|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online December 1, 2003
doi: 10.1242/10.1242/dev.00889
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Molecular Biology, Université de Montréal, 110 ave
des Pins, ouest, Montréal, Québec H2W 1R7, Canada
2 The Institut de Recherches Cliniques de Montréal, 110 ave des Pins,
ouest, Montréal, Québec H2W 1R7, Canada
3 Division of Experimental Medicine, McGill University, 110 ave des Pins, ouest,
Montréal, Québec H2W 1R7, Canada
* Author for correspondence (e-mail: lohnesd{at}ircm.qc.ca)
Accepted 29 September 2003
| SUMMARY |
|---|
|
|
|---|
Several Hox loci have well characterized RA response elements (RAREs), which have been shown to regulate functionally relevant Hox expression in the neurectoderm. A similar crucial function for any RARE in mesodermal Hox expression has, however, not been documented. The means by which RA regulates mesodermal Hox expression could therefore be either through an undocumented direct mechanism or through an intermediary; these mechanisms are not necessarily exclusive. In this regard, we have found that Cdx1 may serve as such an intermediary. Cdx1 encodes a homeobox transcription factor that is crucial for normal somitic expression of several Hox genes, and is regulated by retinoid signalling in vivo and in vitro likely through an atypical RARE in the proximal promoter. In order to more fully understand the relationship between retinoid signalling, Cdx1 expression and AP patterning, we have derived mice in which the RARE has been functionally inactivated. These RARE-null mutants exhibit reduced expression of Cdx1 at all stages examined, vertebral homeotic transformations and altered Hox gene expression which correlates with certain of the defects seen in Cdx1-null offspring. These findings are consistent with a pivotal role for retinoid signalling in governing a subset of expression of Cdx1 crucial for normal vertebral patterning.
Key words: Retinoic Acid, Cdx, Hox, Vertebral patterning, Somite
| Introduction |
|---|
|
|
|---|
A wealth of information underscores crucial roles for Hox proteins in AP
patterning of derivatives of all germ layers, including the vertebrae.
Somites, which arise from segmentation of paraxial mesoderm, differentiate
into dermamyotome and sclerotome, the latter of which is the anlage of the
vertebrae. Altered Hox expression has well-documented effects on vertebral
patterning, typically manifesting as homeotic transformations along the AP
axis (Christ and Ordahl, 1995
;
Chen et al., 1998
;
Condie and Capecchi, 1993
;
Favier et al., 1996
;
Horan et al., 1995
). Grafting
experiments in the chick embryo indicate that this patterning is imparted
before overt segmentation of the paraxial mesoderm into somites, probably
during or shortly after gastrulation. In addition, Hox gene expression
characteristic of the initial axial position is retained in such transplants,
consistent with a crucial role for the Hox code in establishing AP vertebral
identity during this window (Kieny et al.,
1972
; Nowicki and Burke,
2000
).
Considerable effort has been applied to the elucidation of the mechanisms
by which Hox genes are regulated (Di Rocco
et al., 2001
; Gould et al.,
1997
; Marshall et al.,
1996
; Barna et al.,
2000
). Among such effectors, the vitamin A derivative retinoic
acid (RA) plays a crucial role (Marshall
et al., 1996
). RA can induce Hox genes in embryocarcinoma cells in
a manner reminiscent of the normal temporal activation of Hox expression, with
3' genes from a given cluster responding earlier, and to lower
concentrations of RA, than more 5' members
(Boncinelli et al., 1991
;
Simeone et al., 1990
). In
vivo, administration of exogenous RA to mouse embryos between E7.5 and E8.5
typically results in anteriorization of a number of Hox genes in a manner that
correlates with posterior vertebral homeotic transformations
(Conlon and Rossant, 1992
;
Kessel, 1992
;
Kessel and Gruss, 1991
).
Similar effects are also elicited by RA on expression of Hox genes in the CNS
and concomitant perturbation of rhombomere patterning
(Gavalas and Krumlauf, 2000
;
Gould et al., 1998
;
Marshall et al., 1992
).
The RA signal is transduced by the RA receptors (RAR
, RARß,
RAR
and their isoforms). RARs belong to the family of ligand-inducible
nuclear receptors and regulate expression of retinoid target genes as
heterodimers with a retinoid X receptor (RXR
, RXRß, RXR
)
partner. RXR-RAR heterodimers function by binding to cis-acting regulatory
sequences (RAREs) present in the promoter region of target genes
(Chambon, 1996
;
Mangelsdorf et al., 1995
).
Consensus RAREs have been described which consist of direct repeats (DR) of
the sequence PuG(G/T)TCA with two or five nucleotides intervening the repeats
(a DR2 or a DR5 element, respectively). RAREs are, however, highly
polymorphic, and a number of variant motifs have been described
(Huang et al., 2002
;
Glass, 1996
). Retinoid
signaling is also tightly controlled by the opposing actions of RALDH2, which
is essential for the generation of most embryonic RA, and CYP26 members, which
catabolizes RA (Swindell et al.,
1999
; Sakai et al.,
2001
; Abu-Abed et al.,
1998
; MacLean et al.,
2001
; Perlmann,
2002
).
A role for endogenous retinoid signaling in affecting Hox expression and AP
patterning is supported by numerous studies
(Gavalas et al., 1998
;
Huang et al., 1998
;
Zhang et al., 1997
). Vertebral
homeosis and hindbrain patterning defects, including altered Hox expression,
are observed in a number of RAR-null backgrounds, particularly RAR double null
mutant (Lohnes et al., 1995
;
Lohnes et al., 1993
;
Dupé et al., 1999
;
Wendling et al., 2001
).
Patterning defects of a similar nature are also seen in both Raldh2
mutant embryos, which are essentially devoid of RA
(Niederreither et al., 2000
;
Grandel et al., 2002
) and
CYP26A1 mutants, which have expanded fields of retinoid activity
(Abu-Abed et al., 2001
;
Maden, 1999
).
The above data demonstrate a clear relationship between retinoid
signalling, Hox expression and AP patterning of both neurectoderm and paraxial
mesoderm. RA response elements (RAREs) have been described for a number of Hox
genes, demonstrating that they are direct retinoid targets
(Dupé et al., 1997
;
Marshall et al., 1994
;
Zhang et al., 1997
;
Frasch et al., 1995
;
Zhang et al., 2000
;
Oosterveen et al., 2003
).
However, gene targeting studies suggest that these RAREs are crucial for
directing Hox function in the hindbrain
(Marshall et al., 1996
;
Gavalas et al., 1998
;
Nolte et al., 2003
). Although
certain RAREs, such as the Hoxd4 RARE, have been shown to affect
expression of a transgenic reporter in the mesoderm
(Zhang et al., 1997
) the
functional significance of this element has not been definitively established,
and an RARE crucial for directing Hox function in paraxial mesoderm has not
been formally described. These data suggest that RA may regulate Hox
expression in paraxial mesoderm either directly, through means such as the
aforementioned RAREs, or indirectly; Cdx gene products (Cdx1, 2 and
4) (Gamer and Wright, 1993
;
Meyer and Gruss, 1993
;
Beck et al., 1995
) are logical
candidates for such an intermediary.
Cdx genes encode homeodomain transcription factors, and have been
implicated as direct regulators of Hox expression
(Subramanian et al., 1995
;
Charité et al., 1998
;
Isaacs et al., 1998
;
van den Akker et al., 2002
).
Of particular relevance, Cdx1-/- offspring display
homeotic transformations of the axial skeleton reminiscent of defects seen in
RAR
/
-null mutants
(Subramanian et al., 1995
;
Allan et al., 2001
;
Lohnes et al., 1993
;
Lohnes et al., 1994
). We have
found that Cdx1 is responsive to excess RA and RAR ablation in vivo,
and have documented a functional RARE that regulates expression in tissue
culture (Houle et al., 2000
).
Taken together, these data strongly suggest that Cdx1 is a direct RA
target gene and may relay the retinoid signal to contribute to coordinated
expression of Hox genes in the paraxial mesoderm.
To establish a more precise relationship between RA, Cdx1, Hox expression and vertebral patterning, we derived mice harbouring a functionally inactive Cdx1 RARE. These RARE mutants exhibit normal onset of Cdx1 expression at late gastrulation, although transcript levels were consistently reduced compared with wild type, while expression at later stages was severely compromised. The RARE mutants also present with vertebral defects and altered Hox expression patterns that correlate with a subset of the Cdx1-null phenotype. Although these data underscore a crucial role for retinoid signalling in the regulation of Cdx1 expression, we also found that Cdx1 responded to exogenous RA in the RARE mutant background. Thus, as for several other known RA target genes, Cdx1 may be regulated by several RA-dependent mechanisms.
| Materials and methods |
|---|
|
|
|---|
|
Animals and genotyping
F1 males from chimera-C57BL/6 crosses bearing the targeted allele were bred
with homozygous female CMV-Cre mice
(Dupé et al., 1997
) and
offspring assessed for excision of the floxed selection cassette by genomic
Southern blot analysis following EcoRI digestion. All subsequent
genotyping was performed by PCR using the primers
5'-GGTACACAATGCAACTCGGTG and 5'-CCTCACACCCGCCACAG which flank the
RARE. The wild-type and mutant RARE allele can be distinguished by virtue of
the increased size of the PCR product generated from the mutant allele
following electorphoresis through a 2% agarose gel. The specificity of PCR
analysis was further confirmed by Southern blot analysis of amplification
products using oligonucleotide probes specific for wild type (5'
GGTCACGACCCTTCGGGTCC) or mutant (5' CGAAGTTATCCCTGCTTATCG) products.
Lines derived from each ES clone were separately maintained in a
129Sv-C57BL/6 hybrid background. Skeletal defects, assessed as described
previously (Allan et al.,
2001
), were identical with respect to expressivity and penetrance
in both lines, and subsequent studies were conducted using only one mutant
line. RARE homozygous mutants were crossed with both Cdx1-null
mutants and with RAR
heterozygotes. In the former case, double
heterozygous offspring were assessed for skeletal defects, whereas in the
latter situation, Rare+/-Rarg+/-
offspring were intercrossed, fetuses collected at term, genotyped and assessed
for skeletal anomalies.
In situ hybridization and embryo culture
Embryos were harvested at E7.5-9.5, with noon of the day of detection of a
vaginal plug considered to be E0.5. Embryos were fixed overnight in 4% PFA at
4°C and processed for in situ hybridization as previously described
(Allan et al., 2001
). Embryos
to be compared were processed in parallel to control for variation in signal
intensity, and stage matched according to established criteria. Probes for in
situ hybridization were generated from previously described plasmids;
Hoxa3 (Manley and Capecchi,
1995
), Hoxb3 (Manley
and Capecchi, 1998
), Hoxd3
(Condie and Capecchi, 1993
),
Hoxa4 (Wolgemuth et al.,
1987
), Hoxb4 (Folberg
et al., 1999
), Hoxd4
(Featherstone et al., 1988
)
and Cdx1 (Houle et al.,
2000
). Embryo culture, including cycloheximide and RA treatment,
was carried out as described (Houle et
al., 2000
) using 15% FBS in DMEM equilibrated under N2 containing
5% O2 and 5% CO2.
| Results |
|---|
|
|
|---|
Transfection assays were used to verify that the targeted mutation
abrogated RA response. To this end, we used PCR to amplify Cre-recombined
sequences spanning the mutated RARE and substituted these sequences in a
reporter vector comprising 2 kb of Cdx1 genomic DNA directing
expression of a luciferase gene. This reporter (Lox mut in
Fig. 2) was compared with the
wild-type construct and with another previously published RARE mutation (Mut
in Fig. 2) which is not capable
of RXR/RAR binding or RA response (Houle
et al., 2000
). In F9 embryocarcinoma cells, the wild-type reporter
was induced by 10-6 M RA, whereas both the Lox mut and Mut
reporters were unresponsive (Fig.
2). Thus, the targeted mutation appears to effectively attenuate
retinoid regulation through this RARE.
|
|
|
|
| RARE mutants exhibit vertebral homeotic transformations |
|---|
|
|
|---|
RARE heterozygous offspring exhibited a low incidence of defects affecting
the first (C1) and second (C2) cervical vertebrae (compare
Fig. 6B with control in 6A;
Table 1). These consisted of a
small posterior extension of the basioccipital bone, slightly narrower C1
neural arches and/or a short cartilaginous AAA on C2; the latter two defects
are suggestive of a partial transformation of C2 to a C1 identity. By
contrast, RARE homozygotes presented highly penetrant skeletal defects, with
90% of all specimens examined exhibiting vertebral homeosis and/or other
malformations. Defects typically consisted of partial C2 to C1 transformation,
as evidenced by the presence of an ectopic AAA and/or broader neural arches on
C2 (Fig. 6C;
Table 1). Fusions between the
AAA and the basioccipital bone, and/or narrow C1 neural arches were also
observed, although at a lower frequency
(Table 1). Interestingly, the
RARE mutants were rarely affected posterior to the C2
(Table 1), although
Cdx1-null mutants are affected throughout the cervical and anterior
thoracic skeleton (Subramanian et al.,
1995
).
|
|
The incidence of vertebral defects exhibited variable sensitivity to RARE
and Cdx1 dosage along the axis. Malformations of C1, including
reduced NA, enlargement of the basioccipital, or its fusion with the anterior
arch of the atlas, were completely penetrant in the Cdx1-null
background, as described previously (van
den Akker et al., 2002
; Allan
et al., 2001
; Subramanian et
al., 1995
). These defects were observed at a much lower frequency
in Cdx1+/-, Rare-/- and
Rare+/-Cdx1+/- backgrounds
(Table 1). The partial C2 to C1
homeotic transformation was also completely penetrant in Cdx1-null
mutants and, in contrast to C1 malformations, was observed at a high incidence
in Rare-/- and
Rare+/-Cdx1+/- offspring.
In contrast to more anterior elements, C3 was never affected in the
Rare-/- or Cdx1+/- offspring, but
exhibited C2 characteristics in all Cdx1-/- samples.
Approximately one third of
Rare+/-Cdx1+/- offspring also
exhibited this transformation. Similarly, transformation of C7 to C6,
evidenced by ectopic anterior tuberculi, was absent in
Rare-/- and Cdx1+/- offspring, but was
completely penetrant in Cdx1-/- mice and observed at an
intermediate frequency in
Rare+/-Cdx1+/- samples. These latter
two transformations argue strongly that the RARE mutation is allelic with
Cdx1. Additional defects, including fusions between cervical neural
arches, were also prevalent in
Rare+/-Cdx1+/- mutants, and may
represent incomplete vertebral homeosis, as previously discussed
(Allan et al., 2001
).
It is interesting to note that the incidence of defects in both the RARE-null and RARE-Cdx compound mutant backgrounds exhibited a variable frequency along the AP axis: C1 and basioccipital appear to require minimal Cdx1 function, C2 being most sensitive, and more posterior cervical vertebrae exhibit an intermediate level of sensitivity. This suggests a restricted window of function for the RARE, and by extension RA, in affecting Cdx1 expression and function.
Interaction between RAR
and RARE mutant alleles
To further investigate the relationship between Rare-dependent Cdx
function, RAR signalling and vertebral patterning, we assessed the skeletal
phenotype of an allelic series of RARE-RAR
compound mutants.
Rarg+/- offspring are essentially normal, whereas
RAR
-null mutants exhibit a low frequency of vertebral defects, the most
prevalent being a partial C2 to C1 transformation, which is similar to the
predominant malformation exhibited by Rare-/- mutants
(compare Fig. 7B with 7A and Fig.
6C; Table 1).
Rare+/-Rarg+/- compound mutants did
not exhibit an increased incidence of vertebral malformations. By contrast,
Rare-/-Rarg-/- double null offspring
showed a marked increase in both the penetrance of defects characteristic of
either mutant, as well as additional malformations not observed in either
background (Fig. 7 and
Table 1). Malformation of C1,
including reduction of the neural arches, fusion of the AAA with the
basioccipital bone or fusion of the neural arches of C1 and C2, were all
observed at a higher incidence in the double mutant background in a manner
suggesting a synergistic interaction between these alleles. The C2 to C1
transformation, which was incompletely penetrant in both
Rare-/- and Rarg-/- backgrounds, was
observed in all the double null mutants. The C3 to C2 homeosis, which was
absent in RARE and RAR
-null backgrounds, was observed in
Rarg-/-Rare-/- offspring, albeit with
incomplete penetrance (Table 1;
data not shown). Consistent with these data,
Rarg-/-Rare+/- and
Rarg+/-Rare-/- offspring presented a
range of malformations and degree of penetrance that were intermediate between
the vertebral phenotype of
Rarg-/-Rare-/- and
Rarg+/-Rare+/- compound mutants
(Fig. 7D,E;
Table 1). Taken together with
our prior work (Allan et al.,
2001
), these finding suggest that retinoid-dependent vertebral
patterning is affected by pathways involving both the Cdx1 RARE and other
RAR-regulated events.
|
-RARE compound mutants closely phenocopy the defects observed in
certain Hox mutant mice (Manley and
Capecchi, 1997
In wild-type E9.5 embryos, Hoxa3, Hoxb3 and Hoxd3 are all
expressed with a rostral limit between the fourth and the fifth somite
(Gaunt, 1988
;
Sham et al., 1992
;
Condie and Capecchi, 1993
),
and null mutants of Hoxb3 and Hoxd3 phenocopy certain
aspects of the Cdx1-null phenotype (Manley
and Capecchi, 1997
; Condie and
Capecchi, 1993
; Allan et al.,
2001
; Subramanian et al.,
1995
). Consistent with this observation, the expression pattern of
all three of these Hox genes was consistently posteriorized by one somite in
Cdx1-/- offspring (Fig.
8 and Table 2). By
contrast, mutation of the RARE had no discernable effect on the pattern of
expression of any of these transcripts. This suggests that although Cdx1 plays
a crucial role in establishing the proper rostral expression of these group 3
genes, the RARE is not critically required for this function.
|
|
|
|
| Discussion |
|---|
|
|
|---|
The RARE is crucial for Cdx1 expression
We chose to inactivate the Cdx1 RARE by insertional mutagenesis,
the end result of which was replacement of the RARE sequences with a
lox site. This strategy was chosen in order to avoid unknown effects
of lox insertion on sequences elsewhere in the locus, and to maximize
the frequency of recovery of targeted clones. Indeed, targeting of
Cdx1 regulatory sequences using an unlinked selectable marker is much
less efficient at this locus (N. Pilon and D.L., unpublished). An identical
strategy to the present approach has been used previously to disrupt the
Hoxa1 RARE (Dupé et al.,
1997
).
The reduced Cdx1 expression seen in the RARE-null mutants could be
due to non-specific effects resulting from the residual lox
sequences, rather than from disruption of the RARE per se, and such a
possibility cannot be unequivocally ruled out. However, a number of
observations suggest that the targeted disruption of the Cdx1 RARE is
both specific and obviates RA-response through this element. First, apart from
the RARE, this region of the Cdx1 promoter is poorly conserved between murine
and human genomes (Houle et al.,
2000
), suggesting the absence of other conserved regulatory
elements. Second, RARE-null embryos initially exhibit a decrease in expression
of Cdx1 at E7.5. This effect is observed in the primitive streak
region, which is an active region of retinoid signalling at this stage
(Balkan et al., 1992
;
Rossant et al., 1991
).
Finally, transfection assays demonstrated that the mutated RARE no longer
mediates a retinoid response in tissue culture.
A role for the RARE in other Cdx1-dependent processes is also suggested by
the finding that the null mutants exhibit reduced expression of Cdx1
in the neurectoderm at E8.0. Although this could occur through a reduction in
initial expression at E7.5, RA is also found in the embryonic trunk at this
stage (Rossant et al., 1991
).
The reduced expression of Cdx1 in RARE-null offspring may therefore reflect a
role for RA in directly regulating Cdx1 in the neurectoderm per se. A
similar retinoid-dependent mechanism has been suggested previously for
Hoxb4 gene expression in the neurectoderm
(Gould et al., 1998
). In
should also be noted that, although a role for Cdx1 in the CNS is presently
unknown, it is tempting to speculate that some of the effects of RA on Hox
expression in this lineage could be conveyed via Cdx1, and that the
significance of this relationship may be masked by functional overlap with
Cdx2 (van den Akker et al.,
2002
).
A second RA-dependent mechanism affecting Cdx1 expression
The present study suggests the existence of a second pathway for RA
induction of Cdx1 that does not require the RARE and is independent
of de novo protein synthesis. Although alternative mechanism cannot be ruled
out, this observation is consistent with a second direct means for RA-mediated
regulation of Cdx1 expression. This is not without precedent, as
disruption of the Hoxa1 RARE does not completely attenuate response
of this gene to exogenous RA in vivo
(Dupé et al., 1997
).
Hoxb1 is also subject to regulation by multiple RAREs which function
tissue-specifically (Huang et al.,
1998
). However, despite this selective function, some of the
Hoxb1 RAREs can mediate response to exogenous RA in a non-specific
manner. For example, disruption of the Hoxb1 RARE that normally
affects hindbrain expression in vivo does not completely abrogate retinoid
response in the neurectoderm (Huang et
al., 2002
).
Although the existence and identity of a second Cdx1 RARE is presently
speculative, we have documented a DR5-like element in the distal Cdx1 promoter
that can mediate RA-response in transfection assays in P19 embryocarcinoma
cells (M.H., J.R.S. and D.L., unpublished). A putative DR2 RARE has also been
described in first intron of both chick and mouse Cdx1 loci that is
necessary for a subset of expression in transgenic reporter assays
(Gaunt et al., 2003
). Although
more definitive analysis is necessary to confirm that either of these elements
are bone fide RAREs, a second element would offer a basis for induction of
Cdx1 by exogenous RA as seen in the RARE-null mutants. Such a mechanism would
also offer an explanation for some of the discrepancies between our present
findings and observations from transgenic models of Cdx1 regulation
(Lickert and Kemler, 2002
). In
these latter transgenic models, minimal Cdx1 genomic sequences
(containing the proximal RARE mutated in the present study) were found to
suffice to recapitulate most of the normal pattern of expression of
Cdx1. Mutation of the RARE in this context severely affected
expression at E7.5, much more so than the outcome of targeted ablation of this
element presented here. As both the putative DR5 and DR2 elements are excluded
from this transgenic promoter, they could potentially contribute to both early
expression in the primitive streak and/or mediate the response of
Cdx1 to exogenous RA seen in the RARE-null mutants.
The RARE is essential for maintaining Cdx1 expression at
post-gastrulation stages
Previously, we had shown that Cdx1 expression is compromised in
RAR
1-RAR
double null mutants in the primitive streak region
specifically at E7.5, although expression at E8.5 is unaffected relative to
controls (Houle et al., 2000
).
This finding is in accordance with the distribution of bioactive retinoid
signalling, which is robust in the primitive streak region at E7.5 but is
absent at E8.5 and later in the tail bud
(Balkan et al., 1992
;
Rossant et al., 1991
).
Conversely, we (Prinos et al.,
2001
) and others (Ikeya and
Takada, 2001
), have suggested a role for Wnt signalling in
affecting Cdx1 expression at later (E8.5-9.5) stages in the tail bud.
Moreover, we have observed that loss of Cdx1 protein leads to eventual failure
of Cdx1 expression at E8.5, but not at earlier stages. This model
(Prinos et al., 2001
) suggests
that RA specifically regulates early Cdx1 expression, and that other
mechanisms, including Wnt signalling and autoregulation, subsequently maintain
expression at later stages.
Although the above observations suggest an exclusive early role for
retinoid signalling in regulating Cdx1 in the caudal embryo,
expression was severely compromised in RARE-null mutants at E8.5 and later.
One interpretation for this finding is that loss of the RARE may led to a
reduction of Cdx1 expression below a crucial threshold, resulting in
subsequent failure of autoregulation. This observation also suggests that
ablation of the RARE leads to a loss of greater than 50% of expression, as
Cdx1 heterozygous embryos do not exhibit such a compromise in late expression
(Prinos et al., 2001
). Such an
interaction is not without precedent, as the Hoxa4 RARE and an
autoregulatory element genetically interact to maintain a similar loop
(Packer et al., 1998
).
Alternatively, loss of expression at E8.5 may reflect a late, direct, role for
the Cdx1 RARE. Such an possibility, however, necessitates a
ligand-independent mechanism, as retinoid bioactivity is excluded from the
caudal embryo at this stage. In this regard, a role for unliganded RAR has
been proposed in the development of both the apendicular skeleton and the
anterior embryo (Weston et al.,
2002
; Koide et al.,
2001
), albeit in a repressor context. Finally, we cannot exclude
the possibility that an effector other than the RARs may function through the
RARE to maintain later Cdx1 expression.
Vertebral defects in RARE-null mutants
RAR-null mutants, in particular RAR
-RAR
double mutants,
phenocopy some of the vertebral malformations seen in Cdx1 mutants
(Lohnes et al., 1995
;
Subramanian et al., 1995
;
Allan et al., 2001
). The
vertebral defects seen in RARE-null mutants are also in agreement with a
crucial role for RA in governing a subset of Cdx1 expression and function. It
is notable, however, that the vertebral defects in RARE-null mutants were
restricted to a subset of the rostral-most region affected by loss of Cdx1,
while more caudal elements were not affected. As somites receive patterning
information prior to their overt segmentation, the reduction of expression
seen in RARE mutants at E8.5 and later does not appear to correlate with
vertebral defects, which would be anticipated to occur at more caudal levels.
This suggests that the RARE is essential for only a limited, early, function
of Cdx1, and, conversely, that Cdx1 is not critically required for AP
patterning at E8.5 and later stages. In this regard, Cdx2 has been suggested
to overlap functionally with Cdx1 (van den
Akker et al., 2002
;
Charité et al., 1998
;
Marom et al., 1997
), which may
mask later roles for Cdx1 in vertebral patterning. It is likewise possible
that a second RARE precludes our understanding of the full scope of retinoid
signalling on Cdx1 expression and function.
We found that RAR
and RARE-null alleles interact on vertebral
patterning. In particular,
Rare+/-Rarg-/- mutants show high
penetrance of the C2 to C1 transformation, as seen in
Rare-/- offspring. This is consistent with our previous
finding that RAR
and Cdx1 synergize in vertebral patterning through Hox
expression in a manner suggesting that retinoid signalling acts both upstream
of, and parallel to, Cdx1 (Allan et al.,
2001
). An alternative interpretation for the interactions seen
between RARE and RAR
-null mutants is that loss of the receptor may
affect Cdx1 expression through the proximal RARE, and that a second
putative RARE is not affected by the loss of this RAR. This possibility is
supported by the phenotype of RARE-RAR
double null mutants, which is
not reminiscent of Cdx1-/- offspring as may have been
anticipated if RAR
impacts on Cdx1 expression through multiple,
equivalent, RAREs. Thus, it is conceivable that a second Cdx1 RARE may be
involved in tissue- or RAR-specific regulation, but is still capable of
mediating a response to exogenous RA in paraxial mesoderm analogous to the
differential functions of the Hoxb1 RAREs
(Huang et al., 2002
).
Alternatively, it is also possible that RARs can regulate Cdx1
expression through a second RARE, but such a role is not seen in
RAR
-RARE double null mutants because of functional redundancy among
this receptor family (e.g. Lohnes et al.,
1994
).
The RARE is essential for a subset of Cdx1-dependent Hox gene
expression
Based on the nature of the vertebral defects observed in both Cdx1 and
RARE-null backgrounds, we investigated the expression of Hox genes from
paralogue groups 3 and 4 as likely candidates for patterning defects at these
axial levels. We found that all Hox group 3 genes assessed were posteriorized
in Cdx1-null embryos, but were unperturbed in RARE-null offspring. This
finding is consistent with the more severe nature of C1 defects associated
with both Cdx1 and the respective Hox group 3-null mutants
(Subramanian et al., 1995
;
Chisaka and Capecchi, 1991
;
Manley and Capecchi, 1997
;
Condie and Capecchi, 1993
)
(Table 3).
Although the expression of Hoxa4 was not perceptibly altered in
any background examined, the anterior limit of expression of both
Hoxb4 and Hoxd4 was posteriorized by one somite in both
Cdx1-/- and Rare-/- embryos. This is
in close agreement with the phenotypes of these particular Hox-null
mice (Ramirez-Solis et al.,
1993
; Horan et al.,
1995
), which exhibit vertebral defects reminiscent of those seen
in RARE-null mutants (summarized in Table
3). Moreover, the frequency of posteriorized Hox expression in
RARE-null mutants is similar to the incidence of associated vertebral
malformations. Taken together, these data suggest a direct relationship
between retinoid signalling and Cdx1 function essential for establishing
normal expression of these specific Hox genes.
It is notable that, although Cdx1-null mutants exhibit altered
expression of both Hox group 3 and group 4 genes, loss of the RARE affected
only Hoxb4 and Hoxd4. One possible reason for this
observation is that Cdx1 may not be affected at early stages by RARE
disruption, and hence more rostrally-expressed Hox genes are not perturbed. We
have not, however, noted such an effect, as Cdx1 expression was
uniformly reduced at onset in the RARE mutants. Alternatively, it is
conceivable that expression of Hox group 3 genes is reliant on a relatively
low threshold of Cdx1 protein, and this value is exceeded in RARE-null
mutants. Consistent with this, Cdx1+/- offspring exhibit a
higher frequency of vertebral defects associated with loss of expression of
Hox paralogue group 4 genes, relative to group 3 members
(Allan et al., 2001
). This
suggests that Hox genes exhibit differential sensitivity to Cdx dose along the
AP axis, as previously discussed (Marom et
al., 1997
; Charité et
al., 1998
; Gaunt et al.,
2003
). It will be of interest to investigate Cdx1-dependent
regulatory mechanisms governing expression of these particular Hox genes to
determine if this is, indeed, the case.
A relationship between FGF, Cdx members and Hox expression has also been
shown in Xenopus and the chick embryo
(Isaacs et al., 1998
;
Pownall et al., 1996
;
Bel-Vialar et al., 2002
), and
it has been suggested that this pathway is important in establishing the
expression domains of more 5' Hox gene paralogues, at least in the
latter model (Bel-Vialar et al.,
2002
). This study also suggests a qualitative difference in Hox
response to RA versus FGF, with more 3' paralogs responding to RA, but
not FGF. We, and others, have also suggested a similar relationship between
Wnt signalling, Cdx1 expression and vertebral patterning
(Prinos et al., 2001
;
Ikeya and Takada, 2001
). Based
on these observations, it is tempting to speculate that Cdx members may play a
general role in conveying posteriorization information from multiple
signalling pathways to the Hox genes.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abu-Abed, S., Dollé, P., Metzger, D., Beckett, B.,
Chambon, P. and Petkovich, M. (2001). The retinoic
acid-metabolizing enzyme, CYP26A1, is essential for normal hindbrain
patterning, vertebral identity, and development of posterior structures.
Genes Dev. 15,226
-240.
Abu-Abed, S. S., Beckett, B. R., Chiba, H., Chithalen, J. V.,
Jones, G., Metzger, D., Chambon, P. and Petkovich, M. (1998).
Mouse P450RAI (CYP26) expression and retinoic acid-inducible retinoic acid
metabolism in F9 cells are regulated by retinoic acid receptor gamma and
retinoid X receptor alpha. J. Biol. Chem.
273,2409
-2415.
Allan, D., Houle, M., Bouchard, N., Meyer, B. I., Gruss, P. and
Lohnes, D. (2001). RAR gamma and Cdx1 interactions in
vertebral patterning. Dev. Biol.
240, 46-60.[CrossRef][Medline]
Balkan, W., Colbert, M., Bock, C. and Linney, E.
(1992). Transgenic indicator mice for studying activated retinoic
acid receptors during development. Proc. Natl. Acad. Sci.
USA 89,3347
-3351.
Barna, M., Hawe, N., Niswander, L. and Pandolfi, P. P.
(2000). Plzf regulates limb and axial skeletal patterning.
Nat. Genet. 25,166
-172.[CrossRef][Medline]
Beck, F., Erler, T., Russell, A. and James, R.
(1995). Expression of Cdx-2 in the mouse embryo and placenta:
possible role in patterning of the extra-embryonic membranes. Dev.
Dyn. 204,219
-227.[Medline]
Bel-Vialar, S., Itasaki, N. and Krumlauf, R.
(2002). Initiating Hox gene expression: in the early chick neural
tube differential sensitivity to FGF and RA signaling subdivides the HoxB
genes in two distinct groups. Development
129,5103
-5115.
Boncinelli, E., Simeone, A., Acampora, D. and Mavilio, F.
(1991). HOX gene activation by retinoic acid. Trends
Genet. 7,329
-334.[Medline]
Burke, A. C., Nelson, C. E., Morgan, B. A. and Tabin, C.
(1995). Hox genes and the evolution of vertebrate axial
morphology. Development
121,333
-346.[Abstract]
Chambon, P. (1996). A decade of molecular
biology of retinoic acid receptors. FASEB J.
10,940
-954.[Abstract]
Charité, J., de, Graaff, W., Consten, D., Reijnen, M. J.,
Korving, J. and Deschamps, J. (1998). Transducing positional
information to the Hox genes: critical interaction of cdx gene products with
position-sensitive regulatory elements. Development
125,4349
-4358.[Abstract]
Chen, F., Greer, J. and Capecchi, M. R. (1998).
Analysis of Hoxa7/Hoxb7 mutants suggests periodicity in the generation of the
different sets of vertebrae. Mech. Dev.
77, 49-57.[CrossRef][Medline]
Chisaka, O. and Capecchi, M. R. (1991).
Regionally restricted developmental defects resulting from targeted disruption
of the mouse homeobox gene hox-1.5. Nature
350,473
-479.[CrossRef][Medline]
Christ, B. and Ordahl, C. P. (1995). Early
stages of chick somite development. Anat. Embryol.
191,381
-396.[CrossRef][Medline]
Condie, B. G. and Capecchi, M. R. (1993). Mice
homozygous for a targeted disruption of Hoxd-3 (Hox-4.1) exhibit anterior
transformations of the first and second cervical vertebrae, the atlas and the
axis. Development 119,579
-595.
Conlon, R. A. and Rossant, J. (1992). Exogenous
retinoic acid rapidly induces anterior ectopic expression of murine Hox-2
genes in vivo. Development
116,357
-368.[Medline]
Deschamps, J. and Wijgerde, M. (1993). Two
phases in the establishment of HOX expression domains. Dev.
Biol. 156,473
-480.[CrossRef][Medline]
Di Rocco, G., Gavalas, A., Popperl, H., Krumlauf, R., Mavilio,
F. and Zappavigna, V. (2001). The recruitment of SOX/OCT
complexes and the differential activity of HOXA1 and HOXB1 modulate the Hoxb1
autoregulatory enhancer function. J. Biol. Chem.
276,20506
-20515.
Duboule, D. (1998). Vertebrate hox gene
regulation: clustering and/or colinearity? Curr. Opin. Genet.
Dev. 8,514
-518.[CrossRef][Medline]
Duboule, D. and Dollé, P. (1989). The
structural and functional organization of the murine HOX gene family resembles
that of Drosophila homeotic genes. EMBO J.
8,1497
-1505.[Medline]
Dupé, V., Davenne, M., Brocard, J., Dollé, P.,
Mark, M., Dierich, A., Chambon, P. and Rijli, F. M. (1997).
In vivo functional analysis of the Hoxa-1 3' retinoic acid response
element (3'RARE). Development
124,399
-410.[Abstract]
Dupé, V., Ghyselinck, N. B., Wendling, O., Chambon, P.
and Mark, M. (1999). Key roles of retinoic acid receptors
alpha and beta in the patterning of the caudal hindbrain, pharyngeal arches
and otocyst in the mouse. Development
126,5051
-5059.[Abstract]
Favier, B., Rijli, F. M., Fromental-Ramain, C., Fraulob, V.,
Chambon, P. and Dollé, P. (1996). Functional
cooperation between the non-paralogous genes Hoxa-10 and Hoxd-11 in the
developing forelimb and axial skeleton. Development
122,449
-460.[Abstract]
Featherstone, M. S., Baron, A., Gaunt, S. J., Mattei, M. G. and
Duboule, D. (1988). Hox-5.1 defines a homeobox-containing
gene locus on mouse chromosome 2. Proc. Natl. Acad. Sci.
USA 85,4760
-4764.
Ferrier, D. E. K. and Holland, P. W. H. (2001).
Ancient origin of the Hox gene cluster. Nat. Rev.
Genet. 2,33
-38.[Medline]
Folberg, A., Kovacs, E. N., Huang, H., Houle, M., Lohnes, D. and
Featherstone, M. S. (1999). Hoxd4 and Rarg interact
synergistically in the specification of the cervical vertebrae.
Mech. Dev. 89,65
-74.[CrossRef][Medline]
Frasch, M., Chen, X. and Lufkin, T. (1995).
Evolutionary-conserved enhancers direct region-specific expression of the
murine Hoxa-1 and Hoxa-2 loci in both mice and Drosophila.
Development 121,957
-974.[Abstract]
Gamer, L. W. and Wright, C. V. (1993). Murine
Cdx-4 bears striking similarities to the Drosophila caudal gene in its
homeodomain sequence and early expression pattern. Mech.
Dev. 43,71
-81.[CrossRef][Medline]
Gaunt, S. J. (1988). Mouse homeobox gene
transcripts occupy different but overlapping domains in embryonic germ layers
and organs: a comparison of Hox-3.1 and Hox-1.5.
Development 103,135
-144.[Abstract]
Gaunt, S. J. (1994). Conservation in the Hox
code during morphological evolution. Int. J. Dev.
Biol. 38,549
-552.[Medline]
Gaunt, S. J., Krumlauf, R. and Duboule, D.
(1989). Mouse homeo-genes within a subfamily, Hox-1.4, -2.6 and
-5.1, display similar anteroposterior domains of expression in the embryo, but
show stage- and tissue-dependent differences in their regulation.
Development 107,131
-141.[Abstract]
Gaunt, S. J., Drage, D. and Cockley, A. (2003).
Vertebrate, caudal, gene, expression, gradients, investigated, by, use, of,
chick, Cdx-A/lacZ, and mouse, Cdx-1/lacZ, reporters, in,
transgenic, mouse, embryos:, evidence, for, an, intron, enhancer.
Mech. Dev. 120,573
-586.[CrossRef][Medline]
Gavalas, A. and Krumlauf, R. (2000). Retinoid
signalling and hindbrain patterning. Curr. Opin. Genet.
Dev. 10,380
-386.[CrossRef][Medline]
Gavalas, A., Studer, M., Lumsden, A., Rijli, F. M., Krumlauf, R.
and Chambon, P. (1998). Hoxa1 and Hoxb1 synergize in
patterning the hindbrain, cranial nerves and second pharyngeal arch.
Development 125,1123
-1136.[Abstract]
Gehring, W. J. (1993). Exploring the homeobox.
Gene 135,215
-221.[CrossRef][Medline]
Gellon, G. and Mcginnis, W. (1998). Shaping
animal body plans in development and evolution by modulation of hox expression
patterns. BioEssays 20,116
-125.[CrossRef][Medline]
Glass, C. K. (1996). Some new twists in the
regulation of gene expression by thyroid hormone and retinoic acid receptors.
J. Endocrinol. 150,349
-357.
Gould, A., Itasaki, N. and Krumlauf, R. (1998).
Initiation of rhombomeric Hoxb4 expression requires induction by somites and a
retinoid pathway. Neuron
21, 39-51.[CrossRef][Medline]
Gould, A., Morrison, A., Sproat, G., White, R. A. and Krumlauf,
R. (1997). Positive cross-regulation and enhancer sharing:
two mechanisms for specifying overlapping Hox expression patterns.
Genes Dev. 11,900
-913.
Grandel, H., Lun, K., Rauch, G. J., Rhinn, M., Piotrowski, T.,
Houart, C., Sordino, P., Kuchler, A. M., Schulte-Merker, S., Geisler, R.,
Holder, N., Wilson, S. W. and Brand, M. (2002). Retinoic acid
signalling in the zebrafish embryo is necessary during pre-segmentation stages
to pattern the anterior-posterior axis of the CNS and to induce a pectoral fin
bud. Development 129,2851
-2865.
Hogan, B., Constantini, F., Lacy, P. and Beddington, R. S.
P. (1994). Manipulating the Mouse Embryo: A
Laboratory Manual, 2nd edn. Cold Spring Harbor: Cold Spring
Harbor Laboratory Press.
Horan, G. S., Ramirez-Solis, R., Featherstone, M. S., Wolgemuth,
D. J., Bradley, A. and Behringer, R. R. (1995). Compound
mutants for the paralogous hoxa-4, hoxb-4, and hoxd-4 genes show more complete
homeotic transformations and a dose-dependent increase in the number of
vertebrae transformed. Genes Dev.
9,1667
-1677.
Horan, G. S., Wu, K., Wolgemuth, D. J. and Behringer, R. R.
(1994). Homeotic transformation of cervical vertebrae in Hoxa-4
mutant mice. Proc. Natl. Acad. Sci. USA
91,12644
-12648.
Houle, M., Prinos, P., Iulianella, A., Bouchard, N. and Lohnes,
D. (2000). Retinoic acid regulation of Cdx1: an indirect
mechanism for retinoids and vertebral specification. Mol. Cell
Biol. 20,6579
-6586.
Huang, D., Chen, S. W. and Gudas, L. J. (2002).
Analysis of two distinct retinoic acid response elements in the homeobox gene
Hoxb1 in transgenic mice. Dev. Dyn.
223,353
-370.[CrossRef][Medline]
Huang, D., Chen, S. W., Langston, A. W. and Gudas, L. J.
(1998). A conserved retinoic acid responsive element in the
murine Hoxb-1 gene is required for expression in the developing gut.
125,3235
-3246.
Ikeya, M. and Takada, S. (2001). Wnt-3a is
required for somite specification along the anteroposterior axis of the mouse
embryo and for regulation of cdx-1 expression. Mech.
Dev 103,27
-33.[CrossRef][Medline]
Isaacs, H. V., Pownall, M. E. and Slack, J. M.
(1998). Regulation of Hox gene expression and posterior
development by the Xenopus caudal homologue Xcad3. EMBO
J. 17,3413
-3427.[CrossRef][Medline]
Iulianella, A. and Lohnes, D. (2002). Chimeric
analysis of retinoic acid receptor function during cardiac looping.
Dev. Biol. 247,62
-75.[CrossRef][Medline]
Kessel, M. (1992). Respecification of vertebral
identities by retinoic acid. Development
115,487
-501.[Abstract]
Kessel, M. and Gruss, P. (1991). Homeotic
transformations of murine vertebrae and concomitant alteration of Hox codes
induced by retinoic acid. Cell
67, 89-104.[CrossRef][Medline]
Kieny, M., Mauger, A. and Sengel, P. (1972).
Early regionalization of somitic mesoderm as studied by the development of
axial skeleton of the chick embryo. Dev. Biol.
28,142
-161.[CrossRef][Medline]
Koide, T., Downes, M., Chandraratna, R. A., Blumberg, B. and
Umesono, K. (2001). Active repression of RAR signaling is
required for head formation. Genes Dev.
15,2111
-2121.
Krumlauf, R. (1994). Hox genes in vertebrate
development. Cell 78,191
-201.[CrossRef][Medline]
Lickert, H. and Kemler, R. (2002). Functional
analysis of cis-regulatory elements controlling initiation and maintenance of
early Cdx1 gene expression in the mouse. Dev. Dyn.
225,216
-220.[CrossRef][Medline]
Lohnes, D., Kastner, P., Dierich, A., Mark, M., LeMeur, M. and
Chambon, P. (1993). Function of retinoic acid receptor gamma
in the mouse. Cell 73,643
-658.[CrossRef][Medline]
Lohnes, D., Mark, M., Mendelsohn, C., Dollé, P., Decimo,
D., LeMeur, M., Dierich, A., Gorry, P. and Chambon, P.
(1995). Developmental roles of the retinoic acid receptors.
J. Steroid Biochem. Mol. Biol.
53,475
-486.[CrossRef][Medline]
Lohnes, D., Mark, M., Mendelsohn, C., Dollé, P., Dierich,
A., Gorry, P., Gansmuller, A. and Chambon, P. (1994).
Function of the retinoic acid receptors (RARs) during development (I).
Craniofacial and skeletal abnormalities in RAR double mutants.
Development 120,2723
-2748.[Abstract]
MacLean, G., Abu-Abed, S., Dollé, P., Tahayato, A.,
Chambon, P. and Petkovich, M. (2001). Cloning of a novel
retinoic-acid metabolizing cytochrome P450, Cyp26B1, and comparative
expression analysis with Cyp26A1 during early murine development.
Mech. Dev. 107,195
-201.[CrossRef][Medline]
Maden, M. (1999). Heads or tails? Retinoic acid
will decide. BioEssays
21,809
-812.[CrossRef][Medline]
Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P.,
Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P. et
al. (1995). The nuclear receptor superfamily: the second
decade. Cell 83,835
-839.[CrossRef][Medline]
Manley, N. R. and Capecchi, M. R. (1995). The
role of Hoxa-3 in mouse thymus and thyroid development.
Development 121,1989
-2003.[Abstract]
Manley, N. R. and Capecchi, M. R. (1997). Hox
group 3 paralogous genes act synergistically in the formation of somitic and
neural crest-derived structures. Dev. Biol.
192,274
-288.[CrossRef][Medline]
Manley, N. R. and Capecchi, M. R. (1998). Hox
group 3 paralogs regulate the development and migration of the thymus,
thyroid, and parathyroid glands. Dev. Biol.
195, 1-15.[CrossRef][Medline]
Marom, K., Shapira, E. and Fainsod, A. (1997).
The chicken caudal genes establish an anterior-posterior gradient by partially
overlapping temporal and spatial patterns of expression. Mech.
Dev. 64,41
-52.[CrossRef][Medline]
Marshall, H., Morrison, A., Studer, M., Popperl, H. and
Krumlauf, R. (1996). Retinoids and Hox genes.
FASEB J. 10,969
-978.[Abstract]
Marshall, H., Nonchev, S., Sham, M. H., Muchamore, I., Lumsden,
A. and Krumlauf, R. (1992). Retinoic acid alters hindbrain
Hox code and induces transformation of rhombomeres 2/3 into a 4/5 identity.
Nature 360,737
-741.[CrossRef][Medline]
Marshall, H., Studer, M., Popperl, H., Aparicio, S., Kuroiwa,
A., Brenner, S. and Krumlauf, R. (1994). A conserved retinoic
acid response element required for early expression of the homeobox gene
Hoxb-1. Nature 370,567
-571.[CrossRef][Medline]
Meyer, B. I. and Gruss, P. (1993). Mouse Cdx-1
expression during gastrulation. Development
117,191
-203.
Niederreither, K., Vermot, J., Schuhbaur, B., Chambon, P. and
Dollé, P. (2000). Retinoic acid synthesis and
hindbrain patterning in the mouse embryo. Development
127, 75-85.[Abstract]
Nolte, C., Amores, A., Nagy, K. E., Postlethwait, J. and
Featherstone, M. (2003). The role of a retinoic acid response
element in establishing the anterior neural expression border of Hoxd4
transgenes. Mech. Dev.
120,325
-335.[CrossRef][Medline]
Nowicki, J. L. and Burke, A. C. (2000). Hox
genes and morphological identity: axial versus lateral patterning in the
vertebrate mesoderm. Development
127,4265
-4275.[Abstract]
Oosterveen, T., Niederreither, K., Dollé, P., Chambon,
P., Meijlink, F. and Deschamps, J. (2003). Retinoids regulate
the anterior expression boundaries of 5' Hoxb genes in posterior
hindbrain. EMBO J. 22,262
-269.[CrossRef][Medline]
Packer, A. I., Crotty, D. A., Elwell, V. A. and Wolgemuth, D.
J. (1998). Expression of the murine Hoxa4 gene requires both
autoregulation and a conserved retinoic acid response element.
Development 125,1991
-1998.[Abstract]
Perlmann, T. (2002). Retinoid metabolism: a
balancing act. Nat. Genet.
31, 7-8.[CrossRef][Medline]
Phelan, M. L., Rambaldi, I. and Featherstone, M. S.
(1995). Cooperative interactions between hox and pbx proteins
mediated by a conserved peptide motif. Mol. Cell Biol.
15,3989
-3997.[Abstract]
Pownall, M. E., Tucker, A. S., Slack, J. M. and Isaacs, H.
V. (1996). eFGF, Xcad3 and Hox genes form a molecular pathway
that establishes the anteroposterior axis in Xenopus.
Development 122,3881
-3892.[Abstract]
Prinos, P., Joseph, S., Oh, K., Meyer, B. I., Gruss, P. and
Lohnes, D. (2001). Multiple pathways governing Cdx1
expression during murine development. Dev. Biol.
239,257
-269.[CrossRef][Medline]
Ramirez-Solis, R., Zheng, H., Whiting, J., Krumlauf, R. and
Bradley, A. (1993). Hoxb-4 (Hox-2.6) mutant mice show
homeotic transformation of a cervical vertebra and defects in the closure of
the sternal rudiments. Cell
73,279
-294.[CrossRef][Medline]
Roelen, B. A., de, Graaff, W., Forlani, S. and Deschamps, J.
(2002). Hox cluster polarity in early transcriptional
availability: a high order regulatory level of clustered Hox genes in the
mouse. Mech. Dev. 119,81
-90.[CrossRef][Medline]
Rossant, J., Zirngibl, R., Cado, D., Shago, M. and Giguere,
V. (1991). Expression of a retinoic acid response
element-hsplacZ transgene defines specific domains of transcriptional activity
during mouse embryogenesis. Genes Dev.
5,1333
-1344.
Sakai, Y., Meno, C., Fujii, H., Nishino, J., Shiratori, H.,
Saijoh, Y., Rossant, J. and Hamada, H. (2001). The retinoic
acid-inactivating enzyme CYP26 is essential for establishing an uneven
distribution of retinoic acid along the anterio-posterior axis within the
mouse embryo. Genes Dev.
15,213
-225.
Sham, M. H., Hunt, P., Nonchev, S., Papalopulu, N., Graham, A.,
Boncinelli, E. and Krumlauf, R. (1992). Analysis of the
murine Hox-2.7 gene: conserved alternative transcripts with differential
distributions in the nervous system and the potential for shared regulatory
regions. EMBO J. 11,1825
-1836.[Medline]
Simeone, A., Acampora, D., Arcioni, L., Andrews, P. W.,
Boncinelli, E. and Mavilio, F. (1990). Sequential activation
of HOX2 homeobox genes by retinoic acid in human embryonal carcinoma cells.
Nature 346,763
-766.[CrossRef][Medline]
Subramanian, V., Meyer, B. I. and Gruss, P.
(1995). Disruption of the murine homeobox gene Cdx1 affects axial
skeletal identities by altering the mesodermal expression domains of Hox
genes. Cell 83,641
-653.[CrossRef][Medline]
Swindell, E. C., Thaller, C., Sockanathan, S., Petkovich, M.,
Jessell, T. M. and Eichele, G. (1999). Complementary domains
of retinoic acid production and degradation in the early chick embryo.
Dev. Biol. 216,282
-296.[CrossRef][Medline]
van den Akker, A. E., Forlani, S., Chawengsaksophak, K., de,
Graaff, W., Beck, F., Meyer, B. I. and Deschamps, J. (2002).
Cdx1 and Cdx2 have overlapping functions in anteroposterior patterning and
posterior axis elongation. Development
129,2181
-2193.
Wendling, O., Ghyselinck, N. B., Chambon, P. and Mark, M.
(2001). Roles of retinoic acid receptors in early embryonic
morphogenesis and hindbrain patterning. Development
128,2031
-2038.
Weston, A. D., Chandraratna, R. A. S., Torchia, J. and
Underhill, T. M. (2002). Requirement for RAR-mediated gene
repression in skeletal progenitor differentiation. J. Cell
Biol. 158,39
-51.
Wolgemuth, D. J., Viviano, C. M., Gizang-Ginsberg, E., Frohman,
M. A., Joyner, A. L. and Martin, G. R. (1987). Differential
expression of the mouse homeobox-containing gene Hox-1.4 during male germ cell
differentiation and embryonic development. Proc. Natl. Acad. Sci.
USA 84,5813
-5817.
Zhang, F., Popperl, H., Morrison, A., Kovacs, E. N., Prideaux,
V., Schwarz, L., Krumlauf, R., Rossant, J. and Featherstone, M. S.
(1997). Elements both 5' and 3' to the murine Hoxd4
gene establish anterior borders of expression in mesoderm and neurectoderm.
Mech. Dev. 67,49
-58.[CrossRef][Medline]
Zhang, F., Nagy, K. E. and Featherstone, M. S.
(2000). Murine hoxd4 expression in the CNS requires multiple
elements including a retinoic acid response element. Mech.
Dev. 96,79
-89.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
V. Ribes, I. Le Roux, M. Rhinn, B. Schuhbaur, and P. Dolle Early mouse caudal development relies on crosstalk between retinoic acid, Shh and Fgf signalling pathways Development, February 15, 2009; 136(4): 665 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Gaunt, D. Drage, and R. C. Trubshaw Increased Cdx protein dose effects upon axial patterning in transgenic lines of mice Development, August 1, 2008; 135(15): 2511 - 2520. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pilon, K. Oh, J.-R. Sylvestre, J. G. A. Savory, and D. Lohnes Wnt signaling is a key mediator of Cdx1 expression in vivo Development, June 15, 2007; 134(12): 2315 - 2323. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deschamps and J. van Nes Developmental regulation of the Hox genes during axial morphogenesis in the mouse Development, July 1, 2005; 132(13): 2931 - 2942. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Beland and D. Lohnes Chicken Ovalbumin Upstream Promoter-Transcription Factor Members Repress Retinoic Acid-induced Cdx1 Expression J. Biol. Chem., April 8, 2005; 280(14): 13858 - 13862. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tabaries, J. Lapointe, T. Besch, M. Carter, J. Woollard, C. K. Tuggle, and L. Jeannotte Cdx Protein Interaction with Hoxa5 Regulatory Sequences Contributes to Hoxa5 Regional Expression along the Axial Skeleton Mol. Cell. Biol., February 15, 2005; 25(4): 1389 - 1401. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||