|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00294


1 Graduate School of Agricultural and Life Sciences, University of Tokyo, Tokyo
113-8657, Japan
2 Faculty of Agriculture, Hokkaido University, Sapporo 060-8589, Japan
3 Faculty of Agriculture, Kyushu University, Fukuoka 812-8581, Japan
4 DuPont Company, Agriculture and Nutrition, Delaware Technology Park 200, 1
Innovation Way, Newark, DE 19714, USA
5 Present address: Orynova Co. Ltd., Iwata 438-0802, Japan
Authors for correspondence (e-mail:
anagato{at}mail.ecc.u-tokyo.ac.jp
and
Hajime.Sakai{at}usa.dupont.com)
Accepted 14 November 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Rice, Oryza sativa, DROOPING LEAF, SUPERWOMAN1, Floral mutants, Floral organ identity, Homeotic mutations, MADS box
| INTRODUCTION |
|---|
|
|
|---|
The floral developmental program in monocots has not been studied to the
extent that it has been in dicots, although several homologs of ABC class
genes have been isolated from monocot plants. Two genes homologous to
AG were isolated from maize, one of the extensively studied monocot
plants (Schmidt et al., 1993
;
Mena et al., 1995
;
Theissen et al., 1995
). For
instance, the function of one AG homologue, ZAG1, was
determined by analyzing the corresponding knockout line. A loss-of-function
mutant of ZAG1, zag1-mum1, has been isolated which showed loss of
determinacy in the central floral whorl, but no alteration of floral organ
identity (Mena et al., 1996
).
These studies suggest that, although the function of floral organ identity
genes might have split and diverged, these genes still play important roles in
flower development in monocots. As one of the class B homeotic genes, the
silky1 gene of maize was revealed to be homologous to AP3
(Ambrose et al., 2000
). Since
the silky1 mutant shows a homeotic conversion of lodicules and
stamens into palea-like organs and carpels, respectively, similar to
ap3, it may indicate that the class B genes are functionally more
conserved than class A and C genes among flowering plants. In rice, several
MADS-box genes have also been isolated
(Chung et al., 1994
;
Chung et al., 1995
;
Kang et al., 1995
;
Moon et al., 1999
;
Kyozuka et al., 2000
).
OsMADS3 and OsMADS4 share sequence similarity to AG
and PI, respectively, and their functions were analyzed by transgenic
experiments. The transgenic plants expressing antisense OsMADS3
produced lodicule-like organs in whorl 3 and several abnormal flowers in whorl
4 instead of a carpel, whereas OsMADS4 antisense plants showed
transformation of stamens into carpels
(Kang et al., 1998
). In
contrast, ectopic expression of OsMADS3 in rice caused a homeotic
transformation of lodicules to stamens
(Kyozuka and Shimamoto, 2002
).
These results show that the function of these genes, at least in part, is as
predicted from the ABC model. The important role of MADS-box genes in rice
flower development is further shown by the report that the leafy hull
sterile (lhs1) mutant, which has a defect in the
OsMADS1 gene and belongs to the AP1/AGL9 group, has
abnormalities in meristem identity, organ number and organ identity
(Jeon et al., 2000
).
The rice flower has an architecture different from those of the two model
dicot species. In general, it is believed to consist of three distinct floral
organs, one gynoecium with two stigmas, six stamens, and two lodicules
(Hutchinson, 1934). In order to be able to compare rice, Arabidopsis
and Antirrhinum, we designate the lodicule region as whorl 2, the
stamen region as whorl 3, and the carpel region as whorl 4 in this study. In
rice, two bract-like organs, the palea and lemma, subtend these floral organs
in an alternate arrangement. The palea is regarded as homologous to the
prophyll [the first leaf produced by the axillary meristem
(Arber, 1934
; Dahlgren et al.,
1985)], is smaller than the lemma and has three vascular bundles while the
lemma has five. A floret consists of one gynoecium, six stamens, two
lodicules, one palea and one lemma. Two empty glumes that are regarded as
vestigial organs of two lower florets subtend the apical floret in an
alternate arrangement. Two rudimentary glumes (the first two glumes) subtend
the empty glumes. These organs form a spikelet of rice.
Several floral mutants have been described in grasses. The
midribless (mbl) mutant, which has midrib-less leaves and
the homeotic conversion of the gynoecium into stamens, has been reported in
Panicum maximum (Fladung et al.,
1991
). Although the photosynthetic ability of these midrib-less
leaves was analyzed in detail, the morphology of floral organs was not fully
described. Similar mutants have been described in barley, ovaryless
(ovl) (Tsuchiya,
1962
; Tsuchiya,
1969
), and in pearl millet, midribless-1 (mrl-1)
and mrl-2 (Rao et al.,
1988
), in which both the midrib and carpel differentiation are
affected. The detailed floral morphology has not been described for either
mutant. In rice, a similar mutation, drooping leaf (dl), was
identified previously (Iwata and Omura,
1971
), but the floral abnormalities have not been reported.
Recently, we identified new dl alleles affecting both flower
development and midrib formation. We also identified other homeotic mutants,
including superwoman 1 (spw1). In this study, we describe
the morphological and genetic analysis of these homeotic mutants, which led us
to propose a model in which DL specifies a novel function in
reproductive floral organs. The model was further supported by our molecular
characterization of the SPW1 gene and expression studies.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Morphological analysis
For scanning electron microscopy (SEM), samples were fixed in 2.5%
glutaraldehyde in 0.1 M sodium phosphate buffer (pH 7.2) for about 16 hours at
4°C. After they were rinsed with 0.1 M sodium phosphate buffer (pH 7.2),
the samples were post-fixed in 1% osmium tetroxide for 3 hours at 4°C.
Subsequently, they were rinsed with the buffer, dehydrated through a graded
ethanol series, and substituted with 3-methyl-butyl-acetate. Samples were
critical-point-dried, sputter-coated with platinum, and observed under the
scanning electron microscope (Hitachi S-4000, Tokyo) at an accelerating
voltage of 15 kV.
For light microscopic observations, flowers were fixed in 2.5% glutaraldehyde for at least 16 hours at 4°C. They were dehydrated through a graded ethanol series, and then embedded in Technovit 7100 resin (Kulzer, Germany). Samples were sectioned in 4 µm and stained with 0.05% Toluidine Blue-O and observed under the light microscope (Olympus AX-80, Tokyo).
Linkage analysis and sequencing
F2 populations were generated by the self-pollination of
F1 plants derived from the cross between SPW1/spw1-1
(Japonica cv. Kinmaze) and Kasalath (Indica). Plants homozygous for
spw1-1 were selected from F2 populations and used for
linkage analysis of OsMADS16. The genomic DNA of these F2
mutants was extracted by the proteinase K DNA extraction method
(http://www.its.caltech.edu/~plantlab/html/.index.html).
Genomic DNA was digested with XbaI and subjected to gel
electrophoresis. The separated DNA was blotted to Nylon membrane and
hybridized with DIG-labeled OsMADS16 DNA as a probe. The membrane was
washed in 1x SSPE 0.1%SDS at 65°C for 1 hour and then in 0.1x
SSPE 0.1%SDS at 65°C for 1 hour. Detection was carried out according to
the manufacturer's instructions (Roche Molecular Biochemicals).
To obtain genomic clones containing OsMADS16, we screened a BAC
library, which was constructed in the Japonica YT14 background
(Bryan et al., 2000
), by PCR
using primers, M16F4:ATGTTCTC- CTCCACCGGCAAG and M16R8:GTCCAGATCTTCTCCCATC-
CTT. We isolated one BAC clone and subcloned a 7 kb BamHI DNA
fragment into pUC18. The subcloned fragment was nebulized and 2 kb-long DNA
fragments were cloned into the SmaI site of pUC18 and sequenced. For
sequencing of mutant alleles, we amplified genomic DNA from spw1-1
and spw1-2 by PCR with the following primers: GGTTCCCAACTCATCGATCCATC
and AAGCATGAAATATGC- ACGGATCTG for exon 1-4, ACGGTTCATGATCAGATCCGTGCA and
GTCAACAGCTTCCAAGGGAAGGA for exon 5, CACACA- TATGCTGGACCCTGTGTC and
CATAGCACACATCAAGTGGT- TTGGT for exon 6 and 7. Amplified fragments were cloned
into pGEM-T Easy vector (Promega). At least three clones from each
PCR-amplified fragment were sequenced to determine mutations.
RNA isolation and analysis
Total RNA was extracted from 500 mg young inflorescence tissues of wild
type, spw1-1 and spw1-2 as described previously
(Naito et al., 1988
). Poly(A)
RNA was obtained using an mRNA purification kit (Amersham Pharmacia Biotech UK
Limited). 1 µg of poly(A) RNA was loaded on a 1% denaturing agarose gel,
which contained 1x Mops, 1.85% formaldehyde, and separated for 2 hours
at 70 V.RNA was transferred on Hybond-N+ nylon membrane (Amersham Pharmacia
Biotech UK Limited). Hybridization was performed at 42°C in the buffer
with 5 xDenhardt's, 50% formamide, 5 xSSC and 100 µg/ml herring
sperm DNA. An SPW1 cDNA fragment without the MADS box domain, i.e.
the fragment that covered the region between 102 aa residue and the 3'
end of SPW1 cDNA, was used to make a randomly primed probe with
[
-32P]CTP. After hybridization, the membrane was washed with
6x SSC for 30min twice at room temperature and then washed with
0.5x SSC at 65°C for 1 hour. Signals were detected on a
phosphoimager screen (Molecular Dynamics, Inc.) and visualized on a STORM 820
scanner (Molecular Dynamics, Inc.). As a reference, a DNA fragment of the rice
ubiquitin gene was amplified using a set of primers (AGCGTCGACTCCTTCTTGGAT and
ATCTTCGTGAAGACGCT- GACG). The fragment was labeled and hybridized on the same
blot as described above.
For RT-PCR analysis, 1 µg of total RNA was treated with 1 unit of RNase-free DNase (Promega) and further reverse transcribed by using oligo(dT) primer and Retroscript RT PCR kit (Ambion). One twentieth of transcribed cDNA was subjected to PCR reaction. To amplify the mutant SPW1 cDNA, we used a primer set consisting of spw1RTF: CAGGTCGCCATCATCATGTTCTC and spw1RTR: GCTCCTGCTGCAGAGTCTCGTACG. The Advantage-GC2 PCR kit (Invitrogen) was used for set up PCR reactions following the manufacture's instructions. PCR was performed for 35 cycles at 94°C for 30 seconds, 58°C for 30 seconds and 68°C for 30 seconds. Amplified DNA fragments were cloned into p-GEM-T Easy (Promega), transformed into DH10B (Invitrogen) and sequenced.
In situ hybridization
Wild-type and mutant flowers were fixed in 3% paraformaldehyde and 0.3%
glutaraldehyde for 16 hours at 4°C. They were dehydrated through a butanol
series and embedded in Paraplast and sectioned at 8 µm using a rotary
microtome. DIG-labeled RNA probe was synthesized from the 0.6 kb-long,
3' region of OsMADS45 and the 0.7 kb-long, 3' region of
OsMADS16 excluding the MADS-box region, following the manufacturer's
instructions (Roche Molecular Biochemicals). Hybridization and immunological
detection with alkaline phosphatase were performed according to the method of
Kouchi and Hata (Kouchi and Hata,
1993
). Radioactive in situ hybridization was performed as
described previously (Sakai et al.,
1995
), with the exception that the exposure length was 6
weeks.
| RESULTS |
|---|
|
|
|---|
|
|
Although the carpels in whorls 3 and 4 of spw1 often produced ovaries and stigmas, they failed to produce fused and functional ovaries (Fig. 2F). The number of stigmas for each carpel varied from four to none. Frequently, nucellar tissues were formed in carpels, including whorl 3 carpels, and protruded from the ovary (Fig. 2G-I). When the nucellar tissue remained in the ovary, an ovule-like structure was often formed without producing a fully differentiated embryo sac (Fig. 2H). Occasionally, when the nucellar tissue completely protruded from the underdeveloped ovary, the ovule-like structure was not formed (Fig. 2I). When the spw1-1 carpels were crossed with wild-type pollen, there was no seed set, showing that spw1-1 carpels, including the one in whorl 4, were sterile.
Early development of wild-type and spw1 mutant flowers
In the wild-type flower, six stamen primordia start to develop just after
the palea primordium has established (Fig.
3A). After stamen primordia are produced, the carpel primordium
becomes enlarged (Fig. 3B). The
gynoecial ridge starts to develop on the lemma side of the floral meristem and
encloses the ovule primordium. The lemma side of the carpel protrudes to form
stigmas (Fig. 3C).
|
In the spw1-1 flower, the shape of the six primordia of the ectopic carpels in whorl 3 was similar to that of the wild-type stamen primordia at the initial stage (Fig. 3D). Whereas wildtype stamen primordia became rectangular in shape, the six primordia in whorl 3 of the spw1-1 flower became broad, and followed the developmental course of the gynoecium (Fig. 3E). When the central gynoecium formed stigma primordia, the ectopic palea-like organs became apparent in the position of wild-type lodicules between the lemma and ectopic carpels (Fig. 3F). These results indicated that the number of organ primordia in whorl 3 was not altered, and the transformation of stamens into carpels occurred at a very early stage of floral organ development.
Phenotypes of drooping leaf mutants
Four dl mutants, which showed the drooping leaf phenotype
(Fig. 4B), produced flowers
with varying degrees of abnormalities in carpel formation
(Table 1,
Fig. 5). The blade and sheath
of dl mutants failed to form the midrib and fully developed clear
cells (Fig. 4D). The
dl mutants appeared to produce a lateral vein at the position of the
midrib of the wildtype leaf. Other leaf structures were not affected.
|
|
|
The dl-1 (HO788) mutant produced drooping leaves and, frequently, abnormal flowers. Although more than half of dl-1 (HO788) flowers were normal, about 40% of flowers produced a gynoecium with three or four stigmas (Table 1, Fig. 5B). Very rarely, dl-1(HO788) flowers produced staminoid carpels, in which anthers were formed apically, or ectopic stamens originated from the base of carpels. Despite these abnormalities, dl-1(HO788) plants exhibited only slightly reduced seed fertility (80.4%) comparable to the wild type (87.5%).
dl-1(T65), the introgressed dl-1(HO788) mutation in another Japonica background, affected carpel development more severely than dl-1(HO788). In dl-1(T65), the number of stigmas was increased in about 60% of flowers, and the transformation of the gynoecium into stamens or the production of ectopic stamens was detected in nearly 10% of flowers (Table 1, Fig. 5C). Occasionally, staminoid carpels, which bore anther tissues on the carpel tissue, were formed between more completely transformed ectopic stamens and the whorl 3 stamens (Fig. 5D). When two carpels were formed in dl-1 (T65) flowers, they were aligned in the lemma-palea direction. The seed fertility of dl-1(T65) (52.7%) was lower than that of dl-1(HO788).
Plants harboring the dl-2 mutation showed drooping leaves, while flowers were normal except for producing carpels with three stigmas at a low frequency (Fig. 5E, Table 1). Thus, dl-2 affects only the midrib development and rarely the carpel development, and can be considered the weakest of the four dl alleles.
The homeotic conversion of the carpel into stamens as well as the formation of drooping leaves was observed in all dl-supl and dl-sup2 plants (Fig. 1C,G, Fig. 5F,H, Table 1). The phenotype of dl-sup2 (Fig. 5H, Table 1) was almost the same as that of dl-sup1. In both mutants, the transformation was complete, producing no carpel. The number and position of the original stamens were not affected, and the ectopic stamens were produced in alternate arrangement in the position of the gynoecium (Fig. 5G,I). The number of ectopic stamens in dl-sup1 varied from three to seven, and the ectopic stamens were produced in the lemma-palea direction (Fig. 5G). As a result, many alternately arranged extra stamens occupied the position of the wild-type gynoecium. The ectopic stamens often had broad filaments (Fig. 5H).
We analyzed the development of dl-sup1 and dl-sup2. The primordia of six stamens in whorl 3 were normally produced in dl-sup1 flowers (Fig. 3G,J). The primordium of the first ectopic stamen emerged as a lateral protrusion on the lemma side of the floral meristem (Fig. 3H,K). When normal anthers became rectangular in shape, the first ectopic stamen primordium became broad and subtended the central apical meristem (Fig. 3K). At the stage when two stigmas were differentiated from the carpel primordium in the wild-type flower, several ectopic stamens were produced alternately, and the floral meristem at the center appeared to remain undifferentiated in the mutant flower (Fig. 3I,L).
Interaction between SPW1 and DL
To elucidate a possible genetic interaction between SPW1 and
DL, we constructed the double mutant, spw1-1 dl-sup1. The
spw1-1 dl-sup1 flower showed an unexpected phenotype, which could not
be explained by additive or epistatic interactions
(Fig. 1D,H). Lodicules were
homeotically transformed into palea-like organs in whorl 2 as in
spw1-1. Interior to whorl 2, yellowish and soft organs were produced
indeterminately which were neither stamens nor carpels
(Fig. 1D). The upper part of
these organs was often enlarged. The abaxial side of the most outer organ in
whorl 3 was occasionally covered with trichomes similar to those of paleae or
lemmas (Fig. 6A). Also, at the
top of these organs, large and long trichomes were formed, which resembled
hairs of the bracts subtending primary inflorescence branches
(Fig. 6B,C). Trichomes were not
observed in more inner organs. These characteristics suggest that the organs
in whorl 3 have partial inflorescence-like identity. Longitudinal sections of
these organs indicated that the inside of the enlarged part had no pollen or
ovule (Fig. 6E).
|
The ontogeny of double mutant flowers showed that the primordia in whorl 2, corresponding to lodicules in the wild type, developed into palea-like organs as in spw1-1. The six primordia corresponding to wild-type stamens in whorl 3 seemed to be normal at the beginning (Fig. 6F). However, the primordia in whorl 3 successively became broader similar to those seen in the development of spw1-1 ectopic carpels (Fig. 6G), but the subsequent development of the spw1-1 dl-sup1 flower deviated from the spw1-1 flower. In the region interior to whorl 3, the central meristem became enlarged toward the palea and lemma (Fig. 6G), and continuously produced new meristems in a medial plane (Fig. 6H), forming a number of apices (Fig. 6H). Unidentifiable organs were formed indeterminately from each meristematic apex (Fig. 6D,I).
To elucidate whether these organs were floral in nature, we analyzed
OsMADS45 expression by means of in situ hybridization.
OsMADS45 shares homology with Arabidopsis SEP1
(AGL2) and SEP2 (AGL4)
(Pelaz et al., 2000
) and was
shown to be expressed in floral organs in whorl 2, 3 and 4 of wild-type
flowers (Greco et al., 1997
)
(Fig. 7C). In order to see
whether OsMADS45 is expressed specifically in flowers, we examined
expression in various tissues. The expression of OsMADS45 appeared to
be floral specific and was not detected in the vegetative shoot or
inflorescence meristems (Fig.
7A,B). After stamen primordia started to develop,
OsMADS45 was expressed in developing stamen and lodicule primordia
(Fig. 7C). OsMADS45
RNA was further detected in the developing carpel
(Fig. 7C) and in integuments
(data not shown). In spw1 dl-sup1 flowers, the expression of
OsMADS45 was not altered (Fig.
7D). OsMADS45 was expressed in organ primordia formed in
whorl 2,3 and 4. This result suggested that these organs still retain partial
floral organ identity.
|
Identification of the SPW1 gene
The phenotype of spw1 mutants is similar to the ap3 and
pi mutants of Arabidopsis. It has been reported that there
are three homologs of B function genes in rice, OsMADS2 and
OsMADS4, which are genes homologous to PI, and
OsMADS16, which is homologous to AP3
(Chung et al., 1995
;
Moon et al., 1999
). In order
to examine a possible linkage of SPW1 to one of these homologs, we
attempted to analyze the segregation of the spw1 phenotype with these
genes, using the F2 spw1 mutants derived from the cross
between spw1-1 and Indica cv. Kasalath. By analyzing RFLP associated
with OsMADS16 in 30 F2 spw1-1 plants, the
Japonica genotype was found to completely co-segregate with the
spw1-1 allele (data not shown). Based on the tight linkage of
SPW1 and OsMADS16, we examined the OsMADS16 genomic
sequence of the wild type and mutants. The 4.3 kb-long OsMADS16
genomic region consisted of seven exons and six introns
(Fig. 8A,B). By sequencing
spw1 mutants, we identified a G to A base change at the 3' end
of the third intron in spw1-1 and a G to A base change at the
5' end of the fifth intron in spw1-2
(Fig. 8A).
|
The effect of spw1 mutations on the SPW1 transcript was analyzed by RNA blot hybridization. Total RNA from young panicles of spw1-1, spw1-2 and the wild type was separated for the purpose, which was subsequently hybridized with a probe specific to SPW1. In the two mutants, the accumulation of SPW1 RNA was significantly reduced. Furthermore, the size of SPW1 RNA in spw1-2 appeared to be shorter than the wild-type RNA (Fig. 8C). In order to analyze the effect of spw1 mutations more precisely, we further analyzed SPW1 RNA by using RT-PCR. The sequence of amplified DNA fragments revealed that the splicing of SPW1 RNA was affected by the mutations (Fig. 8E). In spw1-1, the mutation occurred at the acceptor site of the third intron, leading to cryptic splicing at a position six bases downstream of the acceptor site and causing the deletion of two conserved amino acid residues in the K box (Fig. 8B). In spw1-2, the mutation occurred at the donor site of the sixth intron and resulted in deletion of the entire fifth exon (Fig. 8B).
Expression of the SPW1 gene
SPW1 expression in wild-type flowers was analyzed by means of in
situ hybridization using SPW1 antisense RNA as probe. SPW1
RNA started to accumulate in incipient primordia of lodicules and stamens in
wild-type flowers (Fig. 9A).
The strong expression of SPW1 RNA continued to be seen in stamen and
lodicule primordia (Fig. 9B,C)
and also in mature tissues of filaments and anthers except developing
microsporophylls (Fig. 9D). No
signal was detected in the gynoecium or in the lemma and the palea.
|
SPW1 expression was also examined in spw1 mutants. We failed in several attempts to detect reproducible signals in mutants by using the non-radioactive method, and therefore we performed in situ hybridization with a radioactive probe. After exposing the hybridized tissues for 6 weeks, we detected weak signals of SPW1 RNA in incipient organ primordia in the region of whorls 2 and 3 of spw1-1 developing flowers (Fig. 9M,N). However, shortly after organ primordia were formed in whorls 2 and 3, SPW1 RNA was not observed above the limits of detection (Fig. 9O,P).
In order to examine the relationship between DL and SPW1 at the transcriptional level, we further analyzed the accumulation of SPW1 RNA in dl-sup1 mutant flowers. The expression pattern of SPW1 RNA in dl-sup flowers was indistinguishable from the wild-type expression until the stage when whorl 4 organ primordia emerged from the floral meristem (Fig. 9E). When the gynoecial ridge began to rise in the wild-type flower, SPW1 RNA was ectopically expressed in the lemma side of the whorl 4 floral meristem in dl-sup1 flowers where the first ectopic stamen primoridum would arise (Fig. 9F). SPW1 RNA was further detected in the region where the second ectopic stamen arises (Fig. 9H). SPW1 expression in the whorl 4 area appears to be limited to the developing primordia, often leaving several cell layers that do not accumulate SPW1 RNA. Also, throughout the floral development, SPW1 expression was not detected in the very central region of the floral meristem of dl-sup1 (Fig. 9F-H).
| DISCUSSION |
|---|
|
|
|---|
The functional correlation between SPW1 and AP3 is shown
not only by the sequence similarity but also by loss-of-function phenotypes.
The recessive spw1 mutations transform whorl 3 organs (stamens) to
whorl 4 organs (carpels) and whorl 2 organs (lodicules) to organs that
resemble the palea, which is normally formed exterior to whorl 2 in the
wild-type flower. Also, the maize silky1 mutant that carries a lesion
in the gene homologous to AP3
(Ambrose et al., 2000
) exhibits
a phenotype very similar to rice spw1. This also supports the notion
that class B floral organ identity genes are present in monocots. Although
these class B homeotic genes appear to have conserved functions in organ
identity specification, other functions of these genes in flower development
appear to be diverse. In spw1 mutants, the number of whorl 2 organs
is more than that of the wild type. Furthermore, the spw1 mutants do
not form any functional carpels even in whorl 4, resulting in complete
sterility, whereas ap3 or pi mutants are female fertile. The
sterility of spw1 seems to correlate with overproduction of
undifferentiated nucellar tissue. It is noteworthy to mention that the
Arabidopsis class B mutants, ap3 and pi, also
affect cell proliferation; however, in these mutants there is a reduction of
organ number in whorl 3, while whorl 2 organ number is not altered
(Bowman et al., 1991
;
Jack et al., 1992
;
Sakai et al., 2000
). To this
extent, SPW1 appears to have a specific function in the regulation of
the whorl-specific proliferation, which is distinct from AP3 and
PI.
Implication of spw1 homeotic transformation in monocot
flower evolution
The identification of SPW1 as a class B gene in rice provides
insight into the floral structure of rice and other monocots. The comparison
of spw1 loss-of-function phenotypes with the class B mutant
phenotypes in dicots strongly suggests that lodicules are equivalent to petals
and the palea-like organs formed in spw1 whorl 2 correspond to
sepals, whorl 1 floral organs in dicots. This finding is very similar to what
was described for the maize silky1 mutant
(Ambrose et al., 2000
). Our
observation of spw1 whorl 2 organs being morphologically not
identical to the wild-type palea might lead to two diverse interpretations.
(1) The transformation of lodicules to paleae is incomplete because of the
presence of residual lodicule identity in spw1, or (2) organs formed
in spw1 whorl 2 are indeed the sepal-equivalent organs, which are,
however, distinct from the wild-type palea and usually not formed in the
wild-type floret. These organs are evident only when the class B function is
missing in whorl 2. In the latter case, the palea could be considered a
bract-like organ, in agreement with the general hypothesis that grass flowers
lack sepals (Hackel, 1887
;
Arber, 1934
; Dahlgren et al.,
1985). The evolutionary relevance of the homology between paleae and sepals
remains to be explored.
DL plays an important role in vegetative and reproductive
development
Based on the loss-of-function phenotype, DL has functions in two
distinct developmental pathways, midrib and carpel development. Mutants
similar to dl have been identified in other grass species, barley
(Tsuchiya, 1962
), pearl millet
(Rao et al., 1988
), and
Panicum maximum (Fladung et al.,
1991
). These mutations are single and recessive, and affect both
the midrib formation and carpel development. In P. maximum, the
mbl mutation causes midrib-less leaves and the conversion of the
gynoecium into stamens (Fladung et al.,
1991
). In pearl millet, at least two loci, MRL-1 and
MRL-2, have been identified, both affecting midrib and carpel
development (Rao et al.,
1988
). In barley, ovl causes the loss of midrib and the
degeneration of ovary (Tsuchiya,
1962
). Although the flower phenotype of these mutants has not been
fully characterized except in the case of mbl of P. maximum,
mrl-1, mrl-2 and ovl do not show any homeotic conversion of
carpel into stamens. However, midrib-less leaves and occasional abnormal
carpel development are common to all the above mutants. Since similar
mutations pleiotropically affecting both leaf midrib and carpel development
have not been reported in dicots, these genes appear to have a unique
combination of functions in monocots. The phenotypic characteristics of four
dl alleles, particularly floral phenotypes, indicate that
dl-2 is the weakest allele, which does not affect floral organ
development, and dl-sup1 and dl-sup2 are the strong alleles
converting the carpel into stamens. No mutants have been identified which
produce normal leaves but cause homeotic conversion of the carpel into
stamens. This suggests that the formation of the midrib requires more complete
activity of the DL gene product than the carpel development does.
The floral phenotype of strong dl mutants (dl-sup1 and
dl-sup2) is similar to that of superman (sup)
mutants in Arabidopsis, which form extra stamens interior to the
stamen whorl (Schultz et al.,
1991
; Bowman et al.,
1992
). It is reported that SUP encodes a C2H2-type
zinc-finger protein, and is expressed in the adaxial region of the whorl 3
floral meristem (Sakai et al.,
1995
). The function of SUP is shown to be involved in
co-ordinated proliferation control of whorl 3 and 4 floral meristems. However,
the dl flower exhibits several phenotypes seemingly distinct from
sup. Firstly, SUP does not affect vegetative development
(Schultz et al., 1991
;
Bowman et al., 1992
;
Sakai et al., 1995
). Secondly,
ectopically formed stamens are arranged in a different pattern. In
sup mutants, the extra stamens are formed in extra whorls that
exhibit a duplicated pattern of the stamen whorl (whorl 3)
(Schultz et al., 1991
;
Bowman et al., 1992
). In
contrast, these extra stamens in dl-sup mutants are formed not as a
duplication of whorl 3 but as a branch structure along the axis of the palea
and lemma. These differences could be explained by assuming that DL
acquired several new functions during its divergence away from the
DL/SUP ancestral gene. Nevertheless, taking into account the
interaction between DL and SPW1 as discussed below, we are
tempted to consider that DL is distinct from SUP in
specification of carpel identity.
Genetic interaction between SPW1 and DL
In order to examine potential genetic interactions between dl and
spw1, we constructed the double mutant. The double mutant showed a
phenotype distinct from that seen in Arabidopsis ap3 sup. The ap3
sup double mutant has a phenotype similar to ap3
(Schultz et al., 1991
;
Bowman et al., 1992
), but the
development of whorl 4 organs is suppressed, which is largely explained by an
additive interaction of two mutations
(Sakai et al., 2000
). In the
spw1-1 dl-sup1 double mutant flower, however, organs whose identities
are neither carpel nor stamen are indeterminately produced in whorls 3 and 4.
This phenotype again indicates that DL function is not to regulate
the boundary between whorl 3 and whorl 4 but rather to provide the carpel
organ identity and the whorl 4 determinacy. Furthermore, the expression
pattern of OsMADS45, which we showed to be flower specific, suggests
that the organs formed whorl 3 and 4 of double mutant flowers have floral
organ identity.
A model of rice flower development
According to previous data derived from cDNA sequences and expression
patterns, genes corresponding to the ABC floral homeotic genes in
Arabidopsis and Antirrhinum appear to be present in rice,
and their corresponding functions were partly proved by antisense experiments
(Chung et al., 1994
;
Chung et al., 1995
;
Kang et al., 1995
;
Kang et al., 1998
;
Moon et al., 1999
;
Kyozuka et al., 2000
). Two
genes sharing homology to AG, OsMADS3 (also referred to as
RAG) and OsMADS13, have been cloned in rice
(Lopez-Dee et al., 1999
;
Kang et al., 1998
). Their
expression patterns and transgenic experiments suggested that OsMADS3
is the C function gene in rice (Kang et
al., 1998
; Kyozuka et al.,
2000
; Kyozuka and Shimamoto,
2002
). Also, two genes sharing homology to PI, OsMADS2
and OsMADS4, have been cloned in rice. Based on the expression
patterns in flowers, OsMADS2 and OsMADS4 are believed to be
PI homologs (Chung et al.,
1995
; Kyozuka et al.,
2000
). In the case of OsMADS4, the function has further
been elucidated by anti-sense experiments
(Kang et al., 1998
). As for
the AP3 homolog, OsMADS16 was initially isolated by
screening for proteins which could interact with OsMADS4 protein
(Moon et al., 1999
). We show
in this report that the SPW1 gene is identified as OsMADS16
and the loss of SPW1 function causes the phenotype corresponding to
the class B mutant phenotype. There are several rice genes sharing sequence
homology to the Arabidopsis class A gene, AP1. Among them,
the LHS1 gene (OsMADS1) was shown to carry AP1
function at least in part (Jeon et al.,
2000
).
As discussed above, our data show that DL has a novel function
that has not yet been described in other flowering plants. With regard to its
function in floral organ specification, DL appears to act in whorl 4
to specify carpel identity, presumably in conjunction with other genes
including class C genes (Fig.
10A). The transformation of floral organs in dl as well
as spw1 mutants can be explained by the mutually exclusive
interaction of both genes: the loss of DL function results in the
spatial expansion of SPW1 function in whorl 4, which leads to the
transformation of the gynoecium into stamens
(Fig. 10B). Likewise, the loss
of SPW1 function causes spatial expansion of DL function in
whorl 3, which leads to the transformation of stamens into carpels
(Fig. 10C). Such mutually
antagonistic interaction of DL and SPW1 resembles the one
between class A and C activities in Arabidopsis
(Bowman et al., 1991
;
Drews et al., 1991
). The loss
of both SPW1 and DL causes the transformation of whorl 3 and
4 organs into indeterminate structures that produce organs with no apparent
identity (Fig. 10D). This
indicates that these two rice genes, SPW1 and DL, play an
essential role in specifying floral organ identity. In Arabidopsis,
genes that specify carpel identity were isolated and their interactions with
ABC homeotic genes studied (Alvarez and
Smyth, 1997
; Alvarez and Smyth,
1999
; Liu et al.,
2000
). These genes include LEUNIG (LUG), AINTEGUMENTA (ANT),
CRABS CLAW (CRC) and SPATULA (SPT). Among them, crc and
spt mutants show a significant reduction in carpelloidy in
combination with the pi-1 mutation
(Alvarez and Smyth, 1999
). None
of the loss-of-function mutants of these genes, however, exhibits a phenotype
similar to dl-sup. Nevertheless, it would be interesting to see
whether there is any common genetic pathways controlled by CRC/SPT in
Arabidopsis and DL in rice.
|
Although data on DL expression is currently not available, the
studies on SPW1 expression in mutants provide additional data that
are consistent with the model. SPW1 expression was significantly
downregulated in the spw1 mutant. Although this transcriptional
repression could be due to a splicing defect, resulting in increased RNA
turnover, or possible autoregulation similar to the one reported for
AP3 (Jack et al.,
1994
), it could also be due to ectopic DL activity in the
spw1 mutant background. However, ectopic SPW1 expression was
detected in whorl 4 of the strong dl mutants. Ectopic expression was
not detected at the stage of the initial SPW1 expression. Rather, it
was seen at the later stage when whorl 3 stamen primordia started to
differentiate into filament and anther structures and the whorl 4 floral
meristem proliferated to form a mound. The pattern of ectopic expression again
differed from what has been observed in sup mutants in
Arabidopsis, where AP3 expression gradually spread into the
whorl 4 area (Sakai et al.,
1995
). In dl-sup, ectopic expression of SPW1
occurred abruptly in part of the whorl 4 floral meristem. This also suggests
that the organ identities of whorls 3 and 4 are not specified at the same
stage in rice as they are in Arabidopsis. In rice, the specification
of whorl 4 appears to occur after that of whorl 3. A model of sequential
specification of floral organs has been discussed in other species
(Hicks and Sussex, 1971
). In
Arabidopsis and tobacco, floral organ specification was shown not to
require signals from outer whorls (Day et
al., 1995
). It remains to be explored whether floral whorls in
rice are also autonomous and independent from each other with regard to organ
specification.
According to recent report, the DL gene has been identified by implementing a map-based cloning strategy (T. Yamaguchi, Y. Nagato and H. Hirano, personal communication). Further analyses of the DL gene at the molecular level could shed more light on the unique function of DL and its interaction with other floral homeotic genes.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alvarez, J. and Smyth, D. R. (1997). Carpel development genes in Arabidopsis. Flowering Newsletter 23, 12-17.
Alvarez, J. and Smyth, D. R. (1999). CRABS CLAW and SPATULA, two Arabidopsis genes that control carpel development in parallel with AGAMOUS.Development 126,2377 -2386.[Abstract]
Arber, A. (1934). The Gramineae: A Study of Cereal, Bamboo and Grass. Cambridge University Press, New York.
Ambrose, B. A., Lerner, D. R., Ciceri, P., Padilla, C. M., Yanofsky, M. F. and Schmidt, R. J. (2000). Molecular and genetic analyses of the Silky1 gene reveal conservation in floral organ specification between eudicots and monocots. Mol. Cell 5, 569-579.[CrossRef][Medline]
Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M. (1991). Genetic interactions among floral homeotic genes of Arabidopsis. Development 112, 1-20.[Abstract]
Bowman, J. L., Sakai, H., Jack, T., Weigel, D., Mayer, U. and Meyerowitz, E. M. (1992). SUPERMAN, a regulator of floral homeotic genes in Arabidopsis. Development 114,599 -615.[Abstract]
Bradley, D., Carpenter, R., Sommer, H., Hartley, N. and Coen, E. S. (1993). Complementary floral homeotic phenotypes result from opposite orientations of a transposon at the plena locus of Antirrhinum. Cell 72,85 -95.[CrossRef][Medline]
Bradley, J. M., Whitelam, G. C. and Harberd, N. P. (1995). Impaired splicing of phytochrome B pre-mRNA in a novel phyB mutant of Arabidopsis. Plant Mol. Biol. 27,1133 -1142.[CrossRef][Medline]
Bryan, G. T., Wu, K. S., Farrall, L., Jia, Y., Hershey, H. P.,
McAdams, S. A., Faulk, K. N., Donaldson, G. K., Tarchini, R. and Valent,
B. (2000). tA single amino acid difference distinguishes
resistant and susceptible alleles of the rice blast resistance gene Pi-ta.
Plant Cell 12,2033
-2046.
Carpenter, R. and Coen, E. S. (1990). Floral
homeotic mutations produced by transposon-mutagenesis in Antirrhinum
majus. Genes Dev. 4,1483
-1493.
Chung, Y. Y., Kim, S. R., Finkel, D., Yanofsky, M. F. and An, G. (1994). Early flowering and reduced apical dominance result from ectopic expression of a rice MADS box gene. Plant Mol. Biol. 26,657 -665.[CrossRef][Medline]
Chung, Y. Y., Kim, S. R., Kang, H. G., Noh, Y. S., Park, M. C., Finkel, D. and An, G. (1995). Characterization of two rice MADS box genes homologous to GLOBOSA. Plant Sci. 109, 45-56.[CrossRef]
Coen, E. S. and Meyerowitz, E. M. (1991). The war of the whorls: genetic interactions controlling flower development. Nature 353,31 -37.[CrossRef][Medline]
Dahrgren, R. M. T., Clifford, H. T. and Yeo, P. F. (1985). The Families of the Monocotyledons. Springer-Verlag, Berlin.
Day, C. D., Galgoci, B. F. C. and Irish, V. F. (1995). Genetic ablation of petal and stamen primordia to elucidate cell interactions during floral development. Development 121,2887 -2895.[Abstract]
Drews, G. N., Bowman, J. L. and Meyerowitz, E. M. (1991). Negative Regulation of the Arabidopsis Homeotic Gene AGAMOUS by the APETALA2 Product. Cell 65,991 -1002.[CrossRef][Medline]
Fladung, M., Bossinger, G., Roeb, G. W. and Salamini, F. (1991). Correlated alterations in leaf and flower morphology and rate of leaf photosynthesis in a midribless (mbl) mutant of Panicum maximum Jacq. Planta 184,356 -361.
Goto, K. and Meyerowitz, E. M. (1994). Function
and regulation of the Arabidopsis floral homeotic gene
PISTILLATA. Genes Dev.
8,1548
-1560.
Goto, K., Kyozuka, J. and Bowman, J. L. (2001). Turning floral organs into leaves, leaves into floral organs. Curr. Opin. Genet. Dev. 11,449 -456.[CrossRef][Medline]
Greco, R., Stagi, L., Colombo, L., Angenent, G. C., Sari-Gorla, M. and Pè, M. E. (1997). MADS box genes expressed in developing inflorescences of rice and sorghum. Mol. Gen. Genet. 253,615 -623.[CrossRef][Medline]
Hackel, E. (1887). Gramineae. In Die natürlichen Pflanzenfamilien (ed. A. Engler and K. Prantl). Verlag von Wilhelm Engelmann. Leipzig.
Hicks, G. S. and Sussex, I. M. (1971). Organ regeneration in sterile culture after median bisection of the flower primordia of Nicotiana tabacum. Bot. Gaz. 132,350 -363.[CrossRef]
Huijser, P., Klein, J., Lönnig, W.-E., Meijer, H., Saedler, H. and Sommer, H. (1992). Bracteomania, an inflorescence anomaly, is caused by the loss of function of the MADS-box gene squamosa in Antirrhinum majus. EMBO J. 11,1239 -1249.[Medline]
Hutchingson, J. (1934). The Families of Flowering Plants: Volume II Monocotyledons. Maxmillan and Co., Ltd. London.
Iwata, N. and Omura, T. (1971). Linkage analysis by reciprocal translocation method in rice plants (Oryza sativa L.). II. Linkage groups corresponding to the chromosomes 5,6,8,9,10 and 11. Sci. Bull. Fac. Agr. Kyushu Univ. 25, 137-153. (in Japanese with English summary).
Jack, T., Brockman, L. L. and Meyerowitz, E. M. (1992). The homeotic gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell 68,683 -697.[CrossRef][Medline]
Jack, T., Fox, G. L. and Meyerowitz, E. M. (1994). Arabidopsis homeotic gene APETALA3 ectopic expression: transcriptional and posttranscriptional regulation determine floral organ identity. Cell 76,703 -716.[CrossRef][Medline]
Jeon, J. S., Jang, S., Lee, S., Nam, J., Kim, C., Lee, S. H.,
Chung, Y. Y., Kim, S. R., Lee, Y. H., Cho, Y. G. and An, G.
(2000). leafy hull sterile is a homeotic mutation in a
rice MADS box gene affecting rice flower development. Plant
Cell 12,871
-884.
Joufuku, K. D., den Boer, B. G. W., van Montagu, M. and Okamuro, J. K. (1994). Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell 6,1211 -1225.[Abstract]
Kang, H. G., Noh, Y. S., Chung, Y. Y., Cocta, M. A., An, K. and An, G. (1995). Phenotypic alterations of petal and sepal by ectopic expression of a rice MADS box gene in tobacco. Plant Mol. Biol. 29,1 -10.[CrossRef][Medline]
Kang, H. G., Jeon, J. S., Lee, S. and An, G. (1998). Identification of class B and class C floral organ identity genes from rice plants. Plant. Mol. Biol. 38,1021 -1029.[CrossRef][Medline]
Kouchi, H. and Hata, S. (1993). Isolation and characterization of novel nodulin cDNAs representing genes expressed at early stages of soybean nodule development. Mol. Gen. Genet. 238,106 -119.[Medline]
Kyozuka, J., Kobayashi, T., Morita, M. and Shimamoto, K. (2000). Spatially and temporally regulated expression of rice MADS box genes with similarity to Arabidopsis class A, B and C genes. Plant Cell Physiol. 41,710 -718.
Kyozuka, J. and Shimamoto, K. (2002). Ectopic
expression of OsMADS3, a rice ortholog of AGAMOUS, caused a
homeotic transformation of lodicules to stamens in transgenic rice plants.
Plant Cell Physiol. 43,130
-135.
Liu, H. X. and Filipowicz, W. (1996). Mapping of branchpoint nucleotides in mutant pre-mRNAs expressed in plant cells. Plant J. 9,381 -389.[CrossRef][Medline]
Liu, Z., Franks, R. G. and Klink, V. P. (2000).
Regulation of gynoecium marginal tissue formation by LEUNIG and
AINTEGUMENTA. Plant Cell
12,1879
-1892.
Lopez-Dee, Z. P., Wittich, I. J., Pe, M., Rigola, D., Del Buono, I., Gorla, M. S., Kater, M. M. and Colombo, L. (1999). OsMADS13, a novel rice MADS-box gene expressed during ovule development. Dev Genet. 25,237 -244.[CrossRef][Medline]
Mandel, M. A., Gustafson-Brown, C., Savidge, B. and Yanofsky, M. F. (1992). Molecular characterization of the Arabidopsis floral homeotic gene APETALA1.Nature 360,273 -277.[CrossRef][Medline]
Mena, M., Mandel, M. A., Lerner, D. R., Yanofsky, M. F. and Schmidt, R. J. (1995). A characterization of the MADS-box gene family in maize. Plant J. 8, 845-854.[CrossRef][Medline]
Mena, M., Ambrose, B. A., Meeley, R. B., Briggs, S. P.,
Yanofsky, M. F. and Schmidt, R. J. (1996). Diversification of
C-function activity in maize flower development.
Science 274,1537
-1540.
Moon, Y. H., Jung, J. Y., Kang, H. G. and An, G. (1999). Identification of a rice APETALA3 homologue by yeast two-hybrid screening. Plant Mol. Biol. 40,167 -177.[CrossRef][Medline]
Naito, S., Dube, P. H. and Beachy, R. N. (1988). Differential expression of a'-conglycinin and b subunit genes in transgenic plants. Plant Mol. Biol. 11,109 -123.[CrossRef]
Orozco, B. M., McClung, C. R., Werneke, J. M. and Ogren, W. L. (1993). Molecular basis of the ribulose-1,5-bisphosphate carboxylase/oxygenase activase mutation in Arabidopsis thaliana is a guanine-to-adenine transition at the 5'-splice junction of intron 3. Plant Physiol. 102,227 -232.[Abstract]
Pelaz, S., Ditta, G. S., Baumann, E., Wisman, E. and Yanofsky, M. F. (2000). B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature 405,200 -203.[CrossRef][Medline]
Rao, S. A., Mengesha, M. H. and Reddy, C. R.
(1988). Characteristics, inheritance, and allelic relationships
of midribless mutants in pearl millet. J. Hered.
79, 18-20.
Sakai, H., Medrano, L. J. and Meyerowitz, E. M. (1995). Role of SUPERMAN in maintaining Arabidopsis floral whorl boundaries. Nature 378,199 -203.[CrossRef][Medline]
Sakai, H., Krizek, B. A., Jacobsen, S. E. and Meyerowitz, E.
M. (2000). Regulation of SUP expression identifies
multiple regulators involved in Arabidopsis floral meristem
development. Plant Cell
12,1607
-1618.
Schmidt, R. J., Veit, B., Mandel, M. A., Mena, M, Hake, S. and
Yanofsky, M. F. (1993). Identification and molecular
characterization of ZAG1, the maize homolog of the
Arabidopsis floral homeotic gene AGAMOUS. Plant
Cell 5,729
-737.
Schultz, E. A., Pickett, F. B. and Haughn, G. W.
(1991). The FLO10 gene product regulates the expression
domain of homeotic gene AP3 and PI in Arabidopsis
flowers. Plant Cell 3,1221
-1237.
Schwarz-Sommer, Z., Huijser, P., Nacken, W., Seadler, H. and
Sommer, H. (1990). Genetic control of flower development by
homeotic genes in Antirrhinum majus. Science
250,931
-936.
Sommer, H., Beltrán, J.-P., Huijser, P., Pape, H., Lönnig, W. E., Saedler, H. and Schwarz-Sommer, Z. (1990). Deficiens, a homeotic gene involved in the control of flower morphogenesis in Antirrhinum majus: the protein shows homology to transcription factors. EMBO J. 9, 605-613.[Medline]
Theissen, G., Strater, T., Fischer, A. and Saedler, H. (1995). Structural characterization, chromosomal localization and phylogenetic evaluation of two pairs of AGAMOUS-like MADS-box genes from maize. Gene 156,155 -166.[CrossRef][Medline]
Tsuchiya, T. (1962). Radiation breeding in two-rowed barley. Seiken Ziho 14, 21-34.
Tsuchiya, T. (1969). Characteristics and inheritance of radiation induced mutations in barley: some extreme mutations. In: International Atomic Energy Agency Publication, pp573 -690, Vienna.
Tröbner, W., Ramirez, L., Motte, P., Hue, I., Huijser, P., Lönnig, W. E., Saedler, H., Sommer, H. and Schwarz-Sommer, Z. (1992). GLOBOSA: a homeotic gene which interacts with DEFICIENS in the control of Antirrhinum floral organogenesis. EMBO J. 11,4693 -4704.[Medline]
Yanofsky, M. F., Ma, H., Bowman, J. L., Drews, G. N., Feldmann, K. A. and Meyerowitz, E. M. (1990). The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature 346, 35-39.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
V. F. Irish Evolution of petal identity J. Exp. Bot., July 1, 2009; 60(9): 2517 - 2527. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Soltis, S. F. Brockington, M.-J. Yoo, A. Piedrahita, M. Latvis, M. J. Moore, A. S. Chanderbali, and D. E. Soltis Floral variation and floral genetics in basal angiosperms Am. J. Botany, January 1, 2009; 96(1): 110 - 128. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Hileman and V. F. Irish More is better: the uses of developmental genetic data to reconstruct perianth evolution Am. J. Botany, January 1, 2009; 96(1): 83 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Rasmussen, E. M. Kramer, and E. A. Zimmer One size fits all? Molecular evidence for a commonly inherited petal identity program in Ranunculales Am. J. Botany, January 1, 2009; 96(1): 96 - 109. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Thompson and S. Hake Translational Biology: From Arabidopsis Flowers to Grass Inflorescence Architecture Plant Physiology, January 1, 2009; 149(1): 38 - 45. [Full Text] [PDF] |
||||
![]() |
Y. Zhu, T. Saraike, Y. Yamamoto, H. Hagita, S. Takumi, and K. Murai orf260cra, a Novel Mitochondrial Gene, is Associated with the Homeotic Transformation of Stamens into Pistil-Like Structures (Pistillody) in Alloplasmic Wheat Plant Cell Physiol., November 1, 2008; 49(11): 1723 - 1733. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ohmori, M. Abiko, A. Horibata, and H.-Y. Hirano A Transposon, Ping, is Integrated into Intron 4 of the DROOPING LEAF Gene of Rice, Weakly Reducing its Expression and Causing a Mild Drooping Leaf Phenotype Plant Cell Physiol., August 1, 2008; 49(8): 1176 - 1184. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-I. Itoh, Y. Sato, and Y. Nagato The SHOOT ORGANIZATION2 Gene Coordinates Leaf Domain Development Along the Central-Marginal Axis in Rice Plant Cell Physiol., August 1, 2008; 49(8): 1226 - 1236. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Barabe, C. Lacroix, and B. Jeune Quantitative Developmental Analysis of Homeotic Changes in the Inflorescence of Philodendron (Araceae) Ann. Bot., May 1, 2008; 101(7): 1027 - 1034. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-G. Yao, S. Ohmori, M. Kimizu, and H. Yoshida Unequal Genetic Redundancy of Rice PISTILLATA Orthologs, OsMADS2 and OsMADS4, in Lodicule and Stamen Development Plant Cell Physiol., May 1, 2008; 49(5): 853 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Drea, L. C. Hileman, G. de Martino, and V. F. Irish Functional analyses of genetic pathways controlling petal specification in poppy Development, December 1, 2007; 134(23): 4157 - 4166. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Adam, S. Jouannic, F. Morcillo, J.-L. Verdeil, Y. Duval, and J. W. Tregear Determination of Flower Structure in Elaeis guineensis: Do Palms use the Same Homeotic Genes as Other Species? Ann. Bot., July 1, 2007; 100(1): 1 - 12. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shitsukawa, C. Tahira, K.-i. Kassai, C. Hirabayashi, T. Shimizu, S. Takumi, K. Mochida, K. Kawaura, Y. Ogihara, and K. Murai Genetic and Epigenetic Alteration among Three Homoeologous Genes of a Class E MADS Box Gene in Hexaploid Wheat PLANT CELL, June 1, 2007; 19(6): 1723 - 1737. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Yadav, K. Prasad, and U. Vijayraghavan Divergent Regulatory OsMADS2 Functions Control Size, Shape and Differentiation of the Highly Derived Rice Floret Second-Whorl Organ Genetics, May 1, 2007; 176(1): 283 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Adam, S. Jouannic, Y. Orieux, F. Morcillo, F. Richaud, Y. Duval, and J. W. Tregear Functional characterization of MADS box genes involved in the determination of oil palm flower structure J. Exp. Bot., April 1, 2007; 58(6): 1245 - 1259. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bortiri and S. Hake Flowering and determinacy in maize J. Exp. Bot., March 3, 2007; (2007) erm015v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Kramer, L. Holappa, B. Gould, M. A. Jaramillo, D. Setnikov, and P. M. Santiago Elaboration of B Gene Function to Include the Identity of Novel Floral Organs in the Lower Eudicot Aquilegia PLANT CELL, March 1, 2007; 19(3): 750 - 766. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hirai, T. Kamimura, and A. Kanno The Expression Patterns of Three Class B Genes in Two Distinctive Whorls of Petaloid Tepals in Alstroemeria ligtu Plant Cell Physiol., February 1, 2007; 48(2): 310 - 321. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Whipple, M. J. Zanis, E. A. Kellogg, and R. J. Schmidt Conservation of B class gene expression in the second whorl of a basal grass and outgroups links the origin of lodicules and petals PNAS, January 16, 2007; 104(3): 1081 - 1086. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Chu, Q. Qian, W. Liang, C. Yin, H. Tan, X. Yao, Z. Yuan, J. Yang, H. Huang, D. Luo, et al. The FLORAL ORGAN NUMBER4 Gene Encoding a Putative Ortholog of Arabidopsis CLAVATA3 Regulates Apical Meristem Size in Rice Plant Physiology, November 1, 2006; 142(3): 1039 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Kater, L. Dreni, and L. Colombo Functional conservation of MADS-box factors controlling floral organ identity in rice and Arabidopsis J. Exp. Bot., October 1, 2006; 57(13): 3433 - 3444. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Preston and E. A. Kellogg Reconstructing the Evolutionary History of Paralogous APETALA1/FRUITFULL-Like Genes in Grasses (Poaceae) Genetics, September 1, 2006; 174(1): 421 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Rijpkema, S. Royaert, J. Zethof, G. van der Weerden, T. Gerats, and M. Vandenbussche Analysis of the Petunia TM6 MADS Box Gene Reveals Functional Divergence within the DEF/AP3 Lineage PLANT CELL, August 1, 2006; 18(8): 1819 - 1832. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamaguchi, D. Y. Lee, A. Miyao, H. Hirochika, G. An, and H.-Y. Hirano Functional Diversification of the Two C-Class MADS Box Genes OSMADS3 and OSMADS58 in Oryza sativa PLANT CELL, January 1, 2006; 18(1): 15 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-C. Tsai, P.-F. Lee, H.-I. Chen, Y.-Y. Hsiao, W.-J. Wei, Z.-J. Pan, M.-H. Chuang, C.-S. Kuoh, W.-H. Chen, and H.-H. Chen PeMADS6, a GLOBOSA/PISTILLATA-like Gene in Phalaenopsis equestris Involved in Petaloid Formation, and Correlated with Flower Longevity and Ovary Development Plant Cell Physiol., July 1, 2005; 46(7): 1125 - 1139. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kurata, K. Miyoshi, K.-I. Nonomura, Y. Yamazaki, and Y. Ito Rice Mutants and Genes Related to Organ Development, Morphogenesis and Physiological Traits Plant Cell Physiol., January 15, 2005; 46(1): 48 - 62. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bommert, N. Satoh-Nagasawa, D. Jackson, and H.-Y. Hirano Genetics and Evolution of Inflorescence and Flower Development in Grasses Plant Cell Physiol., January 15, 2005; 46(1): 69 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-I. Itoh, K.-I. Nonomura, K. Ikeda, S. Yamaki, Y. Inukai, H. Yamagishi, H. Kitano, and Y. Nagato Rice Plant Development: from Zygote to Spikelet Plant Cell Physiol., January 15, 2005; 46(1): 23 - 47. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Whipple, P. Ciceri, C. M. Padilla, B. A. Ambrose, S. L. Bandong, and R. J. Schmidt Conservation of B-class floral homeotic gene function between maize and Arabidopsis Development, December 15, 2004; 131(24): 6083 - 6091. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vandenbussche, J. Zethof, S. Royaert, K. Weterings, and T. Gerats The Duplicated B-Class Heterodimer Model: Whorl-Specific Effects and Complex Genetic Interactions in Petunia hybrida Flower Development PLANT CELL, March 1, 2004; 16(3): 741 - 754. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Eckardt What Makes a Grass? DROOPING LEAF Influences Flower and Leaf Development in Rice PLANT CELL, February 1, 2004; 16(2): 291 - 293. [Full Text] [PDF] |
||||
![]() |
E. M. Kramer, M. A. Jaramillo, and V. S. Di Stilio Patterns of Gene Duplication and Functional Evolution During the Diversification of the AGAMOUS Subfamily of MADS Box Genes in Angiosperms Genetics, February 1, 2004; 166(2): 1011 - 1023. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamaguchi, N. Nagasawa, S. Kawasaki, M. Matsuoka, Y. Nagato, and H.-Y. Hirano The YABBY Gene DROOPING LEAF Regulates Carpel Specification and Midrib Development in Oryza sativa PLANT CELL, February 1, 2004; 16(2): 500 - 509. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lee, J. Kim, J.-S. Son, J. Nam, D.-H. Jeong, K. Lee, S. Jang, J. Yoo, J. Lee, D.-Y. Lee, et al. Systematic Reverse Genetic Screening of T-DNA Tagged Genes in Rice for Functional Genomic Analyses: MADS-box Genes as a Test Case Plant Cell Physiol., December 15, 2003; 44(12): 1403 - 1411. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Prasad and U. Vijayraghavan Double-Stranded RNA Interference of a Rice PI/GLO Paralog, OsMADS2, Uncovers Its Second-Whorl-Specific Function in Floral Organ Patterning Genetics, December 1, 2003; 165(4): 2301 - 2305. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Watanabe and K. Okada Two Discrete cis Elements Control the Abaxial Side-Specific Expression of the FILAMENTOUS FLOWER Gene in Arabidopsis PLANT CELL, November 1, 2003; 15(11): 2592 - 2602. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||