|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online December 1, 2003
doi: 10.1242/10.1242/dev.00909
1 Department of Biology, University of Utah, Salt Lake City, Utah, 84112,
USA
2 Department of Biological Sciences, University of Alberta, Edmonton, AB, Canada
T6G 2E9
* Author for correspondence (e-mail: sieburth{at}biology.utah.edu)
Accepted 10 September 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Leaf Development, Vein Pattern, WD domain, Meristem, Arabidopsis thaliana
| Introduction |
|---|
|
|
|---|
Leaf primordia arise as radial pegs on the flank of the shoot apical
meristem (SAM), and become flattened early in development, indicating
acquisition of abaxial/adaxial polarity. These steps are rapidly followed by
the outgrowth of the leaf blade and differentiation of specialized cell types
(Pyke et al., 1991
;
Carland and McHale, 1996
;
Donnelly et al., 1999
;
Medford et al., 1992
).
Arabidopsis genes whose products are proposed to play a role in
polarity establishment have been identified based on mutant phenotypes
(McConnell and Barton, 1998
;
Kerstetter et al., 2001
;
Siegfried et al., 1999
;
Eshed et al., 2001
;
McConnell et al., 2001
). These
studies implicate separate sets of genes for specification of adaxial and
abaxial leaf domains.
The importance of abaxial/adaxial polarity for leaf architecture has been
revealed by both mutant phenotypes and ectopic expression of polarity genes.
Dominant phb mutants produce radialized leaves composed entirely of
adaxial tissue (McConnell and Barton,
1998
) and ectopic KANADI expression results in radialized
leaves composed entirely of abaxial tissues
(Kerstetter et al., 2001
;
Eshed et al., 2001
). The
defects in these radialized leaves include leaf morphology and specification
of epidermal and internal tissues. These and other studies have contributed to
a model for leaf blade outgrowth as a down-stream event following
juxtaposition of adaxial and abaxial cell types.
While lamina outgrowth appears to be initiated by acquisition of polarity,
the final shape of a leaf appears to be governed by a host of additional
factors. For example, leaf cell polar elongation contributes to leaf shape, as
cell elongation mutants produce leaves that are either narrower or shorter
than the wild type (Tsuge et al.,
1996
). This polar expansion and shape change appear to be related
to altered control of the cytoskeleton, as the leaf cell expansion mutant
an1 has defects in organization of cortical microtubules
(Kim et al., 2002
).
Over-expression of KNOX genes also leads to leaf shape defects,
presumably through altered regulation of GA biosynthesis
(Ori et al., 2000
;
Chuck et al., 1996
;
Byrne et al., 2000
;
Sakamoto et al., 2001
; Hay et
al., 2003).
The plant hormone auxin has also been implicated in leaf development. Auxin
is synthesized is apical portions of the plant, and actively transported
basipetally (reviewed by Muday and DeLong,
2001
). Arabidopsis mutants with defects in auxin
transport or auxin responses also produce leaves with altered morphology. For
example, the lop1 mutant produces small asymmetric leaves with
disrupted vascular development and it has reduced polar auxin transport
(Carland and McHale, 1996
).
Similarly, the pin1 mutant, which has a lesion in a putative auxin
efflux carrier, and the tir3 mutant, which has reduced auxin
transport, both produce leaves with morphological defects
(Okada et al., 1991
;
Ruegger et al., 1997
). Leaf
development is also perturbed by growing wild-type plants in the presence of
polar auxin transport inhibitors (Mattsson
et al., 1999
; Sieburth,
1999
). Furthermore, some auxin-resistant mutants, such as
axr1 and axr2-1, have disrupted auxin responses and also
produce misshapen leaves (Estelle and
Somerville, 1987
; Timpte et
al., 1994
). The combined altered leaf shape and perturbed auxin
processes in all these examples provides strong evidence that auxin plays a
role in leaf development. However, with the exception of lop1,
detailed anatomical characterization of the leaf developmental defects are
lacking.
Although the role of auxin in leaf morphogenesis is not understood, a large
body of work implicates polar transport of auxin as an inductive signal for
vein formation (reviewed by Sachs,
1981
; Aloni, 1987
).
In leaves, both auxin antibodies and the auxin responsive reporter gene DR5
show auxin to be largely localized in procambial cells (precursors to vascular
cell types) as leaf veins are formed
(Avsian-Ketchmer et al., 2002
;
Aloni et al., 2003
;
Mattsson et al., 2003
).
However, whether the varied leaf morphologies described for auxin-related
mutants is due to effects on vascular tissue or effects on other aspects of
leaf development is not known.
Here we describe varicose (vcs) mutants, which show pleiotropic temperature dependent developmental defects in leaves and the meristem. VCS encodes a putative WD domain protein, and each of the five vcs alleles we identified has a lesion expected to produce a null allele. The vcs leaf phenotype is enhanced under conditions in which auxin signaling is perturbed, but no defects in auxin signaling itself is detectable in vcs mutants. These observations led us to propose that VCS and a pathway perturbed by polar auxin transport inhibitors play partially redundant roles in leaf blade formation.
| Materials and methods |
|---|
|
|
|---|
We used web based resources to find a mutation in the VCR gene
(Salk_002338) (Alonso et al.,
2003
). For analyzing the axr1-3 vcs-1 double mutant,
control crosses (vcs x Col-0) were carried out and analyzed in
parallel. axr1-3 vcs-1 double mutants were obtained from the
self-pollinated (F3) progeny of auxin-resistant F2 plants.
Polar auxin transport inhibition experiments used growth medium supplemented with N-1-naphthylphthalamic acid (NPA, Chemserv) dissolved in dimethyl sulfoxide (Sigma), and DMSO-supplemented growth medium (GM) used as a control.
Root elongation assays
Wild type and vcs seeds were germinated on vertical hormone-free
GM for 5 (16°C) or 3 (29°C) days, then 11-20 seedlings of each
genotype per treatment were transferred to fresh GM supplemented with
indole-3-acetic acid (IAA; Sigma) (10-6 M to 10-12 M in
0.1x serial dilutions). We measured the root length after 3 days growth
at the same temperature. The dose of IAA that caused 50% inhibition of root
elongation (I50) was determined using linear
regression (Maher and Martindale,
1980
).
Molecular characterization
Mapping of VCS used 750 F2 plants from a cross of
vcs-1 heterozygotes to a plant of the Columbia ecotype. We isolated
DNA from homozygous mutant F2 plants
(Dellaporta et al., 1983
).
Polymorphic PCR-based markers were used to map recombination breakpoints
(Bell and Ecker, 1994
;
Konieczny and Ausubel, 1993
).
Markers included polymorphisms identified by CEREON
(Jander et al., 2002
), details
about primer sequences and polymorphisms are available upon request. Candidate
genes within the identified interval were amplified from DNA isolated from
each mutant allele, and the PCR products were sequenced using the University
of Utah sequencing facility. DNA sequences were assembled and analyzed using
JELLYFISH (LabVelocity, San Francisco). The homolog from humans has the
accession no. NP_055144, and that from Drosophila, accession no.
NP_609486.
The pVCS::GUS gene fusion was constructed using a 980 bp fragment
(extending between the 3'UTR of the upstream gene and the VCS
transcription start site), amplified using primers that introduced
HindIII and BamHI restriction sites (5':
CTGCAGGGATCCATCTCGCTCTCTCTGTTTCTTC and 5':
CACTGTAAGCTTAGATTTTTTGCAGATTTAAGATCG). This fragment was cloned into
pCambia1381z, and sequenced to identify clones containing no mutations. The
resulting plasmid was introduced into Agrobacterium tumifaciens
LBA4404. Wild-type Columbia and Landsberg erecta plants were
transformed by floral dip (Clough and
Bent, 1998
). GUS staining, driven by the VCS upstream
region (pVCS::GUS) was analyzed in 12 independent transformants, and compared
to seven independent transformants carrying the empty vector. Ten of the
twelve pVCS::GUS lines produced an identical expression pattern; six empty
vector controls gave no expression, and one gave faint staining in hydathodes
and the root apex.
RT-PCR
RT-PCR was carried out using the Promega Reverse Transcription System kit,
and oligo(dT) for first strand synthesis. Amplification used primers within
exon 6 (3980F: 5': GGTCCCGGTTTGTCATCTAC) and within exon 11 (5931R:
5':CTGTAGGGCCGAAGTGAAAG). Control reactions used primers for
tubulin as described by Semiarti et al.
(Semiarti et al., 2001
). RNA
was isolated from roots, hypocotyls, cotyledons and apex (leaves plus
meristem) of 8-day seedlings, 12-day whole seedlings and assorted siliques
from mature Ler plants (all grown at 22°C) using the RNeasy kit
from Qiagen.
Microscopy
Tissue for dark-field and DIC microscopy were fixed in a solution of
ethanol and acetic acid (3:1), and cleared in saturated chloral hydrate.
Tissue preparation for CLSM followed the method of Running
(Running, 2002
). Tissue for
SEM was prepared as described by Chen et al.
(Chen et al., 1999
). Leaf vein
development was assessed in chloral-hydrate-cleared first leaf pairs by visual
inspection using 200 and 400x DIC microscopy. We examined both leaves of
12-16 seedlings, per time point. Procambium was recognized as files of
elongated cells in positions expected for veins, and a vein counted as
differentiated if tracheary elements were present.
GUS staining
Tissue was fixed for 10 minutes in cold 90% acetone, and stained for 3-10
hours at 37°C in 2 mM 5-bromo-4-chloro-3-indoxyl-ß-D-glucuronide, 50
mM sodium phosphate, pH 7.0; 5 mM
K3/K4Fe(CN)6, 0.1% (w/v) Triton X-100.
Following staining, samples were rinsed in water for 1-3 hours, fixed
overnight in a 6:1 solution of ethanol:acetic acid, and cleared in saturated
chloral hydrate.
| Results |
|---|
|
|
|---|
|
|
|
|
|
VCS is required throughout leaf development
To determine when VCS was needed for normal leaf development, we carried
out temperature shift experiments. We reasoned that if VCS was only required
early, then shifting plants from low temperature to high temperature after
leaf initiation may allow production of the suppressed leaf phenotype.
Alternatively, if VCS was only required late, then shifting plants from high
to low temperature after leaf initiation may allow production of the
suppressed leaf phenotype. We germinated seedlings at 16°C (or 29°C),
shifted a subset to 29°C (or 16°C) daily, and examined all the plants
at day 14 (Fig. 5A).
vcs mutants were smaller and more chlorotic the longer they were held
at 29°C, regardless of whether the 29°C period was applied early or
late in development. These data indicate that the 16°C treatment was
required continuously for the suppressed phenotype.
|
|
Relationship between VCS and auxin signaling
Because the plant hormone auxin has been proposed to play roles in both
leaf development and vein patterning, we used several approaches to explore
the relationship between VCS and auxin signaling. First, we characterized
axr1-3 vcs-1 double mutants. AXR1 encodes a ubiquitin E3
ligase-like protein that is required for activation of the SCF
ubiquitin-protein ligase, which targets specific cellular proteins for
degradation (Leyser et al.,
1993
; del Poze and Estelle,
1999
; Gray et al.,
1999
; Gray et al.,
2001
). axr1 mutants show reduced auxin responses, altered
leaf shape, reduced apical dominance, and smaller hypocotyl vascular bundles
(Estelle and Somerville, 1987
;
Lincoln et al., 1990
). We
found that axr1-3 cotyledons contained reduced numbers of secondary
veins [1.45 complete areoles and 0.7 incomplete areoles per cotyledon
(n=67) in axr1-3 compared to 3.1 complete and 0.8 incomplete
areoles for Col-0 (n=45)], and that these cotyledon veins were often
aberrantly positioned (Fig.
7C). The axr1-3 leaf secondary veins were also reduced in
number, frequently failed to intersect along the leaf margin, and isolated
vascular islands were occasionally present
(Fig. 7D). Growth temperature
did not affect this vein pattern phenotype (data not shown).
|
To examine intracellular patterns of biologically active auxin, we
characterized DR5 expression in vcs mutants. DR5 contains synthetic
auxin response elements fused to the GUS reporter gene
(Ulmasov et al., 1997
).
Patterns of DR5 expression in developing Arabidopsis leaves have been
well characterized (Aloni et al.,
2003
; Mattsson et al.,
2003
). At early leaf developmental stages, DR5 expression occurs
in a spot at the distal end of the organ
(Fig. 8A). As leaf development
progresses, DR5 expression occurs within procambium and differentiating
vascular tissues (Fig. 8B-C)
(Aloni et al., 2003
;
Mattsson et al., 2003
). In
vcs mutants, DR5 expression was in similar positions as in wild type,
with the caveat that fewer procambial strands and veins were present
(Fig. 8D-F). At all stages of
leaf development, GUS staining intensity appeared modestly reduced, especially
at the hydathodes. Nevertheless, the similar patterns of DR5 expression in
vcs and wild type suggests that pathways for auxin expression and
movement within leaves is essentially intact.
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Does VCS encode a WD domain protein?
The VCS gene contained few sequence motifs that would suggest
possible biochemical functions, with the exception of the two well-conserved
WD repeats. WD repeats have been characterized structurally in the Gß
subunit of the trimeric G protein, where it assumes a seven-bladed propeller
structure (Wall et al., 1995
).
Studies have highlighted the importance of the WD domain for protein-protein
interactions, and the participation of these proteins in diverse processes
(such as transcriptional repression and vesicle trafficking) (reviewed by
Smith et al., 1999
;
Yu et al., 2000
). However,
theoretical calculations indicate that a minimum of four WD repeats are
required to achieve a stable propeller configuration
(Chothia et al., 1997
), yet
VCS contains only two robust WD repeats. Thus, if VCS does form a
propeller-like structure, it must do so either by recruiting non-canonical WD
repeats [such as has been suggested for TTG
(Walker et al., 1999
)] or
through formation of a multimeric complex.
In Arabidopsis, a large number of WD domain- containing genes have
been identified. For example, the Pleiotropic regulatory locus
1(PRL1) gene encodes a nuclear-localized WD domain protein and
prl1 mutants show pleiotropic phenotypes including defects in hormone
signaling (Németh et al.,
1998
). Because WD domain proteins often have multiple different
binding partners (e.g. van der Voorn and
Ploegh, 1992
; Holm et al.,
2001
) (reviewed by Smith et
al., 1999
), the pleiotropy of vcs (and prl1)
mutants might be explained if their WD domains mediate interactions with
multiple proteins and/or signaling pathways.
Temperature sensitivity of vcs alleles
Although the vcs phenotype was temperature dependent, four of the
five vcs alleles were the result of premature stop codons, and one
altered the 3' splice site in the first intron. This result was
surprising, as temperature sensitivity is most commonly associated with
missense mutations that decrease the protein's thermostability, and the
premature stop codons and splice site mutation we identified in the
vcs mutants are likely to result in hypomorphic or null alleles. One
explanation for vcs temperature sensitivity may be that there is a
more stringent requirement for VCS function at high temperatures. For example,
auxin levels are greater in plants grown at high temperature
(Gray et al., 1998
), and
vcs temperature sensitivity might be explained if VCS functioned in a
pathway that modified a response to elevated auxin levels. However,
vcs mutants have apparently normal auxin responses. Nevertheless, it
is possible that VCS functions in a different pathway that also has higher
signal output at higher temperatures.
Alternatively, vcs temperature sensitivity could arise from a molecule or pathway that provides a functionally redundant activity. If a functionally redundant molecule is either less efficient, or requires a physical interaction that is thermally unstable, then the overall result could be phenotypic rescue under specific circumstances only, such as low temperature. VCR shares 87% amino acid identity with VCS, and thus is an attractive candidate to explain vcs temperature sensitivity. Although vcr mutants produced no discernable phenotype, a role for VCR in vcs temperature sensitivity cannot be ruled out until VCR function is assessed in the absence of VCS activity.
VCS and leaf development
Temperature shift experiments indicated a requirement for VCS throughout
leaf development, however only a narrow developmental window allowed the
development of leaf secondary veins. While previous descriptive studies have
shown that secondary veins are normally established early during leaf
development (Pyke et al.,
1991
; Tefler and Poethig, 1994), our data indicate that the
secondary veins must be produced during this time period, as restoration of
permissive conditions at later time points did not allow for secondary vein
formation. These data might reflect a limited period of competence for leaf
cells to produce, perceive and/or respond to vein formation signals.
By examining vcs leaf defects across a spectrum of growth temperatures, we found that internal leaf blade tissues (vascular and non-vascular) showed the greatest sensitivity to the loss of VCS. This observation suggests a direct role for VCS in normal patterning of internal leaf tissues. Internal tissue defects include both gross-level organizational defects (e.g. the disruption of palisade parenchyma and vein pattern), and control over cell proliferation (e.g. the increased number of xylem tracheary element cell files in veins of vcs leaves). That defects extended to several tissue types could either mean that VCS functions to coordinate the development of these leaf tissues or that multiple independent pathways within the leaf require VCS. Future work to identify VCS binding partners should help to resolve this issue.
A severe loss of leaf blade was evident in vcs mutants grown in
the presence of polar auxin transport inhibitors. In addition, this treatment
reduced low-temperature suppression of the vcs phenotype. This
reduced low-temperature suppression suggests that polar auxin transport
inhibitors block an activity that provides functional redundancy with VCS.
Although the simplest interpretation of these observations is that the
partially redundant activity is polar auxin transport or a downstream pathway,
we also note that auxin polar transport inhibitors disrupt general vesicle
trafficking (Geldner et al.,
2001
). Thus, possible candidates for VCS redundancy remain
numerous.
Current models of leaf formation propose that outgrowth of the leaf blade and lamina formation result from earlier events specifying leaf polarity. Although it is tempting to speculate that VCS may play a direct roles in leaf margin outgrowth, it is also possible that VCS function is more closely related to tissue formation, coordination of cell proliferation, or acquisition of cell identities within the lamina.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Aloni, R. (1987). Differentiation of vascular tissues. Annu. Rev. Plant Physiol. 38,179 -204.[CrossRef]
Aloni, R., Schwalm, K., Langhans, M. and Ullrich, C. I. (2003). Gradual shifts in sites of free-auxin production during leaf-primordium development and their role in vascular differentiation and leaf morphogenesis in Arabidopsis. Planta 216,841 -853.[CrossRef][Medline]
Alonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J.,
Chen, H., Shinn, P., Stevenson, D. K., Zimmerman, J., Barajas, P., Cheuk, R.
et al. (2003). Genome-wide insertional mutagenesis of
Arabidopsis thaliana. Science
301,653
-657.
Avsian-Ketchmer, O., Cheng, J.-C., Chen, L., Moctezuma, E. and
Sung, Z. R. (2002). Indole acetic acid distribution coincides
with vascular differentiation pattern during arabidopsis leaf ontogeny.
Plant Physiol. 130,199
-209.
Bell, C. J. and Ecker, J. (1994). Assignment of 30 microsatellite loci to the linkage map of Arabidopsis. Genomics 19,137 -144.[CrossRef][Medline]
Byrne, M. E., Barley, R., Curtis, M., Arroyo, J. M., Dunham, M., Hudson, A. and Martienssen, R. A. (2000). Asymmetric leaves1 mediates leaf patterning and stem cell function in Arabidopsis. Nature 408,967 -971.[CrossRef][Medline]
Bryne, M. E., Simorowski, J. and Martienssen, R. A. (2002). ASYMMETRIC LEAVES1 reveals knox gene redundancy in Arabidopsis. Development 129,1957 -1965.
Carland, F. M. and McHale, N. A. (1996). LOP1: a gene involved in auxin transport and vascular patterning in Arabidopsis. Development 122,1811 -1819.[Abstract]
Chen, Q., Atkinson, A., Otsuga, D., Christensen, T., Reynolds, L. and Drews, G. N. (1999). The Arabidopsis FILAMENTOUS FLOWER gene is required for flower formation. Development 126,2715 -2726.[Abstract]
Chothia, C., Hubard, T., Brenner, S., Barns, H. and Murzin,
A. (1997). Protein folds in the all-ß and all-
classes. Annu. Rev. Biophys. Biomol. Struct.
26,597
-626.[CrossRef][Medline]
Chuck, G., Lincoln, C. and Hake, S. (1996). KNAT1 induces lobed leaves with ectopic meristems when overexpressed in Arabidopsis. Plant Cell 8,1277 -1289.[Abstract]
Clough, S. J. and Bent, A. (1998). Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,735 -743.[CrossRef][Medline]
del Pozo, J. C. and Estelle, M. (1999). The
Arabidopsis cullin AtCUL1 is modified by the ubiquitin-related
protein RUB1. Proc. Natl. Acad. Sci. USA
96,15342
-15347.
Dellaporta, S. L., Wood, J. and Hicks, J. B. (1983). A plant DNA minipreparation: version II. Plant Mol. Biol. Rep. 1,19 -21.
Deyholos, M. K., Cordner, G., Beebe, D. and Sieburth, L. E. (2000). The SCARFACE gene is required for cotyledon and leaf vein patterning. Development 127,3205 -3213.[Abstract]
Donnelly, P. M., Bonetta, D., Tsukaya, H., Dengler, R. E. and Dengler, N. G. (1999). Cell cycling and cell enlargement in developing leaves of Arabidopsis. Dev. Biol. 215,407 -419.[CrossRef][Medline]
Eshed, Y., Baum, S. F., Perea, J. V. and Bowman, J. L. (2001). Establishment of polarity in lateral organs of plants. Curr. Biol. 11,1251 -1260.[CrossRef][Medline]
Estelle, M. and Somerville, C. (1987). Auxin-resistant mutants of Arabidopsis thaliana with an altered morphology. Mol. Gen. Genet. 206,200 -206.[CrossRef]
Geldner, N., Friml, J., Stierhof, Y.-D., Jürgens, G. and Palme, K. (2001). Auxin transport inhibitors block PIN1 cycling and vesicle trafficking. Nature 413,425 -428.[CrossRef][Medline]
Gray, W. M., Ostin, A., Sandberg, G., Romano, C. P. and Estelle,
M. (1998). High temperature promotes auxin-mediated hypocotyl
elongation in Arabidopsis. Proc. Natl. Acad. Sci.
USA 95,7197
-7202.
Gray, W. M., del Pozo, J. C., Walker, L., Hobbie, L., Risseeuw,
E., Banks, T., Crosby, W. L., Yang, M., Ma, H. and Estelle, M.
(1999). Identification of an SCF ubiquitin-ligase complex
required for auxin response in Arabidopsis thaliana. Genes
Dev. 13,1678
-1691.
Gray, W. M., Kepinski, S., Rouse, D., Leyser, O. and Estelle, M. (2001). Auxin regulates SCFTIR1-dependent degradation of AUX/IAA proteins. Nature 414,271 -276.[CrossRef][Medline]
Hay, A., Kaur, H., Phillips, A., Hedden, P., Hake, S. and Tsiantis, M. (2002). The gibberellin pathway mediates KNOTTED1-type homeobox function in plants with different body plans. Curr. Biol. 12,1557 -1565.[CrossRef][Medline]
Holm, M., Hardtke, C. S., Gaudet, R. and Deng, X.-W. (2001). Identification of a structural motif that confers specific interaction with the WD40 repeat domain of Arabidopsis COP1. EMBO J. 20,118 -127.[CrossRef][Medline]
Jander, G., Norris, S. R., Rounsley, S. D., Bush, D. F., Levin,
I. M. and Last, R. L. (2002). Arabidopsis map-based cloning
in the post-genome era. Plant Physiol.
129,440
-450.
Kerstetter, R. A., Bollman, K., Taylor, R. A., Bomblies, K. and Poethig, R. S. (2001). KANADI regulates organ polarity in Arabidopsis. Nature 411,706 -709.[CrossRef][Medline]
Kim, G.-T., Shoda, K., Tsuge, T., Cho, K.-H., Uchimiya, H., Yokayama, R., Nishitani, K. and Tsukaya, H. (2002). The ANGUSTIFOLIA gene of Arabidopsis, a plant CtBP gene, regulates leaf-cell expansion, the arrangement of cortical microtubules in leaf cells and expression of a gene involved in cell-wall formation. EMBO J. 21,1267 -1279.[CrossRef][Medline]
Konieczny, A. and Ausubel, F. M. (1993). A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J. 4, 403-410.[CrossRef][Medline]
Leyser, H. M. O., Lincoln, C. A., Timpte, C., Lammer, D., Turner, J. and Estelle, M. (1993). Arabidopsis auxin-resistance gene AXR1 encodes a protein related to ubiquitin-activating enzyme E1. Nature 364,161 -164.[CrossRef][Medline]
Lincoln, C., Britton, J. H. and Estelle, M.
(1990). Growth and development of the axr1 mutants of
Arabidopsis. Plant Cell.
2,1071
-1081.
Maher, E. P. and Martindale, S. J. B. (1980). Mutants of Arabidopsis thaliana with altered responses to auxins and gravity. Biochem. Genet. 18,1041 -1053.[CrossRef][Medline]
Mattsson, J., Sung, Z. R. and Berleth, T. (1999). Responses of plant vascular systems to auxin transport inhibition. Development 126,2979 -2991.[Abstract]
Mattsson, J., Ckurshumova, W. and Berleth, T.
(2003). Auxin signaling in Arabidopsis leaf vascular development.
Plant Physiol. 131,1327
-1339.
McConnell, J. R. and Barton, M. K. (1998). Leaf polarity and meristem formation in Arabidopsis. Development 125,2935 -2942.[Abstract]
McConnell, J. R., Emery, J., Eshed, Y., Bao, N., Bowman, J. and Barton, M. K. (2001). Role of PHABULOSA and PHABOLUTA in determining radial patterning in shoots. Nature 411,709 -413.[CrossRef][Medline]
Medford, J. I., Behringer, F. J., Callos, J. D. and Feldmann, K.
A. (1992). Normal and abnormal development in the Arabidopsis
vegetative shoot apex. Plant Cell
4, 631-643.
Muday, G. K. and DeLong, A. (2001). Polar auxin transport: controlling where and how much. Trends Plant Sci. 6,535 -542.[CrossRef][Medline]
Németh, K., Salchert, K., Putnoky, P., Bhalerao, R.,
Koncz-Kálmán, Z., Stankovic-Stangeland, B., Bakó, L.,
Mathur, J., Okrész, L., Stabel, S., Geigenberger, P., Stitt, M.,
Rédei, G., Schell, J. and Koncz, C. (1998).
Pleiotropic control of glucose and hormone responses by PRL1, a nuclear WD
protein, in Arabidopsis. Genes Dev.
12,3059
-3073.
Okada, K., Ueda, J., Komaki, M., Bell, C. and Shimura, Y.
(1991). Requirement of the auxin polar transport system in early
stages of Arabidopsis bud formation. Plant Cell
3, 677-684.
Ori, N., Eshed, Y., Chuck, G. Bowman, J. L. and Hake, S. (2000). Mechanisms that control knox gene expression in the Arabidopsis shoot. Development 127,5523 -5532.[Abstract]
Pyke, K. A., Marrion, J. L. and Leech, R. M.
(1991). Temporal and spatial development of the cells of the
expanding first leaf of Arabidopsis thaliana (L.) Heynh.
J. Exp. Bot. 42,1407
.
Reed, R. C., Brady, S. R. and Muday, G. K.
(1998). Inhibition of auxin movement from the shoot into the root
inhibits lateral root development in Arabidopsis. Plant
Physiol. 118,1369
-1378.
Ruegger, M., Dewey, E., Hobbie, L., Brown, D., Bernasconni, P., Turner, J., Muday, G. and Estelle, M. (1997). Reduced naphthylphthalamic acid binding in the tir3 mutant of Arabidopsis is associated with a reduction in polar auxin transport and diverse morphological defects. Plant Cell 9,745 -757.[Abstract]
Running, M. P. (2002). Nuclear staining for confocal microscopy. In Arabidopsis-A Laboratory Manual (ed. D. Weigel and J. Glazebrook), pp.100 -103. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Sachs, T. (1981). The control of the patterned differentiation of vascular tissues. Ad. Bot. Res. 9, 151-262.
Sakamoto, T., Kamiya, N., Ueguchi-Tanaka, M., Iwahori, S. and
Matsuoka, M. (2001). KNOX homeodomain protein directly
suppresses the expression of a gibberellin biosynthetic gene in the tobacco
shoot apical meristem. Genes Dev.
15,581
-590.
Semiarti, E., Ueno, Y., Tsukaya, H., Iwakawa, H., Machida, C. and Machida, Y. (2001). The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana regulates formation of a symmetric lamina, establishment of venation and repression of meristem-related homeobox genes in leaves. Development 128,1771 -1783.[Abstract]
Sieburth, L. E. (1999). Auxin is required for
leaf vein pattern in Arabidopsis. Plant Physiol.
121,1179
-1190.
Siegfried, K. R., Eshed, Y., Baum, S. F., Otsuga, D., Drews, G. N. and Bowman, J. L. (1999). Members of the YABBY gene family specify abaxial cell fate in Arabidopsis. Development 126,4117 -4128.[Abstract]
Smith, T. F., Gaitatzes, C., Saxena, K. and Neer, E. J. (1999). The WD repeat: a common architecture for diverse functions. Trends Biochem. Sci. 24,181 -185.[CrossRef][Medline]
Telfer, A. and Poethig, R. S. (1994). Leaf Development. In Arabidopsis (ed. C. R. Somerville and E. Meyerowitz), pp. 379-403. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Timpte, C., Wilson, A. K. and Estelle, M. (1994). The axr2-1 mutation of Arabidopsis thaliana is a gain-of-function mutation that disrupts and early step in auxin response. Genetics 138,1239 -1249.[Abstract]
Tsuge, T., Tsukaya, H. and Uchimiya, H. (1996). Two independent and polarized processes of cell elongation regulate leaf blade expansion in Arabidopsis thaliana (L.) Heynh. Development 122,1589 -1600.[Abstract]
Ulmasov, T., Hagen, G. and Guilfoyle, T. J. (1997). Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9,1963 -1971.[Abstract]
van der Voorn, L. and Ploegh, H. L. (1992). The WD-40 repeat. FEBS Lett. 307,131 -134.[CrossRef][Medline]
Wall, M. A., Coleman, D. E., Lee, E., Iniguez-Lluhi, J. A., Posner, B. A., Gilman, A. G. and Sprang, S. R. (1995). The structure of the G protein heterotrimer Gi alpha 1 beta 1 gamma 2. Cell 38,1047 -1058.
Walker, A. R., Davison, P. A., Bolognesi-Winfield, A. C., James,
C. M., Srinivasan, N., Blundell, T. L., Esch, J. J., Marks, M. D. and Gray, J.
C. (1999). The TRANSPARENT TESTA GLABRA1 locus,
which regulates trichome differentiation and anthocyanin biosynthesis in
Arabidopsis, encodes a WD40 repeat protein. Plant Cell
11,1337
-1349.
Yu, L., Gaitatzes, C., Neer, E. and Smith, T. F. (2000). Thirty-plus functional families from a single motif. Protein Sci. 9,2470 -2476.[Abstract]
This article has been cited by other articles:
![]() |
R. F. Degenhardt and P. C. Bonham-Smith Arabidopsis Ribosomal Proteins RPL23aA and RPL23aB Are Differentially Targeted to the Nucleolus and Are Disparately Required for Normal Development Plant Physiology, May 1, 2008; 147(1): 128 - 142. [Abstract] [Full |