|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online December 1, 2003
doi: 10.1242/10.1242/dev.00886
Howard Hughes Medical Institute, Department of Molecular and Cell Biology, 16 Barker Hall, University of California, Berkeley, CA 94720-3204, USA
* Author for correspondence (e-mail: bjmeyer{at}uclink.berkeley.edu)
Accepted 26 September 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Dosage compensation, Sex determination, Gene regulation, C. elegans, DPY-21, SDC-2, SDC-3, her-1
| Introduction |
|---|
|
|
|---|
Typically, protein complexes that regulate gene expression across entire
chromosomes or subchromosomal domains do not function as specific regulators
of individual genes. However, the C. elegans dosage compensation
complex is unusual in this regard. Not only does the complex repress
expression of X chromosomes by twofold, it represses transcription of the
autosomal sex determination gene her-1 by 20-fold
(Chu et al., 2002
;
Dawes et al., 1999
). This
contrast led us to investigate how a protein complex achieves uniformly weak
repression of numerous genes in one context and strong repression of a
specific gene in another. The work presented here on the dosage compensation
gene dpy-21 reveals distinctions in the composition and recruitment
of the complexes that achieve these two levels of repression.
Prior research showed that sex determination and dosage compensation in
C. elegans are coordinately controlled in response to the
X-chromosome counting mechanism (DeLong et
al., 1993
; Klein and Meyer,
1993
; Miller et al.,
1988
; Nusbaum and Meyer,
1989
; Rhind et al.,
1995
; Villeneuve and Meyer,
1987
). In XX embryos, SDC-2 is the pivotal factor that initiates
dosage compensation (Dawes et al.,
1999
). It is the only dosage compensation protein known to be
expressed exclusively in hermaphrodites, and it can localize to X chromosomes
independently of other dosage compensation proteins. SDC-2 acts together with
SDC-1 and SDC-3 to trigger assembly of the condensin-like dosage compensation
proteins (DPY-26, DPY-27 and MIX-1) onto hermaphrodite X chromosomes to reduce
gene expression by half. In fact, ectopic expression of SDC-2 in males is
sufficient to trigger assembly of this complex onto the single X chromosome,
causing death from inappropriately low X-linked gene expression. The SDC
complex also induces hermaphrodite sexual development in XX embryos by
associating with the promoter of the male sex-determining gene her-1
to repress its transcription (Chu et al.,
2002
; Dawes et al.,
1999
). Again, SDC proteins recruit DPY-26, DPY-27 and MIX-1, this
time to her-1 regulatory regions
(Chu et al., 2002
). This
localization, together with the observation that dpy mutations affect
sexual fate in specific genetic backgrounds, suggests that DPY proteins may
act directly with SDC proteins to repress her-1.
dpy-21 is also required for dosage compensation; however,
dpy-21 differs significantly from other dosage compensation genes.
Like mutations in other dosage compensation genes, dpy-21 mutations
cause elevated X-linked gene expression and morphological phenotypes dependent
upon X-chromosome dose: XO animals appear wild type, while XX animals are
dumpy and egg-laying defective (L. DeLong, PhD thesis, Massachusetts Institute
of Technology, 1990) (DeLong et al.,
1987
; Hodgkin,
1983
; Meneely and Wood,
1984
; Meneely and Wood,
1987
; Meyer and Casson,
1986
; Plenefisch et al.,
1989
). But unlike other dosage compensation mutations, which
disrupt the stability or X-localization of the dosage compensation complex,
causing extensive XX-specific lethality, dpy-21 mutations, shown here
to be null, cause no embryonic lethality and only infrequent larval lethality
(Chuang et al., 1996
;
Lieb et al., 1998
;
Lieb et al., 1996
;
Plenefisch et al., 1989
).
Consistent with the weak dosage compensation phenotype, dpy-21 null
mutations cause no obvious defect in the assembly or localization of the
dosage compensation complex (Chuang et al.,
1996
; Davis and Meyer,
1997
; Lieb et al.,
1998
; Lieb et al.,
1996
). We place DPY-21 in the molecular pathway of dosage
compensation.
We show that DPY-21 is a member of the dosage compensation complex and localizes to X chromosomes in a sex-specific manner. DPY-21 is the first member of the dosage compensation complex that does not also localize to her-1. Moreover, we show that recognition of her-1 target DNA is initiated by a different SDC protein from that responsible for initial recognition of X-chromosome targets. These findings represent the first molecular differences in the repression complexes that achieve gene-specific versus chromosome-wide regulation.
| Materials and methods |
|---|
|
|
|---|
RNA isolation for RNAi experiments
Plasmids were excised from cDNA-containing phagemids (provided Y. Kohara),
linearized with either KpnI or NotI, and used as template
for either Ribomax (Promega) T3 or T7 transcription reactions. Single-stranded
RNAs (ssRNAs) were injected at a concentration of 1 mg/ml.
Genetic assays to clone dpy-21
ssRNA was tested for its ability to mimic a dpy-21 mutation in two
genetic assays. In the first assay, single-stranded RNA (ssRNA) corresponding
to each EST family was tested for its ability to rescue the XO-specific
lethality caused by a xol-1 mutation. xol-1 mutations
inappropriately activate the hermaphrodite program of dosage compensation in
XO males, causing male lethality from reduced X-linked gene expression
(Miller et al., 1988
).
Mutations in dpy-21 suppress the XO lethality by disrupting dosage
compensation. ssRNAs were injected into a him-5(e1485); xol-1(y9)
strain and the progeny were examined for males. The him-5 mutation
causes X-chromosome non-disjunction and was included in the xol-1
strain to generate XO animals. Partial rescue of male lethality was observed
with ssRNA corresponding to cDNA clones yk132a2 and yk278g2.
In the second assay, the strongest xol-1 suppressor (ssRNA to
yk132a2) was tested for its ability to suppress the masculinization caused by
sdc-3(Tra). Only 1% of sdc-3(y52Tra) XX homozygous
animals from sdc-3(y52Tra)/+ mothers are hermaphrodites at 20°C,
but 65% of sdc-3(y52Tra) dpy-21(e428) XX animals from
sdc-3(y52Tra) dpy-21(e428)/++ mothers are hermaphrodites
(DeLong et al., 1993
). To test
yk132a2, ssRNA was injected into sdc-3(y52Tra)
unc-76(e911)/sdc-3(y128Dpy) animals and the percentage of Unc
Tra male and Unc hermaphrodite progeny was determined. Thirty-five percent of
the Unc progeny (n=220) were hermaphrodites, indicating suppression
similar to a dpy-21 mutation. Together, these assays indicate that
yk132a2 is likely to represent dpy-21.
DNA sequence analysis of yk132a2 and yk278g2 showed that both cDNAs represented the same gene (ORF Y59A8b.1), a conclusion previously obscured by the fact that the cDNAs were incomplete and differed in their 5' and 3' ends. The true 5' end of Y59A8b.1 was obtained using PCR with a primer to the C. elegans trans-splice leader SL1 and an internal primer.
RT-PCR of dpy-21
Total C. elegans RNA was isolated as described
(DeLong et al., 1993
). mRNA was
purified using Oligotex (Qiagen). dpy-21 cDNA was made by reverse
transcription using primers DPY-21.51 (5' GCAAATAGGGGTACTCCATTG
3') and SuperScriptII (Invitrogen). To amplify dpy-21,
first-round nested PCR used primers DPY-21.52 (5' GATCTCATCGGGTAAAGGATTC
3') and NOTSL1, which includes the SL1 splice leader and a NotI
restriction site. Second-round nested PCR used primers DPY-21.53 (5'
GTGTATGAAGCGAAGAACTTCG 3') and NOTSL1.
Sequence analysis of dpy-21 mutants
Molecular lesions in the dpy-21 mutants were identified by
sequence analysis of genomic DNA (e428 and y59) or RT-PCR
products (e459, y43, y47, y188ts and y150ts). Sequence
analysis was performed on three different DNA preparations for each mutation.
The DNA changes were as follows: y428, CAG to TAG at codon 394;
y59, CAG to TAG at codon 417; e459, GGA to GAA at codon
1291; y150ts, CTC to TTC at codon 1383; y88ts, AAG to GAG at
codon 1396; y47, CAG to TAG at codon 1423. dpy-21(y43) has
both a silent change at bp 4290 and a 134 bp deletion that removes the
intron/exon 8 boundary. A splice site 87 base pairs upstream of the normal
splice site is used, resulting in an in-frame deletion of 29 amino acids, as
shown by sequence analysis of RT-PCR products.
Stage-specific northern
RNA was made from wild-type embryos, L1, L2, L3 and L4 larvae, and
non-gravid adults according to a protocol by G. Csankovszki. Trizol (10 ml,
Invitrogen) was added to 2-3 ml of packed animals and the mixture homogenized
using a polytron. The aqueous sample was subjected to three sequential
extractions using 2 ml chloroform, then an equal volume of phenol and 0.2
volumes of chloroform, and, finally, an equal volume of chloroform. For each
extraction, the phases were separated by centrifugation at 9000
g for 15 minutes at 4°C. The aqueous layer was mixed with
0.5 volumes of 2-propanol and incubated at room temperature for 10 minutes.
The RNA was pelleted at 9000 g for 15 minutes at 4°C and
washed with 70% ethanol. mRNA was purified from total RNA using Oligotex
(Qiagen). Poly-A RNA (5 µg) was separated by gel electrophoresis, and
northern analysis was performed (Wutz and
Jaenisch, 2000
) using random-primed probes transcribed from
nucleotides 1-3347 of dpy-21.
Antibodies
Rabbit anti-DPY-21 antibodies were raised against a fusion protein composed
of a GST tag and DPY-21 amino acids 1-173 that had been expressed from vector
pGEX-5X-2 (Amersham) and purified using Glutathione Sepharose 4B (Amersham).
Affinity purification of the anti-DPY-21 antibodies was performed as described
(Davis and Meyer, 1997
), using
a 6x-His-tagged fusion protein that was made to the same DPY-21 region,
expressed from vector pRSETA (Invitrogen), purified with Ni-NTA spin (Qiagen)
and coupled to 6xReacti-Gel (Pierce).
Rabbit anti-DPY-21 antibodies were also raised against a fusion protein
composed of DPY-21 amino acids 467-1102, a GST tag at the N terminus and a
6x-His tag at the C terminus. The plasmid used to express the antigen
was constructed by subcloning a RT-PCR product corresponding to nucleotides
1533-3460 of the dpy-21 transcript into pGEX-5X-2 vector that had
been modified by adding 6 histidines prior to the stop codon. Affinity
purification of these anti-DPY-21 antibodies was performed
(Davis and Meyer, 1997
) using
the 6x-His-tagged fusion protein coupled to 6xReacti-Gel (Pierce)
with one modification. The serum was first passed through a GST-only column
(gift of R. Chan) to remove antibodies against GST, and the flow-through was
collected for antigen-specific purification.
SDC-3 was detected in embryos and in her-1 array experiments using affinity-purified rat polyclonal antibodies raised against amino acids 1067-1340 (from C. Tsai).
Extract preparation
Extracts were prepared by boiling wild-type and mutant embryos in four
volumes of SDS-PAGE loading buffer (100 mM Tris, pH 6.8, 2% SDS, 0.1%
bromophenol blue, 7.5 M Urea, and 0.1 M DTT) for 10 minutes. Insoluble debris
was removed by centrifugation at 9300 g for 1 minute. SDS-PAGE
(Novex) and immunoblotting (Bio-Rad) using chemiluminescent detection (ECL,
Amersham) were performed with the extract.
Immunoprecipitation experiments
Lysates were prepared by sonicating embryos in chromatin buffer (200 mM
sucrose, 5 mM Tris, pH 7.5, 80 mM NaCl, 1 mM CaCl2) supplemented
with a protease inhibitor cocktail (Calbiochem). Lysates were titrated to 5 mM
EDTA and allowed to rock at 4°C for 20 minutes. Cellular debris was
cleared by centrifugation at 4500 g for 5 minutes at 4°C.
The supernatant was incubated with 5 µg primary antibody for 4 hours at
4°C and then incubated with Protein A Sepharose beads for 1 hour.
Immunocomplexes bound to the Protein A Sepharose beads were washed with CHIP
buffer (50 mM HEPES, pH 7.6, 140 mM KCl, 1 mM EDTA, and 0.5% NP-40). Proteins
were eluted by boiling the beads in an SDS dye (50 mM Tris, pH 6.8, 2% SDS,
0.1% bromophenol blue, 10% glycerol and 0.1 M DTT). Immunoprecipitates were
analyzed by SDS-PAGE and immunoblotting.
Immunostaining of embryos and gut cells
Embryos were collected, fixed, and stained as described
(Chuang et al., 1994
;
Davis and Meyer, 1997
), except
that embryos were fixed at room temperature for 15 minutes, and all washes
were in PBST (0.14 M NaCl, 2.7 mM KCl, 10 mM Na2HPO4,
1.8 mM KH2PO4, 0.5% Triton X-100 and 1 mM EDTA, pH 8.0).
Gut cells were stained as described (Howe
et al., 2001
). For confocal microscopy, animals were mounted in
Vectashield (Vector Laboratories) containing 1 µg/ml of DAPI. Laser
confocal microscopy was performed on a Leica TCS-NT confocal microscope. Over
100 embryos were analyzed in most immunostaining experiments.
X-chromosome fluorescence in situ hybridization (FISH) and
anti-DPY-21 staining in embryos
The X-chromosome FISH protocol was developed in collaboration with G.
Csankovszki and T. Wu based on the FISH protocol previously described
(Dernburg and Sedat, 1998
).
Gravid hermaphrodites were removed from plates and washed with M9 (8.5 mM
NaCl, 41 mM Na2HPO4, 8.5 mM KH2PO4
and 18 mM NH4Cl) and treated with hypochlorite to obtain embryos.
After several washes with M9, an equal volume of embryos was added to sperm
salts (50 mM PIPES, pH 7.0, 25 mM KCl, 1 mM MgSO4, 45 mM NaCl and 2
mM CaCl2) containing 3% paraformaldehyde (Electron Microscopy
Sciences) on a poly-lysine coated slide and incubated in a humid chamber for 5
minutes. The slide was freeze cracked on dry ice, placed in 95% ethanol for 1
minute and washed with PBST. Subsequently, the slide was dehydrated for 2
minutes each in 70% ethanol, 80% ethanol, 95% ethanol and 100% ethanol, then
allowed to air dry. X-chromosome fluorescent probe (10 µl) made by random
primed labeling (Promega) of X-specific YAC DNA (gift of G. Csankovszki) was
added. The slide was denatured at 95°C for 3 minutes, then incubated
overnight in a humid chamber at 37°C. The slide was washed three times for
5 minutes each at 39°C with 2xSSC (0.3 M NaCl and 30 mM
Na3C6H5O7) in 50% formamide, three
times for 5 minutes each at 39°C with 2xSSC, and once for 10 minutes
at 39°C with 1xSSC. The slide was rinsed in PBST and antibody
staining was performed as described for immunostaining of adult germline and
gut cells.
Localization of DPY-21 was analyzed in dosage compensation mutants. Dosage compensation mutations that cause XX-specific lethality were maintained in XO strains for which the hermaphrodite mode of sex determination and dosage compensation had been switched on by a xol-1 mutation. XO-specific lethality caused by the xol-1 mutation was suppressed by the dosage compensation mutation being assayed. For sdc-2 and sdc-3 mutant strains, a her-1 mutation was included to allow the XO animals to develop as hermaphrodites. The genotypes of strains were:
sdc-1(n485);
dpy-26(n199) unc-30(e191) IV; lon-2(e678) xol-1(y9) V;
unc-32(e189) dpy-27(y167) III; flu-2(e1003) xol-1(y9) V;
dpy-28(s939) III; him-5(e1490); xol-1(y9) V;
her-1(hv1y101) V; xol-1(y9) sdc-2(y74) unc-9(e101) X; and
her-1(e1520) sdc-3(y126) V; xol-1(y9) X.
The dosage compensation mutations used in the staining experiments were molecular or genetic nulls.
her-1 array experiments
Except for her-1 array strains carrying either an sdc-2
or sdc-3 mutation, previously established her-1 array and
control lines were used to examine DPY-21 localization
(Chu et al., 2002
;
Dawes et al., 1999
). All
her-1 arrays contained the her-1 region indicated and
plasmids encoding LacI::GFP and Lac O repeats. Animals were
heat-shocked at 34°C for 30 minutes and allowed to recover at room
temperature for 30 minutes to induce production of the LacI::GFP fusion
protein, which is controlled by a heat-shock promoter.
| Results |
|---|
|
|
|---|
The detection of molecular changes in ORF Y59A8b.1 from several dpy-21 mutant alleles proved that dpy-21 had been correctly identified (Fig. 1A). dpy-21(e428) is a nonsense mutation predicted to truncate DPY-21 at amino acid 394. This mutation causes the most severe dpy-21 mutant phenotype: 17% larval lethality and all adult survivors are dumpy (Dpy) and egg-laying defective (Egl). dpy-21(y59am) and dpy-21(y47am) are also nonsense mutations, predicted to terminate translation at codons 417 and 1396, respectively, and both can be suppressed by the amber mutant tRNA suppressor sup-7. y47 and e428 cause very similar phenotypes. dpy-21(e459) and the temperature-sensitive mutations dpy-21(y88ts) and dpy-21(y150ts) all have missense mutations (Fig. 1A). y88 causes the weakest phenotype: no lethality and all adults are Dpy and Egl. Finally, dpy-21(y43) has a 134 bp deletion that results in an in-frame deletion of 29 amino acids.
|
The dpy-21 gene includes 11 introns and is predicted to encode a 5629 bp transcript. DPY-21 appears to be a novel, conserved protein of 1641 amino acids with a proline-rich N terminus. No other motifs could be identified based on sequence. However, homologs of DPY-21 share a unique, evolutionarily conserved C-terminal domain (amino acids 1230-1620) (Fig. 2). The biochemical functions of the proteins in this family are unknown.
|
5700 bp, consistent with the predicted transcript size of
5629 bp. The dpy-21 transcript levels appeared highest during
embryogenesis after normalization to the myo-1 (pharyngeal myosin)
control transcript. This expression pattern resembles that of other dosage
compensation genes.
DPY-21 interacts biochemically with components of the dosage
compensation complex
All previously identified dosage compensation proteins form a complex that
localizes to hermaphrodite X chromosomes and represses their gene expression
(Chu et al., 2002
;
Chuang et al., 1996
;
Davis and Meyer, 1997
;
Dawes et al., 1999
;
Lieb et al., 1998
;
Lieb et al., 1996
). To
determine whether DPY-21 is a member of the dosage compensation complex,
antibodies were raised to two different regions of DPY-21, the first 173 amino
acids and an internal peptide (amino acids 467-1102) (Materials and methods).
Two findings indicate that these antibodies are specific to DPY-21. First,
both antibodies recognized a 210 kDa protein in extracts from wild-type gravid
adults that was not detectable in extracts from either dpy-21(e428)
or dpy-21(y59) mutant gravid adults
(Fig. 3A and data not shown).
The apparent molecular weight of this protein is slightly larger than the
predicted size of 185 kDa. A control assessing levels of SMC-1, a chromosome
cohesion protein, demonstrated that the dpy-21(e428) mutant and
wild-type extracts had comparable levels of proteins
(Fig. 3A). Second, the
N-terminal antibody detected a protein of 60 kDa in the dpy-21(e428)
mutant extract, consistent with the size of a truncated DPY-21 product
predicted from the location of the nonsense mutation at codon 394
(Fig. 3A). The truncated
protein was detected variably.
|
Although DPY-21 interacts with other dosage compensation proteins, two differences were noticed in the behavior of DPY-21 compared with the other proteins. First, the immunoprecipitation reactions were not reciprocal in that DPY-27 antibodies immunoprecipitated DPY-21, but DPY-21 antibodies did not precipitate DPY-27. Second, antibodies to the dosage compensation protein DPY-26 precipitated DPY-21 only weakly, even though it precipitates DPY-27 and MIX-1 robustly. Although we do not know the reasons for these differences, we speculate that the antibodies might disrupt interactions between DPY-21 and other dosage compensation proteins or that the association between DPY-21 and the other proteins might not be as strong as that of other components. These observations suggest that the function of DPY-21 within the complex may be different from that of the other proteins.
DPY-21 localizes specifically to both X chromosomes of
hermaphrodites
If DPY-21 functions as a member of the dosage compensation complex in vivo,
as predicted by the biochemical experiments, DPY-21 should localize to X
chromosomes of XX embryos at or beyond the 40-cell stage, when SDC-2 recruits
dosage compensation proteins to X. Immunofluorescence experiments using DPY-21
antibodies showed DPY-21 to be diffusely localized in nuclei of XX embryos
(<40 cells) that had not yet activated dosage compensation
(Fig. 4A). In embryos with
greater than 40 cells, DPY-21 formed punctate, subnuclear foci that coincided
with the X-localized SDC-3 foci (Fig.
4B). We showed directly that the DPY-21 foci co-localized with X
chromosomes by probing simultaneously with DPY-21 antibodies and
X-chromosome-specific DNA probes that were visualized by fluorescence in situ
hybridization (FISH) (Fig. 5A).
DPY-21 maintains its localization to X chromosomes throughout C.
elegans development, like other dosage compensation proteins, as
indicated by its presence on X chromosomes of adult gut nuclei
(Fig. 4D). The in vivo
specificity of both DPY-21 antibodies was confirmed by the absence of staining
in the two dpy-21 mutant strains homozygous for early nonsense
mutations, dpy-21(e428) (Fig.
4C and data not shown) or dpy-21(y59) (data not shown).
These results establish that DPY-21 is recruited to the X chromosomes of
hermaphrodites with other members of the dosage compensation complex at the
onset of dosage compensation.
|
|
Activity of the dosage compensation proteins is switched off in males by
the male-specific gene xol-1, which represses the
hermaphrodite-specific sdc genes and thereby prevents recruitment of
the dosage compensation complex to the male X chromosome
(Davis and Meyer, 1997
;
Dawes et al., 1999
;
DeLong et al., 1993
;
Miller et al., 1988
;
Rhind et al., 1995
). If DPY-21
is controlled by the genetic hierarchy that regulates other dosage
compensation proteins, we would expect DPY-21 to be localized ectopically to
the X chromosome of xol-1 mutant XO animals. This expectation was met
in the experiment of Fig.
4F.
Recruitment of DPY-21 to hermaphrodite X chromosomes requires all
other members of the dosage compensation complex
In hermaphrodites, SDC-2, SDC-3 and DPY-30 are essential for the
recruitment of all dosage compensation proteins to X chromosomes
(Chuang et al., 1996
;
Lieb et al., 1998
;
Lieb et al., 1996
). SDC-2
confers both hermaphrodite specificity and X-chromosome recognition to the
dosage compensation process (Dawes et al.,
1999
). To explore the mechanism by which DPY-21 is recruited to X
chromosomes, we determined whether mutation of individual dosage compensation
genes blocks the recruitment of DPY-21 to X. In sdc-2 and
sdc-3 mutants, DPY-21 was present but distributed throughout the
nucleus in multiple foci of intense staining, as it is in males
(Fig. 5A-C). These DPY-21 foci
did not coincide with X chromosomes, as demonstrated by the combination of
DPY-21 antibody staining and X-chromosome FISH
(Fig. 5A-C). Therefore, SDC-2
and SDC-3 are required for the recruitment of DPY-21 to X.
In hermaphrodites, DPY-26, DPY-27, DPY-28 and MIX-1 have a complex
dependence on each other for their stability and X localization. For example,
without DPY-27, both DPY-26 and MIX-1 are stable but cannot localize to X
(Lieb et al., 1998
;
Lieb et al., 1996
). Without
DPY-28, the DPY-26, DPY-27 and MIX-1 proteins are unstable
(Chuang et al., 1996
;
Lieb et al., 1998
;
Lieb et al., 1996
). Unlike
these DPY proteins, DPY-21 does not require DPY-26, DPY-27 or DPY-28 for its
accumulation and stability. However, DPY-21 does require DPY-26, DPY-27 and
DPY-28 for its localization to X chromosomes
(Fig. 5D-F). The dependence of
DPY-21 on SDC and DPY proteins for its recruitment to X further indicates that
DPY-21 downregulates X-linked gene expression in XX animals through the dosage
compensation complex.
DPY-21 is not required for the stability or X localization of the other
dosage compensation proteins, even though it is a member of the complex
(Chuang et al., 1996
;
Davis and Meyer, 1997
;
Dawes et al., 1999
;
Lieb et al., 1998
;
Lieb et al., 1996
). Our
biochemial analysis further demonstrated this point. The level of MIX-1, a
dual-functional protein with roles in both dosage compensation and chromosome
condensation, is equivalent in wild-type and dpy-21(428) mutant
extracts (Fig. 3A). Regarding
the stability and localization of the complex, DPY-21 behaves like the dosage
compensation complex member SDC-1 and unlike the other DPY proteins
(Chuang et al., 1994
;
Davis and Meyer, 1997
;
Dawes et al., 1999
;
Lieb et al., 1998
;
Lieb et al., 1996
).
Nonetheless, the localization of DPY-21 and SDC-1 occurs independently. DPY-21
localizes to X chromosomes in sdc-1 mutants
(Fig. 5G), and SDC-1 localizes
to X in dpy-21 mutants (not shown).
DPY-21 participates directly in chromosome-wide repression but not in
gene-specific repression
In addition to activating dosage compensation, SDC proteins induce
hermaphrodite sexual differentiation by repressing transcription of the
male-specific, autosomal gene her-1
(Chu et al., 2002
;
Dawes et al., 1999
;
DeLong et al., 1993
;
Trent et al., 1991
). SDC
proteins repress her-1 transcription 20-fold by binding to three
separate regulatory regions within the gene
(Chu et al., 2002
). The first
binding site overlaps the start point of her-1 transcription. The
second and third sites lie within the second intron of her-1; each
contains a 15 bp sequence that is necessary for SDC localization. The SDC
proteins recruit the DPY components of the X-chromosome dosage compensation
complex to her-1, implying the direct participation of these DPY
proteins in gene-specific repression (Chu
et al., 2002
). Given that DPY-21 is a member of the repression
complex on X, we asked whether DPY-21 is a member of the repression complex on
her-1.
Recruitment of proteins to her-1 can be assayed in hermaphrodites
carrying an extrachromosomal DNA array containing multiple tandem repeats of
the her-1 regulatory regions, lac operator repeats
(Straight et al., 1996
), and a
transgene encoding LacI::GFP (Chu et al.,
2002
; Dawes et al.,
1999
). LacI::GFP binds to the lac operator sequence,
allowing the array to be visualized by GFP fluorescence. If a protein is
recruited to her-1, an antibody raised against the protein will
co-localize with GFP fluorescence.
Surprisingly, DPY-21 was not recruited to her-1. In both embryos (Fig. 6A) and adult gut nuclei (Fig. 6B) co-stained with SDC-3 and DPY-21 antibodies, SDC-3 co-localized with her-1 arrays and X chromosomes, but DPY-21 only co-localized with X chromosomes. DPY-21 provides the first indication that the repression complex on X differs from the repression complex on her-1.
|
While examining the localization of SDC-3 in young embryos (<30 cells) we noticed that SDC-3 could associate with her-1 regulatory regions at a time well before it localized to X chromosomes (Fig. 7A,B), suggesting another difference between the X and her-1 repression complexes. To verify this result, we assayed SDC-3 localization in four strains (Table 1A). Two strains contained independent arrays with all three SDC binding sites in her-1, and a third strain contained arrays with only SDC binding sites 2 and 3 (Fig. 7G). The fourth strain contained control arrays with only the vector sequences present in the other arrays. In embryos with fewer than 20 cells, SDC-3 localized infrequently to X chromosomes or to arrays with vector sequence only, but localized robustly to the arrays carrying her-1 regulatory regions (Table 1A). Thus, SDC-3 localizes to her-1 earlier than it localizes to X.
|
|
The dependence of SDC-3 on other dosage compensation proteins for its
recruitment to her-1 was also examined. SDC-3 is expressed in low
levels in dpy-27(null) mutants and does not localize to X chromosomes
(Davis and Meyer, 1997
). By
contrast, we found that SDC-3, like SDC-2
(Chu et al., 2002
), localizes
to her-1 arrays in dpy-27(null) mutant embryos
(Fig. 7E,
Table 1B), providing another
example that SDC-3 has different requirements for its recruitment to
her-1 versus X. Together these results demonstrate that SDC-2 and
SDC-3 assemble onto their regulatory targets in a different order and have
different requirements for their localization. Moreover, different SDC
proteins are pivotal for the recognition of her-1 versus X-chromosome
targets.
| Discussion |
|---|
|
|
|---|
The partial disruption of dosage compensation caused by dpy-21 null mutations can now be understood in the context of DPY-21 behavior. Although DPY-21 is a member of the dosage compensation complex, its association with the complex is not as stable as that of other members. Antibodies to dosage compensation proteins do not immunoprecipitate DPY-21 as readily as other components. Moreover, the stability of DPY-21 does not depend on the presence of other dosage compensation proteins, further suggesting that DPY-21 is not as integral to the complex as other members. Finally, recruitment of DPY-21 to X requires all other dosage compensation proteins except SDC-1. By contrast, the stability and/or X localization of these other dosage compensation proteins requires only a subset of dosage compensation proteins, implying an earlier and/or stronger association with the complex than DPY-21.
How might DPY-21 regulate X-chromosome gene expression? The DPY-21 protein sequence provided no clue as to its function. DPY-21, unlike the dosage compensation proteins DPY-26, DPY-27 and MIX-1, has no similarity to subunits of condensin, a complex that controls mitotic and meiotic chromosome structure. Rather than functioning in X-chromosome gene regulation through modification of X-chromosome structure, as proposed for the other proteins, DPY-21 might modify the activity of the dosage compensation complex, for example through a covalent modification or an allosteric effect. A more intriguing possibility is that DPY-21 might act directly on X chromatin to stabilize a repressed chromatin state initiated by the core dosage compensation complex, perhaps through histone modification or a direct association with chromatin.
Targeting of SDC proteins to her-1 versus X-chromosome
regulatory regions
The dosage compensation complex associates with X chromosomes of
hermaphrodites to repress transcription twofold, while it associates with the
regulatory sites of the male sex-determination gene her-1 to repress
transcription 20-fold (Chu et al.,
2002
; Dawes et al.,
1999
). Our experiments revealed the first molecular differences in
the repression at her-1 versus X: in the composition and recruitment
of repression complexes and in the proteins that recognize these DNA
targets.
Although DPY-21 localizes to X chromosomes as a component of the dosage compensation complex, it does not localize to her-1, unlike the other dosage compensation proteins. It is not yet known how this difference in DPY-21 localization contributes to the mechanisms of gene-specific versus chromosome-wide repression. DPY-21 does not, for example, counteract the activity of other dosage compensation proteins to limit the degree of X repression to only twofold. If it did, dpy-21 mutations would cause enhanced X repression rather than the diminished repression observed. Perhaps DPY-21 is absent from her-1 because its replacement in the repression complex with a different protein would increase the repressive capacity of the complex. Alternatively, DPY-21 may have a mechanism of action on X that would be detrimental to the development or viability of the organism if DPY-21 were allowed to bind to her-1. For example, if DPY-21 helps transmit the repressed chromatin state along X, then binding of DPY-21 to her-1 might adversely influence the activity of genes neighboring her-1.
We have shown that SDC-2 and SDC-3 have different protein requirements for
recruitment to their targets at her-1 versus X. Moreover, the SDC
protein sufficient for her-1 target recognition is different from the
one sufficient for X target recognition. SDC-2 can localize to X independently
of SDC-3, but requires SDC-3 for its localization to her-1. SDC-2
triggers assembly of dosage compensation proteins onto X chromosomes and
appears pivotal for X-chromosome recognition
(Dawes et al., 1999
). By
contrast, SDC-3 can localize to her-1 independently of SDC-2 but
requires SDC-2 for its localization to X. Similarly, SDC-3 does not require
DPY-27 for its association with her-1 but it does require DPY-27 for
its association with X. SDC-3 is essential for the localization of all dosage
compensation proteins to her-1, and SDC-3 appears pivotal for
her-1 target recognition.
These results concur with and extend previous genetic analysis indicating
that SDC-3 functions differently at her-1 versus X. More
specifically, the sex determination and dosage compensation activities of
SDC-3, unlike SDC-2, are separately mutable: SDC-3 requires its zinc fingers
to localize to X but its ATP binding motif to localize to her-1
(Chu et al., 2002
;
Dawes et al., 1999
;
DeLong et al., 1993
;
Klein and Meyer, 1993
). The
initial mapping of recognition elements within her-1 identified three
SDC binding sites, each of which differed in sequence, but two of which shared
an identical 15 bp sequence essential for SDC binding
(Chu et al., 2002
). Because
that 15 base pair sequence is not present on X chromosomes, it cannot be
central for the recruitment of dosage compensation components to X
chromosomes. This observation can now be interpreted in light of our finding
that different SDC proteins play lead roles in recognizing her-1
versus X regulatory targets. The 15 bp sequence might be part of a recognition
sequence used by SDC-3 but not by SDC-2. In conclusion, our analysis has
revealed important molecular differences in the composition and targeting of
protein complexes that achieve both gene-specific and chromosome-wide
regulation, opening the way to a deeper understanding of the mechanisms
underlying these two major forms of gene regulation.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Chu, D. S., Dawes, H. E., Lieb, J. D., Chan, R. C., Kuo, A. F.
and Meyer, B. J. (2002). A molecular link between
gene-specific and chromosome-wide transcriptional repression. Genes
Dev. 16,796
-805.
Chuang, P.-T., Albertson, D. G. and Meyer, B. J.
(1994). DPY-27: a chromosome condensation protein homolog that
regulates C. elegans dosage compensation through association with the
X chromosome. Cell 79,459
-474.[CrossRef][Medline]
Chuang, P.-T., Lieb, J. D. and Meyer, B. J.
(1996). Sex-specific assembly of a dosage compensation complex on
the nematode X chromosome. Science
274,1736
-1739.
Davis, T. L. and Meyer, B. J. (1997). SDC-3
coordinates the assembly of a dosage compensation complex on the nematode X
chromosome. Development
124,1019
-1031.[Abstract]
Dawes, H. E., Berlin, D. S., Lapidus, D. M., Nusbaum, C., Davis,
T. L. and Meyer, B. J. (1999). Dosage compensation proteins
targeted to X chromosomes by a determinant of hermaphrodite fate.
Science 284,1800
-1804.
DeLong, L., Casson, L. P. and Meyer, B. J.
(1987). Assessment of X chromosome dosage compensation in
Caenorhabditis elegans by phenotypic analysis of lin-14.
Genetics 117,657
-670.
DeLong, L. D., Plenefisch, J. D., Klein, R. D. and Meyer, B.
J. (1993). Feedback control of sex determination by dosage
compensation revealed through Caenorhabditis elegans sdc-3 mutations.
Genetics 133,875
-896.[Abstract]
Dernburg, A. F. and Sedat, J. W. (1998).
Mapping three-dimensional chromosome architecture in situ. Methods
Cell Biol. 53,187
-233.[Medline]
Hagstrom, K. A., Holmes, V. F., Cozzarelli, N. R. and Meyer, B.
J. (2002). C. elegans condensin promotes mitotic
chromosome architecture, centromere organization, and sister chromatid
segregation during mitosis and meiosis. Genes Dev.
16,729
-742.
Hodgkin, J. (1983). X chromosome
dosage and gene expression in Caenorhabditis elegans: two unusual
dumpy genes. Mol. Gen. Genet.
192,452
-458.[CrossRef]
Howe, M., McDonald, K. L., Albertson, D. G. and Meyer, B. J.
(2001). HIM-10 is required for kinetochore structure and function
on Caenorhabditis elegans holocentric chromosomes. J. Cell
Biol. 153,1227
-1238.
Klein, R. D. and Meyer, B. J. (1993).
Independent domains of the sdc-3 protein control sex determination
and dosage compensation in C. elegans. Cell
72,349
-364.[CrossRef][Medline]
Lieb, J. D., Capowski, E. E., Meneely, P. and Meyer, B. J.
(1996). DPY-26, a link between dosage compensation and meiotic
chromosome segregation in the nematode. Science
274,1732
-1736.
Lieb, J. D., Albrecht, M. R., Chuang, P.-T. and Meyer, B. J.
(1998). MIX-1: An essential component of the C. elegans
mitotic machinery executes X chromosome dosage compensation.
Cell 92,265
-277.[CrossRef][Medline]
Meller, V. H. and Kuroda, M. I. (2002). Sex and
the single chromosome. Adv. Genet.
46, 1-24.[Medline]
Meneely, P. M. and Wood, W. B. (1984). An
autosomal gene that affects X chromosome expression and sex determination in
Caenorhabditis elegans. Genetics
106, 29-44.
Meneely, P. M. and Wood, W. B. (1987). Genetic
analysis of X-chromosome dosage compensation in Caenorhabditis
elegans. Genetics
117, 25-41.
Meyer, B. J. (2000). Sex in the worm: counting
and compensating X-chromosome dose. Trends Genet.
16,247
-253.[CrossRef][Medline]
Meyer, B. J. and Casson, L. P. (1986).
Caenorhabditis elegans compensates for the difference in X chromosome
dosage between the sexes by regulating transcript levels.
Cell 47,871
-881.[CrossRef][Medline]
Miller, L. M., Plenefisch, J. D., Casson, L. P. and Meyer, B.
J. (1988). xol-1: a gene that controls the male
modes of both sex determination and X chromosome dosage compensation in C.
elegans. Cell 55,167
-183.[CrossRef][Medline]
Nusbaum, C. and Meyer, B. J. (1989). The
Caenorhabditis elegans gene sdc-2 controls sex determination
and dosage compensation in XX animals. Genetics
122,579
-593.
Plenefisch, J. D., DeLong, L. and Meyer, B. J.
(1989). Genes that implement the hermaphrodite mode of dosage
compensation in Caenorhabditis elegans.
Genetics 121,57
-76.
Rhind, N. R., Miller, L. M., Kopczynski, J. B. and Meyer, B.
J. (1995). xol-1 acts as an early switch in the
C. elegans male/hermaphrodite decision. Cell
80, 71-82.[CrossRef][Medline]
Straight, A., Belmont, A., Robinett, C. and Murray, A.
(1996). GFP tagging of budding yeast chromosomes reveals that
protein-protein interactions can mediate sister chromatid cohesion.
Curr. Biol. 6,1599
-1608.[CrossRef][Medline]
Trent, C., Purnell, B., Gavinski, S., Hageman, J. and Wood, W.
B. (1991). Sex-specific transcriptional regulation of the
C. elegans sex-determining gene her-1. Mech.
Dev. 34,43
-56.[CrossRef][Medline]
Villeneuve, A. M. and Meyer, B. J. (1987).
sdc-1: a link between sex determination and dosage compensation in
C. elegans. Cell
48, 25-37.[CrossRef][Medline]
Wutz, A. and Jaenisch, R. (2000). A shift from
reversible to irreversible X inactivation is triggered during ES cell
differentiation. Mol. Cell
5, 695-705.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. M. Gladden and B. J. Meyer A ONECUT Homeodomain Protein Communicates X Chromosome Dose to Specify Caenorhabditis elegans Sexual Fate by Repressing a Sex Switch Gene Genetics, November 1, 2007; 177(3): 1621 - 1637. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.J. MEYER, P. MCDONEL, G. CSANKOVSZKI, and E. RALSTON Sex and X-Chromosome-wide Repression in Caenorhabditiselegans Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 71 - 80. [Abstract] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||