spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 19 November 2003
doi: 10.1242/dev.00894


Development 130, 6507-6518 (2003)
Published by The Company of Biologists 2003


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.00894v1
130/26/6507    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frank, C. A.
Right arrow Articles by Garriga, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frank, C. A.
Right arrow Articles by Garriga, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

HLH-14 is a C. elegans Achaete-Scute protein that promotes neurogenesis through asymmetric cell division

C. Andrew Frank, Paul D. Baum* and Gian Garriga{dagger}

Department of Molecular and Cell Biology, University of California, Berkeley, Berkeley, CA 94720-3204, USA

{dagger} Author for correspondence (e-mail: garriga{at}uclink4.berkeley.edu)

Accepted 22 September 2003


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Achaete-Scute basic helix-loop-helix (bHLH) proteins promote neurogenesis during metazoan development. In this study, we characterize a C. elegans Achaete-Scute homolog, HLH-14. We find that a number of neuroblasts express HLH-14 in the C. elegans embryo, including the PVQ/HSN/PHB neuroblast, a cell that generates the PVQ interneuron, the HSN motoneuron and the PHB sensory neuron. hlh-14 mutants lack all three of these neurons. The fact that HLH-14 promotes all three classes of neuron indicates that C. elegans proneural bHLH factors may act less specifically than their fly and mammalian homologs. Furthermore, neural loss in hlh-14 mutants results from a defect in an asymmetric cell division: the PVQ/HSN/PHB neuroblast inappropriately assumes characteristics of its sister cell, the hyp7/T blast cell. We argue that bHLH proteins, which control various aspects of metazoan development, can control cell fate choices in C. elegans by regulating asymmetric cell divisions. Finally, a reduction in the function of hlh-2, which encodes the C. elegans E/Daughterless bHLH homolog, results in similar neuron loss as hlh-14 mutants and enhances the effects of partially reducing hlh-14 function. We propose that HLH-14 and HLH-2 act together to specify neuroblast lineages and promote neuronal fate.

Key words: Caenorhabditis elegans, HLH-14, HLH-2, bHLH, Proneural, Neuroblast


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Basic helix-loop-helix (bHLH) transcription factors play integral roles in a number of developmental processes, including neurogenesis. Neural bHLH proteins have been characterized in organisms as diverse as nematodes, flies and vertebrates. These factors can assume a variety of tasks, depending upon when and where they are expressed. For example, proneural bHLH factors are expressed early in neurogenesis and are both necessary and sufficient to promote neuroblast lineages. By contrast, neuronal differentiation bHLH factors are expressed later, in neuronal precursors or postmitotic neurons, and help to fine tune neuronal fates (reviewed by Bertrand et al., 2002Go).

The first proneural genes identified were the Achaete-Scute (A-S) Complex genes in Drosophila. Genes in this family include achaete (ac), scute (sc), lethal of scute (lsc) and asense (ase), and are required for external sense organ development (Garcia-Bellido, 1979Go; Gonzalez et al., 1989Go; Villares and Cabrera, 1987Go). Later work in Drosophila identified atonal (ato), the founding member of another proneural bHLH gene family, as crucial for the development of internal sense organs, the chordotonal organs (Jarman et al., 1993Go). Other fly Atonal family members are also involved in sense organ development and include absent of MD neurons and olfactory sensilla (amos) and cousin of atonal (cato) (Goulding et al., 2000aGo; Goulding et al., 2000bGo; Huang et al., 2000Go).

Proneural genes can act as developmental switches that control neural fate. In general, proneural gene expression promotes the generation of neuroblasts at the expense of adjacent cell types, like epidermal cells. Flies lacking ac and sc function, for example, are missing most of their mechanosensory and chemosensory organs (Bertrand et al., 2002Go; Garcia-Bellido, 1979Go) because of a failure to select sensory organ progenitors from the ectoderm. Ectopic expression of A-S genes in the ectoderm can induce the development of ectopic sensory organs at the expense of dermal cells (Dominguez and Campuzano, 1993Go; Rodriguez et al., 1990Go). Similarly, flies lacking ato gene function are missing their chordotonal sensory organs, and ectopic expression of Atonal family members promotes the formation of extra chordotonal organs (Chien et al., 1996Go; Goulding et al., 2000bGo; Huang et al., 2000Go; Jarman et al., 1993Go).

In vertebrates, members of the A-S, Atonal and Neurogenin (Ngn) bHLH families all exhibit proneural characteristics. Again, specification of neuroblast cell fate is a crucial function of these factors. For example, the A-S protein Ash1 is present in most, if not all, vertebrates (Allende and Weinberg, 1994Go; Ball et al., 1993Go; Ferreiro et al., 1993Go; Frowein et al., 2002Go; Verma-Kurvari et al., 1996Go). Mice lacking functional Mash1 (mouse Ash1) have neurogenesis defects in the ventral telencephalon and olfactory sensory epithelium (Casarosa et al., 1999Go; Guillemot et al., 1993Go; Horton et al., 1999Go). These defects are correlated with an absence of progenitor cells, consistent with Mash1 promoting neurogenesis.

C. elegans, like Drosophila and vertebrates, has a number of neural bHLH proteins. To date, the most extensively characterized is LIN-32, the sole C. elegans Atonal family member (Ledent et al., 2002Go; Zhao and Emmons, 1995Go). Reminiscent of Drosophila atonal mutants, lin-32 mutants lack some sensory organs (Portman and Emmons, 2000Go; Zhao and Emmons, 1995Go). In particular, lin-32 mutant males lack rays, peripheral sensory organs of the male tail that are important for sensing hermaphrodites during mating (Zhao and Emmons, 1995Go). Ectopic expression of LIN-32 under a ubiquitous heat-shock promoter is sufficient to generate ectopic ray papillae structures (Zhao and Emmons, 1995Go).

bHLH proteins usually activate transcription of target genes as heterodimers with members of the E/Daughterless (DA) bHLH family (Cabrera and Alonso, 1991Go; Johnson et al., 1992Go; Massari and Murre, 2000Go). Heterodimer formation is mediated by the helices of the bHLH proteins, while the basic regions are important for binding to DNA sequences with an E-box motif, CANNTG. In C. elegans, both LIN-32 and the A-S protein HLH-3 can bind to the C. elegans E/DA homolog, HLH-2, in the presence of E-box motifs (Krause et al., 1997Go; Portman and Emmons, 2000Go; Thellmann et al., 2003Go). Both LIN-32 and HLH-3 are expressed in many of the same neuronal lineages as HLH-2 and probably require heterodimerization for the proper execution of some of these lineages (Krause et al., 1997Go; Portman and Emmons, 2000Go; Thellmann et al., 2003Go).

In this study, we characterize a new C. elegans A-S family member, HLH-14. We find that hlh-14 function is required for the production of specific neurons, notably three lineally related neurons: the PVQ interneuron, the HSN motoneuron, and the PHB sensory neuron. Like other A-S factors, HLH-14 is expressed in neuronal precursors and has proneural characteristics. Yet HLH-14 does not have a strictly proneural role; it appears to act in neuronal differentiation as well. Additionally, genetic data suggest that hlh-14 and hlh-2 act together in neurogenesis.

Surprisingly, we find that loss of hlh-14 function causes an asymmetric cell division defect. Specifically, in hlh-14 mutants, the PVQ/HSN/PHB neuroblast appears to assume characteristics of its sister cell, the hyp7/T blast cell. Taken together with previous studies in nematodes, we propose that C. elegans proneural genes play slightly different roles from their Drosophila or vertebrate counterparts. In particular, C. elegans proneural genes such as hlh-14 can promote neurogenesis, in part, by regulating asymmetric cell divisions. Additionally, C. elegans proneural genes lack the specificity of their homologs and promote neuroblast lineages that generate neural cells of disparate function.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
C. elegans strains
Nematodes were maintained as previously described (Brenner, 1974Go). Strains were kept at 20°C unless otherwise noted. This study uses standard C. elegans nomenclature (Horvitz et al., 1979Go). The wild-type strain N2 was used unless otherwise noted.

Strains with the following mutant alleles, chromosomal aberrations or transgenic arrays were used in this work. Unreferenced strains were generated in the course of this study.

Linkage Group (LG) I
unc-13(e51) (Brenner, 1974Go), hlh-2(bx115) (Portman and Emmons, 2000Go), ynIs45[flp-15::gfp] (Li et al., 1999Go), nuIs11[osm-10::gfp] (Hart et al., 1999Go) and kyIs39[sra-6::gfp] (Troemel et al., 1995Go).

LG II
bli-2(st1016) (Nonet et al., 1997Go), lin-4(e912) (Horvitz and Sulston, 1980Go), dpy-10(e128) (Brenner, 1974Go), clr-1(e1745) (Way and Chalfie, 1988Go), hlh-14(gm34), hlh-14(ju243) (W.-M. Woo and A. Chisholm, personal communication), gmIs20[hlh-14::gfp], mIn1 (Edgley and Riddle, 2001Go), maDf4 (V. Ambros, personal communication), ccDf5 (Chen et al., 1992Go).

LG III
gmIs12[srb-6::gfp] (N. Hawkins, personal communication) (Troemel et al., 1995Go), gmIs21[nlp-1::gfp] (Li et al., 1999Go).

LG IV
kyIs179[unc-86::gfp] (Gitai et al., 2003Go), ham-1(n1811) (Desai et al., 1988Go; Guenther and Garriga, 1996Go), ced-3(n717) (Ellis and Horvitz, 1986Go).

LG V
gmIs22[nlp-1::gfp] (Li et al., 1999Go).

Extrachromosomal arrays
gmEx281[hlh-14::gfp], leEx887[C50B6.8::gfp] (Mounsey et al., 2002Go).

Isolation of hlh-14 mutants and cloning of hlh-14
hlh-14(gm34) was isolated in a genetic screen for mutants with missing or misplaced HSN motoneurons (G.G., unpublished), and hlh-14(ju243) was isolated in a screen for mutants with morphological defects (W.-M. Woo and A. Chisholm, personal communication). As the two alleles displayed similar defects and mapped to the same region of LG II, a complementation test was performed, confirming that they are allelic.

hlh-14(gm34) was genetically mapped between bli-2 and lin-4 on LG II. From worms of the parental genotype hlh-14(gm34)/bli-2(st1016) lin-4(e912), 4/11 Bli nonLin recombinant progeny segregated the hlh-14(gm34) mutation. Corroborating this map position, the deficiency maDf4 fails to complement hlh-14(gm34), but the deficiency ccDf5 complements hlh-14(gm34). Few C. elegans cosmid clones are in the region corresponding to these mapping data. Rescue of Hlh-14 phenotypes was achieved with injection of two of the cosmids in this region, F22C7 and C18A3, both of which contain the hlh-14-coding region, C18A3.8.

Detection of hlh-14 mutant lesions
To detect lesions in hlh-14 mutants, we PCR amplified the genomic region of hlh-14 from mutant genomic DNA and sequenced the amplicons. To obtain mutant genomic DNA, we picked about five mutant worms into the cap of a PCR tube containing 10 µl of lysis buffer (10 mM Tris pH 8.2, 50 mM KCl, 2.5 mM MgCl2, 0.45% Tween 20, 0.05% gelatin). The tubes were briefly centrifuged to bring down the lysis buffer and worms and then placed on dry ice for 10 minutes. The tubes were thawed at room temperature and then placed in the PCR machine for a lysis reaction (60 minutes at 60°C, followed by 15 minutes at 95°C). Lysate (3 µl) was used as a genomic DNA template for PCR reactions.

To amplify the hlh-14-coding region for sequencing, the primers C18A3.8-L1 (5' AGACAATGCAAATTGGGAGG 3') and C18A3.8-R1 (5' GCTAATTGACTCTCGTCCGC 3') were used. The resulting 5.9 kb product was used as a template to reamplify the region with the primers C18A3.8-L2 (5' TACATCGCCTGCAGTAGTGG 3') and C18A3.8-R2 (5' TTGGTATGGGAGGAGAGTGC 3'), yielding a 5.2 kb product.

To sequence the hlh-14-coding region, the primers bg1-s1 (5' ATACCTCCCACATTTTGG 3'), bg1-s2 (5' CACCACCGTCTTCCCT 3'), bg1-s4 (5' TCACAAGTAGTATTCTTCC 3') and bg1-s5 (5' CATAGAAGTACACATGATTG 3') were used. Sequencing reactions with bg1-s2 and bg1-s5 reliably detected the hlh-14 lesions.

hlh-14 5' and 3' RACE
To perform 5' and 3' RACE, 5' and 3' C. elegans cDNA libraries were made using the SMARTTM RACE cDNA Amplification Kit protocol (Clontech). Using these libraries as a template, 3' RACE PCR was performed using the primers BG1-GSPL2 (5' CAGAAATGAGAGAGAACGCAAGCG 3') and Clontech's UPM primer mix. This reaction amplified the 3' cDNA end common to all hlh-14 cDNAs.

5' RACE was performed using a number of different primers. Using library template, the UPM primer mix and the primer BG1-GSPR1 (5' TGCTGTTGTTCATCGTGTAGTCGG 3'), we amplified the 5' end of one hlh-14 transcript, designated hlh-14 Short; this cDNA represents the shortest hlh-14 transcript. We believe this is the 5' end of the most common hlh-14 transcript because it is the only one we can amplify without a second nested reaction. The 5' ends of two other transcripts were detected with nested reactions. They were amplified with a primary PCR reaction using library template, the UPM primer mix and the primer BG1-GSPR3 (5' GCTAATGGTGAGAGGAAAGGCGGG 3'). The resulting amplicon was used as a template to detect the 5' ends of the less common hlh-14 transcripts. The primers for this second, nested reaction were Clontech's NUP primer and BG1-GSPR4 (5' GGATATTGGCACAAACCGTATTGGC 3').

Generation of hlh-14::gfp transgenes
To generate the full-length hlh-14::gfp transgene, the primers BG1GFP-L4 (5' AAATGTCGACCAACATGCAAAAGCTAATGGG 3') and BG1GFP-R2 (5' CCAAGGATCCATGGTGTGGATAATTGGAATATGA 3') were used to amplify the promoter and coding regions of hlh-14, using the cosmid F22C7 as a template. The resulting 8.4 kb genomic product and the GFP vector pPD95.77 (A. Fire, S. Xu, J. Ahnn and G. Seydoux, unpublished) were double digested with SalI and BamHI and ligated together. The resulting construct was co-injected into hlh-14(gm34)/mIn1 animals at a concentration of 0.5 ng/µl with the pRF4 plasmid (Mello et al., 1991Go) at a concentration of 50 ng/µl. Rescued hlh-14(gm34) animals were found among the transgenic progeny, establishing the extrachromosomal array line gmEx281. Rescued animals were identified by the absence of the mIn1 GFP balancer, the presence of the array (pRF4-bearing Rol progeny), and the absence of Hlh-14 morphological defects. Prior to array integration, hlh-14(gm34); gmEx281 animals were backcrossed to wild-type animals, and gmEx281 was recovered in a wild-type background.

The extrachromosomal array gmEx281 was integrated into the genome by UV irradiation. L4 stage gmEx281 worms were washed four times with M9 and placed on a NGM agar plate without bacteria. The worms were irradiated in a UV Stratalinker at a strength of 250 µJx100 and allowed to recover on bacteria at 15°C overnight and lay eggs the next day. Approximately 150 F1 progeny were cloned to individual plates and allowed to produce F2 progeny; two or three F2 animals per F1 plate were cloned to new individual plates. F3 progeny were then scored for 100% transgenic animals (pRF4 Rol phenotype). In this way, the integrated array gmIs20 was generated.

Detection and analysis of specific neurons
The HSN neurons were detected in larvae using the unc-86::gfp reporter, kyIs179 (Gitai et al., 2003Go). The HSN neurons were detected in adult worms using the serotonin staining procedure as described (Garriga et al., 1993Go). The PHB neurons were detected with two different GFP reporters. The srb-6::gfp reporter (Troemel et al., 1995Go), which was integrated onto LG III to form the strain gmIs12 (N. Hawkins, personal communication), detected both the PHA and PHB phasmid neurons. The nlp-1::gfp reporter (Li et al., 1999Go) gmEx285 was integrated onto LG III and LG V to form the arrays gmIs21 and gmIs22, respectively; these arrays specifically detected the PHB neurons. The PHA neurons were detected using the flp-15::gfp reporter ynIs45 (Li et al., 1999Go) and the osm-10::gfp reporter nuIs11 (Hart et al., 1999Go) (PHA-specific in adults). The PVQ neurons were detected using the sra-6::gfp reporter kyIs39 (Troemel et al., 1995Go).

All neurons were visualized using a Zeiss Axioskop compound microscope. Some images were captured using Elite Chrome 100 color film (Kodak) and developed into slides. Other images were captured with a Hamamatsu ORCA-ER digital camera and saved as OpenLab files. Images were formatted using Adobe Photoshop.

Lineage analysis of living embryos
Lineage analysis was performed for two experiments: determining that hlh-14::gfp is expressed in the PVQ/HSN/PHB neuroblast lineage; and determining the cell lineage defect of hlh-14(gm34) embryos. For both experiments, embryos were mounted on 5% agar pads in 2 µl of M9 buffer and examined on a Zeiss Axioskop compound microscope by Nomarski optics. Specific cells were identified relative to nearby landmark cell deaths (Sulston et al., 1983Go). In the analysis of hlh-14(gm34) embryos, lineaging began at the four-cell stage and was followed for only one of the two bilaterally symmetric lineages. Lineages were observed until the comma stage of development.

RNA interference and analyses
RNA interference experiments were performed on two genes, hlh-14 and hlh-2. hlh-14 sequences were amplified from C. elegans cDNA library template (see 5' and 3' RACE Methods) using the primers BG1-LHIS1 (5' GAATCTGCAGCAATGGGTCTGAGCTCAGATTTTC 3') and BG1-RHIS3 (5' CAAAAAGCTTTTAATGGTGTGGATAATTGGAATATG 3'), yielding a 0.7 kb product. hlh-2 sequences were amplified from C. elegans genomic DNA using the primers HLH-2L (5' GTTGACTACAATCATCAATTCCCACC 3') and HLH-2R (5' TTAAAACCGTGGATGTCCAAACTGC 3'), yielding a 0.8 kb product.

PCR products were cloned into the TA cloning vector, pGEM T-Easy (Promega). This vector is equipped with T7 and SP6 promoters flanking the site of DNA insertion. Following the protocols of Promega's Ribomax in vitro transcription kit, sense and antisense RNAs were made using the T7 and SP6 sites. Sense and antisense RNAs (1 µl of each) were run side by side on a 1.7% agarose gel to estimate relative concentrations. Based on this estimation, equimolar amounts of sense and antisense RNA were mixed with PBS (1x final concentration), incubated at 65°C for 15 minutes, and then incubated at 37°C for 30 minutes to complete the annealing reaction. To confirm the annealing reactions had worked, 1 µl of each ssRNA species was run on a 1.7% agarose gel next to 1 µl of dsRNA. A shifted banding pattern indicated successful annealing.

To control for general effects of RNAi, we injected dsRNA molecules of genes used in a separate study. Control RNAi injections did not phenocopy hlh-14 and hlh-2 dsRNA injections. To make control dsRNA molecules, we obtained cDNA phage clones from Yuji Kohara: yk394g5 (egr-1), yk73c3 (chd-3) and yk72d6 (chd-4). cDNAs were excised from phage following protocols provided by Yuji Kohara. After excision, the cDNAs were in the pBluescript plasmid, which is equipped with T7 and T3 transcription sites flanking the sites of cDNA insertion. Using both the T7 and T3 sites, sense and antisense transcripts were made for each clone, according to the protocol described in Promega's RiboMax in vitro transcription kit. Annealing and RNA integrity analyses were performed as described above.

For RNA interference, dsRNA was always injected into young adult worms at the maximum possible concentration; it was never diluted after the annealing reactions. Injected animals were picked to plates seeded with bacteria, allowed to lay eggs for 24 hours, and then transferred to fresh plates. Progeny laid after the first 24 hours were likely to display RNAi defects.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
hlh-14 cloning and characterization of mutations
hlh-14 was initially defined by two mutations, hlh-14(gm34) and hlh-14(ju243). hlh-14(gm34) was isolated in a genetic screen for mutants with missing or misplaced HSN motoneurons (G.G., unpublished), and hlh-14(ju243) was isolated in a screen for mutants with morphological defects (W.-M. Woo and A. Chisholm, personal communication). On a gross level, hlh-14 mutants have morphologically disorganized posteriors (Fig. 1B), an Unc (Uncoordinated) ventral coiling phenotype, and an Egl (Egg-laying defective) phenotype. Both hlh-14 alleles can be maintained in homozygous strains, but homozygotes have a high degree of larval lethality and are slow to develop. Homozygotes that escape lethality and reach adulthood have low fertility (data not shown).



View larger version (105K):
[in this window]
[in a new window]
 
Fig. 1. Grossly visible phenotypes of hlh-14 mutants. (A) The tail of a wild-type C. elegans larva. (B) An hlh-14(gm34) larva. hlh-14 mutant worms can have disorganized, lumpy tails (arrow) and, less often, lumps at other positions along the AP axis. The cellular bases for these morphological defects are unclear. (C,D) hlh-14(RNAi) larvae. hlh-14(RNAi) larvae can display a range of morphological defects. (C) A severely affected hlh-14(RNAi) animal with a large posterior bulge (arrow). (D) An animal mildly affected by hlh-14(RNAi) treatment, showing only a small bump in the tail (arrow). Some hlh-14(RNAi) animals have a normal body structure, but still display neuronal phenotypes, indicating that these two phenotypes can be uncoupled.

 
We cloned hlh-14 by conventional mapping and rescue experiments (see Materials and methods). In the C. elegans genome database, hlh-14 is identified as the open reading frame C18A3.8 and encodes a basic helix-loop-helix (bHLH) protein similar to members of the A-S family (Fig. 2). We detected three different forms of hlh-14 mRNA expressed in C. elegans by performing 5' and 3' RACE (Fig. 2A; see Materials and methods). The three forms predict three different HLH-14 proteins, each containing a unique N terminus, but all containing the same bHLH domain and the same novel C terminus (Fig. 2B).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 2. hlh-14 gene structure, predicted protein sequence and comparison with other A S family members. (A) Schematic representation of hlh-14 mRNA. By 5' and 3' RACE, we detected three different hlh-14 cDNAs, predicting three different forms of HLH-14 protein (Materials and methods). Analyses of these cDNA species indicate that hlh-14 mRNA is not trans-spliced. The three forms of mature hlh-14 mRNA have unique start codons (AUG) but encode the same bHLH domain and the same novel C terminus. The shortest form encodes a 148 amino acid protein. The 5' end of the corresponding short cDNA is the only 5' end we could amplify out of a RACE cDNA library without performing a second, nested PCR reamplification (Materials and methods). Therefore, it is likely that this form is the most abundant form of hlh-14 mRNA in C. elegans. In the corresponding protein, there are only eight amino acids N-terminal of the bHLH domain (MAKKNQVA). (B) Primary amino acid sequences of HLH-14. The three different start methionines are enlarged. For the two longer forms of HLH-14, alternative beginning peptides are boxed. The leucine and glutamine residues changed, respectively, by the hlh-14(gm34) missense mutation and the hlh-14(ju243) nonsense mutation are enlarged and underlined. Both lesions are in the conserved bHLH domain. (C) Alignment of the bHLH domains of HLH-14, HLH-3 (C. elegans), Achaete (Drosophila), Scute (Drosophila) and Mash1 (Ascl1; mouse). Residues shaded in black are identical. Lightly shaded residues are similar to corresponding black residues. Consensus residues are present in at least three of the five proteins aligned. The residues affected by the hlh-14(gm34) and hlh-14(ju243) mutations are detailed.

 
Both hlh-14 mutations are lesions in the bHLH domain (Fig. 2C). hlh-14(gm34) is a missense mutation, changing a conserved leucine to a phenylalanine in the N-terminal helix. hlh-14(ju243) is a nonsense mutation in the C-terminal helix, changing a glutamine codon to an ochre stop codon. Several observations suggest that both hlh-14 alleles severely reduce or eliminate gene function. First, both alleles are recessive, generate similar phenotypes and fail to complement one another (data not shown). Second, the deficiency maDf4 fails to complement both hlh-14(gm34) and hlh-14(ju243); hemizygous hlh-14/maDf4 and homozygous hlh-14 mutants display similar defects (Table 1). Third, reduction of hlh-14 function by RNA interference (RNAi) generates similar, although weaker, phenotypes as the hlh-14 mutations (Fig. 1C,D; Tables 2, 3, 4). Finally, the hlh-14 molecular lesions are predicted to reduce or eliminate hlh-14 function. The hlh-14(gm34) leucine to phenylalanine missense mutation alters a highly conserved leucine (Fig. 2C). An identical leucine to phenylalanine mutation is found in the C. elegans bHLH loss-of-function mutant lin-32(e1926) (Zhao and Emmons, 1995Go). The hlh-14(ju243) nonsense mutation is predicted to eliminate the C terminus of the second helix, which contains highly conserved residues (Fig. 2C).


View this table:
[in this window]
[in a new window]
 
Table 1. hlh-14 loss induces PHB neuron loss

 


View this table:
[in this window]
[in a new window]
 
Table 2. hlh-14 loss induces HSN neuron loss

 


View this table:
[in this window]
[in a new window]
 
Table 3. hlh-14 loss induces PVQ neuron loss

 


View this table:
[in this window]
[in a new window]
 
Table 4. hlh-2 loss induces PVQ, HSN, and PHB neuron loss

 
HLH-14::GFP is expressed in the cells of the PVQ/HSN/PHB neuroblast lineage
To determine which cells express HLH-14, we generated a full-length hlh-14::gfp translational fusion (see Materials and methods). hlh-14; hlh-14::gfp animals are rescued for the morphological defects and the larval lethality observed in hlh-14 mutants, indicating that this fusion is functional (data not shown). The hlh-14::gfp transgene expresses GFP in the nuclei of several cells in the developing embryo. Prior to morphogenesis, a horseshoe-shaped pattern of cells expresses HLH-14::GFP in the anterior embryo (data not shown). The expressing cells appear to be neuroblasts but have not been positively identified. During morphogenesis, HLH-14::GFP assumes a complicated, diverse pattern, and no HLH-14::GFP is visible during postembryonic development (data not shown).

In the posterior embryo, we first detect HLH-14::GFP in the bilaterally symmetric blast cells ABplapppa and ABprapppa. Respectively, we call these cells the left and right PVQ/HSN/PHB neuroblasts (Fig. 3B,D) because they generate the PVQ interneurons, the HSN motoneurons, and the PHB sensory neurons. A centrally located posterior blast cell expresses HLH-14::GFP a little later. We have tentatively identified this centrally located cell as C.aapa (Fig. 3F).



View larger version (126K):
[in this window]
[in a new window]
 
Fig. 3. HLH-14::GFP is expressed in the PVQ/HSN/PHB neuroblasts and their descendants. All images in this series show a ventral view. Anterior is at the upper left corner and posterior is at the lower right corner. Images in this series reveal posterior embryonic HLH-14::GFP expression. Nomarski photomicrographs (A,C,E,G,I,K) and the corresponding fluorescence photomicrographs (B,D,F,H,J,L) of wild-type embryos containing a gmIs20[hlh-14::gfp] transgene. (A,B) HLH-14::GFP is expressed in the right PVQ/HSN/PHB neuroblast, ABprapppa (arrow). (C,D) GFP expression of the same embryo shown in A and B, showing a different focal plane. HLH-14::GFP is expressed in the left PVQ/HSN/PHB neuroblast, ABplapppa (arrow). (E,F) HLH-14::GFP is expressed in the daughter cells of the PVQ/HSN/PHB neuroblasts: the anterior PVQ neuroblasts (open arrows) and the posterior HSN/PHB neuroblasts (closed arrows). We have tentatively identified the central GFP-expressing cell as the neuroblast C.aapa (arrowhead). (G,H) HLH-14::GFP is expressed in the anterior daughter of the right HSN/PHB neuroblast, a cell fated to die (closed arrow), and in its larger sister cell, the right HSN/PHB precursor (open arrow). The asterisk indicates the right PVQ neuroblast, which is out of focus. (I,J) HLH-14::GFP is expressed in the daughters of the left HSN/PHB neuroblast (arrows analogous to H). (K,L) HLH-14::GFP is expressed in the daughters of the PVQ neuroblast, the anterior PVQ neurons (closed arrows) and their posterior sisters, which are fated to die (open arrows). Scale bar: 5 µm. (M) Cell lineage depicting the PVQ/HSN/PHB neuroblast and its descendants.

 
Around 230 minutes of development, each PVQ/HSN/PHB neuroblast divides to generate an anterior PVQ neuroblast and a posterior HSN/PHB neuroblast. We see HLH-14::GFP expressed in both of these daughter cells (Fig. 3F). At 280 minutes of development, the HSN/PHB neuroblast divides to produce a small daughter cell that dies and a larger daughter cell, the HSN/PHB precursor. Both cells contain HLH-14::GFP (Fig. 3H,J). Finally, around 310 minutes of development, the PVQ neuroblast divides to produce a posterior daughter cell that dies and the PVQ neuron. Again, we see HLH-14::GFP in both of these cells (Fig. 3L).

hlh-14 mutants are missing HSN motoneurons and PHB sensory neurons
In hermaphrodite larvae, a left/right bilaterally symmetric pair of HSN motoneurons is found at the middle of the animal, near the presumptive gonad. By Nomarski optics, we only rarely found the HSNs in hlh-14 mutant worms; when we did find them, they were displaced posteriorly, having failed to complete their normal migratory routes (data not shown). We corroborated this observation using an HSN reporter, unc-86::gfp (Gitai et al., 2003Go). unc-86 encodes a POU homeodomain protein, and this promoter fusion always expresses GFP in the HSNs of wild-type larvae (Fig. 4A). By contrast, we never saw HSNs expressing GFP in hlh-14(gm34); unc-86::gfp larvae (Fig. 4B; Table 2).



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 4. hlh-14 mutants are missing HSN, PHB, and PVQ neurons. Images in this series show lateral views of either wild-type (A,C,E) or hlh-14 mutant (B,D,F) larvae expressing GFP reporters to visualize the HSN, PHB or PVQ neurons. (A,B) Anterior is towards the left and ventral is upwards. (A) GFP expression in an hlh-14(gm34)/mIn1; kyIs179[unc-86::gfp] larva. As this worm is only heterozygous for the hlh-14(gm34) mutation, it appears wild type and expresses GFP in the HSN neuron visible in this focal plane (arrow). The GFP expression in the pharynx of this worm indicates the presence of the mIn1 balancer, and hence, a wild-type copy of the hlh-14 gene. (B) GFP expression in an hlh-14(gm34); kyIs179 larva. No HSNs are visible by GFP expression. The arrow indicates the position where the HSNs would be in a wild-type animal. (C) GFP expression in the tail of a wild-type gmIs12[srb-6::gfp] larva. GFP is visible in both phasmid neurons, PHA and PHB (two arrows), sensory neurons in the tail. (D) GFP expression in an hlh-14; gmIs12 larva. Only one phasmid neuron (PHA) is visible; PHB is missing. (E) GFP expression in an hlh-14(gm34)/mIn1; kyIs39[sra-6::gfp] larva. As this worm is only heterozygous for the hlh-14(gm34) mutation, it appears wild type and expresses GFP in the PVQ neuron visible in this focal plane (arrow). The GFP expression slightly anterior to PVQ is due to the presence of mIn1. (F) GFP expression in an hlh-14(gm34); kyIs39 larva. No PVQs are visible by GFP expression. The arrow indicates the position of the PVQs in a wild-type animal.

 
Staining the HSNs with an anti-serotonin antibody (see Materials and methods) also revealed the loss of HSNs in hlh-14 mutants (Table 2). On the rare occasions this antibody did detect the HSNs in hlh-14 mutants, they had failed to migrate properly (data not shown). We conclude that hlh-14 mutants are either missing their HSN neurons, or at best, they produce profoundly defective HSN neurons. In either case, hlh-14 appears important for HSN development.

The PHB sensory neuron is the sister cell of the HSN. As hlh-14 mutants lack HSNs, we hypothesized that they might also lack PHBs. To test this possibility, we used the reporter srb-6::gfp, which expresses GFP in both the PHA and PHB phasmid neurons, sensory neurons that are located in the tail. srb-6 encodes a seven transmembrane receptor protein expressed in several sensory neurons (Troemel et al., 1995Go). Wild-type srb-6::gfp animals always had two GFP-expressing neurons on each side of the tail, one PHA and one PHB (Fig. 4C; Table 1). By contrast, hlh-14; srb-6::gfp larvae almost always had only a single GFP-expressing neuron per side, consistent with hlh-14 mutants missing their PHB neurons (Fig. 4D, Table 1).

To eliminate the possibility that hlh-14 mutants lacked PHAs and not PHBs, we used more specific markers (data not shown). With the PHB-specific neuropeptide-like promoter fusion nlp-1::gfp (Li et al., 1999Go), we found that hlh-14 mutants lacked PHB neurons. With the PHA-specific promoter fusions flp-15::gfp (Li et al., 1999Go) and osm-10::gfp (Hart et al., 1999Go) (PHA-specific in adults), we found no alteration in the number of PHA neurons in hlh-14 mutants.

hlh-14 mutations are epistatic to mutations that disrupt the HSN/PHB neuroblast division
hlh-14 mutants have the opposite neuronal phenotype as ham-1 mutants. ham-1 encodes a novel protein involved in executing the asymmetric divisions of neuroblasts (Guenther and Garriga, 1996Go). In ham-1 mutants, the HSN/PHB neuroblast divides symmetrically, inappropriately generating two HSN/PHB precursor cells, and subsequently, extra HSN and PHB neurons. This phenotype can be seen using srb-6::gfp, where PHB neuron duplications generate extra GFP-expressing phasmid neurons about 25% of the time in ham-1 mutants (Table 1). In ham-1 ced-3 double mutants, the phenotype is more striking (Table 1). Concurrent removal of the novel protein HAM-1 and the caspase CED-3, which is necessary for normal programmed cell death (Ellis and Horvitz, 1986Go; Yuan et al., 1993Go), can increase the penetrance of extra PHB neurons to over 90% (Guenther and Garriga, 1996Go).

We reasoned that if hlh-14 mutations were affecting the overall ability to determine neuronal fate, hlh-14 should be epistatic to ham-1. Indeed this is the case, as hlh-14; ham-1 double mutants were always missing their PHB neurons (Table 1). To rule out the possibility that the effects we saw in hlh-14 mutants were simply due to inappropriate programmed cell death, we examined hlh-14; ham-1 ced-3 triple mutants. As with hlh-14 single mutants, these triply mutant animals were always missing their PHB neurons (Table 1). We conclude that hlh-14 mutations are epistatic to mutations that alter the HSN/PHB neuroblast division. Furthermore, hlh-14 mutants are not missing neurons because of inappropriate programmed cell death. Therefore, hlh-14 appears to be a vital factor in determining the HSN/PHB neuroblast fate, or the fate of a cell that generates the HSN/PHB neuroblast.

hlh-14 mutants are missing PVQ neurons
Considering the HLH-14::GFP expression pattern, we hypothesized that the PVQ neurons might be missing or defective in hlh-14 mutants. Analysis of the tails of hlh-14 mutants by Nomarski optics suggested that the PVQs were missing (data not shown). To test this hypothesis directly, we used the PVQ-specific GFP reporter, sra-6::gfp (Troemel et al., 1995Go). Wild-type sra-6::gfp animals always had PVQ neurons expressing GFP (Fig. 4E; Table 3). By contrast, sra-6::gfp; hlh-14(gm34) animals never had PVQ neurons expressing GFP (Fig. 4F; Table 3).

hlh-14 mutants have a cell division defect in the PVQ/HSN/PHB neuroblast lineage
The preceding data are consistent with HLH-14 acting to promote the PVQ, HSN and PHB fates. HLH-14 could act directly in these neurons. However, as HLH-14 is an A-S family member, it could play a proneural role, acting earlier to ensure the proper execution of the entire PVQ/HSN/PHB neuroblast lineage. To address this possibility, we directly observed the cell division patterns of hlh-14(gm34) mutant embryos.

We examined two PVQ/HSN/PHB neuroblast lineages in hlh-14(gm34) embryos. In wild-type embryonic lineages (Fig. 5A), the ABpl/rappp cell divides to generate the PVQ/HSN/PHB neuroblast and the hyp7/T blast cell around 170 minutes after fertilization (Sulston et al., 1983Go). This division occurred at the right time in each hlh-14(gm34) mutant lineage. Approximately 230 minutes after fertilization in wild-type embryos, the PVQ/HSN/PHB neuroblast divides to generate the PVQ neuroblast and the HSN/PHB neuroblast (Fig. 5A). This division also appeared to occur normally in hlh-14(gm34) embryos. Approximately 280 minutes after fertilization in wild-type embryos, the HSN/PHB neuroblast divides, and at ~310 minutes, the PVQ neuroblast divides (Fig. 5A). Neither of these divisions occurred in the hlh-14(gm34) embryos.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 5. Cell lineage defects in hlh-14 mutants. (A) In wild-type embryos, the ABpl/rappp cell divides to generate the PVQ/HSN/PHB neuroblast and the hyp7/T blast cell. The PVQ/HSN/PHB neuroblast subsequently undergoes a series of divisions, ultimately generating the PVQ, HSN and PHB neurons. The hyp7/T blast cell divides only once during embryogenesis, generating a hyp7 cell and the T blast cell, a seam cell that divides postembryonically. (B) In hlh-14 mutants, the ABpl/rappp cell divides at the appropriate time. However, the presumptive PVQ/HSN/PHB neuroblast does not undergo a series of divisions to generate the PVQ, HSN and PHB neurons. Instead, it divides just once, like its sister cell, the hyp7/T blast cell. In hlh-14 mutants, it is possible that the PVQ/HSN/PHB neuroblast is transformed into a hyp7/T blast-like cell, a model shown in this lineage. (C) A wild-type L1 larva containing a C50B6.8::gfp reporter construct, which expresses GFP in the ten hypodermal seam cells, H0-H2, V1-V6 and T (Mounsey et al., 2002Go). (D) An hlh-14 mutant L1 larva expressing the C50B6.8::gfp reporter. In addition to expressing GFP in the ten hypodermal seam cells, this larva expresses GFP in an extra cell in the tail, presumably a T-like cell (arrow). In 38% of the of hlh-14 mutants, we observed this ectopic GFP expression (n=60 sides scored). We never observed this extra cell in wild-type animals bearing C50B6.8::gfp.

 
In the course of our cell lineage analyses, we never saw any inappropriate cell death corpses (data not shown). This observation is consistent with the idea that programmed cell death is not responsible for missing neurons in hlh-14 mutants. We conclude that in hlh-14 mutants, cell division is abnormal in both daughters of the PVQ/HSN/PHB neuroblast; specifically, the daughter cells fail to divide.

In hlh-14 mutants, the PVQ/HSN/PHB neuroblast may be transformed into its sister cell
We questioned why the HSN/PHB neuroblast and the PVQ neuroblast both failed to divide in hlh-14 mutants. They may have withdrawn from the cell cycle prematurely, or they may have inappropriately assumed the fates of other cells. Considering this latter possibility, we noted that in hlh-14 mutant embryos, the division pattern of the presumptive PVQ/HSN/PHB neuroblast was similar to the normal division pattern of its sister cell, the hyp7/T blast cell (Fig. 5A,B). We hypothesized that the PVQ/HSN/PHB neuroblast may adopt the fate of its sister cell in hlh-14 mutants. Such a cell fate transformation would signify a defect in asymmetric cell division, which is defined as the process by which sister cells adopt distinct fates (Horvitz and Herskowitz, 1992Go).

If the PVQ/HSN/PHB neuroblast were transformed into an extra hyp7/T blast cell, then hlh-14 mutants should have extra T cells, a type of dermal blast cell in the tail. To test whether hlh-14 mutants have extra T cells, we used a C50B6.8::gfp reporter. C50B6.8 is a C. elegans gene that is expressed in the ten hypodermal seam cells, including the T cells (Mounsey et al., 2002Go) (Fig. 5C). C50B6.8 encodes a protein with a domain similar to the ligand binding domains of nuclear hormone receptors (Mounsey et al., 2002Go). With this GFP reporter, we observed that hlh-14 mutants often have extra GFP-expressing cells in the tail, presumably extra T (or T-like) cells (Fig. 5D). This observation is consistent with the PVQ/HSN/PHB neuroblast assuming a hyp7/T blast cell fate in hlh-14 mutants.

Notably, these supernumerary T-like cells are smaller than normal T cells (Fig. 5D). They are also located slightly medial to the seam cells, which is consistent with the positions of the presumptive PVQ/HSN/PHB neuroblast daughter cells in hlh-14 mutants. Collectively, our observations indicate that the PVQ/HSN/PHB neuroblasts can adopt characteristics of hyp7/T blast cells in hlh-14 mutants.

HLH-14 determines cell fate in the descendants of the PVQ/HSN/PHB neuroblasts
HLH-14 appears to determine PVQ/HSN/PHB neuroblast fate, a proneural characteristic. Yet HLH-14::GFP is expressed not only in the PVQ/HSN/PHB neuroblast but also in its descendants. In addition to HLH-14 acting like a proneural factor, we wondered whether HLH-14 might also act like a neural differentiation bHLH factor and determine the fates of cells late in this neuroblast lineage.

To examine this possibility, we took advantage of the partial loss-of-function phenotype of hlh-14(RNAi). hlh-14(RNAi) treatment does not cause a complete loss of PVQ, HSN or PHB neurons (Tables 2, 3, 4). Therefore, we were able to test whether the loss of one neuron type was correlated with the loss of another neuron type in hlh-14(RNAi) animals. A correlation between HSN loss and PVQ loss, for example, could indicate a defect in their common precursor, the PVQ/HSN/PHB neuroblast. A lack of correlation could indicate a role for HLH-14 later in the cell lineage, perhaps in the neurons themselves.

We first looked for a correlation between HSN and PHB loss in hlh-14(RNAi) animals. We subjected worms bearing the nlp-1::gfp transgene, which expresses GFP in the PHB neurons, to hlh-14(RNAi) treatment. We isolated F1 progeny as adults and double stained them with anti-serotonin and anti-GFP antibodies to examine the HSNs and PHBs. A large majority of the time, HSN loss (or presence) correlated with PHB loss (or presence; 69/78 sides scored correlated). Occasionally, however, one cell or the other was lost (9/78 sides scored). Additionally, several of the HSN neurons that were detected in hlh-14(RNAi) animals were not fully migrated, and some had axon outgrowth defects (data not shown). Together, these results indicate that in addition to determining the fates of HSN and PHB precursors, HLH-14 plays roles in determining the fates of the HSN and PHB neurons themselves.

In a similar experiment, we looked for a correlation between HSN and PVQ loss in sra-6::gfp; hlh-14(RNAi) worms. We found that HSN loss is not at all correlated with PVQ loss in these animals (21/54 sides scored correlated). The PVQ neurons are lost significantly more often than the HSN neurons (Tables 2, 3), accounting for most of the differences we observe. The PVQ neuroblast or PVQ neuron appear to be especially sensitive to hlh-14 loss, by our assay. We conclude that although hlh-14 may play a role in determining PVQ/HSN/PHB neuroblast fate, it also appears to determine the fates of the descendants of the neuroblast.

Loss of hlh-2 function can cause neuron loss and exacerbate hlh-14(RNAi) neuron loss
Neural bHLH proteins often regulate transcription by forming heterodimers with the E/Daughterless (DA) proteins, a ubiquitously expressed family of bHLH proteins. Therefore, we wondered whether the C. elegans E/DA family member, HLH-2, might function with HLH-14 in the PVQ/HSN/PHB neuroblast lineage. Indeed, previous work demonstrated that HLH-2 is expressed in this lineage (Krause et al., 1997Go).

To date, no strong loss-of-function hlh-2 mutants exist or have been reported, so we used RNAi treatment to see what effects hlh-2 loss could exert on PVQ, HSN and PHB neuron development. Consistent with previous studies, hlh-2(RNAi) treatment caused nearly complete embryonic lethality (Kamath et al., 2003Go; Krause et al., 1997Go). However, a small percentage of animals escaped this lethality. Like hlh-14 mutants, these hlh-2(RNAi) escapers had gross phenotypes, including posterior morphological defects and larval lethality (data not shown). Most relevant to our study, they often lacked PVQ, HSN and PHB neurons (Table 4).

Partial loss-of-function hlh-2 mutations generate no phenotypes on their own, but a prior study demonstrated that they can exacerbate the male tail ray loss phenotype of hypomorphic lin-32 mutants; HLH-2 and LIN-32 act together to execute neuronal fates in the ray lineage (Portman and Emmons, 2000Go). We wondered if the mutation, hlh-2(bx115), could also enhance hlh-14(RNAi), which produces a partial loss-of-function phenotype (Fig. 1C,D; Tables 2, 3, 4). Although hlh-2(bx115) mutants have a normal number of HSN and PHB neurons, hlh-2(bx115); hlh-14(RNAi) animals lack more HSN and PHB neurons than hlh-14(RNAi) animals, showing that a weak hlh-2 mutant can enhance partial hlh-14 loss (Table 4).


    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
We have described a role in neuronal development for a C. elegans A-S bHLH family member, HLH-14. hlh-14 mutants lack three lineally related neurons: the PVQ interneuron, the HSN motoneuron and the PHB sensory neuron. Based on GFP reporter data and cell lineage analyses, we hypothesize that these neurons are missing because their common precursor, the PVQ/HSN/PHB neuroblast, fails to differentiate properly, and instead adopts characteristics of its sister cell. It also appears that HLH-14 acts in conjunction with the C. elegans E/Daughterless homolog, HLH-2, in regulating neuronal fate in this cell lineage.

hlh-14 and other Achaete-Scute family genes: similarities and differences
Aside from its conserved sequence, there are a number of similarities between hlh-14 and previously characterized A-S genes. The most obvious similarity is that hlh-14 mutants lack neurons. A-S family members in Drosophila specify external sense organs. In the absence of A-S genes, neuronal cell types needed for the function of these organs are lost (Garcia-Bellido, 1979Go; Gonzalez et al., 1989Go; Villares and Cabrera, 1987Go). Vertebrate A-S family members generate a wide variety of neuronal precursors, including the progenitors of the cerebral cortex and progenitors in the ventral telencephalon (Casarosa et al., 1999Go; Guillemot et al., 1993Go; Horton et al., 1999Go). In this study, we have clearly established that hlh-14 function is required for normal PVQ, HSN, and PHB neuron development.

Yet a close look at the types of neurons specified by hlh-14 reveals an important difference between hlh-14 and other A-S genes. While Drosophila and mammalian A-S genes appear to specify neuroblast lineages dedicated to generating neuronal cells of a particular type or coordinated function, hlh-14 specifies a neuroblast lineage dedicated to generating three disparate types of neuron: an interneuron (PVQ), a motoneuron (HSN) and a sensory neuron (PHB). There is no known coordinated function that these three neurons perform. Why is hlh-14 less specific than fellow A-S family members in this regard? One possibility is that C. elegans must adapt the function of neural bHLH genes such as hlh-14 in order to generate its diverse collection of 302 neurons (of 118 distinct types) out of only 959 somatic cells. Such adaptation may allow hlh-14 to specify lineally related, yet functionally distinct, collections of neurons.

A second similarity between hlh-14 and other A-S-like genes is the genetic interaction between hlh-14 and hlh-2, the C. elegans E/DA homolog. In Drosophila, heterodimers between DA and A-S family members are essential for neurogenesis (Cabrera and Alonso, 1991Go). In C. elegans, the A-S factor HLH-3 can bind E/DA HLH-2 in vitro, and the expression patterns of HLH-3 and HLH-2 overlap in a number of neuronal lineages (Krause et al., 1997Go; Thellman et al., 2003). Taken together, four facts suggest that HLH-14 and HLH-2 act together in the PVQ/HSN/PHB lineage to regulate neuronal development. First, A-S proteins, as well as other types of bHLH proteins, are known to interact physically with E/DA family members to form functional heterodimers in a number of organisms (Cabrera and Alonso, 1991Go; Johnson et al., 1992Go; Krause et al., 1997Go; Massari and Murre, 2000Go). Second, both HLH-14 and HLH-2 are expressed in the PVQ/HSN/PHB lineage (this study) (Krause et al., 1997Go). Third, loss of function of either gene results in the loss of neurons in this lineage. Fourth, a weak hlh-2 mutant can enhance the partial neuronal loss defects of hlh-14(RNAi).

Another similarity that HLH-14 shares with certain A-S family members is that it possesses proneural characteristics. Not only is hlh-14 necessary for neuron development, but also it is expressed early in neurogenesis. We see hlh-14::gfp expressed in the PVQ/HSN/PHB neuroblast, the first cell in this lineage solely dedicated to generating neurons.

Individual neural bHLH factors can assume multiple roles in C. elegans
Even though hlh-14 has proneural characteristics, a notable difference between hlh-14 and some A-S genes is that hlh-14 is not strictly proneural. Numerous pieces of evidence point to this conclusion. First, hlh-14::gfp expression is not restricted to early neuroblasts. We observe hlh-14::gfp expression in the lineal descendants of the PVQ/HSN/PHB neuroblast, including the PVQ neuron, a postmitotic cell. Second, hlh-14 mutants do not display wholesale neuron loss for all the neurons we examined. For example, the HSNs are not always lost. Furthermore, of the HSNs that are generated, many fail to migrate and project their axons properly. Finally, HSN loss is not perfectly correlated with PHB and PVQ loss in hlh-14(RNAi) animals. Collectively, these results demonstrate that hlh-14 plays important roles in the descendants of the PVQ/HSN/PHB neuroblast, not just the neuroblast itself.

There are other A-S genes that are not strictly proneural. For example, the Drosophila gene asense has proneural characteristics; its ectopic expression induces the generation of ectopic sense organs (Dominguez and Campuzano, 1993Go). However, unlike other proneural factors, asense is not normally expressed early in neuroblast lineages. It is expressed later, in the precursors of sensory organ cells (Dominguez and Campuzano, 1993Go; Gonzalez et al., 1989Go). Among A-S genes that have been characterized, hlh-14 appears unique in the sense that it is expressed early in a lineage to establish neuroblast fate, but nevertheless persists in subsequent generations to execute the fates of neuronal precursors and neurons.

This characteristic of hlh-14 is shared by other C. elegans neural bHLH factors. For example, the C. elegans Atonal homolog, LIN-32, both establishes ray neuroblast fate and helps execute the fates of cells at multiple steps in the ray lineage (Portman and Emmons, 2000Go; Zhao and Emmons, 1995Go). The C. elegans NeuroD bHLH homolog, CND-1, is expressed in both neuronal precursors and postmitotic neurons and appears to be important to keep these precursors from withdrawing from their lineages (Hallam et al., 2000Go). The only other neural bHLH that has been described in any detail in C. elegans is the A-S protein HLH-3. It has not been reported how HLH-3 promotes neurogenesis, but embryonic expression of an hlh-3::gfp transgene is extensive and shows considerable overlap with HLH-2 expression in neuronal lineages (Krause et al., 1997Go). Therefore, it seems plausible that HLH-3 could affect both early and late events in neuronal development.

It is unclear why some C. elegans bHLH factors act at several steps in neuronal lineages, seemingly unlike their Drosophila or vertebrate counterparts. It is not because nematodes have fewer neural bHLH proteins at their disposal; indeed, there are five A-S-like genes in C. elegans, but only four in Drosophila, and three in mouse (Ledent et al., 2002Go). The fact that individual C. elegans bHLH factors appear sufficient to drive both early and late events in neural development contrasts with the progressive determination model formulated from studies in Drosophila and vertebrates (Dambly-Chaudiere and Vervoort, 1998Go; Ghysen and Dambly-Chaudiere, 1989Go; Jan and Jan, 1994Go). According to this model, neuronal lineages consist of cells whose fates become more restricted with each generation. A sequential cascade of bHLH factors helps drive this process, with proneural factors defining neuroblast lineages and signaling through Notch to promote the expression of differentiation bHLH factors that promote later developmental events. In C. elegans, however, a single neural bHLH protein appears capable of functioning in each of these steps, at least in some cell lineages.

C. elegans bHLH mutations can disrupt asymmetric cell divisions
An additional difference between hlh-14 and other A-S family members comes from analyzing Hlh-14 mutant phenotypes. The loss of neurons is expected for the loss of an A-S family member like hlh-14. What is unexpected is the inappropriate duplication of a lineally related sister cell. In hlh-14 mutants, there appear to be duplications of the hyp7/T blast cell at the expense of its sister cell, the PVQ/HSN/PHB neuroblast. While these duplications are not completely penetrant, they do occur with reasonable frequency, as assayed by the presence of extra T-like cells in hlh-14 mutants (Fig. 5D). The incomplete penetrance may be due to incomplete or partial transformations of PVQ/HSN/PHB neuroblast fate.

Asymmetric cell division is defined as any division in which a mother cell gives rise to two daughter cells of distinct fates (Horvitz and Herskowitz, 1992Go). It is a fundamental mechanism employed by metazoans to generate cellular diversity. The vast majority of C. elegans non-germline cell divisions are asymmetric (Kimble and Hirsh, 1979Go; Sulston and Horvitz, 1977Go; Sulston et al., 1983Go). Normally, ABpl/rappp divides asymmetrically, generating the PVQ/HSN/PHB neuroblast and the hyp7/T blast cell. Our data suggest that this asymmetric division is disrupted in hlh-14 mutants because the PVQ/HSN/PHB neuroblast can be partially transformed into its sister cell.

The disruption of an asymmetric cell division is not unprecedented for the loss of a neural bHLH factor in C. elegans. This phenomenon is what one observes in the V5.pa cell lineage in lin-32 mutants and in the NSM cell lineage in hlh-3 mutants. In wild-type animals, the V5.pa cell becomes a neuroblast called the postdeirid neuroblast. However, in lin-32 mutants, lineage analysis shows that V5.pa can assume the fate of its sister cell, the V5.pp hypodermal blast cell (Zhao and Emmons, 1995Go). In hlh-3 mutants, the sister cell of the NSM neuron can forego a programmed cell death fate and assume an NSM-like fate instead (Thellmann et al., 2003Go).

Why might some nematode asymmetric divisions become symmetric upon losing a bHLH factor? The answer is unclear, but it seems instructive to consider the cellular context in which neurons are generated in different organisms. In Drosophila, proneural genes are first expressed in the neuroectoderm in order to select neuronal precursors. Without proneural activity, neuroblast lineages are not selected, resulting in an absence of neuronal organs and excess dermal cells. In vertebrates, proneural genes are first expressed in neuroepithelial cells. Proneural expression induces the selection of neuronal precursors that then delaminate from the neuroepithelium and divide a finite number of times to generate neuronal cell types. Some neuroepithelial cells that are not selected to be neuroblasts delaminate and generate glia instead. Loss of proneural function can lead to a loss of neurons, but extra glia in vertebrates.

By contrast, C. elegans does not select most of its neuroblast lineages from populations of dermal cells. Instead, C. elegans works within the context of its cell lineage, which generates only 959 somatic cells in the adult (Kimble and Hirsh, 1979Go; Sulston and Horvitz, 1977Go; Sulston et al., 1983Go). Considering this, and considering our work, it seems possible that neural bHLH factors can act like a switch between one of two sister cell fate decisions in nematodes. This is not entirely dissimilar from what has been observed in Drosophila and vertebrates, where proneural bHLH factors act like a switch between neuroblast and ectodermal or epithelial/glial cell fates. The difference is that in flies and vertebrates cell fate is regulated spatially, while in C. elegans, cell fate may be distributed asymmetrically at mitosis. As a result, loss of a neural bHLH factor can result in the disruption of an asymmetric cell division.


    ACKNOWLEDGMENTS
 
We thank Wei-Meng Woo and Andrew Chisholm for isolating and sharing the hlh-14(ju243) allele, as well as Douglas Portman and Scott Emmons for sharing hlh-2(bx115) and experimental ideas regarding hlh-2. We are grateful to Chun Tsai and Barbara Meyer for use of their 5' and 3' RACE C. elegans cDNA libraries, as well as to Cori Bargmann, Ann Hart, Nancy Hawkins, Ian Hope, Josh Kaplan and Chris Li for providing GFP reporter constructs. Finally, we thank Shaun Cordes, Kirsten Hagstrom and Jim Withee for critical reading of the manuscript and members of the Garriga, Meyer, Dernburg, and Kaplan laboratories for helpful discussions. This work was supported by National Institutes of Health grant NS42213 to G.G. C.A.F. was supported by a National Science Foundation predoctoral fellowship.


    Footnotes
 
* Present address: Gladstone Institute of Virology and Immunology, University of California, San Francisco, San Francisco, CA 94141-9100, USA Back


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 


Allende, M. L. and Weinberg, E. S. (1994). The expression pattern of two zebrafish achaete-scute homolog (ash) genes is altered in the embryonic brain of the cyclops mutant. Dev. Biol. 166,509 -530.[CrossRef][Medline]
Ball, D. W., Azzoli, C. G., Baylin, S. B., Chi, D., Dou, S., Donis-Keller, H., Cumaraswamy, A., Borges, M. and Nelkin, B. D. (1993). Identification of a human achaete-scute homolog highly expressed in neuroendocrine tumors. Proc. Natl. Acad. Sci. USA 90,5648 -5652.[Abstract/Free Full Text]
Bertrand, N., Castro, D. S. and Guillemot, F. (2002). Proneural genes and the specification of neural cell types. Nat. Rev. Neurosci. 3, 517-530.[CrossRef][Medline]
Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-94.[Abstract/Free Full Text]
Cabrera, C. V. and Alonso, M. C. (1991). Transcriptional activation by heterodimers of the achaete-scute and daughterless gene products of Drosophila. EMBO J. 10,2965 -2973.[Medline]
Casarosa, S., Fode, C. and Guillemot, F. (1999). Mash1 regulates neurogenesis in the ventral telencephalon. Development 126,525 -534.[Abstract]
Chen, L., Krause, M., Draper, B., Weintraub, H. and Fire, A. (1992). Body-wall muscle formation in Caenorhabditis elegans embryos that lack the MyoD homolog hlh-1. Science 256,240 -243.[Abstract/Free Full Text]
Chien, C. T., Hsiao, C. D., Jan, L. Y. and Jan, Y. N. (1996). Neuronal type information encoded in the basic-helix-loop-helix domain of proneural genes. Proc. Natl. Acad. Sci. USA 93,13239 -13244.[Abstract/Free Full Text]
Dambly-Chaudiere, C. and Vervoort, M. (1998). The bHLH genes in neural development. Int. J. Dev. Biol. 42,269 -273.[Medline]
Desai, C., Garriga, G., McIntire, S. L. and Horvitz, H. R. (1988). A genetic pathway for the development of the Caenorhabditis elegans HSN motor neurons. Nature 336,638 -646.[CrossRef][Medline]
Dominguez, M. and Campuzano, S. (1993). asense, a member of the Drosophila achaete-scute complex, is a proneural and neural differentiation gene. EMBO J. 12,2049 -2060.[Medline]
Edgley, M. L. and Riddle, D. L. (2001). LG II balancer chromosomes in Caenorhabditis elegans: mT1(II;III) and the mIn1 set of dominantly and recessively marked inversions. Mol. Genet. Genomics 266,385 -395.[CrossRef][Medline]
Ellis, H. M. and Horvitz, H. R. (1986). Genetic control of programmed cell death in the nematode C. elegans. Cell 44,817 -829.[CrossRef][Medline]
Ferreiro, B., Skoglund, P., Bailey, A., Dorsky, R. and Harris, W. A. (1993). XASH1, a Xenopus homolog of achaete-scute: a proneural gene in anterior regions of the vertebrate CNS. Mech. Dev. 40,25 -36.[CrossRef][Medline]
Frowein, J., Campbell, K. and Gotz, M. (2002). Expression of Ngn1, Ngn2, Cash1, Gsh2 and Sfrp1 in the developing chick telencephalon. Mech. Dev. 110,249 -252.[CrossRef][Medline]
Garcia-Bellido, A. (1979). Genetic analysis of the achaete-scute system of Drosophila melanogaster. Genetics 91,491 -520.[Abstract/Free Full Text]
Garriga, G., Desai, C. and Horvitz, H. R. (1993). Cell interactions control the direction of outgrowth, branching and fasciculation of the HSN axons of Caenorhabditis elegans. Development 117,1071 -1087.[Abstract]
Ghysen, A. and Dambly-Chaudiere, C. (1989). Genesis of the Drosophila peripheral nervous system. Trends Genet. 5,251 -255.[CrossRef][Medline]
Gitai, Z., Yu, T. W., Lundquist, E. A., Tessier-Lavigne, M. and Bargmann, C. I. (2003). The netrin receptor UNC-40/DCC stimulates axon attraction and outgrowth through enabled and, in parallel, Rac and UNC-115/AbLIM. Neuron 37, 53-65.[CrossRef][Medline]
Gonzalez, F., Romani, S., Cubas, P., Modolell, J. and Campuzano, S. (1989). Molecular analysis of the asense gene, a member of the achaetescute complex of Drosophila melanogaster, and its novel role in optic lobe development. EMBO J. 8,3553 -3562.[Medline]
Goulding, S. E., White, N. M. and Jarman, A. P. (2000a). cato encodes a basic helix-loop-helix transcription factor implicated in the correct differentiation of Drosophila sense organs. Dev. Biol. 221,120 -131.[CrossRef][Medline]
Goulding, S. E., zur Lage, P. and Jarman, A. P. (2000b). amos, a proneural gene for Drosophila olfactory sense organs that is regulated by lozenge. Neuron 25,69 -78.[CrossRef][Medline]
Guenther, C. and Garriga, G. (1996). Asymmetric distribution of the C. elegans HAM-1 protein in neuroblasts enables daughter cells to adopt distinct fates. Development 122,3509 -3518.[Abstract]
Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A., Anderson, D. J. and Joyner, A. L. (1993). Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons. Cell 75,463 -476.[CrossRef][Medline]
Hallam, S., Singer, E., Waring, D. and Jin, Y. (2000). The C. elegans NeuroD homolog cnd-1 functions in multiple aspects of motor neuron fate specification. Development 127,4239 -4252.[Abstract]
Hart, A. C., Kass, J., Shapiro, J. E. and Kaplan, J. M. (1999). District signaling pathways mediate touch and osmosensory responses in apolymodal sensory neuron. J. Neurosci. 19,1952 -1958.[Abstract/Free Full Text]
Horton, S., Meredith, A., Richardson, J. A. and Johnson, J. E. (1999). Correct coordination of neuronal differentiation events in ventral forebrain requires the bHLH factor MASH1. Mol. Cell Neurosci. 14,355 -369.[CrossRef][Medline]
Horvitz, H. R. and Herskowitz, I. (1992). Mechanisms of asymmetric cell division: two Bs or not two Bs, that is the question. Cell 68,237 -255.[CrossRef][Medline]
Horvitz, H. R. and Sulston, J. E. (1980). Isolation and genetic characterization of cell-lineage mutants of the nematode Caenorhabditis elegans. Genetics 96,435 -454.[Abstract/Free Full Text]
Horvitz, H. R., Brenner, S., Hodgkin, J. and Herman, R. K. (1979). A uniform genetic nomenclature for the nematode Caenorhabditis elegans. Mol. Gen. Genet. 175,129 -133.[CrossRef][Medline]
Huang, M. L., Hsu, C. H. and Chien, C. T. (2000). The proneural gene amos promotes multiple dendritic neuron formation in the Drosophila peripheral nervous system. Neuron 25,57 -67.[CrossRef][Medline]
Jan, Y. N. and Jan, L. Y. (1994). Genetic control of cell fate specification in Drosophila peripheral nervous system. Annu. Rev. Genet. 28,373 -393.[CrossRef][Medline]
Jarman, A. P., Grau, Y., Jan, L. Y. and Jan, Y. N. (1993). atonal is a proneural gene that directs chordotonal organ formation in the Drosophila peripheral nervous system. Cell 73,1307 -1321.[CrossRef][Medline]
Johnson, J. E., Birren, S. J., Saito, T. and Anderson, D. J. (1992). DNA binding and transcriptional regulatory activity of mammalian achaete-scute homologous (MASH) proteins revealed by interaction with a muscle-specific enhancer. Proc. Natl. Acad. Sci. USA 89,3596 -3600.[Abstract/Free Full Text]
Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., le Bot, N., Moreno, S., Sohrmann, M. et al. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421,231 -237.[CrossRef][Medline]
Kimble, J. and Hirsh, D. (1979). The postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans. Dev. Biol. 70,396 -417.[CrossRef][Medline]
Krause, M., Park, M., Zhang, J. M., Yuan, J., Harfe, B., Xu, S. Q., Greenwald, I., Cole, M., Paterson, B. and Fire, A. (1997). A C. elegans E/Daughterless bHLH protein marks neuronal but not striated muscle development. Development 124,2179 -2189.[Abstract]
Ledent, V., Paquet, O. and Vervoort, M. (2002). Phylogenetic analysis of the human basic helix-loop-helix proteins. Genome Biol. 3, RESEARCH0030.
Li, C., Nelson, L. S., Kim, K., Nathoo, A. and Hart, A. C. (1999). Neuropeptide gene families in the nematode Caenorhabditis elegans. Ann. New York Acad. Sci. 897,239 -252.[CrossRef][Medline]
Massari, M. E. and Murre, C. (2000). Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol. Cell. Biol. 20,429 -440.[Free Full Text]
Mello, C. C., Kramer, J. M., Stinchcomb, D. and Ambros, V. (1991). Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10,3959 -3970.[Medline]
Mounsey, A., Bauer, P. and Hope, I. A. (2002). Evidence suggesting that a fifth of annotated Caenorhabditis elegans genes may be pseudogenes. Genome Res. 12,770 -775.[Abstract/Free Full Text]
Nonet, M. L., Staunton, J., Kilgard, M. P., Fergestad, T., Hartweig, E. A., Jorgensen, E. M. and Meyer, B. J. (1997). C. elegans rab-3 mutant synapses exhibit impaired function and are partially depleted of vesicles. J. Neurosci. 17,8061 -8073.[Abstract/Free Full Text]
Portman, D. S. and Emmons, S. W. (2000). The basic helix-loop-helix transcription factors LIN-32 and HLH-2 function together in multiple steps of a C. elegans neuronal sublineage. Development 127,5415 -5426.[Abstract]
Rodriguez, I., Hernandez, R., Modolell, J. and Ruiz-Gomez, M. (1990). Competence to develop sensory organs is temporally and spatially regulated in Drosophila epidermal primordia. EMBO J. 9,3583 -3592.[Medline]
Sulston, J. E. and Horvitz, H. R. (1977). Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev. Biol. 56,110 -156.[CrossRef][Medline]
Sulston, J. E., Schierenberg, E., White, J. G. and Thomson, J. N. (1983). The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev. Biol. 100,64 -119.[CrossRef][Medline]
Thellmann, M., Hatzold, J. and Conradt, B. (2003). The Snail-like CES-1 protein of C. elegans can block the expression of the BH3-only cell-death activator gene egl-1 by antagonizing the function of bHLH proteins. Development 130,4057 -4071.[Abstract/Free Full Text]
Troemel, E. R., Chou, J. H., Dwyer, N. D., Colbert, H. A. and Bargmann, C. I. (1995). Divergent seven transmembrane receptors are candidate chemosensory receptors in C. elegans. Cell 83,207 -218.[CrossRef][Medline]
Verma-Kurvari, S., Savage, T., Gowan, K. and Johnson, J. E. (1996). Lineage-specific regulation of the neural differentiation gene MASH1. Dev. Biol. 180,605 -617.[CrossRef][Medline]
Villares, R. and Cabrera, C. V. (1987). The achaete-scute gene complex of D. melanogaster: conserved domains in a subset of genes required for neurogenesis and their homology to myc. Cell 50,415 -424.[CrossRef][Medline]
Way, J. C. and Chalfie, M. (1988). mec-3, a homeobox-containing gene that specifies differentiation of the touch receptor neurons in C. elegans. Cell 54,5 -16.[CrossRef][Medline]
Yuan, J., Shaham, S., Ledoux, S., Ellis, H. M. and Horvitz, H. R. (1993). The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin-1 beta-converting enzyme. Cell 75,641 -652.[CrossRef][Medline]
Zhao, C. and Emmons, S. W. (1995). A transcription factor controlling development of peripheral sense organs in C. elegans. Nature 373, 74-78.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
GeneticsHome page
A. Singhvi, C. A. Frank, and G. Garriga
The T-Box Gene tbx-2, the Homeobox Gene egl-5 and the Asymmetric Cell Division Gene ham-1 Specify Neural Fate in the HSN/PHB Lineage
Genetics, June 1, 2008; 179(2): 887 - 898.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S. Cordes, C. A. Frank, and G. Garriga
The C. elegans MELK ortholog PIG-1 regulates cell size asymmetry and daughter cell fate in asymmetric neuroblast divisions
Development, July 15, 2006; 133(14): 2747 - 2756.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.00894v1
130/26/6507    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frank, C. A.
Right arrow Articles by Garriga, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frank, C. A.
Right arrow Articles by Garriga, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?