|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00295
1 Laboratoire de Biologie Cellulaire, INRA, Route de Saint Cyr, 78026 Versailles
Cedex, France
2 Department of Cell and Developmental Biology, John Innes Centre, Colney Lane,
Norwich, NR4 7UH, UK
* Author for correspondence (e-mail: laufs{at}versailles.inra.fr)
Accepted 7 November 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Arabidopsis thaliana, Flower development, Conditional expression, UFO
| INTRODUCTION |
|---|
|
|
|---|
UFO is involved in several aspects of flower development
(Ingram et al., 1995
;
Lee et al., 1997
;
Levin et al., 1998
;
Samach et al., 1999
;
Wilkinson and Haughn, 1995
).
First, UFO interacts with LEAFY (LFY) and
APETALA1 (AP1) (Mandel
et al., 1992
; Weigel et al.,
1992
) to specify the floral identity of the meristem
(Levin and Meyerowitz, 1995
;
Wilkinson and Haughn, 1995
).
Secondly, UFO plays a role in floral organ identity control. Organ
identities at given positions of the floral meristem are specified by a
combinatorial action of three classes of genes
(Bowman et al., 1991
;
Coen and Meyerowitz, 1991
;
Weigel and Meyerowitz, 1994
).
According to this ABC model, sepal identity is conferred by the action of A
class genes, represented by APETALA1 and APETALA2
(AP1 and AP2) (Jofuku et
al., 1994
; Mandel et al.,
1992
). Class A genes in combination with the class B genes
APETALA3 (AP3) and PISTILATA (PI)
(Goto and Meyerowitz, 1994
;
Jack et al., 1992
) confer
petal identity. Stamen identity results from the combined action of class B
and class C genes, such as AGAMOUS (AG)
(Yanofsky et al., 1990
).
Finally class C genes alone confer carpel development. Each class of identity
genes acts in two adjacent whorls of the floral meristem, class A in whorls 1
and 2, class B in whorls 2 and 3 and class C in whorls 3 and 4. Recently, it
has been shown that the function of the ABC genes also require SEPALLATA1,
2 or 3, three functionally redundant genes
(Jack, 2001
;
Pelaz et al., 2000
).
UFO has a major role in promoting B function as evidenced by the lack
of normal petals and stamens in ufo loss-of function mutants and the
supernumerary petals and stamens observed in lines overexpressing UFO
(Lee et al., 1997
;
Levin and Meyerowitz, 1995
;
Wilkinson and Haughn, 1995
).
Furthermore, second and third whorl defects in ufo mutants can be
rescued by ectopically expressing B-class genes
(Krizek and Meyerowitz,
1996
).
In addition to perturbed identities during floral development, defects in
the growth of organ primordia have been reported for the ufo mutants.
Therefore, a further role of UFO in coordination of organ identity
gene expression and the growth patterns has been suggested
(Ingram et al., 1997
;
Levin and Meyerowitz, 1995
;
Samach et al., 1999
;
Wilkinson and Haughn,
1995
).
In agreement with its complex developmental role, the expression pattern of
the UFO in the flower is highly dynamic
(Lee et al., 1997
;
Samach et al., 1999
). Early
on, UFO is expressed in the central dome of the floral meristem,
after which it becomes progressively restricted to the presumptive whorls 2
and 3 and, finally, to the base of the petals. The predicted UFO protein has
given some hints to its potential function. UFO is the orthologue of FIMBRIATA
from Antirrhinum majus and contains an F-box motif conserved in
plant, mammalian and yeast proteins, which interacts physically with
SKP1-related proteins (del Pozo and
Estelle, 2000
; Ingram et al.,
1995
; Ingram et al.,
1997
; Samach et al.,
1999
; Simon et al.,
1994
; Zhao et al.,
1999
; Zhao et al.,
2001
). F-box proteins associate with a large protein complex
called SCF, that has an E3 ubiquitin ligase activity and targets specific
proteins to degradation through the ubiquitin/proteasome pathway. The
specificity of the SCF complex is conferred by the interaction between the
F-box protein and the target protein. Targets for UFO-containing SCF complex
have not been identified to date, but in other systems the known target
proteins fall mainly in two classes: cell cycle regulators and transcription
factors (Patton et al.,
1998
).
We have examined the changing roles of UFO during flower development by expressing UFO ubiquitously in ufo-2 mutant flowers, at different developmental stages and for various durations, using an ethanol inducible expression system. In this way, the previously known functions of UFO could be temporally separated and related to its expression at specific stages of development. Early UFO expression is required during stage 2 for normal patterning of the primordia in the three innermost whorls. Activation of the B genes can be mediated by UFO expression during floral stage 2 or 3 but petals and stamens differ in their period of competence to respond to UFO: stamen primordia have a wider window than petal primordia. We also show that growth of the petals requires a short pulse of UFO during early stages of their development, indicating that UFO has an additional role in petal outgrowth. Finally, our data suggest a role for UFO in the regulation of the size of the third whorl, possibly through interaction with SUPERMAN.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plant growth and ethanol induction
Seeds were pretreated in water at 4°C for 2 days to ensure synchronous
germination and sown on soil in 6 x 6 x 6 cm pots (5 plants per
pot). Plants were grown in growth chambers under long day conditions (8 hours
dark at 17°C, 16 hours light at 20°C for 1 hour, 23°C for 14 hours
and 20°C for 1 hour, at 70% humidity). Alternatively, in order to
synchronise the flowering time, plants were initially grown for 21-25 days
under short-day conditions (16 hours dark at 16°C, 8 hours light at
20°C, 70% humidity) before transfer to long-day conditions. Ethanol
induction was achieved by irrigating each pot daily for 5 days with 3 ml of 1%
(v/v) ethanol and covering the plants with a 10-cm high transparent lid during
the time of induction. Vapour induction was achieved by placing open 500 µl
microtubes filled with 95% (v/v) ethanol into every alternate pot for 8 hours
every day and covering the plants with a lid, then the ethanol tubes were
removed and the lid opened for the remaining 16 hours. Observations were on
the main inflorescence.
Transcription analysis by RT-PCR
Total RNA were extracted from 5 apices of induced or non-induced
35S::UFOind plants using TRIzol reagent (Life
Technologies) according to the supplier's instructions, including a
centrifugation before chloroform extraction to minimise DNA contamination.
After DNase treatment (1 unit DNase Amp Grad; Life Technologies) for 20
minutes at room temperature, 2.5 µg of total RNA was reverse transcribed
for 50 minutes at 37°C in a final volume of 20 µl in the presence of
250 ng oligo(dT) primers, 5 mM MgCl2, 1 mM of dNTPs and 50 Units of
M-MLV (Eurobio, Les Ulis, France) in the reaction buffer provided. Reactions
were stopped by heat inactivation and 80 µl of H2O were added. 5
µl of the reverse transcription reaction were used for PCR amplification.
The primers pUFO2 (CTTCAGGATCATCAGGAGGGTTAG) and pUFONRI
(TCTTGAATTCAAAGCGGCCGCAACAGACTCCAGGAAATGGAAGTGTT) gave an 872 bp PCR product
for the endogenous and transgene cDNA and the contaminating genomic DNA.
Absence of contaminating genomic DNA was confirmed by the absence of PCR
products in a preparation lacking reverse transcriptase. The primers pAPT-1
(TCCCAGAATCGCTAAGATTGCC) and pAPT-2 (CCTTTCCCTTAAGCTCTG) amplified the adenine
phosphorybosiltransferase cDNA (Moffat et
al., 1994
) and were used as a quantitative control. For
quantification, 14 cycles of PCR were conducted (30 seconds at 94°C, 30
seconds at 55°C, 1 minute at 72°C) followed by radioactive
hybridisation and quantification of the radioactive signal using a BAS-1500
Fujifilm phosphoimager.
The distinction between the transcripts generated by the endogenous mutated
ufo-2 gene and the wild-type UFO transgene was based on the
AflIII polymorphism described by Lee et al.
(Lee et al., 1997
). The
AflIII restriction site was absent from the PCR product generated
with the pUFO2 and pUFONRI primers on wild-type template whereas
AflIII digestion of the PCR product obtained from mutated template
gave rise to 550 bp and 322 bp bands.
In situ hybridisation
In situ hybridisation was performed as described previously
(Laufs et al., 1998
).
DIG-labelled UFO probe was generated by in vitro transcription of the
EcoRI linearised plasmid pJAM170
(Ingram et al., 1995
).
Scanning electron microscopy
Apices were analysed by low-temperature scanning electron microscopy as
described previously (Traas et al.,
1995
). Alternatively, flowers were fixed overnight in 3% (v/v)
glutaraldehyde in 25 mM sodium phosphate buffer pH 7.0, dehydrated in a graded
ethanol series at 4°C and critical-point dried in liquid carbon dioxide.
Samples were dissected, mounted, carbon-gold shadowed and observed in a 525M
Philips scanning electron microscope.
| RESULTS |
|---|
|
|
|---|
Ethanol induction was achieved either by irrigating the plants daily with
1% (v/v) ethanol for 5 days or by exposing them to ethanol vapour in confined
conditions for various durations (see Materials and Methods).
35S::uidAind lines showed ethanol-dependent GUS staining
as previously reported (Roslan et al.,
2001
) (data not shown). Induction of
35S::UFOind in the wild-type background led to flowers
with slightly petaloid sepals, an increased number of petals and, to a lesser
extent, stamens (results not shown).
The constructs were introduced into mutants carrying the strong ufo-2 allele to generate ufo-2 35S::UFOind and ufo-2 35S::uidAind lines, homozygous for both the mutation and the transgene. Flowers of ufo-2 mutants showed defects in all four whorls, with the second and third whorls being the most affected (compare Fig. 1A,B, Fig. 2A,B). Whorls 1 and 4 showed variation in the number and size of the organs, with occasionally 3 or 5 sepals of irregular size and 2-4 carpels with occasional fusion defects in the distal part of the pistil. Normal petals and stamens were missing and replaced by sepal-like organs, filaments, carpeloid or staminoid structures. In addition, the number and position of the organs were abnormal, with occasional united growth of organs in or between whorls.
|
|
Ufo-2 35S::UFOind flowers showed restoration of petals and stamens approximately 16-18 days after the beginning of a 5-day-long treatment with 1% (v/v) ethanol irrigation, starting after 3 weeks culture under long days (Fig. 1H). Wild-type flowers with 4 sepals, 4 petals, 4-6 stamens and a pistil with two carpels could be observed in almost all the inflorescences (Fig. 1H, Fig. 2G). Restoration was dependent on the ethanol treatment and was not observed in either non-transformed or GUS-transformed ufo-2 plants (Fig. 1). A gradient of phenotypic restoration was observed above and below fully restored flowers. This suggested that the temporal regulation of UFO expression was critical to its function and that this might be amenable to experimental dissection.
Transient UFO expression can restore normal development of
whorls 2 and 3
We first addressed the question of the minimal duration of UFO
expression required for normal petal and stamen development. For this,
ufo-2 35S::UFOind plants were subjected to ethanol
treatments for various periods. We used vapour induction in preference to
induction by irrigation in order to have better control of the timing of
induction. Table 1 shows the
mean number of flowers with normal petals and stamens per main apex following
ethanol induction. A single 8-hour ethanol pulse was sufficient to restore
normal petal and stamen development in an average of approximately one flower
per inflorescence whereas prolonged induction led to additional restored
flowers.
|
To correlate the duration of induction with the duration of UFO
expression, we performed quantitative RT-PCR on ufo-2
35S::UFOind apices after an 8-hour vapour induction
(Fig. 3A-C). The ufo-2
allele bears a point mutation that creates a new AflIII restriction
site (Lee et al., 1997
),
producing a polymorphism that could be used to determine the ratio of mutant
and wild-type forms of the UFO transcript
(Fig. 3D). Low levels of
UFO mRNAs were detected before induction
(Fig. 3A-C), and both
transcripts contributed to this at comparable levels
(Fig. 3D). It must be noted,
however, that the amount of the transgene transcript should be lower in
individual meristem cells than the amount of the endogenous transcript as only
a few cells express the endogenous gene whereas the transgene, indirectly
driven by 35S promoter, is ubiquitously expressed. As illustrated in
Fig. 1, basal transgene
expression in the absence of inducer was not sufficient to restore the
flowers. High levels of UFO transcript, due to the activation of the
transgene, were observed from 8 to 24 hours
(Fig. 3A-D). The level of the
transgene mRNA dropped to non-induced levels after 48h. The limited number of
restored flowers following a short pulse of induction suggests that the UFO
protein is not stable.
|
We also used RNA in situ hybridisation to determine the spatial expression
pattern of UFO before and after induction in ufo-2
35S::UFOind apices and compared it to expression in wild-type
and non-transformed ufo-2 apices
(Fig. 4). As described
previously (Ingram et al.,
1995
; Lee et al.,
1997
), UFO expression is first visible in the centre of
stage 2 flowers, when the floral meristems are clearly separated from the
apical meristem [stages as defined by Smyth et al.
(Smyth et al., 1990
)] and then
in a cup-shaped domain (Fig.
4F). During stage 3, UFO is expressed in a ring of cells
interior to the emerging sepal primordia and corresponding to the domains of
whorls 2 and 3 (not shown). During stage 4, when the sepal primordia start to
grow over the floral meristem, UFO expression is concentrated in the
presumptive sites of petal primordium initiation
(Fig. 4A-F). Faint UFO
expression can be seen in a small group of cells that correspond to the petal
primordia (arrowheads in Fig.
4D,E). In non-transformed ufo-2 and non-induced ufo-2
35S::UFOind apices, UFO was initially expressed in a
cup-shaped domain at stage 3, as in wild type
(Fig. 4H). Later, UFO
was expressed at the base of primordia located internal to the sepals
(Fig. 4I). By contrast, induced
ufo-2 35S::UFOind plants showed ubiquitous expression 24
hours after the beginning of an 8-hour ethanol pulse
(Fig. 4J,K). In most, but not
all, of the observed apices, the endogenous pattern could no longer be
recognised, suggesting that the local level of transgene expression was
similar to or higher than the expression of the endogenous gene.
|
Thus, following ethanol induction UFO expression is rapidly and uniformly increased in ufo-2 35S::UFOind apices. Furthermore, a single pulse of UFO expression lasting 24 to 48 hours is sufficient to restore normal development in whorls 2 and 3.
Phenotype of second and third whorl organs defines different phases
of restoration
We reasoned that the partially complemented flowers that developed above
and below the restored flowers could reveal different functions of
UFO that could be temporally separated. In flowers forming below the
restored ones, UFO expression was induced at a later stage of
development than in the complemented ones, whereas in those above,
UFO was expressed at an earlier stage. Therefore we defined the
sequence of floral phenotypes arising following a 5-day ethanol treatment of
ufo-2 35S::UFOind inflorescences. Based on the second and
third whorl organs phenotype, 4 types could be defined, arising along the stem
from bottom to top.
In the most basal part of the stem, typical ufo-2 flowers were
formed, with no, or very few, petals and stamens. Restoration of stamen
identity and partial restoration of petal identity, was the first sign of
partial restoration and defined type I flowers
(Table 2,
Fig. 2C-E,J-N). Chimeric
sepal/petal organs were present in type I flowers
(Fig. 2C-E) indicating that
petal identity had not been fully restored. Petal/stamen organs were observed
(Fig. 2C,E) that may have
resulted from abnormal alignment of the organ primordia with the underlying
expression patterns of the organ identity genes. Although the average number
of stamens per flower was close to that observed in the wild type, the number
of stamen or petaloid stamens in individual flowers varied from 3 to 12. When
more than 7-8 stamens were present they occupied 2 whorls
(Fig. 2J,K), reminiscent of the
superman mutant (Bowman et al.,
1992
; Schultz et al.,
1991
). The total number of organs was increased from 14.2 per
ufo-2 flower to 17.8 in type I
(Table 2). Therefore, besides
modifying the identity of pre-existing primordia, UFO expression
induced a change in the pattern of primordia initiation and/or growth.
|
In type II flowers, sepal/petal chimeric organs were no longer
formed. In the inner whorls, only petals, stamens and petal/stamen chimeric
organs developed, as seen in the weak ufo-6 mutant
(Levin and Meyerowitz, 1995
)
(Table 2,
Fig. 2F). This suggests that in
contrast to type I flowers, B activity is fully restored in type II flowers.
The presence of petal/stamen chimeric organs indicates that coordination of
growth patterns with petal/stamen identity boundary is not fully established
in these flowers as in type I flowers. Flowers containing an extra whorl of
stamens could be observed at a lower frequency than in type I flowers.
Whorls 2 and 3 were fully restored in type III flowers
(Table 2, Fig. 2G). Most of type III
flowers had 4 petals but occasionally 5 petals formed, whereas the stamen
number was more variable ranging from 3 to 8. The increase in the number of
petals and stamens has already been reported in 35S::UFO lines and is
related to the overexpression of UFO
(Lee et al., 1997
).
Type IV flowers were characterised by a single whorl of 4-8 stamens or petaloid stamens interior to the sepals (Table 2, Fig. 2H,I,O,P). Petals were absent, with the exception of an occasional petal or staminoid petal in some flowers. No signs of reduced petals were visible at the expected empty position interior to the sepals (Fig. 2I,O,P). Accordingly, the total number of floral organs was reduced to 11.6 in type IV flowers whereas it was 15.9 in type III.
Approximately 75% of the non-ufo-like flowers induced by ethanol fitted clearly into this classification of types I to IV. The 25% remaining flowers were either transitional forms between the different types, or flowers showing weaker restoration, where one or more `unusual organs' such as filaments or unfused carpels remained.
The order of the types was conserved in all the inflorescences observed but the number of flowers in each type varied from plant to plant and sometimes one or more types could be missing. The average number was 1 type I flower, 1-2 type II flowers and 2-3 type III and IV flowers.
Phenotype of whorls 1 and 4 during the different phases of
restoration
Having established a logical and reproducible framework for phenotypic
analysis based on the morphology of whorls 2 and 3, we then analysed the
effect on whorls 1 and 4. There was no significant difference in the first
whorl between the different flower types, except that petaloid sepals could be
observed occasionally in the outer whorl of type IV flowers (results not
shown).
The number of carpels forming the pistil decreased progressively from type I to type IV flowers (Table 2). Similarly, the percentage of flowers with a wild-type two-carpel pistil increased from 24% in type I flowers to 85% in type IV (Table 3). Whereas only a small minority of pistils showed fusion defects in ufo-2 flowers, 69% of type I flowers showed such defects, which often extended along the whole pistil (Fig. 2C,D,M). Fusion defects usually only affected one side of the pistil, but occasionally two defects on opposite sides of the pistil could give rise to two groups of carpels united only at the style (Fig. 2L). Thickening at the margins of the non-united carpel walls could be observed, mainly in the distal half of the pistil. A structure resembling an anther could form in the distal part of the unfused margin whereas elongated cells resembling stamen filament cells formed on the proximal part of the pistil margin (Fig. 2L). This suggested that the margins had partial stamen identity. Fusion defects became less frequent in later arising types and were rare in type IV flowers.
|
Occasionally, abnormal ovules could be observed in type I to III flowers (Table 3, Fig. 2M,N). These ovules had a straight elongated tubular shape as compared to wild-type ovules which have a typical S shape. The number of abnormal ovules was variable, ranging from one to six, and most often was one to two per pistil. Abnormal ovules could be observed in about one third of the type I flowers and became rarer in later types. Most of the abnormal ovules developed in pistils with fusion defects (Table 3). There was no obvious correlation of the position of these ovules with the proximodistal axis of the pistil or the unfused pistil margins.
In conclusion, specific effects on the fourth whorl and ovules are observed during the different phases of phenotypic restoration, suggesting that UFO proper expression is critical for the development of these structures.
Different phases of restoration reflect induction of UFO at
specific stages of floral development
The different phases of restoration could be the consequence of
fluctuations in the levels of UFO expression. Full restoration in
type III flowers could follow high expression of UFO. The early and
late types could result from weaker expression levels during the time course
of induction and arrest of UFO expression. Alternatively, the
different phenotypes could result from induction at different stages of floral
development. In order to distinguish these possibilities, we induced
UFO expression at different developmental stages. According to the
first hypothesis, a similar range of phenotypes would be expected. In the
second case, one would expect a correlation between the stage at the time of
induction and the phenotype of the mature flower.
ufo-2 35S::UFOind were kept in a vegetative state by
growing them under short day conditions and then they were induced to flower
by transferring them to long days (LD). After different durations in LD,
plants were treated with 1% ethanol for 5 days. The stage of the five oldest
floral buds not subtended by a leaf was determined at the moment of induction
using a binocular microscope or scanning electron microscope
(Table 4,
Fig. 5) and related to the
final morphology of the flowers. We excluded floral meristems subtended by a
leaf from our analyses as they appeared sometimes less developed than more
apical meristems. A simplified classification of the floral buds stages was
used: stages 2 and stage 3 were as defined by Smyth et al.
(Smyth et al., 1990
), stage
4-5 corresponds to stages 4 and 5 from Smyth et al., and stages 6+ had the
floral buds enclosed by the sepals (stages 6 or more from Smyth et al.).
|
|
No recognisable floral meristems were visible after 5 LD (Fig. 5A), but extrapolation of the total number of floral buds formed, assuming a constant primordia initiation rate, indicated that the first stage 2 meristem was formed between 5 and 6 LD. After 7 LD, mainly stage 2 flowers were visible. After 8 LD approximately half of the five oldest flowers were at stage 3 and half at stage 2 (Table 4, Fig. 5B). After 9 LD, the majority of the five oldest flowers were at stage 4-5. Most of the flowers had reached stage 6+ after 10 LD and all had after 11 LD or 12 LD. (Table 4, Fig. 5C,D).
ufo-2 35S::UFOind flowers induced during stage 6+ (12 LD) developed with a general ufo-2 phenotype, showing only a slight increase in the number of stamens and more petaloid characteristics in the sepaloid organs (Fig. 6A). Therefore, expression of UFO had little effect at or after stage 6+.
|
Type I flowers were occasionally observed in 11 LD apices and more often in 10 LD and 9 LD apices (Table 5, Fig. 6B). This suggests that stamen identity could be restored in early stage 6+ and stage 4/5 but that at this stage, the identity of the second whorl organs was already fixed and could not be altered by UFO expression. It must be noted that the endogenous UFO gene is not expressed at these stages of development in the stamen whorl and that the prolonged competence of the stamens to respond to UFO is revealed here by the ectopic expression resulting from the use of 35S promoter.
|
A significant number of type II flowers were observed in inflorescences of 9 LD plants (Table 5) and developed from floral buds induced at stage 3. Restoration of the petal and stamen identities in type II flowers suggests that B genes were fully functional and that the identities of the corresponding meristem domains giving rise to them had not been fixed at the time of induction. The presence of chimeric petal/stamen organs suggests, however, that the developing floral organs primordia in these whorls are misaligned with the underlying organ identities genes, especially those of class A and C. Defects in gynoecium development occur most often in type I and II flowers (Table 3). Type I and II flowers result from UFO expression at or after stage 3, when endogenous UFO is not detected in the central domain of the flower giving raise to the fourth whorl. Therefore the gynoecium defects are likely to result from the ectopic expression of UFO in the central domain due to the use of the ubiquitous 35S promoter.
A significant number of type III flowers were observed after induction of 8-LD plants and they resulted from the expression of UFO in stage 2 meristems (Table 5, Fig. 6C). Therefore, expression of UFO as early as stage 2 is required for proper development of whorl 2 and 3 organs.
Type IV flowers were observed in apices induced after 7 or 8 LD (Table 5, Fig. 6C,D). They resulted from the expression of UFO in early stage 2 and stage 1 floral primordia. Such flowers were not observed following UFO expression in a wild-type background. Therefore, they did not simply result from ectopic UFO expression too early, but were the consequence of a short exposure to UFO and a lack of UFO expression during later stages. The absence of visible petals in type IV flowers suggests that a late function of UFO is to promote growth of the petals. Type IV flowers also showed the best restoration of pistil development, demonstrating that UFO expression as early as stage 2 is required for this process.
Induction of UFO at 5 LD had no major effect on floral morphology compared to non induced flowers (Table 5, Fig. 6E).
Sequential functions for UFO
We show that UFO has a number of different and spatially distinct
roles during flower development (Fig.
7). In wild type, the first function of UFO is during
stage 2, when it is expressed in the centre of the flower and is required for
the patterning of the flower. At this stage, UFO regulates the
position of the primordia of whorls 2, 3 and 4. The second function is to
establish the identity of the petal and the stamens and this may occur at the
same stage, but can still be determined during stage 3, when UFO is
expressed in presumptive whorls 2 and 3. A third and previously unsuspected
function occurs after petal identity is specified, where UFO is
required for initial petal outgrowth. Finally, UFO appears to
regulate the size of the third whorl.
|
| DISCUSSION |
|---|
|
|
|---|
UFO promotes B activity but the response windows differs
between petals and stamens
Induction of UFO expression from stage 2 or stage 3 onwards
restores full B activity as shown by restoration of petal and stamen
identities (Fig. 7A3,A4). As
the cells giving rise to petals and stamens express the endogenous
UFO gene during stages 2 and 3, this is consistent with a role for
UFO in defining the identity of the B whorls during this period. UFO
is part of a larger protein complex that promotes B activity, probably by
targeting a negative regulator of B expression for specific protein
degradation (Samach et al.,
1999
; Zhao et al.,
1999
; Zhao et al.,
2001
). Thus, absence of UFO may result in excess negative
regulator and therefore, failure to accumulate B-function.
However, our timed induction experiments indicate that the definition of
petal identity has the more stringent requirements for UFO. If
UFO is supplied late in development, starting at stage 4/5 or at
early stage 6, petal identity is only partially restored, whereas stamen
development is fully restored across a wide time-span
(Fig. 7A2) Therefore, petal
primordia lose their competence to respond to UFO expression before
the stamen primordia. This could result from a failure of
UFO-mediated activation of the B genes in petal primordia.
Alternatively, the B genes could be activated equally in both petal and stamen
primordia, but petal primordia may have a more stringent temporal or
quantitative requirement for B activity. There is some evidence that defining
petal identity does have a higher requirement for B function in that petals of
the temperature sensitive ap3-1 mutant grown at 16°C, where AP3
is partially functional, have sepaloid characteristics whereas stamens develop
normally (Bowman et al., 1989
).
Thus, delayed activation of UFO expression during stage 4 to early 6
may lead to low levels of B activity sufficient for stamen but not for petal
identities.
Early UFO expression during stage 2 is required for proper
primordia patterning in whorls 2, 3 and 4
Although induction of UFO during stages 2 or 3 is equally able to
restore B activity, UFO expression during stage 2 is required for
correct spatial coordination between primordia initiation patterns and the
underlying identity gene expression patterns
(Fig. 7A4). The endogenous
UFO gene is expressed in a continuous domain covering the presumptive
whorls 2, 3 and 4 during stage 2, consistent with such a role.
UFO expression during early stage 2 is also required for normal
patterning of the fourth whorl organs. Pistils of ufo flowers show an
increased number of carpels, which can be best corrected by UFO
induction during stage 2, when endogenous UFO expression includes the
presumptive fourth whorl cells. Lack of whorl 4 defects as a result of
UFO induction persists even up to stage 6, but with a progressively
decreasing efficiency. This long window of competence is in sharp contrast to
the narrow window during stage 2 for proper initiation patterns of petals and
stamens. This could be explained by a UFO requirement before the
formation of the primordia as the petal and stamen primordia are initiated
before the carpel primordia. Alternatively UFO could directly
regulate primordia patterning in whorl 2 and 3 and have an indirect role in
whorl 4 by diminishing the pool of meristematic cells available for primordium
recruitment. In such an hypothesis, the effect of UFO on primordium
patterning in the fourth whorl would be comparable to those of genes such as
CLAVATA that regulate the size of the meristem
(Clark et al., 1993
;
Clark et al., 1995
).
UFO promotes petal outgrowth, a novel role revealed by transient
expression
Transient UFO expression during the very early stages of flower
development leads to an unexpected phenotype, where mature petals are absent
(Fig. 7A5). These flowers are
not simply the consequence of an early ectopic expression as they are not
observed in either constitutive 35S::UFO lines
(Lee et al., 1997
) or after
ethanol induction of UFO in a wild-type background. Absence of second
whorl organs is never observed in ufo mutants, where sepal-like
organs replace the petals (Levin and
Meyerowitz, 1995
; Wilkinson
and Haughn, 1995
). Therefore, this novel floral phenotype results
from the transient expression of UFO during early stages of floral
development demonstrating that prolonged UFO expression is required
for petal growth.
The lack of petals in the mature flower could be due to an absence of the second whorl resulting from defects in the early patterning of the flower into whorls. Although this cannot be ruled out it seems unlikely as patterning into whorls occurs during stage 3, whereas the absence of petals results from deficiency of UFO expression after stage 3. Alternatively, the absence of petals may result from defects in primordia initiation or outgrowth. Occasionally a single wild-type petal is present following transient UFO expression. Smaller or misshapen petals are never produced, suggesting that UFO has a triggering effect on primordia initiation or early outgrowth and that later growth becomes independent of the presence of UFO. During wild-type development, endogenous UFO gene expression occurs in the petal primordia and persists at their abaxial base throughout this period consistent with our conclusion that UFO is directly required for petal growth.
What might be the mechanism by which UFO promotes petal growth?
UFO is required specifically for the growth of petals and not for
other organs arising in the second whorl because ufo mutants develop
normal sepals instead of petals. UFO requirement for petal growth is
by-passed when AP3 and PI, the two B function genes, are
overexpressed in a ufo-2 background
(Krizek and Meyerowitz, 1996
).
This suggests that UFO promotes petal growth through its positive
effect on B activity. Regulation of B expression has been subdivided in two
phases, an early establishment phase when the two B genes, AP3 and
PI, are activated independently and a later maintenance phase where
the two genes maintain themselves (Goto
and Meyerowitz, 1994
; Jack et
al., 1992
; Jack et al.,
1994
). In ufo flowers, normal AP3 and
PI initial expression patterns have been observed during stage 3, but
the expression of AP3 is reduced compared to wild-type as early as
stage 4 (Samach et al., 1999
).
This defect is earlier than the onset of the autoregulatory circuit. Therefore
UFO expression could be required to retain high levels of
AP3 expression during the transition from the early establishment
phase to the maintenance phase. This involvement of UFO may be
particularly critical for promoting petal growth.
UFO has previously been proposed to promote growth based on the
observation that flowers can be replaced by filaments in ufo
(Levin et al., 1998
;
Levin and Meyerowitz, 1995
).
However, a negative effect of UFO on growth was also proposed based
on the increased growth of inflorescence or floral meristems or in second
whorl organs of ufo (Levin and
Meyerowitz, 1995
; Samach et
al., 1999
). Therefore the relationship between UFO and
growth is complex and may be dependent on other developmentally regulated
factors.
UFO function requires proper timing of expression
The above observations indicate that proper timing of expression is
required for UFO to fulfil all of its functions during flower
development. Additional evidence for this comes from the floral phenotypes
arising from late induction. When UFO is activated during stage 4/5
and in a minor way during stage 3, an additional whorl of stamens, carpel
fusion defects and abnormal ovule development are observed in some flowers
(Fig. 7A3,A2).
Additional stamen whorls and staminoid identity of the unfused carpel
margins following activation of UFO during stage 4-6 suggest that the
B function has spread towards the centre of the meristem and/or there has been
an increased proliferation of the third whorl. These defects are reminiscent
of the superman (sup) mutant phenotype
(Bowman et al., 1992
;
Schultz et al., 1991
).
SUP and the B genes seem to antagonistically regulate the size of the
stamen whorl (Sakai et al.,
1995
). Increased stamen whorls observed following late
UFO activation, therefore, could be due to increased B activity
unbalanced by SUP activity. The balance between SUP and B
genes is apparently re-established when UFO is induced before stage 3
because additional whorls of stamens are not observed when we induce during
early stages of development. The B genes have been shown to positively
regulate SUP expression (Sakai et
al., 1995
; Sakai et al.,
2000
), so early UFO expression may allow a proper balance
between SUP and B function, leading to normal flower morphology. However,
later ectopic UFO expression, in the central domains where endogenous
UFO is no longer detected, is still able to restore B function but
the B genes may not be able to restore proper SUP function. This
would lead to a distorted regulation between SUP and the B genes resulting in
an excess of B activity relative to SUP.
Induction of UFO expression at different stages of development allows different functions of UFO to be separated and assigned to specific developmental windows that generally correlate with the endogenous expression pattern. The effects of UFO expression are complex, involving both direct and indirect events. For instance, early UFO expression activates the B function and, indirectly, the regulatory feedback loop involving SUP and B function. Delayed activation of UFO is still able to induce expression of the B function but not the regulatory loop. Therefore controlled UFO expression not only allows the temporal requirements of gene expression to be dissected but can also reveal more indirect effects.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bowman, J. L., Sakai, H., Jack, T., Weigel, D., Mayer, U. and
Meyerowitz, E. M. (1992). SUPERMAN, a regulator of floral
homeotic genes in Arabidopsis. Development
114,599
-615.[Abstract]
Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M.
(1991). Genetic interactions among floral homeotic genes of
Arabidopsis. Development
112, 1-20.[Abstract]
Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M.
(1989). Genes directing flower development in Arabidopsis.
Plant Cell 1,37
-52.
Caddick, M. X., Greenland, A. J., Jepson, I., Krause, K. P., Qu,
N., Riddell, K. V., Salter, M. G., Schuch, W., Sonnewald, U. and Tomsett, A.
B. (1998). An ethanol inducible gene switch for plants used
to manipulate carbon metabolism. Nat. Biotechnol.
16,177
-180.[CrossRef][Medline]
Clark, S. E., Running, M. P. and Meyerowitz, E. M.
(1993). CLAVATA1, a regulator of meristem and flower
development in Arabidopsis. Development
119,397
-418.[Abstract]
Clark, S. E., Running, M. P. and Meyerowitz, E. M.
(1995). CLAVATA3 is a specific regulator of shoot and
floral meristem development affecting the same processes as CLAVATA1.Development 121,2057
-2067.[Abstract]
Clough, S. J. and Bent, A. F. (1998). Floral
dip: a simplified method for Agrobacterium-mediated transformation of
Arabidopsis thaliana. Plant J.
16,735
-743.[CrossRef][Medline]
Coen, E. S. and Meyerowitz, E. M. (1991). The
war of the whorls: genetic interactions controlling flower development.
Nature 353,31
-37.[CrossRef][Medline]
del Pozo, J. C. and Estelle, M. (2000). F-box
proteins and protein degradation: an emerging theme in cellular regulation.
Plant. Mol. Biol. 44,123
-128.[CrossRef][Medline]
Goto, K. and Meyerowitz, E. M. (1994). Function
and regulation of the Arabidopsis floral homeotic gene PISTILLATA.
Genes Dev. 8,1548
-1560.
Ingram, G. C., Doyle, S., Carpenter, R., Schultz, E. A., Simon,
R. and Coen, E. S. (1997). Dual role for fimbriata in
regulating floral homeotic genes and cell division in Antirrhinum.
EMBO J. 16,6521
-6534.[CrossRef][Medline]
Ingram, G. C., Goodrich, J., Wilkinson, M. D., Simon, R.,
Haughn, G. W. and Coen, E. S. (1995). Parallels between
UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in
Arabidopsis and Antirrhinum. Plant Cell
7,1501
-1510.[Abstract]
Jack, T. (2001). Relearning our ABCs: new
twists on an old model. Trends Plant Sci.
6, 310-316.[CrossRef][Medline]
Jack, T., Brockman, L. L. and Meyerowitz, E. M.
(1992). The homeotic gene APETALA3 of Arabidopsis thaliana
encodes a MADS box and is expressed in petals and stamens.
Cell 68,683
-697.[CrossRef][Medline]
Jack, T., Fox, G. L. and Meyerowitz, E. M.
(1994). Arabidopsis homeotic gene APETALA3 ectopic expression:
transcriptional and posttranscriptional regulation determine floral organ
identity. Cell 76,703
-716.[CrossRef][Medline]
Jofuku, K. D., den Boer, B. G., Van Montagu, M. and Okamuro, J.
K. (1994). Control of Arabidopsis flower and seed development
by the homeotic gene APETALA2. Plant Cell
6,1211
-1225.[Abstract]
Krizek, B. A. and Meyerowitz, E. M. (1996). The
Arabidopsis homeotic genes APETALA3 and PISTILLATA are sufficient to provide
the B class organ identity function. Development
122, 11-22.[Abstract]
Laufs, P., Dockx, J., Kronenberger, J. and Traas, J.
(1998). MGOUN1 and MGOUN2: two genes required for primordium
initiation at the shoot apical and floral meristems in Arabidopsis thaliana.
Development 125,1253
-1260.[Abstract]
Lee, I., Wolfe, D. S., Nilsson, O. and Weigel, D.
(1997). A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS.
Curr. Biol. 7,95
-104.[CrossRef][Medline]
Levin, J. Z., Fletcher, J. C., Chen, X. and Meyerowitz, E.
M. (1998). A genetic screen for modifiers of UFO meristem
activity identifies three novel FUSED FLORAL ORGANS genes required for early
flower development in Arabidopsis. Genetics
149,579
-595.
Levin, J. Z. and Meyerowitz, E. M. (1995). UFO:
an Arabidopsis gene involved in both floral meristem and floral organ
development. Plant Cell
7, 529-548.[Abstract]
Lohmann, J. U. and Weigel, D. (2002). Building
beauty: the genetic control of floral patterning. Dev.
Cell 2,135
-142.[CrossRef][Medline]
Mandel, M. A., Gustafson-Brown, C., Savidge, B. and Yanofsky, M.
F. (1992). Molecular characterization of the Arabidopsis
floral homeotic gene APETALA1. Nature
360,273
-277.[CrossRef][Medline]
Moffat, B. A., McWhinnie, E. A., Agarwal, S. K. and Schaff, D.
A. (1994). The adenine phosphoribosyltransferase-encoding
gene of Arabidopsis thaliana. Gene
143,211
-216.[CrossRef][Medline]
Patton, E. E., Willems, A. R. and Tyers, M.
(1998). Combinatorial control in ubiquitin-dependent proteolysis:
don't Skp the F-box hypothesis. Trends Genet.
14,236
-243.[CrossRef][Medline]
Pelaz, S., Ditta, G. S., Baumann, E., Wisman, E. and Yanofsky,
M. F. (2000). B and C floral organ identity functions require
SEPALLATA MADS-box genes. Nature
405,200
-203.[CrossRef][Medline]
Roslan, H. A., Salter, M. G., Wood, C. D., White, M. R. H.,
Croft, K. P., Robson, F., Coupland, G., Doonan, J. H., Laufs, P., Tomsett, A.
B. et al. (2001). Characterisation of the ethanol inducible
alc gene expression system in Arabidopsis thaliana. Plant
J. 28,225
-235.[CrossRef][Medline]
Sakai, H., Krizek, B. A., Jacobsen, S. E. and Meyerowitz, E.
M. (2000). Regulation of SUP expression identifies multiple
regulators involved in Arabidopsis floral meristem development.
Plant Cell 12,1607
-1618.
Sakai, H., Medrano, L. J. and Meyerowitz, E. M.
(1995). Role of SUPERMAN in maintaining Arabidopsis floral whorl
boundaries. Nature 378,199
-203.[CrossRef][Medline]
Salter, M. G., Paine, J. A., Riddell, K. V., Jepson, I.,
Greenland, A. J., Caddick, M. X. and Tomsett, A. B. (1998).
Characterisation of the ethanol inducible alc gene expression system
for transgenic plants. Plant J.
16,127
-132.[CrossRef]
Samach, A., Klenz, J. E., Kohalmi, S. E., Risseeuw, E., Haughn,
G. W. and Crosby, W. L. (1999). The UNUSUAL FLORAL ORGANS
gene of Arabidopsis thaliana is an F-box protein required for normal
patterning and growth in the floral meristem. Plant J.
20,433
-445.[CrossRef][Medline]
Schultz, E. A., Pickett, F. B. and Haughn, G. W.
(1991). The FLO10 gene product regulates the expression
domain of the homeotic genes AP3 and PI in Arabidopsis flowers.
Plant Cell 3,1221
-1237.
Simon, R., Carpenter, R., Doyle, S. and Coen, E.
(1994). Fimbriata controls flower development by mediating
between meristem and organ identity genes. Cell
78, 99-107.[CrossRef][Medline]
Smyth, D. R., Bowman, J. L. and Meyerowitz, E. M.
(1990). Early flower development in Arabidopsis. Plant
Cell 2,755
-767.
Sweetman, J. P., Chu, C., Qu, N., Greenland, A. J., Sonnewald,
U. and Jepson, I. (2002). Ethanol Vapor Is an Efficient
Inducer of the alc Gene Expression System in Model and Crop Plant Species.
Plant Physiol. 129,943
-948.
Traas, J. A., Laufs, P., Jullien, M. and Caboche, M.
(1995). A mutation affecting etiolation and cell elongation in
Nicotiana plumbaginifolia causes abnormal division plane alignment
and pattern formation in the root meristem. Plant J.
7, 785-796.[CrossRef]
Weigel, D. and Meyerowitz, E. M. (1994). The
ABCs of floral homeotic genes. Cell
78,203
-209.[CrossRef][Medline]
Weigel, D., Alvarez, J., Smyth, D. R., Yanofsky, M. F. and
Meyerowitz, E. M. (1992). LEAFY controls floral meristem
identity in Arabidopsis. Cell
69,843
-859.[CrossRef][Medline]
Wilkinson, M. D. and Haughn, G. W. (1995).
UNUSUAL FLORAL ORGANS control meristem identity and organ primordia fate in
Arabidopsis. Plant Cell
7,1485
-1499.[Abstract]
Yanofsky, M. F., Ma, H., Bowman, J. L., Drews, G. N., Feldmann,
K. A. and Meyerowitz, E. M. (1990). The protein encoded by
the Arabidopsis homeotic gene agamous resembles transcription factors.
Nature 346,35
-39.[CrossRef][Medline]
Zachgo, S., Silva, E. de A., Motte, P., Trobner, W., Saedler, H.
and Schwarz-Sommer, Z. (1995). Functional analysis of the
Antirrhinum floral homeotic DEFICIENS gene in vivo and in vitro by using a
temperature-sensitive mutant. Development
121,2861
-2875.[Abstract]
Zhao, D., Yu, Q., Chen, M. and Ma, H. (2001).
The ASK1 gene regulates B function gene expression in cooperation with UFO and
LEAFY in Arabidopsis. Development
128,2735
-2746.
Zhao, D., Yang, M., Solava, J. and Ma, H.
(1999). The ASK1 gene regulates development and interacts with
the UFO gene to control floral organ identity in Arabidopsis. Dev.
Genet. 25,209
-223.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
T. C. Xiong, C. M. Hann, J. P. Chambers, M. Surget, and C. K.-Y. Ng An inducible, modular system for spatio-temporal control of gene expression in stomatal guard cells J. Exp. Bot., October 1, 2009; 60(14): 4129 - 4136. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. H. Gonzalez-Carranza, U. Rompa, J. L. Peters, A. M. Bhatt, C. Wagstaff, A. D. Stead, and J. A. Roberts HAWAIIAN SKIRT: An F-Box Gene That Regulates Organ Fusion and Growth in Arabidopsis Plant Physiology, July 1, 2007; 144(3): 1370 - 1382. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jain, A. Nijhawan, R. Arora, P. Agarwal, S. Ray, P. Sharma, S. Kapoor, A. K. Tyagi, and J. P. Khurana F-Box Proteins in Rice. Genome-Wide Analysis, Classification, Temporal and Spatial Gene Expression during Panicle and Seed Development, and Regulation by Light and Abiotic Stress Plant Physiology, April 1, 2007; 143(4): 1467 - 1483. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Peaucelle, H. Morin, J. Traas, and P. Laufs Plants expressing a miR164-resistant CUC2 gene reveal the importance of post-meristematic maintenance of phyllotaxy in Arabidopsis Development, March 15, 2007; 134(6): 1045 - 1050. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Brand, M. Horler, E. Nuesch, S. Vassalli, P. Barrell, W. Yang, R. A. Jefferson, U. Grossniklaus, and M. D. Curtis A Versatile and Reliable Two-Component System for Tissue-Specific Gene Induction in Arabidopsis Plant Physiology, August 1, 2006; 141(4): 1194 - 1204. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nakayama, J. M. Arroyo, J. Simorowski, B. May, R. Martienssen, and V. F. Irish Gene Trap Lines Define Domains of Gene Regulation in Arabidopsis Petals and Stamens PLANT CELL, September 1, 2005; 17(9): 2486 - 2506. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Roberts, G. A. Garoosi, O. Koroleva, M. Ito, P. Laufs, D. J. Leader, M. X. Caddick, J. H. Doonan, and A. B. Tomsett The alc-GR System. A Modified alc Gene Switch Designed for Use in Plant Tissue Culture Plant Physiology, July 1, 2005; 138(3): 1259 - 1267. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Xing, M. G. Rosso, and S. Zachgo ROXY1, a member of the plant glutaredoxin family, is required for petal development in Arabidopsis thaliana Development, April 1, 2005; 132(7): 1555 - 1565. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Moon, G. Parry, and M. Estelle The Ubiquitin-Proteasome Pathway and Plant Development PLANT CELL, December 1, 2004; 16(12): 3181 - 3195. [Full Text] [PDF] |
||||
![]() |
P. Laufs, A. Peaucelle, H. Morin, and J. Traas MicroRNA regulation of the CUC genes is required for boundary size control in Arabidopsis meristems Development, September 1, 2004; 131(17): 4311 - 4322. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B. Brewer, P. A. Howles, K. Dorian, M. E. Griffith, T. Ishida, R. N. Kaplan-Levy, A. Kilinc, and D. R. Smyth PETAL LOSS, a trihelix transcription factor gene, regulates perianth architecture in the Arabidopsis flower Development, August 15, 2004; 131(16): 4035 - 4045. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jack Molecular and Genetic Mechanisms of Floral Control PLANT CELL, June 1, 2004; 16(suppl_1): S1 - S17. [Full Text] [PDF] |
||||
![]() |
W. Ni, D. Xie, L. Hobbie, B. Feng, D. Zhao, J. Akkara, and H. Ma Regulation of Flower Development in Arabidopsis by SCF Complexes Plant Physiology, April 1, 2004; 134(4): 1574 - 1585. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Durfee, J. L. Roe, R. A. Sessions, C. Inouye, K. Serikawa, K. A. Feldmann, D. Weigel, and P. C. Zambryski The F-box-containing protein UFO and AGAMOUS participate in antagonistic pathways governing early petal development in Arabidopsis PNAS, July 8, 2003; 100(14): 8571 - 8576. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||