|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00286
National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK
* Author for correspondence (e-mail: calexan{at}nimr.mrc.ac.uk)
Accepted 11 November 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, Transcriptional repression and activation, Engrailed, Hedgehog, Wingless signaling, Extradenticle, Homeotic genes
| INTRODUCTION |
|---|
|
|
|---|
To investigate the activation function of En in vivo, we engineered a form
of En that can only function as an activator by removing its repressor region
and replacing it by the transactivation domain of VP16 (thus making VP16En).
Using this tool we show that one mode of activation by En involves the
repression of a repression. However, we show that, in parallel, En also
functions as a true activator and that such activation requires Wg signaling.
Because no clear activation domain is recognizable in En
(Han and Manley, 1993
), we
presume that positive targets can recruit cofactors that provide an activation
function (reviewed by Mannervik et al.,
1999
). One possible cofactor is the homeodomain-containing protein
encoded by extradenticle (exd), given that it is required
for positive autoregulation by En (Peifer
and Wieschaus, 1990
). Moreover, activation of ph by En
also requires Exd (Serrano and Maschat,
1998
) and in vitro binding experiments have shown that Exd
increases the binding of En on specific `activation sites'
(Peltenburg and Murre, 1996
;
Serrano and Maschat, 1998
).
Overall, these analyses have led to the view that Exd could be a DNA binding
specificity factor that operates on positively regulated genes
(Chan et al., 1994
). One
problem with this model is that the vertebrate homologs of Exd, the PBX family
members, have been implicated in negative (as well as positive) target
recognition, at least in vitro (Asahara et
al., 1999
; Saleh et al.,
2000
).
We found that VP16En requires Exd to activate positive targets at the
anterior of the germ band. In other words, the VP16 activation domain does not
override the need for Exd. This reinforces the view that the role of Exd is in
target recognition and not in providing an activation domain. Indeed, at the
anterior of the germ band, Exd is required for repression, as well as
activation, by En. Thus, in this instance at least, Exd is not an
activation-specific cofactor. In the abdominal region, Exd is dispensable for
repression. Instead, in this domain, the homeotic proteins Ubx and Abd-A
contribute to repression by En. We suggest that these two
homeodomain-containing proteins (or a target thereof) could play the role of
Exd in a region of the embryo where Exd levels are low
(Rauskolb and Wieschaus, 1994
;
Mann and Abu-Shaar, 1996
;
Aspland and White, 1997
).
| MATERIALS AND METHODS |
|---|
|
|
|---|
34B (Grossniklaus
et al., 1992
The following transgenic stocks were used: paired-Gal4 [made by L.
Fasano and C. Desplan (see Yoffe et al.,
1995
)], armadillo-Gal4
(Sanson et al., 1996
),
ftz-Gal4 (Lecourtois et al.,
2001
), UAS-en
(Guillen et al., 1995
),
UAS-Arm* [UAS-ArmS10
(Pai et al., 1997
)],
UAS-wg (Lawrence et al.,
1995
), UAS-Ubx-IVa (Netter et
al., 1998
), UAS-Abd-A
(Michelson, 1994
), UAS-Antp
(B. Bello, NIMR, London).
Design of VP16En
A PCR product corresponding to residues 282 to 522 of En [region EFGH as
defined by Han and Manley (Han and Manley,
1993
)] was cloned as a XbaI-BclI fragment in a
vector containing an HA-tagged version of the HSV VP16 activation domain
(YCGLVP16). The chimeric cDNA was then cut out with
EagI-Asp718 and cloned in pUAST digested with NotI
and Asp718.
Cloning of the 3' UTR region of en
In order to distinguish endogenous en transcripts from those
encoded by UAS-en, we designed a probe that encompasses a region of
the en gene not present in the UAS-en construct. The
3'UTR of en from the EcoRI site at position 2017 to
position 2421 (Poole et al.,
1985
) was amplified with the following primers.
Forward oligo: CCGTAGCGAATTCGAGCTGTAAG; reverse oligo: GATCTCTAGAATTTTTTTTCCCATAATTG (an XbaI site was added). The PCR product was subsequently cut with EcoRI and XbaI and cloned in pBS-KS.
Embryo preparation
For RNA single and double in situ hybridization, embryos were fixed and
hybridized with digoxygenin- or fluorescein-labeled single-stranded RNA probe
as described by Alexandre et al. (Alexandre
et al., 1999
). For double labeling with an antibody and an RNA
probe, the same protocol as described in Alexandre et al.
(Alexandre et al., 1999
) was
used except that the hybridization was performed at 63°C.
The following cDNAs were used: en
(Poole et al., 1985
),
hh (gift from M. van den Heuvel, Oxford University), wg, ci,
ptc (gift from Phil Ingham, Sheffield University), slp1 (gift
from K. Cadigan, University of Michigan, Ann Harbor) and lacZ. The
following antibodies were used: Anti-Ubx
(White and Wilcox, 1984
),
Anti-Abd-A (Macias et al.,
1990
), Anti-Antp [Mab 8C11
Condic et al., 1991
)], Anti-En
(gift from C. H. Girdham and P. H. O'Farrell, University of California at San
Francisco) and Anti-HA (BabCo).
| RESULTS |
|---|
|
|
|---|
|
The En protein harbors a domain, located between residues 168 and 298, that
mediates potent repression in Drosophila cells and a variety of
heterologous systems (see Introduction). This well-defined repressor activity
suggests that En might exert its positive transcriptional effects indirectly,
by repressing a repressor. To address this possibility, we sought to invert
the activity of En by replacing its repressor region [region ABCD as defined
by Han and Manley (Han and Manley,
1993
)] with the strong activator domain of the HSV viral protein
VP16 (Triezenberg et al.,
1988
) (Fig. 2). The
resulting protein is called VP16En. As outlined in the diagram in
Fig. 2, we reasoned that if
wild-type En activates transcription by repressing a repressor (e.g. R), then
VP16En should repress target genes such as hh and en. By
contrast, if En acts as an activator, whether directly or indirectly, VP16En
should still activate hh and en.
|
Before testing these hypotheses, we asked whether the activation domain
grafted onto En was functional. We assessed the effect of VP16En on the
transcription of ci, a gene repressed by en. As expected,
expression of VP16En with the paired-Gal4 driver leads to ectopic
transcription of ci (Fig.
3A,B). This may or may not be a direct effect of VP16En. However,
inversion of activity by VP16 confirms that regulation of ci
expression by En requires bona fide repressor activity. If this were not the
case, no inversion would be seen (see diagram in
Fig. 2). Two additional genes,
wg and ptc, are repressed by En
(Yoffe et al., 1995
) (and not
shown). As with ci, this activity is reversed by the presence of the
VP16 activation domain: VP16En activates transcription of wg
(Fig. 3C,D) and ptc
(not shown). Because Ci is a known positive effector of wg
transcription (Alexandre et al.,
1996
), the activating effect of VP16En on wg expression
could conceivably be mediated by Ci (VP16En activates ci expression).
However, as shown in Fig. 3E,F,
VP16En activates wg expression, even in the absence of Ci. Thus, Ci
is not a required intermediate for VP16En to activate wg
transcription. Importantly for the remainder of this paper, replacement of the
repression domain of En with the VP16 activation domain does reverse
repression into activation.
|
Having established that VP16En is functional allowed us to examine its effects on the two positive targets of En. As shown in Fig. 4, VP16En driven by paired-Gal4 represses the expression of both hh and en. In such embryos, hh transcription begins to decay at stage (st) 10 and, by late st12, hh transcripts are absent in the segments where VP16En is expressed (Fig. 4B). en transcripts follow a similar kinetics of disappearance and by st12, en is completely repressed in the stripes where VP16En is expressed (Fig. 4D). It is highly unlikely that VP16En acts as a true repressor and, therefore, VP16En probably represses hh expression via an intermediate repressor (R). Accordingly, in the wild type, En would repress the expression of R, which itself would repress hh and en expression (see diagram in Fig. 2).
|
R is encoded by slp
Could the ci gene encode R? Expression of ci is clearly
repressed by En (see above). And the Ci protein can be processed by cleavage
into a repressor of hh transcription
(Dominguez et al., 1996
;
Aza-Blanc et al., 1997
).
However, as ci mutants are rescued by a transgene encoding an
uncleavable form of Ci (Methot and Basler,
1999
), the repressor form of ci is dispensable for
embryogenesis. Therefore, Ci is not an essential intermediate for the
activating function of En.
Other potential candidates for R are Slp1 and Slp2, two homologous zinc
finger proteins encoded by adjacent co-regulated genes
(Grossniklaus et al., 1992
).
In various embryonic assays, these genes appear to be redundant. Therefore, we
used deficiencies that remove both genes to assay their function, and we refer
to them as one gene, slp. slp is a candidate for R as it represses
the transcription of en and hh
(Cadigan et al., 1994
).
Conversely, it is itself repressed by En given that ectopically expressed
en (with paired-Gal4) completely suppresses slp
transcription as early as st10 (Fig.
5B). As expected then, VP16En activates slp expression
(Fig. 5D). In summary, En
represses slp, which itself represses hh (and en),
implying that slp could be R, at least within the regions of the
epidermis where these interactions occur.
|
En is an activator (in addition to being a repressor)
Our results so far suggest that En activates target genes via the
repression of slp expression. However, we cannot exclude the
possibility that, in parallel, En could perform a positive role on its own. To
investigate this possibility, we assessed the effect of exogenous En on
hh expression in slp-deficient embryos. In the absence of
slp, en (and hh) expression decays for lack of Wg signaling,
especially in odd-numbered segments (Fig.
6A,B) (see Cadigan et al.,
1994
). Therefore, we used the paired-Gal4 driver to
reintroduce En in these segments and assayed the effect on hh
expression. As shown in Fig.
6C, hh expression is activated (albeit not strongly, see
below). Thus, En still activates hh expression in the absence of Slp.
This could conceivably occur via another intermediate repressor (R').
However, in slp mutants, in contrast to the slp+
situation, VP16En activates hh expression (compare
Fig. 6D with
Fig. 4B) and also that of
en (not shown). We conclude that no other `dominant' repressor
operates, at least in the domain defined by paired-Gal4. If another
repressor existed, its expression would be activated by VP16En and this would
prevent activation of hh expression in slp mutant embryos.
Note that, with the Slp repressor out of the way, En and VP16En have a similar
effect on hh expression (Fig.
6C,D) although VP16En seems to be more potent (an issue to which
we will return). According to the logic outlined in
Fig. 2, `same sign' action of
En and VP16En suggests that En functions as a bona fide activator. It could
either act directly onto its positive targets or it could activate an
intermediate activator.
|
Activation of hh expression by En is weaker in slp
mutants than in slp+ embryos (compare
Fig. 6C with
Fig. 1D). Because slp
mutants lose wg expression prematurely
(Cadigan et al., 1994
), it
could be that Wg signaling contributes to the activation of hh
expression. To address this possibility, we assayed hh expression in
en- slp- double mutant in which
exogenous Wg was introduced with paired-Gal4. Weak but significant
activation ensues (Fig. 7A),
indicating that Wg signaling does activate hh expression even in the
complete absence of En activity. Thus, either En or Wg signaling alone has a
weak effect. Co-expression experiments show that these effects are additive
(possibly synergistic): co-expression of En and activated Armadillo (to
activate Wg signaling) in the absence of Slp leads to strong expression of
hh (Fig. 7D). This
additive effect explains why VP16En is more potent than En in
slp- embryos as VP16En activates wg expression in
addition to activating that of en and hh. Note that the
three conditions that we have shown to be required for maximal activation of
hh expression (Wg signaling, presence of En and absence of Slp) are
fulfilled in cells that normally express hh in wild-type embryos. The
contribution of Wg signaling to activation by En is also illustrated in
wg mutant that express En under the control of paired-Gal4.
In such embryos, only weak (barely detectable) activation of hh
expression is seen while embryos co-expressing En and activated Armadillo
(otherwise wild type) show strong hh expression
(Fig. 7E,F).
|
Exd and Homothorax are required for repression as well as
activation by En
Because En does not contain a recognizable activation domain, it is likely
that cofactors modify its activity on positive targets. Indeed, it has been
suggested that Exd is an activation-specific cofactor of En
(Peifer and Wieschaus, 1990
;
Heemskerk et al., 1991
;
Serrano and Maschat, 1998
).
Furthermore, Exd's activity is regulated by Wg signaling, at least in leg
imaginal disks (Mann and Abu-Shaar,
1996
) and this could potentially explain the contribution of Wg
signaling in activation by En. Consistently with a role of Exd in activation
by En, neither en (not shown) nor hh is activated by
paired-Gal4-driven En in exd- embryos
(Fig. 8B; compare with
activation in the presence of exd+ in
Fig. 8C). In all its known
functions, Exd requires the presence of another homeobox-containing protein,
Homothorax (Hth) (Kurant et al.,
1998
; Rieckhof et al.,
1997
; Pai et al.,
1998
). As expected then, activation of targets (like hh
and en itself) by En (driven by paired-Gal4) is severely
compromised in hth64-1 mutant embryos,
(Fig. 8D). Therefore, the
hth64-1 mutation provides an alternative way to remove
exd function (although we recognize that Hth may be more than just an
accessory to Exd; see Discussion).
|
How does Exd/Hth contribute to activation by En? It has been suggested that Exd could mask the repressor domain of Hox proteins while at the same time perhaps providing an activation domain [e.g. for Deformed (Pinsonnault et al., 1997)]. If, in the case of En, this was the sole function of Exd, VP16En would not require Exd to activate target genes because an activation domain would be provided exogenously. We tested this possibility. For positive targets, the result is simple. VP16En was expressed with paired-Gal4 in hth- slp- doublemutant embryos (Slp was removed to avoid its dominant repressive activity). No activation of either en (not shown) or hh (Fig. 9B) is seen. This shows that Exd is required for VP16En to activate transcription even though VP16En carries its own activation domain. This is consistent with in vitro data showing that Exd is required for positive target recognition. For negative targets, one might expect the activity of VP16En to not be affected by the removal of Exd activity. Surprisingly, this is true only in parts of the germ band. In abdominal (A) segments, at least in A1, A3, A5 and A7 where paired-Gal4 is active, ci, wg and slp are activated by VP16En even in a hth- background. By contrast, at the anterior of the germ band for example, in the second thoracic segment (T2) activation of the same targets does require Hth. This difference is illustrated in Fig. 9D,F, using wg and slp as targets. It can be seen that, in the hth mutant, no activation occurs in T2 but it does in A1. Therefore, in T2, and also in more anterior head segments (not shown), VP16En requires exd/hth to activate both negative and positive targets of En. One probable interpretation is that Exd helps VP16En to recognize all (including negative) targets of En. Thus, we might expect repression by En to require exd/hth in anterior segments.
|
As expected, we find that, in embryos devoid of maternal and zygotic Exd (or lacking zygotic Hth), exogenous expression of En with the paired-Gal4 driver can only repress the expression of both ci (Fig. 10A) and slp (Fig. 10B) in abdominal segments (from A1 to A7). No repression is seen at the anterior of the germ band (compare segments T2 and A1 in Fig. 10). By contrast, Exd is required for activation by En throughout the germband. This is illustrated in Fig. 10C, which shows that in exd- embryos, activation of hh transcription by ectopic En is severely compromised both in T2 and in A1. Importantly, the obligate role of Exd in repression at the anterior of the germ band shows that Exd is not an `activation-specific' cofactor.
|
Role of the two homeotic proteins Ubx and Abd-A in repression by
En
Exd/Hth is required for En to repress target genes in T2 (and more
anteriorly) but not in the abdomen. What could be the genetic basis of this
difference? One obvious possibility is that genes of the Bithorax complex are
involved given that they are differentially expressed along the A-P axis and
they specify segmental identity (Akam and
Martinez Arias, 1985
; Karch et
al., 1990
; Macias et al.,
1990
). In particular, in the absence of Ubx and Abd-A, abdominal
segments such as A1 acquire a thoracic phenotype. Conversely, overexpression
of either Ubx or Abd-A converts thoracic segments into abdominal ones.
Consistent with a role of homeotic genes in En function, coexpression of Abd-A
and En leads to the repression of ci transcription in T2 of
hth- embryos (Fig.
11A), and the same is true for coexpressed Ubx and En (not shown).
Coexpression is required because any factor alone fails to repress ci
expression in T2 of hth mutant embryos (see
Fig. 11B for Abd-A and
Fig. 10A for En; not shown for
Ubx). Note also that coexpression of En and Antennapedia (Antp), a closely
related Hox protein, does not lead to repression in T2 of hth mutants
(Fig. 11C). We conclude that
the presence of Ubx or Abd-A specifically allows En to repress targets in T2
in hth/exd mutant embryos. One possible interpretation is that
overexpressed Ubx or Abd-A gives T2 an abdominal character and thus renders
repression by En independent of exd/hth (as it is in A1-A7).
Alternatively, Ubx or Abd-A (or a target gene thereof) could fulfill the role
of Exd/Hth in helping En repress its negative targets in areas where Exd is
low.
|
To further confirm the role of homeotic products, we assayed the effect of Ubx on VP16En activity. As shown above, VP16En activates the expression of negative targets of En such as wg (Fig. 9C) and, in the thorax, Hth is absolutely required for this to occur (Fig. 9D). Fig. 11E shows that co-expression of Ubx enables VP16En to activate wg expression in T2 of a hth mutant embryo.
The experiments above used ectopic expression to show the activity of Ubx
and Abd-A. We next investigated the issue of requirement using a
loss-of-function approach. No defect in En function has been reported in
embryos lacking Ubx and abd-A and, indeed, negative targets of En (such as
ci) are normally repressed in embryos homozygous for
Df(3R)Ubx109, which removes both Ubx and Abd-A (not shown).
Moreover, as shown in Fig.
11G, paired-Gal4-driven En represses ci
expression in Df(3R)Ubx109 embryos. Superficially then, Ubx and
Abd-A appear not to be required for repression by En. However, expression of
exd, as well as that of hth is upregulated in the germ band
of Bithorax complex mutants (Rauskolb and
Wieschaus, 1994
; Kurant et
al., 1998
) and this could therefore provide redundant cofactor
activity. To address this possibility, we assayed En's activity in embryos
lacking Ubx, abd-A and hth (Df(3R)Ubx109
hth64-1). Note that these embryos are still segmented and continue
to express paired-Gal4 in stripes (e.g.
Fig. 11I). Significantly,
ectopic En does not repress ci anywhere in the germ band of such
embryos (Fig. 11H). This
provides evidence that Ubx and Abd-A are normally part of the mechanism that
allows En to act on its negative targets in the abdomen.
| DISCUSSION |
|---|
|
|
|---|
The role of Slp
The repressor activity that lies between En and its positive targets is
encoded by slp1 and slp2. These two genes are repressed by
En and their products repress en expression (see also Kobayashi et
al., 2003). Importantly, Slp1 and Slp2 are the only dominant repressors that
stand between En and its positive targets, hh and en
at least in the paired-Gal4 domain. If another such repressor
existed, it would prevent VP16En from activating the expression of hh
(or en) in a slp mutant. Expression of slp at the
anterior, and of en at the posterior, of prospective parasegment
boundaries is initiated by the activity of pair-rule genes
(Martinez-Arias, 1993
;
Nasiadka and Krause, 1999
).
Mutual transcriptional repression ensures that neither factor can subsequently
`invade' the other's domain of expression after pair-rule genes have ceased to
function and when cell communication starts to dominate segmental patterning
and thus contributes to the stability of parasegment boundaries. Note that
slp is only expressed at the anterior of each stripe of en
expression (not at the posterior). It may be that no analogous repressive
function is needed at the posterior because the Wg pathway, which contributes
to activation by En, is not active there. Indeed, in otherwise wild-type
embryos, ectopic activation of Wg signaling is sufficient to cause posterior
expansion of en stripes
(Noordermeer et al.,
1992
).
En as an activator
The key evidence for En being a bona fide activator is that, in the absence
of slp, both En and VP16En activate hh transcription. This
result, and the argument outlined in Fig.
2, suggests either that En activates hh directly or that
it activates an intermediate activator of hh transcription. Either
way, we suggest that En must be capable of transcriptional activation (in
addition to repression). Note that in otherwise wild-type embryos, VP16En
formally represses the expression of hh and en
(Fig. 4). This led us to
believe initially that wild-type En acts solely via an intermediate repressor
since we could not see any positive effect of VP16En on the expression of
en or hh. As we know now, these were masked by the presence
of Slp. It was therefore essential to identify the intermediate repressor and
assess the effect of removing its activity in order to infer the true
activation function of En.
Wg signaling and activation by En
As shown in Fig. 7, Wg
signaling contributes to the activation of En's positive targets. We have not
investigated the temporal aspect of this requirement but earlier results
suggest that it is probably transient (see
Heemskerk et al., 1991
). Note
that Wg signaling is irrelevant to repression by En and that, even in cells
that are within the range of Wg, repression and activation (of distinct
targets) coexist. For example, in the normal domain of en expression,
ci is repressed and hh is activated. Therefore, Wg signaling
does not convert En from an activator to a repressor. Perhaps Wg signaling
helps the recruitment, on specific targets, of a cofactor needed to mask the
repressor domain of En, while at the same time providing an activation domain.
One candidate cofactor that could be regulated by Wg is the homeodomain
protein encoded by exd, a known cofactor of Hox gene activity in
vivo (Mann and Chan,
1996
; Mann and Abu-Shaar,
1996
). However, as we discuss below, Exd is not an
activation-specific cofactor and more work is therefore needed to understand
how Wg signaling contributes to the activating function of En.
The role of Exd
Two types of activities have been ascribed to Exd (for a review, see
Mann and Morata, 2000
).
According to the selective binding model, Exd could help En recognize positive
targets and assemble a transcription complex. Alternatively, or in addition,
Exd could mask the repressor domain of En and, at the same time, recruit an
activator (the so-called activity regulation model). We find in our assays
that adding a functional activation domain to En (as in VP16En) does not
override the need for Exd. This gives in vivo support to the selective binding
model and is consistent with in vitro studies, which have shown that Exd and
En can dimerize and bind DNA cooperatively
(van Dijk and Murre, 1994
;
Serrano and Maschat, 1998
).
Cooperativity requires the eh2 domain of En
(Peltenburg and Murre, 1996
),
a domain that is left intact in VP16En (see
Fig. 2). Because VP16En
requires Exd for in vivo activity, we conclude that the N-terminal half of En,
which is absent in VP16En, is not required for the interaction with Exd (see
also Serrano and Maschat,
1998
).
As we have shown, in thoracic segments, VP16En requires exd to act
on all En targets, positive and negative. This is the first indication that
Exd could be involved in negative (as well as positive) target recognition by
En (a suggestion made independently by Kobayashi et al., 2003). Indeed, we
found that, in thoracic segments, wild-type En requires Exd for repression of
its natural targets. This had presumably not been noticed previously because
endogenous expression of En is lost in the absence of Exd. That Exd could be
involved in repression is consistent with in vitro studies with PBX proteins
and earlier suggestions from in vivo work with Drosophila
(Ryoo and Mann, 1999
;
White et al., 2000
; Kobayashi
et al., 2003). Because Exd is required for both repression and activation, the
issue of what distinguishes activated targets from repressed ones remains
unresolved. Throughout the present study, we found that the two En-positive
targets, en and hh, are expressed identically in a variety
of experimental conditions. It may therefore be that the regulatory regions of
these two genes might contain unique features that make them positive
targets.
How does En activate targets?
As we have argued, En must be capable of activating transcription in the
appropriate context. Because En harbors a robust repressor domain, it is
likely that one or several cofactor(s) mask this domain and recruit an
activation function and, as discussed above, it is unlikely that Exd alone
provides such an activity. Nevertheless, the possible role of Hth is worth
discussing. In vitro, Hth binds DNA as a part of a ternary complex with Exd
and a Hox protein (Jacobs et al.,
1999
; Ryoo et al.,
1999
). Intriguingly, overexpression of an activator form of Hth
(VP16Hth) phenocopies the overexpression of wild-type Hth (VP16Hth mimics
overactive Hth) (Inbal et al.,
2001
). This suggests that the normal role of Hth is to bring an
activation domain to a complex a conclusion that contradicts our own
observation that Hth is required for both repression and activation by En. One
way to resolve this paradox would be to suggest that Hth has two distinct
roles: to help target recognition on negative and positive targets and, in
addition, to bring an activation domain onto positive targets. Of course
activation by En could also involve as yet unidentified activating cofactors.
Further progress will require the identification, within natural targets, of
enhancers that confer either activation or repression. Comparing these sites
and subsequent mutational and biochemical analysis could lead to a molecular
understanding of what distinguishes negative from positive targets.
The role of homeotic genes in repression by En
The most unexpected aspect of our results is that, in abdominal segments,
the Hox proteins Ubx and Abd-A are involved in repression by En. In formal
genetic assays, Ubx and Abd-A can substitute for Exd in helping En act on
negative targets. In the absence of Ubx, Abd-A and Exd, En can no longer
repress target genes. By contrast, two other Hox proteins, Antp and Abd-B
appear, not to be involved in En function.
Fig. 11C shows that Antp does
not help En repress targets in vivo even though its homeodomain differs from
that of Abd-A at only five positions. Likewise, Abd-B, a more distantly
related Hox protein, is also unlikely to participate in En function (not
shown). We conclude that the role of Ubx and Abd-A in repression by En is
specific.
How could ectopic Ubx or Abd-A allow En to repress targets in the absence
of Exd? It could be that this is mediated by wholesale transformation of
segmental identity [although such transformation would have to be
exd/hth-independent (see Rieckhof
et al., 1997
)]. Alternatively, Ubx and Abd-A could have a more
immediate involvement in En function. One can envisage that they could
regulate an as yet unidentified corepressor of En (although such regulation
would not require Exd). Alternatively, and more speculatively, Ubx and Abd-A
could serve as cofactors themselves in regions of the embryo where Exd levels
are low. Again, molecular analysis of negative targets will be needed to
discriminate these possibilities.
Homeotic genes have not been previously implicated in En function despite many years of genetic analysis of the Bithorax complex. We suggest that the role of Ubx and Abd-A in En function has been overlooked previously because, in the absence of these two genes, Exd is upregulated in the presumptive abdomen and thus takes over as a repression cofactor. However, our present results establish that homeotic genes do participate in the segmentation cascade and link two regulatory networks previously thought to be independent.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Akam, M. E. and Martinez Arias, A. (1985). The
distribution of Ultrabithorax transcripts in Drosophila embryos.
EMBO J. 4,1689
-1700.[Medline]
Alexandre, C., Jacinto, A. and Ingham, P. W.
(1996). Transcriptional activation of hedgehog target genes in
Drosophila is mediated directly by the cubitus interruptus protein, a member
of the GLI family of zinc finger DNA-binding proteins. Genes
Dev. 10,2003
-2013.
Alexandre, C., Lecourtois, M. and Vincent, J. P.
(1999). Wingless and Hedgehog pattern Drosophila denticle belts
by regulating the production of short-range signals.
Development 126,5689
-5698.[Abstract]
Asahara, H., Dutta, S., Kao, H.-Y., Evans, R. M. and Montminy,
M. (1999). Pbx-Hox heterodimers recruit
coactivator-corepressor complexes in an isoform-specific manner.
Mol. Cell. Biol. 19,8219
-8225.
Aspland, S. E. and White, R. A. (1997).
Nucleocytoplasmic localisation of extradenticle protein is spatially regulated
throughout development in Drosophila. Development
124,741
-747.[Abstract]
Aza-Blanc, P., Ramirez-Weber, F. A., Laget, M. P., Schwartz, C.
and Kornberg, T. B. (1997). Proteolysis that is inhibited by
Hedgehog targets Cubitus interruptus protein to the nucleus and converts it to
a repressor. Cell 89,1043
-1053.[CrossRef][Medline]
Badiani, P., Corbella, P., Kioussis, D., Marvel, J. and Weston,
K. (1994). Dominant interfering alleles define a role for
c-Myb in T-cell development. Genes Dev.
8, 770-782.
Baker, N. E. (1987). Molecular cloning of
sequences from wingless a segment polarity gene in Drosophila the spatial
distribution of a transcript in embryos. EMBO J.
6,1765
-1774.[Medline]
Cadigan, K. M., Grossniklaus, U. and Gehring, W. J.
(1994). Localized expression of sloppy paired protein maintains
the polarity of Drosophila parasegments. Genes Dev.
8, 899-913.
Chan, S. K., Jaffe, L., Capovilla, M., Botas, J. and Mann, R.
S. (1994). The DNA binding specificity of Ultrabithorax is
modulated by cooperative interactions with extradenticle, another
homeoprotein. Cell 78,603
-615.[CrossRef][Medline]
Condic, J. M., Mustard, J. A. and Brower, D. L.
(1991). Generation of anti-Antp monoclonal antibodies and Antp
expression in imaginal discs. Drosophila Information
Service 70,52
-54.
Desplan, C., Theis, J. and O'Farrell, P. H.
(1986). The Drosophila developmental gene, engrailed, encodes a
sequence-specific DNA binding activity. Nature
318,630
-635.
Dominguez, M., Brunner, M., Hafen, E. and Basler, K.
(1996). Sending and receiving the hedgehog signal: Control by the
Drosophila Gli protein cubitus interruptus. Science
272,1621
-1625.[Abstract]
Grossniklaus, U., Pearson, R. K. and Gehring, W. J.
(1992). The Drosophila sloppy paired locus encodes two proteins
involved in segmentation that show homology to mammalian transcription
factors. Genes Dev. 6,1030
-1051.
Guillen, I., Mullor, J. L., Capdevila, J., Sanchez-Herrero, E.,
Morata, G. and Guerrero, I. (1995). The function of engrailed
and the specification of Drosophila wing pattern.
Development 121,3447
-3456.[Abstract]
Han, K. and Manley, J. L. (1993). Functional
domains of the Drosophila engrailed protein. EMBO J.
12,2723
-2733.[Medline]
Heemskerk, J., DiNardo, S., Kostriken, R. and O'Farrell, P.
H. (1991). Multiple modes of engrailed regulation in the
progression towards cell fate determination. Nature
352,404
-410.[CrossRef][Medline]
Hochman, B. (1974). Analysis of a whole
chromosome in Drosophila. Cold Spring Harbor Symp. Quant.
Biol. 38,581
-589.
Hooper, J. E. and Scott, M. P. (1989). The
Drosophila patched gene encodes a putative membrane protein required for
segmental patterning. Cell
59,751
-765.[CrossRef][Medline]
Inbal, A., Halachmi, N., Dibner, C., Frank, D. and Salzberg,
A. (2001). Genetic evidence for the
transcriptional-activating function of Homothorax during adult fly
development. Development
128,3405
-3413.
Jacobs, Y., Schnabel, C. A. and Cleary, M. L.
(1999). Trimeric association of Hox and TALE homeodomain proteins
mediates Hoxb2 hindbrain enhancer activity. Mol. Cell.
Biol. 19,5134
-5142.
Jaynes, J. B. and O'Farrell, P. H. (1991).
Active repression of transcription by the engrailed homeodomain protein.
EMBO J. 10,1427
-1433.[Medline]
John, A., Smith, S. T. and Jaynes, J. B.
(1995). Inserting the ftz homeodomain into engrailed creates a
dominant transcriptional repressor that specifically turns off ftz target
genes in vivo. Development
121,1801
-1813.[Abstract]
Karch, F., Bender, W. and Weiffenbach, B.
(1990). abdA expression in Drosophila embryos. Genes
Dev. 4,1573
-1587.
Kissinger, C. R., Liu, B. S., Martin-Blanco, E., Kornberg, T. B.
and Pabo, C. O. (1990). Crystal structure of an engrailed
homeodomain-DNA complex at 2.8 A resolution: a framework for understanding
homeodomain-DNA interactions. Cell
63,579
-590.[CrossRef][Medline]
Kobayashi, M., Fujioka, M., Tolkunova, E. N., Deka, D.,
Abu-Shaar, M., Mann, R. S. and Jaynes, J. B. Engrailed cooperates with
extradenticle and homothorax to repress target genes in
Drosophila. Development
130,741
-751.
Kurant, E., Pai, C. Y., Sharf, R., Halachmi, N., Sun, Y. and
Salzberg, A. (1998). dorsotonals/homothorax, the Drosophila
homologue of meis 1, interacts with extradenticle in patterning of the
embryonic PNS. Development
125,1037
-1048.[Abstract]
Lawrence, P. A., Bodmer, R. and Vincent, J. P.
(1995). Segmental patterning of heart precursors in Drosophila.
Development 121,4303
-4308.[Abstract]
Lecourtois, M., Alexandre, C., Dubois, L. and Vincent, J. P.
(2001). Wingless capture by frizzled and frizzled2 in Drosophila
embryos. Dev. Biol. 235,467
-475.[CrossRef][Medline]
Lee, J. J., Von Kessler, D., Parks, S. and Beachy, P. A.
(1992). Secretion and localized transcription suggest a role in
positional signaling for products of the segmentation gene hedgehog.
Cell 71,33
-50.[CrossRef][Medline]
Lewis, E. B. (1978). A gene complex controlling
segmentation in Drosophila. Nature
276,565
-570.[CrossRef][Medline]
Macias, A., Casanova, J. and Morata, G. (1990).
Expression and regulation of the abd-A gene of Drosophila.
Development 110,1197
-1207.
Mann, R. S. and Abu-Shaar, M. (1996). Nuclear
import of the homeodomain protein Extradenticle in response to Wg and Dpp
signaling. Nature 383,630
-633.[CrossRef][Medline]
Mann, R. S. and Chan, S. K. (1996). Extra
specificity from extradenticle: the partnership between HOX and PBX/EXD
homeodomain proteins. Trends Genet.
12,258
-262.[CrossRef][Medline]
Mann, R. S. and Morata, G. (2000). The
developmental and molecular biology of genes that subdivide the body of
Drosophila. Annu. Rev. Cell Dev. Biol.
16,243
-271.[CrossRef][Medline]
Mannervik, M., Nibu, Y., Zhang, H. and Levine, M.
(1999) Transcriptional coregulators in development.
Science 284,606
-609.
Manoukian, A. S. and Krause, H. M. (1993).
Control of segmental asymmetry in Drosophila embryos.
Development 118,785
-796.[Abstract]
Martinez Arias, A. (1993). Development and
patterning of the larval epidermis of Drosophila. In The
development of Drosophila melanogaster (eds Bate, M. and Martinez
Arias, A.), pp. 517-608. Cold Spring Harbor
Laboratory, NY: Cold Spring Harbor Laboratory Press.
Methot, N. and Basler, K. (1999). Hedgehog
controls limb development by regulating the activities of distinct
transcriptional activator and repressor forms of Cubitus interruptus.
Cell 96,819
-831.[CrossRef][Medline]
Michelson, A. M. (1994). Muscle pattern
diversification in Drosophila is determined by the autonomous function of
homeotic genes in the embryonic mesoderm. Development
120,755
-768.[Abstract]
Nasiadka, A. and Krause, H. M. (1999). Kinetic
analysis of segmentation gene interactions in Drosophila embryos.
Development 126,1515
-1526.[Abstract]
Netter, S., Fauvarque, M. O., Diez del Corral, R., Dura, J. M.
and Coen, D. (1998). white+ transgene insertions presenting a
dorsal/ventral pattern define a single cluster of homeobox genes that is
silenced by the polycomb-group proteins in Drosophila melanogaster.
Genetics 149,257
-275.
Noordermeer, J., Johnston, P., Rijsewijk, F., Nusse, R. and
Lawrence, P. A. (1992). The consequences of ubiquitous
expression of the wingless gene in the Drosophila embryo.
Development 116,711
-719.[Abstract]
Pai, C. Y., Kuo, T. S., Jaw, T. J., Kurant, E., Chen, C. T.,
Bessarab, D. A., Salzberg, A. and Sun, Y. H. (1998). The
homothorax homeoprotein activates the nuclear localization of another
homeoprotein, extradenticle, and suppresses eye development in Drosophila.
Genes Dev. 12,435
-446.
Pai, L. M., Orsulic, S., Bejsovec, A. and Peifer, M.
(1997). Negative regulation of Armadillo, a Wingless effector in
Drosophila. Development
124,2255
-2266.[Abstract]
Peifer, M. and Wieschaus, E. (1990). Mutations
in the Drosophila gene extradenticle affect the way specific homeodomain
proteins regulate segmental identity. Genes Dev.
4,1209
-1223.
Peltenburg, L. T. and Murre, C. (1996).
Engrailed and Hox homeodomain proteins contain a related Pbx interaction motif
that recognizes a common structure present in Pbx. EMBO
J. 15,3385
-3393.[Medline]
Pinsonneault, J., Florence, B., Vaessin, H. and McGinnis, W.
(1997). A model for extradenticle function as a switch that
changes HOX proteins from repressors to activators. EMBO
J. 16,2032
-2042.[CrossRef][Medline]
Poole, S. J., Kauvar, L. M., Drees, B. and Kornberg, T.
(1985). The engrailed locus of Drosophila: structural analysis of
an embryonic transcript. Cell
40, 37-43.[CrossRef][Medline]
Rauskolb, C. and Wieschaus, E. (1994).
Coordinate regulation of downstream genes by extradenticle and the homeotic
selector proteins. EMBO J.
13,3561
-3569.[Medline]
Rieckhof, G. E., Casares, F., Ryoo, H. D., Abu-Shaar, M. and
Mann, R. S. (1997). Nuclear translocation of extradenticle
requires homothorax, which encodes an extradenticle-related homeodomain
protein. Cell 91,171
-183.[CrossRef][Medline]
Ryoo, H. D. and Mann, R. S. (1999). The control
of trunk Hox specificity and activity by Extradenticle. Genes
Dev. 13,1704
-1716.
Ryoo, H. D., Marty, T., Casares, F., Affolter, M. and Mann, R.
S. (1999). Regulation of Hox target genes by a DNA bound
Homothorax/Hox/Extradenticle complex. Development
126,5137
-5148.[Abstract]
Saleh, M., Rambaldi, I., Yang, X.-J. and Featherstone, M. S.
(2000). Cell signaling switches HOX-PBX complexes from repressors
to activators of transcription mediated by histone deacetylases and histone
acetyltransferases. Mol. Cell. Biol.
20,8623
-8633.
Sanson, B., White, P. and Vincent, J. P.
(1996). Uncoupling cadherin-based adhesion from wingless
signaling in Drosophila. Nature
383,627
-630.[CrossRef][Medline]
Schwartz, C., Locke, J., Nishida, C. and Kornberg, T. B.
(1995). Analysis of cubitus interruptus regulation in Drosophila
embryos and imaginal disks. Development
121,1625
-1635.[Abstract]
Serrano, N. and Maschat, F. (1998). Molecular
mechanism of polyhomeotic activation by engrailed. EMBO
J. 17,3704
-3713.[CrossRef][Medline]
Smith, S. T. and Jaynes, J. B. (1996). A
conserved region of engrailed, shared among all en-, gsc-, Nk1-, Nk2-
and msh-class homeoproteins, mediates active transcriptional repression in
vivo. Development 122,3141
-3150.[Abstract]
Tabata, T., Eaton, S. and Kornberg, T. B.
(1992). The Drosophila hedgehog gene is expressed specifically in
posterior compartment cells and is a target of engrailed regulation.
Genes Dev. 6,2635
-2645.
Tabata, T., Schwartz, C., Gustavson, E., Ali, Z. and Kornberg,
T. B. (1995). Creating a Drosophila wing de novo, the role of
engrailed, and the compartment border hypothesis.
Development 121,3359
-3369.[Abstract]
Triezenberg, S. J., Kingsbury, R. C. and McKnight, S. L.
(1988). Functional dissection of VP16, the trans-activator of
herpes simplex virus immediate early gene expression. Genes
Dev. 2,718
-729.
van Dijk, M. A. and Murre, C. (1994).
Extradenticle raises the DNA binding specificity of homeotic selector gene
products. Cell 78,617
-624.[CrossRef][Medline]
White, R. A. H., Aspland, S. E., Brookman, J. J., Clayton, L.
and Sproat, G. (2000). The design and analysis of a homeotic
response element. Mech. Dev.
91,217
-226.[CrossRef][Medline]
White, R. A. H. and Wilcox, M. E. (1984).
Protein products of the Bithorax complex in Drosophila.
Cell 39,163
-171.[CrossRef][Medline]
Yoffe, K. B., Manoukian, A. S., Wilder, E. L., Brand, A. H. and
Perrimon, N. (1995). Evidence for engrailed-independent
wingless autoregulation in Drosophila. Dev. Biol.
170,636
-650.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. Kumar, B. Bello, and H. Reichert Lineage-specific cell death in postembryonic brain development of Drosophila Development, October 15, 2009; 136(20): 3433 - 3442. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gonzalez, C. Chaouiya, and D. Thieffry Logical modelling of the role of the Hh pathway in the patterning of the Drosophila wing disc Bioinformatics, August 15, 2008; 24(16): i234 - i240. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chaves and R. Albert Studying the effect of cell division on expression patterns of the segment polarity genes J R Soc Interface, August 6, 2008; 5(Suppl_1): S71 - S84. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Walsh and S. B. Carroll Collaboration between Smads and a Hox protein in target gene repression Development, October 15, 2007; 134(20): 3585 - 3592. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Huang, M. Rastegar, C. Bodner, S.-L. Goh, I. Rambaldi, and M. Featherstone MEIS C Termini Harbor Transcriptional Activation Domains That Respond to Cell Signaling J. Biol. Chem., March 18, 2005; 280(11): 10119 - 10127. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Solano, B. Mugat, D. Martin, F. Girard, J.-M. Huibant, C. Ferraz, B. Jacq, J. Demaille, and F. Maschat Genome-wide identification of in vivo Drosophila Engrailed-binding DNA fragments and related target genes Development, April 1, 2003; 130(7): 1243 - 1254. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kobayashi, M. Fujioka, E. N. Tolkunova, D. Deka, M. Abu-Shaar, R. S. Mann, and J. B. Jaynes Engrailed cooperates with extradenticle and homothorax to repress target genes in Drosophila Development, February 15, 2003; 130(4): 741 - 751. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||