Skoglund, P., Bailey, A., Dorsky, R. and Harris, W. A. (1993). XASH1, a Xenopus homolog of achaete-scute: a proneural gene in anterior regions of the vertebrate CNS. Mech. Dev. 40,25 -36.[CrossRef][Medline]
Frowein, J., Campbell, K. and Gotz, M. (2002). Expression of Ngn1, Ngn2, Cash1, Gsh2 and Sfrp1 in the developing chick telencephalon. Mech. Dev. 110,249 -252.[CrossRef][Medline]
Garcia-Bellido, A. (1979). Genetic analysis of
the achaete-scute system of Drosophila melanogaster.
Genetics 91,491
-520.
Garriga, G., Desai, C. and Horvitz, H. R. (1993). Cell interactions control the direction of outgrowth, branching and fasciculation of the HSN axons of Caenorhabditis elegans. Development 117,1071 -1087.[Abstract]
Ghysen, A. and Dambly-Chaudiere, C. (1989). Genesis of the Drosophila peripheral nervous system. Trends Genet. 5,251 -255.[CrossRef][Medline]
Gitai, Z., Yu, T. W., Lundquist, E. A., Tessier-Lavigne, M. and Bargmann, C. I. (2003). The netrin receptor UNC-40/DCC stimulates axon attraction and outgrowth through enabled and, in parallel, Rac and UNC-115/AbLIM. Neuron 37, 53-65.[CrossRef][Medline]
Gonzalez, F., Romani, S., Cubas, P., Modolell, J. and Campuzano, S. (1989). Molecular analysis of the asense gene, a member of the achaetescute complex of Drosophila melanogaster, and its novel role in optic lobe development. EMBO J. 8,3553 -3562.[Medline]
Goulding, S. E., White, N. M. and Jarman, A. P. (2000a). cato encodes a basic helix-loop-helix transcription factor implicated in the correct differentiation of Drosophila sense organs. Dev. Biol. 221,120 -131.[CrossRef][Medline]
Goulding, S. E., zur Lage, P. and Jarman, A. P. (2000b). amos, a proneural gene for Drosophila olfactory sense organs that is regulated by lozenge. Neuron 25,69 -78.[CrossRef][Medline]
Guenther, C. and Garriga, G. (1996). Asymmetric distribution of the C. elegans HAM-1 protein in neuroblasts enables daughter cells to adopt distinct fates. Development 122,3509 -3518.[Abstract]
Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A., Anderson, D. J. and Joyner, A. L. (1993). Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons. Cell 75,463 -476.[CrossRef][Medline]
Hallam, S., Singer, E., Waring, D. and Jin, Y. (2000). The C. elegans NeuroD homolog cnd-1 functions in multiple aspects of motor neuron fate specification. Development 127,4239 -4252.[Abstract]
Hart, A. C., Kass, J., Shapiro, J. E. and Kaplan, J. M.
(1999). District signaling pathways mediate touch and osmosensory
responses in apolymodal sensory neuron. J. Neurosci.
19,1952
-1958.
Horton, S., Meredith, A., Richardson, J. A. and Johnson, J. E. (1999). Correct coordination of neuronal differentiation events in ventral forebrain requires the bHLH factor MASH1. Mol. Cell Neurosci. 14,355 -369.[CrossRef][Medline]
Horvitz, H. R. and Herskowitz, I. (1992). Mechanisms of asymmetric cell division: two Bs or not two Bs, that is the question. Cell 68,237 -255.[CrossRef][Medline]
Horvitz, H. R. and Sulston, J. E. (1980).
Isolation and genetic characterization of cell-lineage mutants of the nematode
Caenorhabditis elegans. Genetics
96,435
-454.
Horvitz, H. R., Brenner, S., Hodgkin, J. and Herman, R. K. (1979). A uniform genetic nomenclature for the nematode Caenorhabditis elegans. Mol. Gen. Genet. 175,129 -133.[CrossRef][Medline]
Huang, M. L., Hsu, C. H. and Chien, C. T. (2000). The proneural gene amos promotes multiple dendritic neuron formation in the Drosophila peripheral nervous system. Neuron 25,57 -67.[CrossRef][Medline]
Jan, Y. N. and Jan, L. Y. (1994). Genetic control of cell fate specification in Drosophila peripheral nervous system. Annu. Rev. Genet. 28,373 -393.[CrossRef][Medline]
Jarman, A. P., Grau, Y., Jan, L. Y. and Jan, Y. N. (1993). atonal is a proneural gene that directs chordotonal organ formation in the Drosophila peripheral nervous system. Cell 73,1307 -1321.[CrossRef][Medline]
Johnson, J. E., Birren, S. J., Saito, T. and Anderson, D. J.
(1992). DNA binding and transcriptional regulatory activity of
mammalian achaete-scute homologous (MASH) proteins revealed by interaction
with a muscle-specific enhancer. Proc. Natl. Acad. Sci.
USA 89,3596
-3600.
Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., le Bot, N., Moreno, S., Sohrmann, M. et al. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421,231 -237.[CrossRef][Medline]
Kimble, J. and Hirsh, D. (1979). The postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans. Dev. Biol. 70,396 -417.[CrossRef][Medline]
Krause, M., Park, M., Zhang, J. M., Yuan, J., Harfe, B., Xu, S. Q., Greenwald, I., Cole, M., Paterson, B. and Fire, A. (1997). A C. elegans E/Daughterless bHLH protein marks neuronal but not striated muscle development. Development 124,2179 -2189.[Abstract]
Ledent, V., Paquet, O. and Vervoort, M. (2002). Phylogenetic analysis of the human basic helix-loop-helix proteins. Genome Biol. 3, RESEARCH0030.
Li, C., Nelson, L. S., Kim, K., Nathoo, A. and Hart, A. C. (1999). Neuropeptide gene families in the nematode Caenorhabditis elegans. Ann. New York Acad. Sci. 897,239 -252.[CrossRef][Medline]
Massari, M. E. and Murre, C. (2000).
Helix-loop-helix proteins: regulators of transcription in eucaryotic
organisms. Mol. Cell. Biol.
20,429
-440.
Mello, C. C., Kramer, J. M., Stinchcomb, D. and Ambros, V. (1991). Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10,3959 -3970.[Medline]
Mounsey, A., Bauer, P. and Hope, I. A. (2002).
Evidence suggesting that a fifth of annotated Caenorhabditis elegans
genes may be pseudogenes. Genome Res.
12,770
-775.
Nonet, M. L., Staunton, J., Kilgard, M. P., Fergestad, T.,
Hartweig, E. A., Jorgensen, E. M. and Meyer, B. J. (1997).
C. elegans rab-3 mutant synapses exhibit impaired function and are
partially depleted of vesicles. J. Neurosci.
17,8061
-8073.
Portman, D. S. and Emmons, S. W. (2000). The basic helix-loop-helix transcription factors LIN-32 and HLH-2 function together in multiple steps of a C. elegans neuronal sublineage. Development 127,5415 -5426.[Abstract]
Rodriguez, I., Hernandez, R., Modolell, J. and Ruiz-Gomez, M. (1990). Competence to develop sensory organs is temporally and spatially regulated in Drosophila epidermal primordia. EMBO J. 9,3583 -3592.[Medline]
Sulston, J. E. and Horvitz, H. R. (1977). Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev. Biol. 56,110 -156.[CrossRef][Medline]
Sulston, J. E., Schierenberg, E., White, J. G. and Thomson, J. N. (1983). The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev. Biol. 100,64 -119.[CrossRef][Medline]
Thellmann, M., Hatzold, J. and Conradt, B.
(2003). The Snail-like CES-1 protein of C. elegans can
block the expression of the BH3-only cell-death activator gene egl-1
by antagonizing the function of bHLH proteins.
Development 130,4057
-4071.
Troemel, E. R., Chou, J. H., Dwyer, N. D., Colbert, H. A. and Bargmann, C. I. (1995). Divergent seven transmembrane receptors are candidate chemosensory receptors in C. elegans. Cell 83,207 -218.[CrossRef][Medline]
Verma-Kurvari, S., Savage, T., Gowan, K. and Johnson, J. E. (1996). Lineage-specific regulation of the neural differentiation gene MASH1. Dev. Biol. 180,605 -617.[CrossRef][Medline]
Villares, R. and Cabrera, C. V. (1987). The achaete-scute gene complex of D. melanogaster: conserved domains in a subset of genes required for neurogenesis and their homology to myc. Cell 50,415 -424.[CrossRef][Medline]
Way, J. C. and Chalfie, M. (1988). mec-3, a homeobox-containing gene that specifies differentiation of the touch receptor neurons in C. elegans. Cell 54,5 -16.[CrossRef][Medline]
Yuan, J., Shaham, S., Ledoux, S., Ellis, H. M. and Horvitz, H. R. (1993). The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin-1 beta-converting enzyme. Cell 75,641 -652.[CrossRef][Medline]
Zhao, C. and Emmons, S. W. (1995). A transcription factor controlling development of peripheral sense organs in C. elegans. Nature 373, 74-78.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. Singhvi, C. A. Frank, and G. Garriga The T-Box Gene tbx-2, the Homeobox Gene egl-5 and the Asymmetric Cell Division Gene ham-1 Specify Neural Fate in the HSN/PHB Lineage Genetics, June 1, 2008; 179(2): 887 - 898. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cordes, C. A. Frank, and G. Garriga The C. elegans MELK ortholog PIG-1 regulates cell size asymmetry and daughter cell fate in asymmetric neuroblast divisions Development, July 15, 2006; 133(14): 2747 - 2756. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||