|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00225



1 Laboratory of Mammalian Genes and Development, National Institute of Child
Health and Human Development, National Institutes of Health, Bethesda,
Maryland 20892, USA
2 Department of Anatomy, University of Wisconsin-Madison Medical School,
Madison, WI 53706, USA
3 National Institutes of Allergy and Infectious Diseases, Rocky Mountain
Laboratories, Hamilton, Montana 59840, USA
Present address: Department of Obstetrics and Gynecology, Asahikawa Medical
College, Nishikagura 4-5-3-11, Asahikawa, Japan
Present address: CyThera Inc., 3550 General Atomics Court, San Diego, CA
92121, USA
Author for correspondence (e-mail:
hw{at}helix.nih.gov)
Accepted 18 October 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Ldb1, Wnt inhibitor(s), Otx2, Mouse, Anterior-posterior axis
| INTRODUCTION |
|---|
|
|
|---|
Genes homologous to Ldb1 have been found in organisms as diverse
as C. elegans and humans. While there are two distinct Ldb
gene family members in vertebrates and four in zebrafish, only one member has
been identified in C. elegans and D. melanogaster
(Cassata et al., 2000
). Gene
duplication events are thought to be responsible for the increase in the
number of both the transcription factors and interacting Ldb proteins during
the course of evolution (Meyer and
Schartl, 1999
).
LIM domains, cysteine-rich motifs that bind zinc and mediate
protein-protein interactions, are found in many proteins expressed in the
embryo (reviewed by Bach, 2000
;
Dawid et al., 1998
). The
biological consequences of disruption of LIM-HD transcription factors are
severe, demonstrating the importance of these genes in development (for
review, see Hobert and Westphal,
2000
). It is well established that LIM domains have a negative
regulatory effect on the function of LIM-homeodomain proteins
(German et al., 1992
;
Taira et al., 1994
;
Sanchez-Garcia and Rabbitts,
1994
). Embryo microinjection studies in Xenopus have
shown that interactions between LIM domains and Ldb1 help relieve the
inhibitory effect of the LIM domains
(Agulnick et al., 1996
). The
LIM-binding portion of Ldb1 has been localized to the carboxyl terminus, while
the amino-terminal region is involved in homodimer formation
(Breen et al., 1998
). The
later domain may also allow formation of heterodimers with Ldb2 (also called
NL2 or Clim-1), the second member of the vertebrate Ldb family
(Agulnick et al., 1996
;
Jurata et al., 1996
;
Bach et al., 1997
).
The ubiquitous expression pattern of Ldb1 during development and its
interaction with numerous transcriptional regulators
(Agulnick et al., 1996
;
Jurata et al., 1996
;
Bach et al., 1997
;
Jurata and Gill, 1997
;
Visvader et al., 1997
;
Wadman et al., 1997
;
Breen et al., 1998
;
Dawid et al., 1998
;
Jurata and Gill, 1998
) suggest
a critical function of the gene in a variety of developmental pathways. In
order to provide direct genetic evidence for the role of mammalian
Ldb1 in embryonic development, we have eliminated its function in
mice. Ldb1 null mutants show severe anterior-posterior patterning
defects that include anterior truncation, posterior duplication, and lack of
heart and foregut formation. Functional impediments of the organizer genes
Otx2, Lim1 (Lhx2), Dkk1, Hesx1 and
Hnf3ß during gastrulation may account for the anterior-posterior
axis patterning defect observed in the mutant at post-gastrulation stages of
development. Our results suggest that defects in the regulation of Wnt
pathways may be the underlying cause for the observed mutant phenotype.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Genotyping
For genotypic analysis of E7.5 to E8.5 embryos, whole embryos were digested
overnight upon completion of in situ analysis and photographing. The genotype
of the embryos was determined by polymerase chain reaction using the following
primers: Ldb1 wild-type allele primers
5'-CCATTGGCCGGACCCTGATACCA-3' and
5'-CTGGGTAAACATGGGTTTGCCGTGCA-3'; NEO primers
5'-CTTGGGTGGAGAGGCTATTC-3' and
5'AGGTGAGATGACAGGAGATC-3', which yielded bands of 175 and 280 bp,
respectively.
Detection of maternal Ldb1 mRNA in oocytes
Total RNA from unfertilized eggs was isolated using Picopure RNA isolation
kit from Arcturus (Cat. no. KIT0202). RNA quantification was performed using
RiboGreen RNA Quantification Reagent and a kit from Molecular Probes (Cat.
nos. R-11491 and R-11490). About 15 ng of RNA was used for RT-PCR analysis.
RT-PCR was performed using Smart Race cDNA Amplification kit from Clontech.
Ldb1 primers used for RT-PCR analyses were as follows. Left primer
5'-GACAATCTCTGGTGGATGCTTTCACAACT-3', right primer
5'-CATAAGTTCCTGCATGGCTCTAGTACTA-3'. Nucleotide sequences of the
control primer set: left primer 5'-GAACAAGTACCAGACTCTTGACAACTA-3',
right primer 5'- GTTTACAGATCTTGGACCAGAAGTGTCT 3'.
Histology and in situ hybridization
For histological analyses, embryos were fixed in 4% paraformaldehyde,
dehydrated, embedded in paraffin, sectioned at 5 µm and stained with
Hematoxylin and Eosin. In situ hybridization to whole embryos was performed as
described previously (Saga et al.,
1996
) using antisense riboprobes to Hesx1/Rpx
(Thomas and Beddington, 1996
;
Hermesz et al., 1996), Otx2
(Simeone et al., 1993
),
Brachyury (T) (Herrmann,
1992
), Six3 (Oliver
et al., 1995
), Hnf3ß
(Ang and Rossant, 1994
),
Dkk1 (Glinka et al.,
1998
), Wnt3 (Liu et
al., 1999
), Wnt3a
(Takada et al., 1994
),
Wnt8 (Bouillet et al.,
1996
), Frzb (Leyns et
al., 1997
; Hoang et al.,
1998
), Sfrp1 (Hoang
et al., 1998
), Sfrp2
(Leimeister et al., 1998
) and
Cer1 (Belo et al.,
1997
).
Scanning electron microscopy
Dissected embryos were placed into Teflon baskets (Ted Pella, Redding, CA)
and prepared for scanning electron microscopy by standard procedures. electron
micrographs were taken at 10 kV on a Hitachi S4500 scanning electron
microscope (Robards and Wilson,
1993
).
Detection of blood islands
Embryos were fixed in 4% paraformaldehyde and washed in PBS. Staining of
the blood islands was performed in a 0.1% benzidine solution dissolved in PBS
and 0.1% glacial acetic acid.
Detection of primordial germ cells
Embryos were fixed in 4% paraformaldehyde and washed in PBS, 70% ethanol
and H2O. Primordial germ cells were stained in 5% veronal buffer,
0.6% MgCl2, 0.1%
-naphtylphosphate and 0.5% Nuclear Fast
Red.
| RESULTS |
|---|
|
|
|---|
|
Ldb1 null mutant phenotype: defects in embryonic
development
Functional ablation of the Ldb1 gene led to a multitude of
developmental defects along the anterior-posterior axis of the early mouse
embryo. In comparison with wild-type (Fig.
2A), gastrulating mutant embryos showed a characteristic
constriction at the embryonic-extraembryonic junction
(Fig. 2B). The embryonic
portion is generally smaller than that in the wild type. Mutant phenotypes
were clearly visible at E8.5 and included anterior truncation, absence of
heart formation and loss of foregut indentation
(Fig. 2E, compared with the
controls shown in Fig. 2C,D).
En2 expression that marks the midbrain-hindbrain boundary of
wild-type embryos (Fig. 2F) is
absent in the mutant (Fig.
2G,H) suggesting a disruption in midbrain and anterior hindbrain
development. Also, the region of expression of Krox20, a hindbrain
marker that marks rhombomeres r3 and r5 in the control
(Fig. 2I), is abnomal in
Ldb1 mutant embryos (Fig.
2J). The pattern of head truncation in Ldb1 mutant
embryos was similar to that seen in the most severely affected Otx2
mutants (Acampora et al., 1995
;
Ang et al., 1996
). However, in
contrast to Otx2 mutants, the anterior region terminated in a
convoluted neural plate structure implying a defect in the regional expansion
of the neuroepithelium (Fig.
2L). Ldb1 mutants lack all rostral structures anterior of
the otic vescicle (Fig. 2L).
Columns of somites were often fused medially. Defective longitudinal extension
of the neuroepithelium is the likely cause of the kinky and compressed shape
of the neural tubes in the mutant embryos. Histological sections of E8.5
mutants at the trunk level show two neural grooves that are connected by a
single neuroepithelial layer (Fig.
2M). A similar phenotype has previously been observed in
Lim1 mutants (Shawlot and
Behringer, 1995
). Moreover, trunk duplication was observed
visually in approximately 40% (24/56) of mutant embryos. Light and scanning
electron microscopy revealed the presence of multiple rows of somites
(Fig. 2N,O). The partial
duplication of the Krox2 signal
(Fig. 2J) suggests that
posterior axis duplication extends to the rostral limit of mutant embryos.
Although Ldb1 mutant embryos survived through stage E9.5, further
development appeared to be arrested at E8.5. This may be a consequence of an
extensive apoptotic cell death that occurs in the mesenchymal tissue of E8.5
mutant embryos (Fig. 2P,Q),
thereby disrupting further tissue differentiation.
|
Ldb1 null mutant phenotype: defects in extraembryonic
tissues
Defects in the development of extraembryonic tissues became apparent in
Ldb1 null mutant embryos as they approached the neural-fold stage
(E8.5). The yolk sac failed to expand around the fetus and a large portion of
the anterior part of the embryo developed outside the yolk sac
(Fig. 2O). The development of
blood islands and primordial germ cells (PGCs) were also defective in the
mutant yolk sac. Benzidine, specific for hemoglobinized erythroid cells, aided
in the identification of vitelline blood vessels. In contrast to wild-type
(Fig. 3A), mutant embryos
lacked any sign of hematopoietic development
(Fig. 3B). Identification of
PGCs was based on their high alkaline phosphatase activity; these were well
developed in the wild-type embryo at E7.5
(Fig. 3C) (see also magnified
cells in the inset). However, cells showing this staining were either absent
(Fig. 3D) or greatly reduced in
Ldb1-/- mutants. Another mesoderm-derived structure, the
allantois, was also defective and in a few instances entirely absent. Where
present, the allantois had become largely detached from the wall of the
exocoelomic cavity and was posteriorly displaced by E7.75 (compare
Fig. 3E and F). In addition, it
appeared to have lost contact with the amnion
(Fig. 3F). By E8.5 the tissue
had grown towards the chorion but failed to make contact with it.
|
Molecular analyses of the heart phenotype
The heart phenotype of embryos lacking Ldb1 gene function was
characterized with the help of marker analyses performed at critical stages of
heart development. Prospective cardiac mesodermal cells invaginate through the
primitive streak and migrate and spread out together with cranial mesoderm.
Subsequently the bilaterally symmetric cardiac precursors migrate and converge
at the midline of the embryo to form the cardiac crescent. Nkx2.5, a
homeobox gene, is expressed in the cardiogenic precursor cells that form the
cardiac crescent at the headfold stage
(Lints et al., 1993
). A marked
reduction in Nkx2.5 expression pattern was observed in
Ldb1-/- embryos suggesting that the mutant embryos fail to
develop a proper cardiac crescent (compare
Fig. 4A and B). Heart
progenitor cells can be recognized as early as E6.5-7.0 by virtue of
expression of the bHLH transcription factor gene Mesp1 in the early
ingressing part of the mesoderm (Saga et
al., 1996
; Saga et al.,
1999
). Mesp1-expressing nascent mesoderm is fated to
become extraembryonic and cranial-cardiac tissue. These cells cease to express
Mesp1 at subsequent stages of gastrulation. However, fate-mapping
experiments show migration of the most anterior mesodermal cells expressing
Mesp1 to the heart field (Saga et
al., 1999
). The Mesp1 mRNA is the earliest molecular
marker for heart precursor cells known to date. At E7.0, expression of
Mesp1 in Ldb1 null mutant embryos typically assumes an
abnormal `inverted V' shaped pattern, and the migration of the
Mesp1-expressing mesodermal cells appears to be restricted to two
lateral paths in proximal regions of the embryo (compare
Fig. 4C and D). The proximal
location of the Mesp1-expressing cells may suggest that the mutant
embryos lack heart and craniofacial mesoderm that are derived from the distal
part of the primitive streak and migrate along a anterior-distal path. This
defect in the generation and/or migration of the Mesp1-expressing
heart progenitor cells may also account for the reduction in Nkx2.5
expression in the anterior cardiac field at E7.75 (not shown). Our marker
analyses thus suggest that the heart phenotype in the Ldb1 null
mutant is an early developmental defect affecting the generation and/or
migration of the earliest recognizable heart precursor cells.
|
Molecular analyses of the anterior-posterior axis phenotype
We used an extensive array of markers to analyze defects in
anterior-posterior axis formation in Ldb1 null mutant embryos. The
posterior axis duplication observed in Ldb1 null mutant embryos was
closely examined using Brachyury (T) as a molecular marker.
In wild-type embryos, T expression was seen in the primitive streak
throughout gastrulation (Fig.
5A), and in the streak and notochord at post-gastrulation stage
E8.5 (Fig. 5D). In gastrulating
mutant embryos, defects in streak formation were not always obvious
(Fig. 5B). However, the twisted
streak seen in some of these mutants suggested to us the presence of two
overlapping primitive streaks (Fig.
5C). Indeed, we often observed T expression in duplicated
primitive streak and notochord formations of E8.5 mutant embryos
(Figs 5E,F). In spite of this
obvious defect, the anterior extension of the primitive streak appears to be
normal. This is not the case in other headless mutant embryos, including
Lim1, Otx2 and Hnf3ß
(Kinder et al., 2001
).
|
Head induction from the presumptive anterior neuroectoderm (ANE) requires Otx2 gene function in the anterior visceral endoderm (AVE) prior to gastrulation and in the node-derived anterior mesendoderm (AME). We have detected a reduction in the field of Otx2 expression in E7.75 Ldb1 null mutant embryos (Fig. 5G,H). Interestingly, this phenotype is accompanied by a loss or reduction in the expression of Dkk1. This, in turn, results in a failure of Hesx1 to be induced in the prospective ANE (Fig. 5Q,R). Given the established role of Otx2 in head development and the fact that both Dkk1 and Hesx1 act downstream of Otx2, our data suggest that a disruption in an Otx2-mediated pathway may be the underlying cause for the head phenotype observed in Ldb1 null mutant embryos.
Hnf3ß is a marker for the node and its expression extends
anteriorly to the migrating axial mesendoderm that includes the AME cells.
Hnf3ß expression in the mutant was duplicated and failed to
extend to the anterior-most aspect of the mutant embryos
(Fig. 5K,L). It is likely that
the duplicated expression patterns may have developed from duplicated nodes.
This is supported by our Lim1/Lhx1 expression analysis that shows two
distinct nodes in the mutant (compare Fig.
5M and N). Note that the probe used in this study confirms the
published Lim1/Lhx1 expression pattern in wild-type embryos
(Tsang et al., 2000
). However,
a small segment of the probe overlaps with the sequence of the closely related
Lim5/Lhx5 gene. Therefore we cannot exclude the possibility that the
expression pattern detected with this probe may correspond to Lhx5.
Nonetheless, our in situ analysis clearly reveals the presence of two nodes in
Ldb1 mutant embryos.
Taken together our results suggest that the anterior truncation of Ldb1 null mutant embryos is the consequence of a disruption of Otx2 gene function in the head organizer tissue while the posterior axis duplication phenotype is the outcome of an early node partitioning event.
Molecular mechanism of Ldb1 gene function
Wnt pathways play an essential role in anterior-posterior axis patterning
(McMahon and Moon, 1989
;
Popperl et al., 1997
; Zheng et
al., 1997; Liu et al., 1999
).
Anterior truncation and posterior duplication of the Ldb1 null mutant
axis are reminiscent of phenotypes resulting from overactivation of Wnt
pathways (Pöpperl et al.,
1997
; Borello et al.,
1999
). We therefore examined the potential role of Ldb1
in regulating Wnt. Wnt overactivation can be achieved either through
upregulation of Wnt functions or downregulation of Wnt inhibitors. We
focused our attention on those Wnt genes and inhibitors that are
expressed in the early embryo and may play crucial roles in development of
structures along the anterior-posterior axis. Our analysis of
Ldb1-/- embryos failed to detect an increase in
steady-state levels of Wnt3, Wnt3a or Wnt8 transcripts (data
not shown). The Wnt inhibitor genes that are expressed during
gastrulation include Dkk1 (Glinka
et al., 1998
), Cerberus-like (Cer1)
(Belo et al., 1997
) and the
three secreted Frizzled-related genes Sfrp1 (Hogan et al., 1998),
Sfrp2 (Leimeister et al.,
1998
), and Frzb/Sfrp3
(Hoang et al., 1998
). At E7.5,
Frzb/Sfrp3 expression is seen in the primitive streak and prospective
cardiac mesoderm of wild-type embryos (Fig.
6A) (Hoang et al.,
1998
). At this stage Sfrp1 expression is found in the
ectodermal tissue located anterior to the migrating head process
(Fig. 6C)
(Hoang et al., 1998
). By
contrast, the expression domain of Sfrp2 is much broader,
encompassing medial and distal embryonic tissues
(Fig. 6E)
(Leimeister et al., 1998
). At
late streak stages, Cer1 expression is seen in the AVE, axial
mesoderm and in definitive endodermal cells of wild-type embryos
(Fig. 6G) (Belo et al., 1997
). Our
analysis showed that expression of all five Wnt inhibitor genes
tested is compromised in the mutants (Fig.
6B,D,F,H,I). While steady-state transcript levels of all Wnt
inhibitors tested were reduced when compared to those of controls, the degree
of reduction varied between individual mutants, as exemplified in
Fig. 6I. Since Wnt proteins are
known to act as posteriorizing agents (reviewed by
Niehrs, 1999
), the apparent
downregulation of Wnt inhibitors suggests the possibility that the headless
phenotype of the Ldb1 null mutants may result from overactivation of
Wnt pathways along the anterior-posterior axis.
|
Detection of maternally deposited Ldb1 mRNA in the wild-type
oocyte
The Drosophila Ldb1 homolog Chip is not only expressed
zygotically but is also provided maternally
(Morcillo et al., 1997
).
Maternal Chip mRNA is required for embryonic development before the
onset of zygotic expression. Embryos lacking maternal mRNA are unable to form
segments and die early in embryonic development while embryos lacking zygotic
Chip are able to form segments. These embryos hatch but die as larvae
(Morcillo et al., 1996
). We
have considered the analogous possibility that maternal Ldb1 mRNA may
play a role in early mouse development. Our RT-PCR analyses of RNA samples
extracted from eggs or zygotes before the onset of zygotic expression clearly
showed deposition of maternal Ldb1 mRNA in early mouse embryos
(Fig. 7). Although we were
unable to detect the presence of maternal Ldb1 mRNA in E7.5 mutant
embryos, the possibility remains that protein translated from maternally
deposited mRNA may support early stages of development in the zygotic null
mutants. Alternatively, or in addition, partial functional redundancy may
exist between Ldb1 and Ldb2, the second member of the
Ldb family (Agulnick et al.,
1996
; Jurata et al.,
1996
; Bach et al.,
1997
). It is possible that variables such as these may underlie
the incomplete penetrance of phenotypes such as posterior axis
duplication.
|
| DISCUSSION |
|---|
|
|
|---|
Ablation of Ldb1 causes posterior axis duplication
The axis duplication that we observed in a majority of Ldb1 null
mutant embryos is reminiscent of a similar phenotype observed in embryos that
carry homozygous mutations at the fused locus
(Gluecksohn-Schoenheimer,
1949
; Perry et al.,
1995
). Axis duplication was also observed in Lim1/Lhx1
null mutant embryos. Here, as in our case, the duplication affected only the
posterior region, resulting in a Y-shaped structure fused at the truncated
anterior end (Shawlot and Behringer,
1995
). Posterior axis duplication can be induced by grafting node
tissue to a posterior-lateral position in the gastrulating mouse embryo
(Beddington, 1994
). Using the
node marker Hnf3ß and Lim1/Lhx1
(Ang and Rossant, 1994
), we
were able to determine that abnormal generation of a duplicated node
structures is the underlying cause for posterior axis duplication in the
Ldb1 mutant. The fact that functional ablation of either
Ldb1 or Lim1/Lhx1 causes anterior truncation and can also
induce partial posterior axis duplication may be taken as a genetic indication
that an interaction of these two factors is essential for proper
anterior-posterior axis development, from head to tail.
Furthermore, we noted that expression of several Wnt inhibitors is
downregulated in Ldb1 mutant embryos. It is important to note that
the function of Cer1 (Belo et al.,
2000
), and possibly that of other Wnt inhibitors as well, is
dispensable during mouse embryonic development, suggesting that functional
redundancy may exist. The severe phenotypic abnormalities observed in
Ldb1 null mutant embryos may reflect the simultaneous functional
obstruction of several Wnt inhibitors.
A number of recent studies have revealed a role of Wnt pathways in
anterior-posterior axis formation (reviewed by
Yamaguchi, 2001
). Frequent
posterior axis duplication is seen in transgenic mice over-expressing chicken
Wnt8c (Pöpperl et al.,
1997
). Wnt3 has been implicated in anterior-posterior
axis formation because null mutant embryos lack the primitive streak and do
not form mesoderm and definitive endoderm
(Liu et al., 1999
).
Loss-of-function analysis of Dkk1 demonstrated that this Wnt
inhibitor is required for rostral development
(Mukhopadhyay et al., 2001
).
Over-expression of the Wnt inhibitor Frzb during early mouse
development leads to reduction in the size of caudal structures (Borello,
1999). Furthermore, Frzb interferes with the ability of
Xwnt8 to induce double axes in Xenopus
(Leyns et al., 1997
;
Wang et al., 1997
). Whether
proper regulation of Wnt inhibitors by Ldb1 (in conjunction with interacting
LIM-homeodomain factors) is a prerequisite for regulation of Wnt pathways
during anterior-posterior axis development remains to be determined.
Ldb1 plays a critical role in heart formation
In Ldb1 null mutant embryos heart development is compromised at
early stages of development. Our data suggest that the Ldb1 gene
function is essential for proper allocation of the Mesp1-expressing
cardiac mesoderm to the heart field. In the chick, heart mesoderm is induced
by the signals from the anterior endoderm. The heart precursor cells are in
contact with presumptive anterior endoderm throughout their migration from the
streak into the lateral plate
(Garcia-Martinez and Schoenwolf,
1993
). Abnormal migration of the heart mesoderm to a
lateral-proximal region of the mutant embryo may therefore abolish inductive
interaction of this tissue with anterior endoderm.
BMP signaling is known to be essential, but not sufficient, for heart
formation (Schultheiss et al.,
1997
; Andree et al.,
1998
). Presently additional factors are being examined in the
chick embryo. One of these is Crescent, a Frizzled-related protein that
inhibits Wnt8c and is expressed in the anterior endoderm during gastrulation.
Ectopic expression of Crescent in the posterior lateral plate
mesoderm leads to development of ectopic heart tissue with beating
cardiomyocytes. The Wnt inhibitor Dkk1 similarly induces heart-specific gene
expression from anterior mesoderm when ectopically expressed. Furthermore,
ectopic Wnt signals can repress heart formation from anterior mesoderm in
vitro and in vivo. These results led to the conclusion that inhibition of Wnt
signaling is required for heart development in the chick
(Marvin et al., 2001
).
Similarly, Wnt antagonism initiates cardiogenesis in Xenopus
(Schneider and Mercola, 2001
).
While this may also hold true for the mouse, there are presently no data that
would support this notion. A vertebrate homolog of Crescent has not
yet been identified. Furthermore, disruption of mouse Dkk1 gene
function does not lead to a disruption of heart development
(Mukhopadhyay et al., 2001
).
It is, of course, entirely possible that mammalian heart development requires
the activity of more than one Wnt inhibitor and that the loss of Dkk1
gene function may be compensated by the activity of other Wnt inhibitors that
remain to be identified. Finally, it is interesting to note that members of
the GATA family of zinc finger transcription factors are required for mouse
heart formation (Molkentin et al.,
1997
). GATA proteins have been detected in nuclear complexes that
also contain Ldb1 (Wadman et al.,
1997
), in keeping with the possibility that a physical interaction
of Ldb1 with GATA peptides may take place during heart development.
Lack of Ldb1 gene function leads to defects in the
development of extraembryonic structures derived from mesoderm
Malformations of the yolk sac, amnion, primordial germ cells (PGCs) and
allantois of the Ldb1 null mutant conceptus point to severe defects
in posterior mesoderm formation. In general these phenotypes may reflect a
defect in mesodermal cell migration even though primitive streak extension
appears normal in the mutant.
The yolk sac plays a pivotal role in the delivery of nutrients to the
embryo prior to fusion of the allantois to the chorion at E9.5 (Cross, 1994),
and disruption of yolk sac function causes embryonic lethality (Bielinska,
1999). In our mutants, the yolk sack failed to surround the entire embryo.
This is reminiscent of malformations seen in the naturally occurring
kinky mutant
(Gluecksohn-Schoenheimer,
1949
), and in Hnf3ß (Foxa2)
(Ang et al., 1996
) and
Gata4 (Molkentin, 1997) null mutants. However, the yolk sac phenotype
of the Ldb1 null mutant is distinct from these because the posterior
part of the embryo develops within the yolk sac whereas the anterior region
does not.
Within the Ldb1 null mutant yolk sack, the development of blood
islands is compromised. In the wild-type controls, blood islands appear at
E7.5 in the extraembryonic mesoderm of the yolk sac. They represent areas of
primitive hematopoiesis and vasculogenesis that develop into a vascular
network by E8.5. Defects of early hematopoiesis and the development of blood
islands have also been observed in Bmp4 null mutants that, like our
Ldb1 null mutants, are characterized by defective mesodermal
differentiation (Winnier, 1995). Ldb1 can form a transcriptional complex with
Lmo2, Tal1, Gata1 and E47. Functional ablation of the first three of these
four proteins by targeted gene disruption results in severe defects in
hematopoiesis (Wadman et al.,
1997
). The absence of blood islands in the
Ldb1-/- mutant may thus be explained by assigning
Ldb1 an essential role as a co-factor in early transcriptional events
that initiate yolk sac hematopoiesis.
Also compromised in the Ldb1 null mutant yolk sac is the formation
of the primordial germ cells (PGCs). These cells are characterized by a high
alkaline phosphatase activity and can be visualized starting around E7.25 in
the mesodermal part of the yolk sac at the base of the allantois, posterior to
the primitive streak (Chiquoine,
1954
; Lawson and Hage,
1994
). Shortly thereafter, they follow a migration path along the
hindgut endoderm and hindgut mesentery to the urogenital ridge where the gonad
forms. Cell transplantation studies have suggested that PGC development
requires a distinct micro-environment in the proximal epiblast
(Tam and Zhou, 1996
). Bmp4
(Lawson, 1999), Bmp8b (Ying, 2000), Hnf3ß and Lim1/Lhx1 (Tsang, 2001)
appear to be essential functional components of this environment, as their
loss results in defects of PGC formation. Since Ldb1 is a known co-factor of
Lim1/Lhx1 activity and PGC development is similarly compromised in
Ldb1 and in Lim1/Lhx1 null mutants (Tsang, 2001), impairment
of Lim1/Lhx1 activity is a likely cause of the PGC phenotype. In
addition, Ldb1 activity may be required for the proper temporal and
spatial expression of some or all of the other aforementioned factors known to
play a role in PGC development. This is suggested by the fact that
Bmp4 and Hnf3ß were mis-expressed in the Ldb1
null mutant (data not shown).
A further defect in the development of extraembryonic tissues was seen in
the allantois of the Ldb1 null mutant conceptus. The wild-type
allantois is derived from posterior streak mesoderm and extends into the
exo-coelomic cavity. Loss-of-function studies have implicated a number of
genes in this process, including Brachyury (T)
(Chesley, 1935
),
Hnf3ß (Ang et al.,
1994
), VCAM-1
(Gurtner et al., 1995
),
Otx2 (Ang et al.,
1996
), Bmp4 (Lawson, 1999) and Lim1/Lhx1 (Tsang,
2001). The Ldb1 null mutants form an extra-coelomic cavity,
indicating that posterior mesoderm has reached the correct extraembryonic
location and has lined the exocoelom. However, after this initial step, growth
of the allantois is arrested and fusion with the chorion does not occur.
We observed a marked constriction between the embryonic and extraembryonic
portions of the E6.5-E7.5 Ldb1 null mutant. Similar constrictions
have been observed in mutants that are homozygous for deletions in
Hnf3ß (Ang and Rossant,
1994
; Weinstein et al.,
1994
), Lhx1/lim1
(Shawlot and Behringer, 1995
;
Shawlot et al., 1999
),
Otx2 (Ang et al.,
1996
) and Nodal
(Varlet et al., 1997
). During
subsequent development, deficiencies in rostral structures are noted in all of
these mutants. The constriction has been viewed as an indication of defective
cell movement during gastrulation (Foley
and Stern, 2001
). Alternatively, it may reflect a failure of
visceral endoderm to proliferate or to confer proper morphogenetic signals to
the underlying embryonic ectoderm (Dufort
et al., 1998
). In the Ldb1 null mutant, the amnion fails
to extend normally. As the volume of the epiblast and that of the exocoelomic
cavity increase rapidly after E6.5, a foreshortening of the amnion between
these two regions of the conceptus may prevent lateral outgrowth in the
mid-region, resulting in the observed constriction. Nonetheless, the embryonic
and extraembryonic portions of the Ldb1-/- mutants are
separated by the amnion, indicating that the initial formation of the
posterior amniotic fold and the subsequent closure of the pro-amniotic canal
occur properly. Around E7.25, coinciding with the malformation of the
allantois and the PGCs, the expansion of the amnion becomes defective. The
amnion consists of two layers, the amniotic mesoderm and the amniotic
ectoderm. Our findings suggest that the failure of the amnion to extend
appropriately is due to a defect in the ectodermal layer of the amnion
(Fig. 3F), because the amniotic
mesoderm forms pockets near the anterior and posterior end of the amniotic
layer, while the ectoderm fails to expand properly. This indicates that there
is an excess of tissue in the mesodermal layer relative to the ectodermal
layer, making it unlikely that the mesodermal layer is primarily responsible
for the constriction. However, as the allantois and PGCs are defective in the
Ldb1 mutant, the development of the amniotic mesoderm, which is also
derived from the posterior primitive streak, may nonetheless be defective as
well.
Conclusion
Loss of zygotic Ldb1 function results in a multi-faceted phenotype
that reveals a requirement of Ldb1 during early post-implantation
development of the mouse embryo, including formation of the anterior-posterior
axis, the anlage of the heart and the elaboration of major mesoderm-derived
extra-embryonic structures. The mutant phenotype very likely reflects the
malfunction of a diverse array of transcription factors whose action depends
on a functional Ldb1 co-factor. This, in turn, may affect major signaling
events, including those mediated by the canonical Wnt pathway.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Acampora, D., Mazan, S., Lallemand, Y., Avantaggiato, V., Maury, M., Simeone, A. and Brulet, P. (1995). Forebrain and midbrain regions are deleted in Otx2-/- mutants due to a defective anterior neuroectoderm specification during gastrulation. Development 121,3279 -3290.[Abstract]
Acampora, D., Avantaggiato, V., Tuorto, F., Briata, P., Corte, G. and Simeone, A. (1998). Visceral endoderm-restricted translation of Otx1 mediates recovery of Otx2 requirements for specification of anterior neural plate and normal gastrulation. Development 125,5091 -5104.[Abstract]
Agulnick, A. D., Taira, M., Breen, J. J., Tanaka, T., Dawid, I. B. and Westphal, H. (1996). Interactions of the LIM-domain-binding factor Ldb1 with LIM homeodomain proteins. Nature 384,270 -272.[CrossRef][Medline]
Andree, B., Duprez, D., Vorbusch, B., Arnold, H. H. and Brand, T. (1998). BMP-2 induces ectopic expression of cardiac lineage markers and interferes with somite formation in chicken embryos. Mech. Dev. 70,119 -131.[CrossRef][Medline]
Ang, S. L., Conlon, R. A., Jin, O. and Rossant, J. (1994). Positive and negative signals from mesoderm regulate the expression of mouse Otx2 in ectoderm explants. Development 120,2979 -2989.[Abstract]
Ang, S. L. and Rossant, J. (1994). HNF-3 beta is essential for node and notochord formation in mouse development. Cell 78,561 -574.[CrossRef][Medline]
Ang, S. L., Jin, O., Rhinn, M., Daigle, N., Stevenson, L. and Rossant, J. (1996). A targeted mouse Otx2 mutation leads to severe defects in gastrulation and formation of axial mesoderm and to deletion of rostral brain. Development 122,243 -252.[Abstract]
Bach, I., Carriere, C., Ostendorff, H. P., Andersen, B. and
Rosenfeld, M. G. (1997). A family of LIM domain-associated
cofactors confer transcriptional synergism between LIM and Otx homeodomain
proteins. Genes Dev. 11,1370
-1380.
Bach, L. (2000). The LIM domain: regulation by association. Mech. Dev. 91, 5-17.[CrossRef][Medline]
Beddington, R. S. P. (1994). Induction of a second neural axis by the mouse node. Development 120,613 -620.[Abstract]
Beddington, R. S. P. and Robertson, E. J. (1998). Anterior patterning in mouse. Trends Genet. 14,277 -284.[CrossRef][Medline]
Belo, J. A., Bouwmeester, T., Leyns, L., Kertesz, N., Gallo, M., Follettie, M. and De Robertis, E. M. (1997). Cerberus-like is a secreted factor with neutralizing activity expressed in the anterior primitive endoderm of the mouse gastrula. Mech. Dev. 68, 45-57.[CrossRef][Medline]
Belo, J. A., Bachiller, D., Agius, E., Kemp, C., Borges, A. C., Marques, S., Piccolo, S. and DeRobertis, E. M. (2000). Cerberus-like is a secreted BMP and nodal antagonist not essential for mouse development. Genesis 26,265 -270.[CrossRef][Medline]
Bielinska, M., Narita, N. and Wilson, D. B. (1999). Distinct roles for visceral endoderm during embryonic mouse development. Int. J. Dev. Biol. 43,183 -205.[Medline]
Borello, U., Coletta, M., Tajbakhsh, S., Leyns, L., De Robertis, E. M., Buckingham, M. and Cossu, G. (1999). Transplacental delivery of the Wnt antagonist Frzb1 inhibits development of caudal paraxial mesoderm and skeletal myogenesis in mouse embryos. Development 126,4247 -4255.[Abstract]
Bouillet, P., Oulad-Abdelghani, M., Ward, S. J., Bronner, S., Chambon, P. and Dolle, P. (1996). A new mouse member of the Wnt gene family, mWnt-8, is expressed during early embryogenesis and is ectopically induced by retinoic acid. Mech. Development 58,141 -152.
Breen, J. J., Agulnick, A. D., Westphal, H. and Dawid, I. B.
(1998). Interactions between LIM domains and the LIM
domain-binding protein Ldb1. J. Biol. Chem.
273,4712
-4717.
Cassata, G., Rohrig, S., Kuhn, F., Hauri, H. P., Baumeister, R. and Burglin, T. R. (2000). The Caenorhabditis elegans Ldb/NLI/Clim orthologue Ldb-1 is required for neuronal function. Dev. Biol. 226,45 -56.[CrossRef][Medline]
Chesley, P. (1935). Development of the short-tailed mutant in the house mouse. J. Exp. Zool. 70,429 -453.[CrossRef]
Chiquoine, A. D. (1954). The identification, origin, and migration of the primordial germ cells in the mouse embryo. Anat. Rec. 118,135 -146.[CrossRef][Medline]
Cross, J. C., Werb, Z. and Fisher, S. J.
(1994). Implantation and the placenta: key pieces of the
development puzzle. Science
266,1508
-1518.
Dawid, I. B., Breen, J. J. and Toyama, R. (1998). LIM domains: multiple roles as adapters and functional modifiers in protein interactions. Trends Genet. 14,156 -162.[CrossRef][Medline]
de Souza, F. S. J. and Niehrs, C. (2000). Anterior endoderm and head induction in early vertebrate embryos. Cell Tissue Res. 300,207 -217.[CrossRef][Medline]
Dufort, D., Schwartz, L., Harpal, K. and Rossant, J. (1998). The transcription factor HNF3beta is required in visceral endoderm for normal primitive streak morphogenesis. Development 125,3015 -3025.[Abstract]
Foley, A. C. and Stern, C. D. (2001). Evolution of vertebrate forebrain development: how many different mechanisms? J. Anat. 199,35 -52.[Medline]
Garcia-Martinez, V. and Schoenwolf, G. C. (1993). Primitive-streak origin of the cardiovascular system in avian embryos. Dev. Biol. 159,706 -719.[CrossRef][Medline]
German, M. S., Wang, J., Chadwick, R. B. and Rutter, W. J.
(1992). Synergistic activation of the insulin gene by a LIM-homeo
domain protein and a basic helix-loop-helix protein: building a functional
insulin minienhancer complex. Genes Dev.
6,2165
-2176.
Glinka, A., Wu, W., Delius, H., Monaghan, P. A., Blumenstock, C. and Niehrs, C. (1998). Dickkopf1 is a member of a new family of secreted proteins and functions in head induction. Nature 391,357 -362.[CrossRef][Medline]
Gluecksohn-Schoenheimer, S. (1949). The effect of a lethal mutation responsible for duplications and twinning in mouse embryos. J. Exp. Zool. 110, 47-76.[Medline]
Gurtner, G. C., Davis, V., Li, H., McCoy, M. J., Sharpe, A. and Cybulsky, M. I. (1995). Targeted disruption of the murine VCAM1 gene: essential role of VCAM-1 in chorioallantoic fusion and placentation. Genes Dev. 9, 1-14.[Medline]
Herrmann, B. G. (1992). Action of the Brachyury gene in mouse embryogenesis. Ciba Found. Symp. 165, 78-86.[Medline]
Hoang, B. H., Thomas, J. T., Abdul-Karim, F. W., Correia, K. M., Conlon, R. A., Luyten, F. P. and Ballock, R. T. (1998). Expression pattern of two Frizzled-related genes, Frzb-1 and Sfrp-1, during mouse embryogenesis suggests a role for modulating action of Wnt family members. Dev. Dyn. 212,364 -372.[CrossRef][Medline]
Hobert, O. and Westphal, H. (2000). Functions of LIM-homeobox genes. Trends Genet. 16, 75-83.[CrossRef][Medline]
Jurata, L. W., Kenny, D. A. and Gill, G. N.
(1996). Nuclear LIM interactor, a rhombotin and LIM homeodomain
interacting protein, is expressed early in neuronal development.
Proc. Natl. Acad. Sci. USA
93, 11693.
Jurata, L. W. and Gill, G. N. (1997). Functional analysis of the nuclear LIM domain interactor NLI. Mol. Cell. Biol. 17,5688 -5698.[Abstract]
Jurata, L. W. and Gill, N. (1998). Structure and function of LIM domains. Curr. Top. Microbiol. Immunol. 228,75 -113.[Medline]
Kinder, S. J., Tsang, T. E., Ang, S. L., Behringer, R. R. and Tam, P. P. (2001). Defects of the body plan of mutant embryos lacking Lim1, Otx2 or Hnf3beta activity. Int. J. Dev. Biol. 45,347 -355.[Medline]
Lawson, K. A., Dunn, N. R., Roelen, B. A., Zeinstra, L. M.,
Davis, A. M., Wright, C. V., Korving, J. P. and Hogan, B. L.
(1999). Bmp4 is required for the generation of primordial germ
cells in the mouse embryo. Genes Dev.
13,424
-436.
Lawson, K. A. and Hage, W. J. (1994). Clonal analysis of the origin of primordial germ cells in the mouse. Ciba Found. Symp. 182,68 -84.[Medline]
Lints, T. J., Parsons, L. M., Hartley, L., Lyons, I. and Harvey, R. P. (1993). Nkx-2.5: a novel murine homeobox gene expressed in early heart progenitor cells and their myogenic descendants. Development 119,419 -431.[Abstract]
Liu, P., Wakamiya, M., Shea, M. J., Albrecht, U., Behringer, R. R. and Bradley, A. (1999). Requirement for Wnt3 in vertebrate axis formation. Nature Genet. 22,361 -365.[CrossRef][Medline]
Leimeister, C., Bach, A. and Gessler, M. (1998). Developmental expression patterns of mouse sFRP genes encoding members of the secreted frizzled related protein family. Mech. Dev. 75,29 -42.[CrossRef][Medline]
Leyns, L., Bouwmeester, T., Kim, S. H., Piccolo, S. and De Robertis, E. M. (1997). Frzb-1 is a secreted antagonist of Wnt signaling expressed in the Spemann organizer. Cell 88,747 -756.[CrossRef][Medline]
Marvin, M. J., Di Rocco, G., Gardiner, A., Bush, S. M. and
Lassar, A. B. (2001). Inhibition of Wnt activity induces
heart formation from posterior mesoderm. Genes Dev.
15,316
-327.
Matsuo, I., Kuratani, S., Kimura, C., Takeda, N. and Aizawa,
S. (1995). Mouse Otx2 functions in the formation and
patterning of rostral head. Genes Dev.
9,2646
-2658.
McMahon, A. P. and Moon, R. T. (1989). Ectopic expression of the protooncogene int-1 in Xenopus embryos leads to duplication of the embryonic axis. Cell 58,1075 -1084.[CrossRef][Medline]
Meyer, A. and Schartl, M. (1999). Gene and genome duplications in vertebrates: the one-to-four (-to-eight in fish) rule and the evolution of novel gene functions. Curr. Opin. Cell. Biol. 11,699 -704.[CrossRef][Medline]
Molkentin, J. D., Lin, Q., Duncan, S. A. and Olson, E. N.
(1997). Requirement of the transcription factor GATA4 for heart
tube formation and ventral morphogenesis. Genes. Dev.
11,1061
-1072.
Morcillo, P., Rosen, C. and Dorsett, D. (1996). Genes regulating the remote wing margin enhancer in the Drosophila cut locus. Genetics 144,1143 -1154.[Abstract]
Morcillo, P., Rosen, C., Baylies, M. K. and Dorsett, D.
(1997). Chip, a widely expressed chromosomal protein required for
segmentation and activity of a remote wing margin enhancer in Drosophila.
Genes Dev. 11,2729
-2740.
Mukhopadhyay, M., Shtrom, S., Rodriguez-Esteban, C., Chen, L., Tsukui, T., Gomer, L., Dorward, D. W., Glinka, A., Grinberg, A., Huang, S. P., Niehrs, C., Belmonte, J. C. and Westphal, H. (2001). Dickkopf1 is required for embryonic head induction and limb morphogenesis in the mouse. Dev. Cell 1,423 -434.[CrossRef][Medline]
Nakano, T., Murata, T., Matsuo, I. and Aizawa, S. (2000). OTX2 directly interacts with LIM1 and HNF-3beta. Biochem. Biophys. Res. Commun. 267, 64-70.[CrossRef][Medline]
Niehrs, C. (1999). Head in the Wnt. Trends in Genet. 15,314 -319.
Oliver, G., Mailhos, A., Wehr, R., Copeland, N. G., Jenkins, N. A. and Gruss, P. (1995). Six3, a murine homologue of the sine oculis gene, demarcates the most anterior border of the developing neural plate and is expressed during eye development. Development 121,4045 -4055.[Abstract]
Perry, W. L. 3rd, Vasicek, T. J., Lee, J. J., Rossi, J. M., Zeng, L., Zhang, T., Tilghman, S. M. and Costantini, F. (1995). Phenotypic and molecular analysis of a transgenic insertional allele of the mouse Fused locus. Genetics 141,321 -332.[Abstract]
Pöpperl, H., Schmidt, C., Wilson, V., Hume, C. R., Dodd, J., Krumlauf, R. and Beddington, R. S. (1997). Misexpression of Cwnt8C in the mouse induces an ectopic embryonic axis andcauses a truncation of the anterior neuroectoderm. Development 124,2997 -3005.[Abstract]
Rhinn, M., Dierich, A., Shawlot, W., Behringer, R. R., Le Meur, M. and Ang, S. L. (1998). Sequential roles for Otx2 in visceral endoderm and neuroectoderm for forebrain and midbrain induction and specification. Development 125,845 -856.[Abstract]
Robards, A. W. and Wilson, A. J., eds (1993). Basic biological preparation techniques for SEM. In Procedures in Electron Microscopy, pp. 11.4.1-11.4.17. Chichester: John Wiley & Sons.
Saga, Y., Hata, N., Kobayashi, S., Magnuson, T., Seldin, M. F. and Taketo, M. M. (1996). MesP1: a novel basic helix-loop-helix protein expressed in the nascent mesodermal cells during mouse gastrulation. Development 122,2769 -2778.[Abstract]
Saga, Y., Miyagawa-Tomita, S., Takagi, A., Kitajima, S., Miyazaki, J. and Inoue, T. (1999). MesP1 is expressed in the heart precursor cells and required for the formation of a single heart tube. Development 126,3437 -3447.[Abstract]
Sanchez-Garcia, I. and Rabbitts, T. H. (1994). The LIM domain: a new structural motif found in zinc-finger-like proteins. Trends Genet. 10,315 -320.[CrossRef][Medline]
Schneider, V. A. and Mercola, M. (2001). Wnt antagonism initiates cardiogenesis in Xenopus laevis. Genes. Dev.